ORIGINAL RESEARCH ARTICLE

Linkage of the dopamine receptor D1 geneto attention-deficit/hyperactivity disorderVL Misener1, P Luca1, O Azeke1, J Crosbie2, I Waldman3, R Tannock2,4, W Roberts5, M Malone5,

R Schachar2,4, A Ickowicz2, JL Kennedy6 and CL Barr1,2,4

1Cell and Molecular Biology Division, Toronto Western Research Institute, University Health Network, Toronto, Ontario,Canada; 2Department of Psychiatry, The Hospital for Sick Children, Toronto, Ontario, Canada; 3Department of Psychology,Emory University, Atlanta, GA, USA; 4Brain and Behaviour Program, The Hospital for Sick Children, Toronto, Ontario, Canada;5Division of Neurology, The Hospital for Sick Children, Toronto, Ontario, Canada; 6Neurogenetics Section, Department ofPsychiatry, Centre for Addiction and Mental Health, University of Toronto, Toronto, Ontario, Canada

Attention-deficit/hyperactivity disorder (ADHD) has a strong genetic basis, and evidence fromhuman and animal studies suggests the dopamine receptor D1 gene, DRD1, to be a goodcandidate for involvement. Here, we tested for linkage of DRD1 to ADHD by examining theinheritance of four biallelic DRD1 polymorphisms [D1P.5 (–1251HaeIII), D1P.6 (�800HaeIII),D1.1 (�48DdeI) and D1.7 (þ 1403Bsp1286I)] in a sample of 156 ADHD families. Owing to linkagedisequilibrium between alleles at the four markers, only three haplotypes are common in oursample. Using the transmission/disequilibrium test (TDT), we observed a strong bias fortransmission of Haplotype 3 (1.1.1.2) from heterozygous parents to their affected children(P¼0.008). Furthermore, using quantitative trait TDT analyses, we found significant andpositive relationships between Haplotype 3 transmission and the inattentive symptoms, butnot the hyperactive/impulsive symptoms, of ADHD. These findings support the proposedinvolvement of DRD1 in ADHD, and implicate Haplotype 3, in particular, as containing apotential risk factor for the inattentive symptom dimension of the disorder. Since none of thefour marker alleles comprising Haplotype 3 is predicted to alter DRD1 function, we hypothesizethat a functional DRD1 variant, conferring susceptibility to ADHD, is on this haplotype. Tosearch for such a variant we screened the DRD1 coding region, by sequencing, focusing on thechildren who showed preferential transmission of Haplotype 3. DNA from 41 children wasanalysed, and no sequence variations were identified, indicating that the putative DRD1 riskvariant for ADHD resides outside of the coding region of the gene.Molecular Psychiatry (2004) 9, 500–509. doi:10.1038/sj.mp.4001440Published online 21 October 2003

Keywords: attention-deficit/hyperactivity disorder; dopamine receptor D1; genetics; linkage;transmission/disequilibrium test

Introduction

Attention-deficit/hyperactivity disorder (ADHD) is achildhood-onset disorder characterized by age-inap-propriate and impairing levels of inattention (egdistractibility), hyperactivity (eg motor restlessness)and impulsivity. Family, twin and adoption studieshave provided evidence for a genetic basis forADHD,1–3 and several twin studies have estimatedthe heritability of ADHD to be as high as 80–90%.4–8

Although the aetiology of this disorder is currentlyunknown, genes of the dopamine neurotransmittersystem are considered likely to be involved, sincepharmacologic agents effective in the treatment ofADHD (ie methylphenidate and D-amphetamine)

primarily influence the dopamine system.9,10 Supportfor genetic changes in dopamine neurotransmissionin ADHD is found in positive and replicated linkageand/or association findings for the dopamine receptorD4, dopamine receptor D5 and dopamine transportergenes.3,11,12 However, the relative risk associated withthese genes appears to be quite low, and thus,additional genes are expected to be involved.

Dopamine receptor D1 (designated D1A in rodents) isthe founding member of the D1 subfamily of dopaminereceptors—receptors that mediate adenylyl cyclaseactivation and phosphoinositide hydrolysis via cou-pling to heterotrimeric G proteins, Gs and Gq,respectively.13,14 D1 receptors are prevalent in brainregions such as the prefrontal cortex (PFC) andstriatum, and can also be found elsewhere in the body,such as in the kidney.15,16 On the basis of collectiveevidence from both animal and human studies(described below), the dopamine receptor D1 gene,DRD1, is a strong candidate for involvement in ADHD.

Received 30 July 2003; revised 08 September 2003; accepted 17September 2003

Correspondence: Dr CL Barr, Toronto Western Hospital, MainPavilion, Rm. 14-302, 399 Bathurst St., Toronto, Ontario, CanadaM5T 2S8. E-mail: cbarr@uhnres.utoronto.ca

Molecular Psychiatry (2004) 9, 500–509& 2004 Nature Publishing Group All rights reserved 1359-4184/04 $25.00

www.nature.com/mp

Dysfunction of the PFC is considered, by many, tobe a fundamental problem in ADHD. This view stemsfrom the observation that individuals with PFClesions exhibit ADHD-like behaviour,17,18 and issupported by numerous neuropsychological andimaging studies showing evidence of compromisedPFC function in individuals with ADHD.18–20 The PFCguides behaviour, in part, through working memory, acognitive process that is modulated by D1 receptors inthis brain region.21,22 Interestingly, there have beenseveral reports of working memory impairment inindividuals with ADHD,19,23 and correlations betweenworking memory capacity and attentional ability havebeen observed in individuals from the generalpopulation.24,25 Together, these studies suggest arelationship between the DRD1 gene and the atten-tional problems of children with ADHD.

