Julius Kuehn Institute, Institute for Plant Protection in Fruit Crops and Viticulture, Schwabenheimer Str. 101, D-69221 Dossenheim, GermanyResearch Institute of Horticulture, Kostytucji 3 Maja 1/3, 96-100 Skierniewice, PolandAll-Russian Center for Plant Quarantine, Pogranichnaya Str. 32, Ramensky Region, Moscow obl., RussiaNational Institute of Biology, Vecna pot 111, SI-1000 Ljubljana, Slovenia
r t i c l e i n f o
rticle history:eceived 21 August 2012eceived in revised form 23 January 2013ccepted 25 January 2013vailable online 6 April 2013
eywords:ire blight
a b s t r a c t
Fire blight, a bacteriosis of apple and pear, was assayed with molecular tools to associate its origin inRussia, Slovenia and south-eastern Austria with neighboring countries. The identification of all investi-gated strains was confirmed by MALDI-TOF mass spectroscopy except one. Independent isolation wasverified by the level of amylovoran synthesis and by the number of short sequence DNA repeats in plas-mid pEA29. DNA of gently lysed E. amylovora strains from Russia, Slovenia, Austria, Hungary, Italy, Spain,Croatia, Poland, Central Europe and Iran was treated with restriction enzymes XbaI and SpeI to create typ-ical banding patterns for PFGE analysis. The pattern Pt2 indicated that most Russian E. amylovora strains
olecular differentiationFGE analysislasmids
were related to strains from Turkey and Iran. Strains from Slovenia exhibited patterns Pt3 and Pt2, bothpresent in the neighboring countries. Strains were also probed for the recently described plasmid pEI70detected in Pt1 strains from Poland and in Pt3 strains from other countries. The distribution of patternPt3 suggests distribution of fire blight from Belgium and the Netherlands to Central Spain and NorthernItaly and then north to Carinthia. The PFGE patterns indicate that trade of plants may have introducedfire blight into southern parts of Europe proceeded by sequential spread.
. Introduction
Fire blight is caused by the Gram-negative bacterium Erwiniamylovora and affects apple, pear, quince and other rosaceouslants. The disease was first described more than 200 years ago
n North America (Denning 1794) and then was introduced intoew Zealand from where it possibly spread to other parts of theorld in the 20th century, such as Europe and the Mediterranean
egion (Bonn and van der Zwet 2000). E. amylovora can be identi-ed by several methods. Detection of fire blight by PCR assays is
n most cases reliable, and identification by comparing the proteinrofiles in MALDI-TOF mass spectroscopy is a fast approach (Sauert al. 2008; Wensing et al. 2012). Most identification methods doot allow further sub-grouping of different strains, which woulde useful in tracking the source of outbreaks for epidemiological
urposes.
American strains and strains isolated outside of Northmerica can be distinguished by analysis of single nucleotide
∗ Corresponding author at: Julius Kühn Institut (JKI) für Pflanzenschutz,chwabenheimer Str. 101, D-69221 Dossenheim,ermany. Tel.: +49 6221 86805 53; fax: +49 6221 86805 15.
polymorphisms (SNPs) in the genes galE, acrB and hrpA (Gehringand Geider 2012). The fact that non-American strains strictly sharethe SNP patterns indicates a single event for introduction of the dis-ease by plant imports to New Zealand and subsequently to Englandand Egypt. On a more local scale, spread of fire blight to adjacentareas is possible by flower-visiting insects, rain and wind. Trade ofinfected plant material can also distribute the disease. The epidemi-ology of strains from a more localized region can be described byusing pulsed-field gel electrophoresis (PFGE) restriction patterns todistinguish them.
In general, Central European strains share the PFGE pattern Pt1,while the Pt3 pattern is dominant in Belgium and Northern France,and strains from the Eastern Mediterranean region exhibit mainlythe Pt2 pattern. Especially the recent occurrence of the Pt3 type inNorthern Italy and Central Spain was associated with plant trade(Jock et al. 2002). Other properties of E. amylovora may be alsosuited to distinguish strains, such as phage sensitivity (Müller et al.2011), levan production (Bereswill et al. 1997) and the amount ofEPS synthesis (Wang et al. 2010). Changes in the short sequenceDNA repeat of the common plasmid pEA29 (Kim and Geider 1999)
are also useful for strain differentiation.