Another line of evidence implicating DRD1 in theaetiology of ADHD is the hyperactive phenotype ofD1A-knockout mice. First, mice lacking the D1A

receptor exhibit locomotor hyperactivity.26–28 How-ever, not all studies have found this to be the case,29–31

and thus it is thought that this hyperactive phenotypemight be influenced by additional factors, such asvariations in mouse genetic background and/ordifferences in methodologies used to assess locomo-tion. D1A-knockout mice are also hyperactive in theirgrooming behaviour,26 and this grooming behaviour ishighly disorganized, in that these mice are unable toproperly coordinate the entire sequence of move-ments that make up full grooming syntax.32 Finally,although there have been several reports of reducedrearing activity in D1A-knockout mice,26,29,30 a detailedanalysis of this behaviour has shown that only rearingfree in a standing position, but not rearing against awall or in a sitting position, is reduced in the mutantanimals.26 In fact, whereas during the initial observa-tion period, rearing against a wall was found to besimilar between wild type and D1A-knockout mice,this rearing activity later subsided completely in thewild types, but persisted in the knockouts, furthercharacterizing these mice as hyperactive.26 Thus, thereductions in rearing behaviour that have beenreported for D1A-knockout mice are probably not dueto reduced motor activity per se, but might instead bereflective of poor motor coordination (resulting in areduced ability to carry out a difficult movement suchas rearing free). That these mice also perform verypoorly on the rotarod task,29 a direct test of motorcoordination, supports this view. Although murinecorrelates of ADHD behavioural symptoms are notwell-defined, the combination of hyperactivity andimpaired motor coordination that is evident in D1A-knockout mice is intriguing, as several studies havereported deficits in motor coordination to be pre-valent in children with ADHD.33,34

Finally, evidence from two rat models of ADHDimplicates DRD1 in the aetiology of this disorder. Thefirst is the Spontaneously Hypertensive rat (SHR). Inaddition to being studied as an animal model ofhypertension, the SHR is considered to be a useful

model of ADHD, prior to hypertension onset.35

Although the mechanistic basis for the ADHD-likebehaviour of the SHR remains to be elucidated,aberrant brain dopaminergic function has beenstrongly implicated.36,37 It is notable, therefore, thatthe development of hypertension in the SHR is due, atleast in part, to a genetic defect in renal D1A

signaling.38,39 This suggests the interesting possibilitythat such a defect in D1A signal transduction mightalso exist in the brain, thereby contributing to theADHD-like behaviour of the SHR. Consistent withsuch a scenario, breeding studies have providedevidence that a component of the behavioural profileof the SHR cosegegrates with the D1A signallingdefect.40 A second rat strain considered to be a usefulbehavioural model of ADHD is the Naples HighExcitability (NHE) rat.41 In a recent study it wasshown that D1A expression in the PFC is abnormallylow in the NHE rat.41

On the basis of evidence described above, wehypothesize that the DRD1 gene is involved in geneticsusceptibility to ADHD. To test this hypothesis, wehave examined the inheritance patterns of four DRD1polymorphisms in a sample of 156 nuclear ADHDfamilies, using both categorical and quantitative traitapplications of the transmission/disequilibrium test(TDT).

Materials and methods

SubjectsSubject assessment and diagnostic criteria for inclu-sion in this study have been described previously.42

Briefly, all of the children were between 7 and 16years of age and met the DSM-IV (Diagnostic andStatistical Manual of Mental Disorders, 4th Edition)43

criteria for ADHD. Children who scored below 80 onboth the Performance and Verbal Scales of the WISC-III (Weschsler Intelligence Scale for Children, 3rdEdition)44 were excluded from the study, as werechildren who exhibited neurological or chronicmedical illness, Tourette syndrome, chronic multipletics, bipolar affective disorder, psychotic symptoms orother anxiety, depressive or developmental disorderthat might better account for their behaviour. Chil-dren with a family history of bipolar disorder orschizophrenia were also excluded from the analysis.Diagnoses of ADHD and comorbid conditions werebased on information obtained from semistructuredinterviews of parents (Parent Interview for ChildSymptoms)45 and teachers (Teacher Telephone Inter-view for Children’s Academic Performance, Atten-tion, Behaviour and Learning: DSM-IV Version),46 andfrom the following standardized questionnaires andassessments: Conners Parent and Teacher RatingScales—Revised,47 Ontario Child Health SurveyScales—Revised,48 Wide Range Achievement Test—Revision 3,49 Clinical Evaluation of Language Funda-mentals—3rd Edition,50 Children’s Depression Inven-tory51 and Children’s Manifest Anxiety Scale.52

Children were free of medication for at least 24 h

Dopamine receptor D1 and ADHDVL Misener et al

501

Molecular Psychiatry

prior to assessment. Among the children included inthis study, 82% were boys and 18% girls, and thedistribution of ADHD subtypes is as follows: 25%Predominantly Inattentive Type, 18% PredominantlyHyperactive/Impulsive Type, 57% Combined Type.The assignment of subtypes, as recognized by theDSM-IV43, was based on scores for the inattentive andhyperactive/impulsive symptom dimensions ofADHD, as reported in the interviews with parentsand teachers (see above). This study protocol wasapproved by the Hospital for Sick Children ResearchEthics Board, with written informed consent obtainedfor all participants.

Isolation of DNA and genotyping of markersDNA was extracted from peripheral blood using ahigh-salt extraction method.53 Genotypes for each offour DRD1 markers were determined by PCR ampli-fication of 60–100 ng DNA, followed by restrictionenzyme digestion of the PCR products. Four primerpairs, designated 50-D1P.4/30-D1P.4, 50-D1P.10/30-D1P.10, 50-D1/30-D1.D and 50-D1.7/30-D1.9, were usedfor amplification of the D1P.5, D1P.6, D1.1 and D1.7markers, respectively.54,55 Primer sequences are givenin Table 1. PCR reactions (20ml volume) supplemen-ted with 1.5 mM MgCl2 (for D1P.6, D1.1 and D1.7) orwith 1.5 mM MgSO4 plus 4 ml Betaine (Sigma-AldrichCanada Inc., Oakville, Ontario, Canada) (for D1P.5)were carried out as follows: (1) initial denaturation(4 min at 941C), (2) 35 cycles of: denaturation (40 s at941C), annealing (40 s at 571C) and extension (30 s at721C), and (3) final extension (10 min at 721C). Forgenotyping, 7.5 ml of the D1P.5 amplification productwas digested with 5 U HaeIII, 7.5 ml of the D1P.6product was digested with 10 U HaeIII, 8 ml of theD1.1 product was digested with 5 U DdeI, and 5 ml ofthe D1.7 product was digested with 7.5 U Bsp1286I(restriction enzymes from New England Biolabs,Beverly, MA, USA). For the D1P.5, D1P.6 and D1.7markers, restriction fragments were resolved onagarose gels consisting of 1.8% agarose plus 1.8%NuSieve 3:1 agarose (Mandel Scientific Company,Inc., Guelph, Ontario, Canada), and visualized byethidium bromide staining. For the D1.1 marker,fragments were resolved on 10% polyacrylamide gelsand visualized by silver staining.

Statistical analysisThe degree of linkage disequilibrium (pairwise asso-ciation) between marker alleles in this study wasevaluated according to Lewontin,56,57 expressing thecoefficient of linkage disequilibrium as D 0. Parentalallele frequencies and 2-marker haplotype frequen-cies, used in the calculation of D 0, were determinedusing the Estimate Haplotypes (EH) program.58 TDTanalyses, considering ADHD diagnosis as a categori-cal trait, were carried out using the extended TDT(ETDT) program59 to examine the transmission ofindividual marker alleles, and the TRANSMIT pro-gram60 to examine the transmission of haplotypes.For biallelic markers (as in this study), the ETDT Table

1D

RD

1p

oly

morp

his

ms

an

dall

ele

frequ

en

cie

s

Poly

morp

his

mR

ef.

Pri

mer

nam

eP

rim

er

sequ

en

ce

Nu

cle

oti

de

posi

tion

a

DN

Avari

an

tA

llele

Rest

ricti

on

en

zym

eF

ragm

en

tsi

zes

(bp

)A

llele

frequ

en

cy

D1P.

555

50 -

D1P.

4G

AG

AC

TG

GC

GA

GG

TA

AC

CA

G�

1251

G1

HaeII

I58þ

191

0.8

630 -

D1P.

4T

CA

GG

AG

CC

TG

TG

GC

AA

TC

258þ

166þ

19

0.1

4

D1P.

655

50 -

D1P.

10

CT

CT

CG

AA

AG

GA

AG

CC

AA

GA

�800

T1

HaeII

I112þ

169

0.3

230 -

D1P.

10

CG

GC

TC

CG

AA

AC

GT

TG

AG

C2

112þ

143þ

26

0.6

8

D1.1

54

50 -

D1

AC

TG

AC

CC

CT

AT

TC

CC

TG

CT

�48

G1

Dd

eI

146þ

61

0.3

230 -

D1.D

AG

CA

CA

GA

CC

AG

CG

TG

TT

CA

2146þ

42þ

19

0.6

8

D1.7

54

50 -

D1.7

TG

GA

GA

AG

CT

GT

CC

CC

AG

1403

T1

Bsp

1286I

189

0.6

730 -

D1.9

GT

AC

CT

TA

GT

TT

CT

TA

AT

AG

CG

AC

2167þ

22

0.3

3

aN

um

bere

din

rela

tion

toth

efi

rst

nu

cle

oti

de

(þ

1)

of

the

tran

slati

on

al

start

cod

on

(see

Fig

ure

1).

Dopamine receptor D1 and ADHDVL Misener et al

502

Molecular Psychiatry

program excludes families for which only oneparental genotype is available, given the potentialfor erroneously biased results if such families areincluded.61 In the analysis of haplotypes, however,the TRANSMIT program makes maximal use of thesample via a likelihood approach that estimatesmissing information. This allows families with miss-ing parents, as well as families for which haplotypephase is uncertain, to be included in the analysiswithout bias.60,62 Quantitative trait TDT analyses,examining transmission of Haplotype 3 in relationto DSM-IV symptom scores, were carried out usingthe FBAT program (v1.4.1)63,64 and a logistic regres-sion-based extension of the TDT65, both of which arerobust to potentially biasing effects of non-normalityin the phenotype distribution. The test statisticcalculated in FBAT is essentially the covariancebetween haplotype transmission and the offspringphenotype (symptom score). The FBAT programallows for the inclusion of some single-parentfamilies for which genotypes of more than oneoffspring are available. The logistic regression-basedTDT method uses standard logistic regression analy-sis to model the probability of transmission of aparticular allele from heterozygous parents to theiroffspring as a function of the offspring phenotypescore. As with ETDT (see above), families with amissing parent were excluded from the logisticregression-based analysis. As this method does notsupport the analysis of haplotypes, Allele 1 of theD1P.6 marker was used as a proxy for Haplotype 3.This was an arbitrary choice among three alleles(D1P.6 Allele 1, D1.1 Allele 1 and D1.7 Allele 2) thatare found almost exclusively within Haplotype 3 inour sample (see Table 4). As described elsewhere,65

transmissions from heterozygous parents were as-signed a binary variable of either ‘1’ (for transmissionof D1P.6 Allele 1) or ‘0’ (for nontransmission of theallele) and logistic regression analysis, using SPSSsoftware (SPSS Inc., Chicago, IL, USA), was carriedout to test the relationship between this variable andthe offspring phenotype scores. For both the FBATand logistic regression analyses, the quantitativephenotypes of inattentive and hyperactive/impulsive

symptom counts (of a possible nine for each dimen-sion, as specified by the DSM-IV43) were tallied forparents and teachers separately. In our study sample,parent-reported symptom scores ranged from 0 to 9(mean¼6.6672.04) for inattentive behaviour andfrom 0 to 9 (mean¼6.5072.26) for hyperactive/impulsive behaviour, and the corresponding teacher-reported scores ranged from 0 to 9 (mean¼6.3572.08)and from 0 to 9 (mean¼5.4172.64), respectively. AllP-values in this study are reported without correctionfor multiple testing.

DNA Sequence AnalysisSequence analysis of the DRD1 gene was carried outby direct sequencing of four PCR products, designatedD1Seq1, D1Seq2, D1Seq3 and D1Seq4. Each wasamplified from 60–100 ng of genomic DNA (purifiedas above), using primer pairs listed in Table 2. PCRreactions (20 ml volume) supplemented with 1.5 mM

MgCl2 (for D1Seq3 and D1Seq4) or with 1.5 mM

MgSO4 plus 4 ml Betaine (Sigma-Aldrich CanadaInc., Oakville, Ontario, Canada) (for D1Seq1 andD1Seq2) were carried out as follows: (1) initialdenaturation (4 min at 941C); (2) 35 cycles of:denaturation (40 s at 941C), annealing (40 s at theappropriate temperature listed in Table 2) and exten-sion (30 s at 721C); and (3) final extension (10 min at721C). PCR products (5 ml) were treated with Exonu-clease I and Shrimp Alkaline Phosphatase (PCRProduct Pre-sequencing Kit; USB Corporation, Cleve-land, OH, USA) according to the manufacturer’sinstructions, and sequenced directly using either ofthe two primers that was used for PCR amplification.Fluorescent automated DNA sequencing was carriedout using the ABI PRISM BigDye Terminator v3.0Cycle Sequencing System (Applied Biosystems, Fos-ter City, CA, USA) and Sequencher analysis software(Gene Codes Corporation, Ann Arbor, MI, USA).