Here we use PFGE typing to follow the movement of fire blightdisease from central to eastern Europe and from Greece westwardsto Hungary. In the Russian Federation, fire blight was detected 2003
nd first identified according to the EPPO Standard. Since 2007, theussian quarantine service has been monitoring E. amylovora. Firelight has now been reported in 11 regions of the European partf Russia. The first sporadic outbreaks of fire blight were seen inlovenia in 2001 and 2002 (Knapic et al. 2004; Dreo et al. 2006).ire blight was discovered for the first time in Southwest Austria in993 on Cotoneaster salicifolius in Vorarlberg and later in the northf Austria (Keck et al. 2006), from where it then spread to otheregions. Recent outbreaks were detected in Carinthia (southeastustria).
To follow this spread of fire blight, selected strains isolated inouthern and eastern Europe were analyzed for their PFGE pat-ern types together with other properties that may be associatedith the strains. MALDI-TOF mass spectroscopy, amylovoran pro-uction, and the presence of the 66 kb cryptic plasmid pEI70 werelso used to analyze fire blight in parts of southern and easternurope.
. Materials and methods
.1. Bacterial strains
The E. amylovora strains used in this study are listed in Table 1.hey were stored frozen at −80 ◦C in 10% glycerol and then grownn Luria–Bertani broth (LB) at 28 ◦C.
.2. PFGE analysis
The genomic DNA from gently lysed cells was digested withestriction enzymes XbaI and SpeI as previously described (Jockt al. 2002). For lysis, the cells embedded in 1% agarose blocks,hich were incubated three days at 50 ◦C in lysis buffer, digestedith 30 units enzyme, and then washed in phosphate/EDTA buffer.
FGE was performed with a CHEFDRIII apparatus (Bio-Rad) in a 1%garose gel with a linear ramping of 5 V/cm for 1–25 s for 22 h at4 ◦C.
.3. PCR assays
qPCR analysis was done as previously described (Mohammadit al. 2009; Wensing et al. 2012) using primers #101 (P29TF) #102bP29TM), #103 (P29TR) (from plasmid pEA29); #107 (AR14819),109 (AR14948c), #113 (AR14840Cy) (chromosomal amsK gene).he samples of the cultures at 1 d were diluted 100-fold in 0.1%ween and the cells lysed 15 min at 65 ◦C. For analysis of shortequence DNA repeats (SSR) numbers and plasmid pEI70, therimers are listed in Table 2. PCR fragments were sequenced com-ercially (Seqlab, Göttingen, Germany).
.4. Amylovoran determinations
Bacteria were grown in MM2C medium for 2 d at 28 ◦C andmylovoran in the supernatant was measured with the CPC assayBellemann et al. 1994) in duplicate.
.5. MALDI-TOF mass spectroscopy
Spectra generation and Biotyper analysis were performed asreviously described (Sauer et al. 2008; Wensing et al. 2012).riefly, cells from an overnight culture in LB medium with 1%lycerol were harvested, washed once, inactivated in ethanol andelleted again. The dried pellet was resuspended in 70% formic acid
or lysis. For MALDI-TOF MS analysis acetonitrile was added andebris removed by centrifugation. 1–2 �l of extracts were placedn an MSP 96 polished steel target using saturated alpha-cyano-4-ydroxy cinnamic acid in 50% acetonitrile–2.5% trifluoroacetic acid
earch 168 (2013) 447– 454
as matrix. Spectra were generated on a Bruker microflex machinewith Biotyper standard settings and analyzed with Biotyper soft-ware 3.1. Scores above 2 indicate a match with reference spectra(Sauer et al. 2008).
3. Results
3.1. MALDI-TOF MS analysis for strain identification
The strains of E. amylovora listed in Table 1 were analyzed byMALDI-TOF MS to verify their identification from previous assays.These strains were obtained over various years in Slovenia, Russia,Hungary, Austria, Italy, Croatia, Poland, Central Europe, Iran andother regions with fire blight. All but one of the strains was con-firmed by MALDI-TOF to be E. amylovora with a score value of ca.2.3 (Table 3) exceeding a threshold of 2 for reliable identification ofspecies (Sauer et al. 2008). Isolate ErwKae28/07 from necrotic peartissue in Carinthia, Austria, was identified as Brenneria quercina.This species may be a common saprophyte in necrotic wood oftrees with fire blight. With this exception, all isolates showed ahomogenous and specific protein pattern that allowed no furthersubtyping.
3.2. PFGE analysis with XbaI and SpeI
E. amylovora strains isolated in the Eastern part of Europe withemphasis on southeast Austria, Poland, Russia and Slovenia werecompared with those of strains from Central Europe, Hungary,Croatia and Northern Italy for their PFGE patterns generated byXbaI and SpeI digestion (Fig. 1 and Table 3). Previously describeddominant patterns were confirmed: Pt1 for Germany and a setof 12 strains from Poland; Pt2 for Hungary, Croatia and Iran; andPt3 for Northern Italy. The pattern distribution was split for othercountries. For Austria three isolates from the southern part werePt3 while two older isolates from the Vienna district were Pt1. InCroatia only Pt2 was found (Halupecki et al. 2006). Slovenia is sur-rounded by countries carrying Pt2 (Croatia) and Pt3 (Northern Italy)and both pattern types were observed during the 2007 outbreak.Based on the presence of the same PFGE patterns, even Carinthiacould be a source of fire blight in parts of Slovenia. The Russianenclave of the Kaliningrad region was infected with Pt1, as werethe surrounding areas of Poland, whereas other parts of Russia har-bored Pt2 strains. Fire blight may have moved into these centralregions from the south, possibly from Turkey and Iran. Strains fromTurkey were previously shown to have the Pt2 pattern (Zhang andGeider 1997). The XbaI patterns clearly distinguished Pt1 and Pt2strains.
The results of this study also show that digestion with SpeI givesthe same PFGE strain groupings as with XbaI. The SpeI digests pro-duced a large DNA fragment with a lack of a smaller one in caseof Pt3 strains. The XbaI pattern types Pt1 and Pt2 can therefore beclearly distinguished from Pt3 in SpeI digests (Fig. 1B, arrows). Wehave confirmed Pt3 XbaI pattern type with SpeI. These highly con-served PFGE patterns are typical for the genomes of E. amylovorastrains.
3.3. Occurrence of plasmid pEI70
As previously reported (Jock et al. 2002) the PFGE pattern ofstrains from Belgium, the Netherlands, France and Central Spainwere mostly Pt3. These and the other strains from Table 1 wereanalyzed for the presence of plasmid pEI70 by qPCR (Fig. 2). A
signal was obtained with primers #721 and #722 for strains NIBZ 895 from Slovenia, EaKae8/07 and EaKae24/07 from Carinthia,Ea404VR, and OMP-BO1194/97, OMP-BO1792/97 from Italy, butnot for NIB Z 972, NIB Z 981 and EaKae23/07, which were among the
S. Jock et al. / Microbiological Research 168 (2013) 447– 454 449
Table 1E. amylovora strains used in this study.
Strains/origin Description of isolation Source, Reference
Russia (this study)VNIIKR KBE1 Cydonia 2009, from Kabardino-Balkaria, Baksan region (North Caucasus, close to Georgia, East of Sochi, between Black Sea and
Caspian Sea)VNIIKR KE6 Crataegus 2007, from Kaliningrad oblast, BaltijskVNIIKR VGE3 Cydonia 2010, from Volgograd oblast, Krasnoslobodsk (450 km up the Volga river from the Caspian Sea)VNIIKR VRE4 Malus domestica 2010, from Voronezh oblast Novousmansk region (300 km south of Moscow)VNIIKR TE9 Pyrus communis 2010, from Tambov oblast, Michurinsk (300 km south of Moscow)
Slovenia (this study)NIB Z 884 M. domestica, 2007, Naklo (first detection of fire blight in 2001)NIB Z 895 Cydonia oblonga, 2007, LukovicaNIB Z 972 M. domestica, 2007, HorjulNIB Z 981 M. domestica, 2007, DomzaleNIB Z 997 M. domestica, 2007, Krizevci