Results

In this study, 156 nuclear families ascertainedthrough an ADHD proband were analysed. Thesample consists of 123 families in which both parents

Table 2 Primers and annealing conditions used to generate PCR products for sequencing

Product name Length (bp) Primer name Primer sequence Annealing temperature (1C)

D1Seq1 701 D1Seq1F CCAGTGCTTTATTTGGGGAA 56D1Seq1R GGTCATCTTTCTCTCATACCGG

D1Seq2 450 D1Seq2F CTGTAACATCTGGGTGGCCT 65D1Seq2R GTGGTGGTCTGGCAATTCTT

D1Seq3 439 D1Seq3F CTGTGGCCATCATGATTGTC 58D1Seq3R GGGCAAAGTCTGTAGCATCC

D1Seq4 492 D1Seq4F CAGCCCTTCTGCATTGATTC 52D1Seq4R CCCAGAGCAATCTCCTCTAGC

Dopamine receptor D1 and ADHDVL Misener et al

503

Molecular Psychiatry

were genotyped and 33 families in which a singleparent was genotyped. Genotypes of affected siblingsof probands, that is, siblings who met the diagnosticcriteria for ADHD, were also included in the analysis.In our sample of 156 families, 36 affected siblingswere identified, giving a total of 192 affected childrenin the study.

The four polymorphic DRD1 markers analysed,D1P.5, D1P.6, D1.1 and D1.7, are described in Table 1.Also shown are the allele frequencies for thesemarkers, as determined from the 558 parental chro-mosomes in our study. All of the values obtained aresimilar to those which have been reported previouslyby others.54,55 To evaluate the degree of association (ielinkage disequilibrium) between marker alleles, weemployed the widely used method of Lewontin.56,57

Marker positions and the coefficient of linkagedisequilibrium (D 0) for each marker pair are shownin Figure 1. Consistent with the strong degree oflinkage disequilibrium observed in each case, amongthe 16 haplotypes that are theoretically possible forthese markers, only three (ie 1.2.2.1, 2.2.2.1 and1.1.1.2) are common in our sample. Haplotypedesignations and the parental haplotype frequenciesare shown in Table 4.

To test for linkage of the DRD1 gene to ADHD weused the TDT, a family-based association method thatis also a test of linkage in the presence of linkagedisequilibrium. The TDT has been shown to be a validtest of linkage when the data are derived from familieswith one affected offspring, families with two or moreaffected offspring, or a mixture of the two types.66–69

Indeed, the inclusion of a substantial number offamilies with affected siblings (eg 23% in our study)may enhance the power of the TDT since, ifphenocopies exist, an allele that predisposes to thedisorder is more likely to be present in familial thanin sporadic cases.59 The TDT tests for biased trans-mission of marker alleles from heterozygous parentsto their affected children. As shown in Table 3, wefound trends for biased allele transmission for each ofthe individual markers analysed (ie biased towardstransmission of D1P.5 Allele 1, P¼0.180; D1P.6 Allele1, P¼0.086; D1.1 Allele 1, P¼0.084; D1.7 Allele 2,P¼0.089). The similarities in these trends is notsurprising given the strong linkage disequilibriumobserved for each marker pair. As shown in Table 4,

we obtained significant evidence for linkage when thetransmission of DRD1 haplotypes was analysed. First,a global test of association on three degrees of freedom(d.f.) (haplotypes with frequencies of o10% werepooled) yielded w2¼8.934 (P¼0.030). In addition,considering the three common haplotypes (Haplo-types 1, 2 and 3) individually, strong evidence forbiased transmission of Haplotype 3 was observed(w2¼6.954, 1 d.f., P¼0.008), together with marginallysignificant evidence for nontransmission of Haplo-type 2 (w2¼4.025, 1 d.f., P¼0.045). These findingssupport the proposed involvement of the DRD1 genein ADHD, and implicate Haplotype 3, in particular, ascontaining a potential risk factor for the disorder.

The DSM-IV diagnosis of ADHD43 is based onsymptom counts for the inattentive and hyperactive/impulsive dimensions of the disorder, but there is

Figure 1 Diagram of the DRD1 gene, showing the positionsof the four polymorphic markers analysed (adapted fromWong et al70). Linkage disequilibrium values (D 0) obtainedfor each marker pair are indicated above the map. Blackboxes represent two exons of the gene.85 Hatched ovalsrepresent two promoters (P1 and P2) from which the gene isexpressed.86 The hatched box represents an oestrogenresponse element (ERE) that upregulates expression fromP1.72 The four PCR products used for sequencing of thecoding region are shown below the map. All nucleotidepositions are numbered relative the first nucleotide (þ 1) ofthe translational start codon (map not drawn to scale).

Table 3 ETDT analysis of the DRD1 markers

D1P.5 D1P.6 D1.1 D1.7

Allele 1 2 1 2 1 2 1 2

Transmissions 46 34 78 58 77 57 59 79Nontransmissions 34 46 58 78 57 77 79 59w2 1.800 2.941 2.985 2.899P-valuea 0.180 0.086 0.084 0.089

a1 d.f.

Dopamine receptor D1 and ADHDVL Misener et al

504

Molecular Psychiatry

considerable heterogeneity, with respect to bothsymptom type and number, among children diag-nosed with ADHD. How this heterogeneity is relatedto genetic factors is not clear at present; however, twinstudies indicate that both shared and unique geneticinfluences are likely to underlie the two behaviouraldimensions.8 On the basis of evidence reviewed in theIntroduction, we hypothesized that DRD1 would be arisk factor for both inattentive and hyperactivebehaviour. Thus, we predicted that within our sampleof children diagnosed with ADHD, the bias fortransmission of Haplotype 3 would be related to highsymptom scores for both the inattentive and hyper-active/impulsive dimensions of the disorder. To testthis, we performed quantitative trait TDT analysis toexamine Haplotype 3 transmission in relation toDSM-IV inattentive and hyperactive/impulsive symp-tom counts ascertained through interviews with bothparents and teachers. The results are shown in Tables5 and 6. Using the FBAT program63,64 we foundsignificant and positive relationships between trans-

mission of Haplotype 3 and inattentive symptomscores reported by both parents (P¼0.024) andteachers (P¼0.030). These relationships were con-firmed using a logistic regression-based method65

(P¼0.008 and 0.045, respectively), with odds ratiosshowing that for every increment of 1 in the parent- orteacher-reported symptom score, the odds of Haplo-type 3 transmission increased B1.2-fold. In contrastto these results, no significant relationships betweenhyperactive/impulsive symptom scores and Haplo-type 3 transmission were evident using either methodof analysis. Thus, our quantitative trait TDT analysesshowed significant evidence for linkage of Haplotype3 to the inattentive symptoms, but not the hyperac-tive/impulsive symptoms, of ADHD.