AustriaEa296/93 C. salicifolus, Vienna, 1993 Jock et al. (2003)Ea674/94 P. communis, Vienna,1994 Bereswill et al. (1997)EaKae8/07 Necrotic pear wood, Carinthia, 2007 This studyEaKae23/07 Necrotic pear wood, Carinthia, 2007 This studyEaKae24/07 Necrotic pear wood, Carinthia, 2007 This studyErwKae28/07 From necrotic pear, Carinthia, 2007, is B. quercina (MALDI-TOF MS score 2.046) This study
Belgium and the NetherlandsDGBBC 350 Malus tsonoski, tree nursery, Oosterzele Jock et al. (2002)DGBBC 351 P. communis, Beech Hill’, tree nursery, Oosterzele Jock et al. (2002)LMG 1880 P. communis, 1979 Jock et al. (2002)LMG 1884 Cotoneaster salicifolius, 1980 Jock et al. (2002)LMG 1893 P. communis, 1980 Jock et al. (2002)OVG038 M. domestica Jock et al. (2002)PD576 Crataegus sp., the Netherlands, 1985 Bereswill et al. (1997)PD3217 Salix sp., the Netherlands, 1998 Jock et al. (2002)
CroatiaEaCr8DJ M. domestica, Djakovo, Croatia 1998 Halupecki et al. (2006)EaCr20/05 P. communis; Èakovec Halupecki et al. (2006)EaCr12/05 M. domestica, Gloster; Nedelisce Halupecki et al. (2006)
GermanyEa7/74 Cotoneaster sp., Northern Germany 1974 Falkenstein et al. (1988)Ea1/79 DSM 17948, M. domestica, Germany, 1979 Falkenstein et al. (1988)Ea63/05 Pfullingen, Germany, Pyracantha sp., 2005; without plasmid pEA29 Mohammadi et al. (2009)EaRW1/06 Cotoneaster sp., Rottweil, Germany 2006 K. Geider
HungaryEaH2 M. domestica, 1995, Kecskemet M. HevesiEaH895 M. domestica, ‘Golden Dilicious’, from leaf vein, Nyarlorinc, 1996 J. NemethEaH909 M. domestica, ‘Jonathan’, from shoot, Zakanyszek, 1996 A. N. KovacsEaH910 C. oblonga, from shoot, Mohacs, 1996 A. N. Kovacs
ItalyEa404VR P. communis, district of Verona Jock et al. (2002)OMP-BO1194/97 P. communis, district of Ferrara, 1997 Jock et al. (2002)OMP-BO1792/97 P. communis, district of Modena, 1997 Jock et al. (2002)
IranEaIrn2 Pear leaf petiole, Shahriar Karaj, Tehran province, 2001 Mohammadi et al. (2009)EaIrn37 P. communis, Tabriz, 2001; without pEA29 Mohammadi et al. (2009)
Poland (this study)EaPL2 Crataegus sp., Oswiecim, 2000EaPL600 Crataegus sp., Kepno, 1993EaPL601 P. communis, Kepno, 1993EaPL603 Crataegus sp., Kepno, 1994EaPL606 Crataegus sp., Elzbietów, 1994EaPL665 P. communis, Kepno, 1993EaPL666 Crataegus sp., Opole, 1996EaPL609a P. communis, Łowicz, 2003EaPL619a P. communis, Biała Rawska, 2007EaPL625a P. communis, Grójec, 2007EaPL367/96 Pyrancantha sp., 1996 P. SobiczewskiEaPL692/95 Sorbus sp., 1995 P. Sobiczewski
SpainIVIA 1603 Cotoneaster sp., Segovia, 1996 Jock et al. (2002)IVIA 1614-2 Pyracantha sp., Segovia, 1996 Jock et al. (2002)IVIA 1899-21 C. oblonga, Guadalajara, 1998 Jock et al. (2002)
Strains from other countriesCFBP 1232T Type strain, P. communis, England, 1959 Jock et al. (2002)CFBP 1430 Crataegus sp., Lille, France, 1972 Jock et al. (2002)Ea4/82 P. communis, Egypt, 1982 Falkenstein et al. (1988)T90 Turkey, 1990 Zhang and Geider (1997)Ea775 NCPPB775; Crataegus sp.; England, 1959 Zhang and Geider (1997)OR6 P. communis, Oregon, USA, 2007 V. StockwellJLVNZ04 Hawke’s bay, New Zealand, 1994 Kim and Geider (1999)PFB15 Prunus sp., USA, before 1995 Kim and Geider (1999)Tp3 P. communis, Toronto, 2001 Jock and Geider (2004)
BCCM/LMG, Belgian co-ordinated collections of micro-organisms; CFBP, Collection Franc aise de Bactéries Phytopathogènes; DSMZ, Deutsche Sammlung von Mikroorganismenund Zellkulturen; NIB Z, bacterial culture collection of the National Institute of Biology, Ljubljana, Slovenia; VNIIKR, Russian Centre for Plant Quarantine.
450 S. Jock et al. / Microbiological Research 168 (2013) 447– 454
Table 2Novel PCR primers used in this study.
Primer Other name Sequence
Sequencing of SSRs in plasmid pEA29#729 Ea29SSR25638 GGCCTATGCCGTCTCAGAAT#730 Ea29SSR26367c GCTGGTAGCGATGTTGATGA
cPCR for detection and sequencing part of plasmid pEI70 (the numbers indicate primer positions, Genbank accession number CP002951)#719 PEI70-52130 ACCTGAAGTCGCACCGGATA#720 PEI70-52924c TGGCGTAGCTGGATTAGTCG
qPCR, detection of plasmid pEI70#721 PEI70-53061Q AGAAGTTAGCGCGAGATGGA#722 PEI70-53226Qc TAGTCCTGCGTGGACGACTA
Fig. 1. PFGE analysis. (A) Digest with enzyme XbaI. Lane 1: CFBP1232 (England, Pt1); 2: Ea4/82 (Egypt, Pt2); 3: CFBP1430 (France, Pt3); 4: NIB Z 884 (Slovenia, Pt2); 5: NIB Z981 (Slovenia, Pt3); 6: VNIIKR KE6 (Kaliningrad; Russia; Pt1); 7: VNIIKR TE9 (Michurinsk, Russia; Pt2). M, marker of lambda oligomers; asterisks, band positions indicating Pt2.(B) Digests with enzyme SpeI. Lane 1: CFBP1232T (England, Pt1); 2: Ea4/82 (Egypt, Pt2); 3Russia; Pt1); 6: EaKae8/07 (Carinthia, Austria; Pt3); 7: Ea404VR (Verona, Italy; Pt3); 8: NIBband for Pt3; arrow with diamond: missing band for Pt3.
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
0 10 20 30 40Cycles
RFU
A
B
Fig. 2. Screening with qPCR for presence of pEI70 using primers #721 and #722.(A) Positive signal for pEI70 from strains: DGBBC 350, LMG 1880, LMG 1893, PD576,IVIA 1603, Sp1899-2, EaKae24/07. (B) No signal (no pEI70): OVG038, EaKae23/07.
: CFBP1430 (France, Pt3); 4: NIB Z 981 (Slovenia, Pt3); 5: VNIIKR KE6 (Kaliningrad, Z 895 (Slovenia; Pt3). M, marker of lambda oligomers in kb; arrow with dot: typical
Pt3 strains from these countries. The positive qPCR data were con-firmed by cPCR with primers #719/#720. The nucleotide sequencesof the amplified fragments were identical.
To determine if plasmid pEI70 is associated with Pt3 strains asinitially observed, we assayed 12 E. amylovora strains from Poland(Table 3), most were identified before as carriers of the plasmid(Llop et al. 2011). In SpeI digests all strains from Poland displayedthe pattern type Pt1, i.e. pEI70 can be carried by strains with PFGEpattern types Pt1 and Pt3. Most of the Pt3 strains from Belgium,the Netherlands, France, and Central Spain were positive for pEI70.None of the tested E. amylovora strains from North America, northe single strain from New Zealand (JLVNZ04) used in this study,carried the plasmid. In conclusion, the PFGE patterns and the pres-ence of pEI70 plasmid, together with limited information on planttrade indicate that trade from Belgium/the Netherlands to CentralSpain and Northern Italy was a possible route for long distancedistribution of fire blight.
3.4. DNA repeat numbers of plasmid pEA29
The E. amylovora strains from Russia, Slovenia and Austria wereinvestigated for the number of short-sequence DNA repeats (SSR) inthe 1 kb PstI fragment of plasmid pEA29. This plasmid region wasamplified with primers #721/#722 and sequenced (Table 3). Thestrains from Slovenia had repeat numbers from 6 to 9. The strains
from Russia showed lower repeat numbers from 4 to 6. Rarelyobserved, Russian strain VNIIKR KBE1 had a different nucleotidesequence in the right part of the amplified PCR fragment, whereasthe rest of the fragment matched with the expected sequence.
S. Jock et al. / Microbiological Research 168 (2013) 447– 454 451
Table 3MALDI-TOF MS identification of E. amylovora strains, presence of plasmid pEI70, number of SSRs in pEA29, and PFGE Pt types.