Among the four marker alleles that make upHaplotype 3, none is predicted to alter DRD1 func-tion.70 As illustrated in Figure 1, the D1.7 marker islocated in the 30-untranslated region54 and D1P.6 andD1.1 are located in the 50-untranslated region.54,55 TheD1P.5 marker is located B0.2 kb upstream of one of

Table 4 DRD1 haplotype frequencies and TRANSMIT analysisa

Haplotype Marker alleles Haplotype frequency Transmission

D1P.5 D1P.6 D1.1 D1.7 Obs.b Exp.c w2 P-valued

1 1 2 2 1 0.526 183.09 190.92 1.507 0.2202 2 2 2 1 0.140 46.91 56.48 4.025 0.0453 1 1 1 2 0.322 141.95 125.31 6.954 0.0084 2 1 1 2 0.0045 1 2 2 2 0.008

aGlobal w2¼8.934; 3 d.f.; P¼0.03 (pooling rare haplotypes 4 and 5).bTest statistic.cExpected value of the test statistic under the null hypothesis of no linkage.d1 d.f.

Table 5 FBAT analysis of Haplotype 3 transmission in relation to DSM-IV Symptom Scores for Inattentive (IN) andHyperactive/Impulsive (HI) behaviour

Phenotype Sa Eb Z P-valuec

Symptom scored,e

Parent-reported IN 487.8 415.8 1.973 0.024Teacher-reported IN 431.7 365.2 1.877 0.030

Parent-reported HI 461.0 412.9 1.316 0.094Teacher-reported HI 377.7 346.8 0.958 0.169

aTest statistic.bExpected value of S under the null hypothesis of no linkage.cOne-tailed.dSymptom scores were ascertained through the Parent Interview for Child Symptoms and the Teacher Telephone Interviewfor Children’s Academic Performance, Attention, Behaviour and Learning (see Materials and methods).eBecause the FBAT program treats values of 0 as missing data, a value of 1 was added to each score, so that all scores wouldbe included in the analysis.

Dopamine receptor D1 and ADHDVL Misener et al

505

Molecular Psychiatry

two promoters for this gene,55 but outside of regionsidentified as being important in the regulation ofDRD1 transcription.71,72 Thus, we hypothesize thatthere is some functional DRD1 variant, on Haplotype3, that confers susceptibility to ADHD. To identifysuch a variant, we have undertaken a screen of theDRD1 gene in our ADHD sample, beginning with thecoding region. This 1341 bp region, which is con-tained within a single exon, was sequenced from fouroverlapping PCR products amplified from genomicDNA, as shown in Figure 1. DNA from 41 childrenwho showed preferential transmission of Haplotype 3(12 homozygotes and 29 heterozygotes) was analysed.No DNA variants in the DRD1 coding region wereidentified, indicating that the putative DRD1 riskvariant for ADHD resides outside of the coding regionof the gene.

Discussion

In this study, we tested the DRD1 gene as a candidatefor involvement in genetic susceptibility to ADHD,using a sample of 156 nuclear families ascertainedthrough an ADHD proband. The families weregenotyped for four polymorphic markers of theDRD1 gene, and TDT analyses were performed to testfor linkage of DRD1 to the diagnosis of ADHD, and tothe inattentive and hyperactive/impulsive symptomdimensions of the disorder. Significant evidence forlinkage of DRD1 to ADHD was obtained using bothapproaches. In the TDT analysis in which ADHDdiagnosis was considered as a categorical trait, strongevidence for biased transmission of Haplotype 3 fromheterozyous parents to their ADHD-affected offspringwas observed (P¼0.008). Although marginally signif-icant evidence for nontransmission of Haplotype 2(P¼0.045) was also observed, this result should beregarded cautiously as it is based on a considerablysmaller number of informative transmissions. In thequantitative trait TDT analyses, in which Haplotype 3transmission was analysed in relation to offspringsymptom scores, we found significant evidence for

linkage of Haplotype 3 to the inattentive symptoms,but not the hyperactive/impulsive symptoms, ofADHD. Previously, twin studies have shown thatinattentive behaviour and hyperactive/impulsive be-haviour are both highly heritable,6,8,73–75 and that bothshared and unique genetic influences are likely tounderlie these two behavioural dimensions.8

Although we cannot rule out the possibility of someinvolvement of the DRD1 gene in the hyperactive/impulsive symptoms of ADHD, our data clearlyimplicate DRD1 Haplotype 3 as being involved ingenetic risk for the inattentive dimension of thedisorder.

The DRD1 gene was also analysed recently byothers, as part of a survey of several dopamine systemgenes, in an ADHD sample of Irish origin.76 Incontrast to our findings, that study did not findevidence for linkage of DRD1 to the diagnosis ofADHD. Several factors might account for the differentresults obtained in the Irish study as compared toours. For example, different ethnic compositions ofthe two study samples might be a factor. In contrast tothe Irish study (in which families were 98% ethni-cally Irish),76 most of the families in our study are ofmixed European Caucasian descent. Only 40 familiesreported having an Irish ancestor, and among those,only one reported all four grandparents of theproband as being Irish. In addition to potential effectsrelated to ethnic differences, the power to detectlinkage in the Irish study may have been limited bythe smaller sample size than that of our study (118 vs196 ADHD-affected children, respectively), and/or bythe analysis of only a single DRD1 marker, rather thanof haplotypes. Finally, given the apparent involve-ment of DRD1 in genetic risk for the inattentivesymptom dimension, in particular, it is possible thatthe difference in results obtained in the two studies isrelated to under-representation of the PrimarilyInattentive ADHD subtype in the Irish sample (8%)77

relative to ours (25%). It is worth noting here thatwhile some studies have found a higher proportion ofgirls contributing to the Primarily Inattentive subtype

Table 6 Logistic regression analysis of D1P.6 Allele 1 transmissiona in relation to DSM-IV Symptom Scores for Inattentive (IN)and Hyperactive/Impulsive (HI) behaviour

Phenotype Regression coefficient P-valueb Odds ratioc (95% CI)

Symptom scored

Parent-reported IN 0.207 0.008 1.230 (1.034–1.462)Teacher-reported IN 0.161 0.045 1.175 (0.973–1.418)

Parent-reported HI 0.049 0.266 1.050 (0.902–1.222)Teacher-reported HI �0.049 0.259 0.952 (0.821–1.104)

aD1P.6 Allele 1 was used as a proxy for Haplotype 3 in this analysis (see Materials and methods).bOne-tailed.cFold change in the odds of Allele 1 being transmitted, per increment of 1 in the symptom score.dSymptom scores were ascertained as in Table 5.

Dopamine receptor D1 and ADHDVL Misener et al

506

Molecular Psychiatry

than to the Primarily Hyperactive/Impulsive orCombined subtype,78,79 this difference between thetwo samples is not reflective of differing genderratios, as similar proportions of boys and girls arefound in our sample (82% boys, 18% girls) and theIrish sample (86% boys, 14% girls).77 Replication ofour DRD1 linkage findings in other samples of ADHDfamilies will be important in the future.