Strain/origin MALDI-TOF MS score pEI70 SSR PFGE pattern; reference
RussiaVNIIKR KBE1 2.285 No a Pt2, this studyVNIIKR KE6 2.274 No 5 Pt1, this studyVNIIKR VGE3 2.320 No 6 Pt2, this studyVNIIKR VRE4 2.297 No 6 Pt2, this studyVNIIKR TE9 2.286 No 4 Pt2, this study
SloveniaNIB Z 884 2.394 No 6 Pt2, this studyNIB Z 895 2.449 Yes 9 Pt3, this studyNIB Z 972 2.335 No 6 Pt3, this studyNIB Z 981 2.368 No 7 Pt3, this studyNIB Z 997 2.258 No 8 Pt2, this study
AustriaEaKae8/07 2.354 Yes 7 Pt3, this studyEaKae23/07 2.308 No 6 Pt3, this studyEaKae24/07 2.262 Yes 6 Pt3, this studyEa296/93 2.324 No 14 Pt1, this studyEa674/94 2.360 No 13 Pt1, this study
Belgium, the NetherlandsDGBBC 350 2.338 Yes Pt3 (Jock et al. 2002)DGBBC 351 2.243 Yes Pt3 (Jock et al. 2002)LMG 1880 2.369 Yes Pt3 (Jock et al. 2002)LMG 1884 2.400 Yes Pt3 (Jock et al. 2002)LMG 1893 2.374 Yes Pt3 (Jock et al. 2002)OVG038 2.343 No Pt3 (Jock et al. 2002)PD576 2.353 Yes Pt3s (Jock et al. 2002)PD3217 2.335 Yes Pt3 (Jock et al. 2002)
CroatiaEaCr8DJ 2.271 No Pt2, this study and Halupecki et al. (2006)EaCr12/05 2.277 No Pt2, this study and Halupecki et al. (2006)EaCr20/05 2.356 No Pt2, this study and Halupecki et al. (2006)
GermanyEa7/74 2.172 No 6 Pt1 (Zhang et al. 1998)Ea1/79 2.352 No 6 Pt1 (Zhang et al. 1998)Ea63/05 (no pEA29) 2.254 No Pt1, this studyEaRW1/06 2.203 No
HungaryEaH2 2.258 No Pt2, this studyEaH895 2.360 No Pt2, this studyEaH909 2.354 No Pt2, this studyEaH910 2.403 No Pt2, this study
ItalyEa404VR 2.318 Yes Pt3, this study and Jock et al. (2002)OMP-BO1194/97 2.323 Yes Pt3, this study and Jock et al. (2002)OMP-BO1792/97 2.407 Yes Pt3, this study and Jock et al. (2002)
IranEaIrn2 2.324 No Pt2, this studyEaIrn37 (no pEA29) 2.318 No Pt2, this study
PolandEaPL2 2.435 Yes Pt1, this studyEaPL600 2.355 No Pt1, this studyEaPL601 2.262 Yes Pt1, this studyEaPL603 2.322 Yes Pt1, this studyEaPL606 2.333 Yes Pt1, this studyEaPL665 2.280 Yes Pt1, this studyEaPL666 2.371 Yes Pt1, this studyEaPL609a 2.372 Yes Pt1, this studyEaPL619a 2.321 Yes Pt1, this studyEaPL625a 2.350 Yes Pt1, this studyEaPL367/96 2.334 No Pt1, this studyEaPL692/95 2.277 No Pt1, this study
SpainIVIA 1603 2.386 Yes Pt3 (Jock et al. 2002)IVIA 1614-2 2.449 Yes Pt3 (Jock et al. 2002)IVIA 1899-2 2.359 Yes Pt3 (Jock et al. 2002)
Other strainsCFBP 1232T 2.407 Pt1 (Jock et al. 2002)CFBP 1430 2.512 No 5 Pt3, this study and Jock et al. (2002)Ea4/82 2.227 No 6 Pt2, this study and Jock et al. (2002)T90 2.207 No 5 Pt2 (Zhang and Geider 1997)Ea775 2.153 No 7 Pt4 (Jock et al. 2002)OR6 2.289 NoJLVNZ04 2.184 NoPFB15 2.281 No 9 Other (Kim and Geider 1999)Tp3 2.177 No Other (Jock and Geider 2004)
a Changes in pEA29, no SSR detected. A MALDI-TOF MS score > 2 identifies E. amylovora; SSR, short sequence DNA-repeats.