On the basis of our current findings, we predict thata functional DRD1 variant conferring susceptibility toADHD is on Haplotype 3, the risk haplotype identi-fied in our study. To search for such a variant, weconducted a DNA sequencing screen of the DRD1gene in our sample, focusing on the children whoshowed preferential transmission of Haplotype 3. NoDNA sequence variations were identified in oursearch of the coding region, a result which isconsistent with previous SSCP-based analyses thatfound no evidence of DRD1 coding region changes inindividuals with ADHD.80,81 To date, there have beenno reports of similar screening applied to otherregions of the gene. We are currently expanding oursearch to cover the entire DRD1 gene, including allelements of known regulatory function (see Figure 1).

In conclusion, the present study supports thehypothesized involvement of the DRD1 gene insusceptibility to ADHD, and suggests a relationshipbetween Haplotype 3 and the inattentive symptomdimension, in particular. Given the possible relation-ship between attentional problems and workingmemory deficits in ADHD, and the known importanceof D1 receptors in working memory function, aninteresting line of enquiry in the future would be toinvestigate whether Haplotype 3 is also a risk factorfor poor working memory ability in ADHD. Regardlessof the biological mechanism(s) by which DRD1 mightbe involved in the disorder, it is notable that a recentADHD genome scan suggested linkage to a region onchromosome 10 that harbours the gene for calcyon,82 atransmembrane protein that binds to the D1 receptorand regulates D1-mediated signaling.83,84 Thus, wespeculate that functional variation in the calcyon andDRD1 genes might constitute distinct, but related,genetic mechanisms leading to perturbations in D1signalling that contribute to ADHD.

Acknowledgements

This work was supported by grants from The Hospitalfor Sick Children Research Training Committee(VLM), The Hospital for Sick Children PsychiatricEndowment Fund (CLB), and the Canadian Institutesof Health Research MT14336 and MOP14334 (CLB).

References

1 Thapar A, Holmes J, Poulton K, Harrington R. Genetic basis ofattention deficit and hyperactivity. Br J Psychiatry 1999; 174:105–111.

2 Faraone SV, Biederman J. Neurobiology of attention-deficithyperactivity disorder. Biol Psychiatry 1998; 44: 951–958.

3 Barr CL, Swanson JM, Kennedy JL. Molecular geneticsof ADHD. In: Levy F, Hay D (eds) Attention, Genes andADHD. Taylor and Francis Inc.: Philadelphia, PA, 2001,pp 173–195.

4 Gillis JJ, Gilger JW, Pennington BF, DeFries JC. Attention deficitdisorder in reading-disabled twins: evidence for a genetic etiology.J Abnormal Child Psychol 1992; 20: 303–315.

5 Thapar A, Hervas A, McGuffin P. Childhood hyperactivity scoresare highly heritable and show sibling competition effects: twinstudy evidence. Behav Genet 1995; 25: 537–544.

6 Gjone H, Stevenson J, Sundet JM. Genetic influence on parent-reported attention-related problems in a Norwegian generalpopulation twin sample. J Am Acad Child Adolesc Psychiatry1996; 35: 588–596.

7 Levy F, Hay DA, McStephen M, Wood C, Waldman I. Attention-deficit hyperactivity disorder: a category or a continuum? Geneticanalysis of a large-scale twin study. J Am Acad Child AdolescPsychiatry 1997; 36: 737–744.

8 Sherman DK, Iacono WG, McGue MK. Attention-deficit hyper-activity disorder dimensions: a twin study of inattention andimpulsivity–hyperactivity. J Am Acad Child Adolesc Psychiatry1997; 36: 745–753.

9 Seeman P, Madras BK. Anti-hyperactivity medication:methylphenidate and amphetamine. Mol Psychiatry 1998; 3:386–396.

10 Levy F. The dopamine theory of attention deficit hyperactivitydisorder (ADHD). Aust NZ J Psychiatry 1991; 25: 277–283.

11 Faraone SV, Doyle AE, Mick E, Biederman J. Meta-analysis of theassociation between the 7-repeat allele of the dopamine D(4)receptor gene and attention deficit hyperactivity disorder. Am JPsychiatry 2001; 158: 1052–1057.

12 Maher BS, Marazita ML, Ferrell RE, Vanyukov MM. Dopaminesystem genes and attention deficit hyperactivity disorder: a meta-analysis. Psychiatr Genet 2002; 12: 207–215.

13 Wang HY, Undie AS, Friedman E. Evidence for the coupling of Gqprotein to D1-like dopamine sites in rat striatum: possible role indopamine-mediated inositol phosphate formation. Mol Pharmacol1995; 48: 988–994.

14 Jin LQ, Wang HY, Friedman E. Stimulated D(1) dopaminereceptors couple to multiple Galpha proteins in different brainregions. J Neurochem 2001; 78: 981–990.

15 Jackson DM, Westlind-Danielsson A. Dopamine receptors: mole-cular biology, biochemistry and behavioural aspects. PharmacolTher 1994; 64: 291–370.

16 Missale C, Nash SR, Robinson SW, Jaber M, Caron MG. Dopaminereceptors: from structure to function. Physiol Rev 1998; 78:189–225.

17 Arnsten AF, Steere JC, Hunt RD. The contribution of alpha 2-noradrenergic mechanisms of prefrontal cortical cognitive func-tion. Potential significance for attention-deficit hyperactivitydisorder. Arch Gen Psychiatry 1996; 53: 448–455.

18 Arnsten AFT. Dopaminergic and noradrenergic influences oncognitive functions mediated by prefrontal cortex. In: Solanto MV,Arnsten AFT, Castellanos FX (eds). Stimulant Drugs and ADHD.Basic and Clinical Neuroscience. Oxford University Press, Inc.:New York, NY, 2001, pp 185–208.

19 Denney CB, Rapport MD. Cognitive pharmacology of stimulants inchildren with ADHD. In: Solanto MV, Arnsten AFT, CastellanosFX (eds) Stimulant Drugs and ADHD. Basic and ClinicalNeuroscience. Oxford University Press, Inc.: New York, NY,2001, pp 283–302.

20 Castellanos FX. Neuroimaging studies of ADHD. In: Solanto MV,Arnsten AFT, Castellanos FX (eds). Stimulant Drugs and ADHD.Basic and Clinical Neuroscience. Oxford University Press, Inc.:New York, NY, 2001, pp 243–258.

21 Sawaguchi T, Goldman-Rakic PS. D1 dopamine receptors inprefrontal cortex: involvement in working memory. Science1991; 251: 947–950.

22 Williams GV, Goldman-Rakic PS. Modulation of memory fields bydopamine D1 receptors in prefrontal cortex. Nature 1995; 376:572–575.

23 Castellanos FX, Tannock R. Neuroscience of attention-deficit/hyperactivity disorder: the search for endophenotypes. Nat RevNeurosci 2002; 3: 617–628.

Dopamine receptor D1 and ADHDVL Misener et al

507

Molecular Psychiatry

24 de Fockert JW, Rees G, Frith CD, Lavie N. The role of workingmemory in visual selective attention. Science 2001; 291:1803–1806.

25 Conway AR, Cowan N, Bunting MF. The cocktail party phenom-enon revisited: the importance of working memory capacity.Psychon Bull Rev 2001; 8: 331–335.

26 Clifford JJ, Tighe O, Croke DT, Sibley DR, Drago J, Waddington JL.Topographical evaluation of the phenotype of spontaneousbehaviour in mice with targeted gene deletion of the D1Adopamine receptor: paradoxical elevation of grooming syntax.Neuropharmacology 1998; 37: 1595–1602.

27 Xu M, Hu XT, Cooper DC, Moratalla R, Graybiel AM, White FJ etal. Elimination of cocaine-induced hyperactivity and dopamine-mediated neurophysiological effects in dopamine D1 receptormutant mice. Cell 1994; 79: 945–955.

28 Xu M, Moratalla R, Gold LH, Hiroi N, Koob GF, Graybiel AM et al.Dopamine D1 receptor mutant mice are deficient in striatalexpression of dynorphin and in dopamine-mediated behavioralresponses. Cell 1994; 79: 729–742.

29 Karasinska JM, George SR, El-Ghundi M, Fletcher PJ, O’Dowd BF.Modification of dopamine D(1) receptor knockout phenotype inmice lacking both dopamine D(1) and D(3) receptors. Eur JPharmacol 2000; 399: 171–181.

30 Drago J, Gerfen CR, Lachowicz JE, Steiner H, Hollon TR, Love PE etal. Altered striatal function in a mutant mouse lacking D1Adopamine receptors. Proc Natl Acad Sci USA 1994; 91:12564–12568.

31 Smith DR, Striplin CD, Geller AM, Mailman RB, Drago J, LawlerCP et al. Behavioural assessment of mice lacking D1A dopaminereceptors. Neuroscience 1998; 86: 135–146.

32 Cromwell HC, Berridge KC, Drago J, Levine MS. Action sequen-cing is impaired in D1A-deficient mutant mice. Eur J Neurosci1998; 10: 2426–2432.

33 Kadesjo B, Gillberg C. Attention deficits and clumsiness inSwedish 7-year-old children. Dev Med Child Neurol 1998; 40:796–804.

34 Barkley RA. Behavioral inhibition, sustained attention, andexecutive functions: constructing a unifying theory of ADHD.Psychol Bull 1997; 121: 65–94.

35 Sagvolden T. Behavioral validation of the spontaneously hyper-tensive rat (SHR) as an animal model of attention-deficit/hyperactivity disorder (AD/HD). Neurosci Biobehav Rev 2000;24: 31–39.

36 Russell VA. Hypodopaminergic and hypernoradrenergic activityin prefrontal cortex slices of an animal model for attention-deficithyperactivity disorder—the spontaneously hypertensive rat. Be-hav Brain Res 2002; 130: 191–196.

37 Sadile AG. Multiple evidence of a segmental defect in the anteriorforebrain of an animal model of hyperactivity and attentiondeficit. Neurosci Biobehav Rev 2000; 24: 161–169.

38 Amenta F, Ricci A, Rossodivita I, Avola R, Tayebati SK. Thedopaminergic system in hypertension. Clin Exp Hypertens 2001;23: 15–24.

39 Hussain T, Kansra V, Lokhandwala MF. Renal dopamine receptorsignaling mechanisms in spontaneously hypertensive and Fischer344 day old rats. Clin Exp Hypertens 1999; 21: 25–36.

40 Sagvolden T, Hendley ED, Knardahl S. Behavior of hypertensiveand hyperactive rat strains: hyperactivity is not unitarily deter-mined. Physiol Behav 1992; 52: 49–57.

41 Viggiano D, Vallone D, Welzl H, Sadile AG. The Naples High- andLow-Excitability rats: selective breeding, behavioral profile,morphometry, and molecular biology of the mesocortical dopa-mine system. Behav Genet 2002; 32: 315–333.

42 Barr CL, Wigg K, Malone M, Schachar R, Tannock R, Roberts W etal. Linkage study of catechol-O-methyltransferase and attention-deficit hyperactivity disorder. Am J Med Genet 1999; 88: 710–713.

43 American Psychiatric Association. Diagnostic and StatisticalManual of Mental Disorders–Fourth Edition. American PsychiatricAssociation: Washington, DC, 1994.

44 Wechsler DI. Examiner’s Manual: Wechsler Intelligence Scale forChildren—Third Edition. Psychological Corporation: New York,NY, 1991.

45 Ickowicz A, Schachar R, Sugarman R, Chen S, Millette C, Cook L etal. Reliability and validity of the Parent Interview for Child

Symptoms (PICS), Paper Presented at 49th Annual Meeting of theAmerican Academy of Child and Adolescent Psychiatry,2002##San Francisco, CA.

46 Tannock R, Hum M, Masellis M, Humphries T, Schachar R.Teacher Telephone Interview for Children’s Academic Perfor-mance, Attention, Behaviour and Learning: DSM-IV Version(TTI-IV). The Hospital for Sick Children: Toronto, Canada,Unpublished document, 2002.

47 Conners CK. Conners’ Rating Scales—Revised. Multi-HealthSystems: Toronto, Canada, 1997.

48 Boyle MH, Offord DR, Racine Y, Fleming JE, Szatmari P, SanfordM. Evaluation of the revised Ontario Child Health Study scales. JChild Psychol Psychiatry 1993; 34: 189–213.

49 Wilkinson GS. Wide Range Achievement Test 3—Revision 3. JastakAssociates: Wilmington, DE, 1993.

50 Semel E, Wing E, Secord W. Clinical Evaluation of LanguageFundamentals—Third Edition (CELF-3). The Psychological Cor-poration: San Antonio, TX, 1995.

51 Kovacs M. Manual: The Children’s Depression Inventory. Multi-Health Systems: Toronto, Canada, 1995.

52 Reynolds CR, Richmond BO. What I Think and Feel (RCMAS).Western Psychological Services: Los Angeles, CA, 1985.

53 Miller SA, Dykes DD, Polesky HF. A simple salting out procedurefor extracting DNA from human nucleated cells. Nucleic Acids Res1988; 16: 1215.

54 Cichon S, Nothen MM, Erdmann J, Propping P. Detection of fourpolymorphic sites in the human dopamine D1 receptor gene(DRD1). Hum Mol Genet 1994; 3: 209.

55 Cichon S, Nothen MM, Stober G, Schroers R, Albus M, Maier Wet al. Systematic screening for mutations in the 50-regulatoryregion of the human dopamine D1 receptor (DRD1) gene inpatients with schizophrenia and bipolar affective disorder. Am JMed Genet 1996; 67: 424–428.

56 Devlin B, Risch N. A comparison of linkage disequilibriummeasures for fine-scale mapping. Genomics 1995; 29:311–322.

57 Lewontin RC. The interaction of selection and linkage. I.General considerations; heterotic models. Genetics 1964; 49:49–67.

58 Ott J. Analysis of Human Genetic Linkage. The Johns HopkinsUniversity Press: Baltimore, MD, 1991.

59 Sham PC, Curtis D. An extended transmission/disequilibrium test(TDT) for multi-allele marker loci. Ann Hum Genet 1995; 59:323–336.

60 Clayton D. A generalization of the transmission/disequilibriumtest for uncertain-haplotype transmission. Am J Hum Genet 1999;65: 1170–1177.

61 Curtis D, Sham PC. A note on the application of the transmissiondisequilibrium test when a parent is missing. Am J Hum Genet1995; 56: 811–812.

62 Cervino AC, Hill AV. Comparison of tests for association andlinkage in incomplete families. Am J Hum Genet 2000; 67:120–132.

63 Laird NM, Horvath S, Xu X. Implementing a unified approach tofamily-based tests of association. Genet Epidemiol 2000; 19:S36–S42.

64 The FBAT Program v1.4.1##http://www.biostat.harvard.edu/Bfbat/default.html.

65 Waldman ID, Robinson BF, Rowe DC. A logistic regression basedextension of the TDT for continuous and categorical traits. AnnHum Genet 1999; 63: 329–340.

66 Spielman RS, Ewens WJ. The TDT and other family-based tests forlinkage disequilibrium and association. Am J Hum Genet 1996; 59:983–989.

67 Spielman RS, McGinnis RE, Ewens WJ. Transmission test forlinkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet 1993; 52:506–516.

68 Ewens WJ, Spielman RS. The transmission/disequilibrium test:history, subdivision, and admixture. Am J Hum Genet 1995; 57:455–464.

69 Ewens WJ, Spielman RS. The transmission/disequilibrium test. In:Balding DJ (ed). Handbook of Statistical Genetics. John Wiley &Sons, Ltd.: New York, 2001, pp 507–518.

Dopamine receptor D1 and ADHDVL Misener et al

508

Molecular Psychiatry

70 Wong AH, Buckle CE, Van Tol HH. Polymorphisms in dopaminereceptors: what do they tell us? Eur J Pharmacol 2000; 410:183–203.

71 Minowa MT, Minowa T, Mouradian MM. Activator region analysisof the human D1A dopamine receptor gene. J Biol Chem 1993; 268:23544–23551.

72 Lee SH, Mouradian MM. Up-regulation of D1A dopamine receptorgene transcription by estrogen. Mol Cell Endocrinol 1999; 156:151–157.

73 Neuman RJ, Todd RD, Heath AC, Reich W, Hudziak JJ, Bucholz KKet al. Evaluation of ADHD typology in three contrasting samples: alatent class approach. J Am Acad Child Adolesc Psychiatry 1999;38: 25–33.

74 Stevenson J. Evidence for a genetic etiology in hyperactivity inchildren. Behav Genet 1992; 22: 337–344.

75 Goodman R, Stevenson J. A twin study of hyperactivity—II. Theaetiological role of genes, family relationships and perinataladversity. J Child Psychol Psychiatry 1989; 30: 691–709.

76 Kirley A, Hawi Z, Daly G, McCarron M, Mullins C, Millar N et al.Dopaminergic system genes in ADHD: toward a biologicalhypothesis. Neuropsychopharmacology 2002; 27: 607–619.

77 Daly G, Hawi Z, Fitzgerald M, Gill M. Mapping susceptibility lociin attention deficit hyperactivity disorder: preferential transmis-sion of parental alleles at DAT1, DBH and DRD5 to affectedchildren. Mol Psychiatry 1999; 4: 192–196.

78 Lahey BB, Applegate B, McBurnett K, Biederman J, Greenhill L,Hynd GW et al. DSM-IV field trials for attention deficithyperactivity disorder in children and adolescents. Am J Psychia-try 1994; 151: 1673–1685.

79 Wolraich ML, Hannah JN, Pinnock TY, Baumgaertel A, Brown J.Comparison of diagnostic criteria for attention-deficit hyperactiv-ity disorder in a county-wide sample. J Am Acad Child AdolescPsychiatry 1996; 35: 319–324.

80 Feng J, Sobell JL, Heston LL, Cook Jr EH, Goldman D, Sommer SS.Scanning of the dopamine D1 and D5 receptor genes by REF inneuropsychiatric patients reveals a novel missense change at ahighly conserved amino acid. Am J Med Genet 1998; 81: 172–178.

81 Thompson M, Comings DE, Feder L, George SR, O’Dowd BF.Mutation screening of the dopamine D1 receptor gene in Tourette’ssyndrome and alcohol dependent patients. Am J Med Genet 1998;81: 241–244.

82 Fisher SE, Francks C, McCracken JT, McGough JJ, Marlow AJ,MacPhie IL et al. A genomewide scan for loci involved inattention-deficit/hyperactivity disorder. Am J Hum Genet 2002;70: 1183–1196.

83 Lidow MS, Roberts A, Zhang L, Koh PO, Lezcano N, Bergson C.Receptor crosstalk protein, calcyon, regulates affinity state ofdopamine D1 receptors. Eur J Pharmacol 2001; 427: 187–193.

84 Lezcano N, Mrzljak L, Eubanks S, Levenson R, Goldman-Rakic P,Bergson C. Dual signaling regulated by calcyon, a D1 dopaminereceptor interacting protein. Science 2000; 287: 1660–1664.

85 Minowa MT, Minowa T, Monsma Jr FJ, Sibley DR, Mouradian MM.Characterization of the 50 flanking region of the human D1Adopamine receptor gene. Proc Natl Acad Sci USA 1992; 89:3045–3049.

86 Lee SH, Minowa MT, Mouradian MM. Two distinct promotersdrive transcription of the human D1A dopamine receptor gene.J Biol Chem 1996; 271: 25292–25299.

Dopamine receptor D1 and ADHDVL Misener et al

509

Molecular Psychiatry