452 S. Jock et al. / Microbiological Research 168 (2013) 447– 454
0
1
2
3
4
5
6
7
8
CFBP
1232
Ea4/
82CF
BP14
30NI
BZ88
4NI
BZ89
5NI
BZ97
2NI
BZ98
1NI
BZ99
7VN
IIKR
KBE1
VNIIK
R KE
6VN
IIKR
VGE3
VNIIK
R VR
E4VN
IIKR
TE9
EaH2
EaH8
95Ea
H909
EaH9
10Ea
Kae8
/07
EaKa
e28/
07Ea
296/
93Ea
674/
94Ea
404V
RP-
BO11
94/9
7P-
BO17
92/9
7Ea
Cr8D
JEa
Cr20
/05
EaCr
12/0
5Ea
Irn2
EaIrn
37Ea
PL36
7/96
EaPL
692/
95Ea
1/79
Ea63
/05
A60
0
mediu
SmtirEn
3
rp#apmTmsbg
ptAsEHaia
3P
iva
Fig. 3. Amylovoran synthesis. The cultures were grown in MM2C liquid
urprisingly, primer #722 annealed at a site to amplify a frag-ent of ca. 900 bp. On the other hand, no homology was found for
he right part of the fragment in BLAST searches to any sequencen nucleotide data bases possibly indicating a recent genomicearrangement. Different SSR numbers indicate that non-identical. amylovora strains occur, even in limited regions such as for Slove-ia. Also strains from Carinthia differed in their SSR number.
.5. Amylovoran synthesis and growth in minimal medium
The amylovoran production in MM2 minimal medium was cor-elated with bacterial growth determined by qPCR. The Taqmanrimers #102b (FAM) from plasmid pEA29 and for confirmation113 (Cy5) from the chromosomal ams region were simultaneouslypplied to measure growth after 1 d of incubation. Use of amsrimers was a precaution to record strains with a change in plas-id pEA29 such as VNIIKR KBE1, which may not produce a signal.
he Ct values for all Tween lysates were almost identical andatched with a lysate of E. amylovora strain Ea1/79 at a cell den-
ity of 1 × 109 CFU/ml. Different amounts of amylovoran synthesisetween strains therefore cannot be attributed to differences in cellrowth.
The capsular EPS amylovoran is strictly required for fullathogenicity (Bellemann and Geider 1992). Among the inves-igated strains, CFBP 1430 from France and Ea296/93 fromustria were high amylovoran producers (Fig. 3). Among thetrains isolated outside Slovenia, Russia and Austria, Ea4/82 fromgypt, EaIrn2 and EaIrn37 from Iran, EaH2 and EaH910 fromungary, EaPL367/96 from Poland synthesized small amounts ofmylovoran. The level of most Russian and Slovenian strains wasntermediate and VNIIKR VRE4 and VNIIKR TE9 from Russia showed
more reduced amylovoran synthesis than the others.
.6. Occurrence and characterization of fire blight in Russia,oland, Slovenia and southeast Austria
On the European mainland, fire blight was detected 1966/1967n the Netherlands and on the Baltic coast of Poland (Bonn andan der Zwet 2000). At present, fire blight is observed with vari-ble intensity in many apple and pear growing regions, mostly in
OM
OM
m for 2 d. After addition of CPC, the turbidity was measured at 600 nm.
the central and south part of Poland. Besides fruit trees, fire blightwas also found on ornamental plants such as Crataegus sp., Sorbussp., Amelanchier sp. The analysis of E. amylovora isolates originat-ing from different geographical regions of Poland and different hostplants showed a high genetic homogeneity but revealed differencesin virulence (Puławska et al. 2006). In the recent years, severalnew loci of fire blight, possibly connected with imported plantmaterial was observed. Nevertheless, the strains from Poland inves-tigated here showed the PFGE pattern Pt1, whereas Belgium/theNetherlands also harbor Pt3 strains with and without plasmidpEI70.
Four clusters of fire blight infection exist in Russia. In the Kali-ningrad oblast, a western enclave, fire blight was widespread 2003on Crataegus sp. and was also detected on Malus, Pyrus, Ame-lanchier and Prunus spp. In contrast to other Russian clusters, thePFGE pattern observed here was Pt1. The second cluster in Rus-sia is in the Central Black Earth Area with remote parts of theVoronezh region (from 2007) with affected old apple and peartrees. There are also locally infested areas in the Tambov region(2007, Michurinsk), and fire blight was found in the Belgorod oblast(2008) on grafted pear scions from Ukraine, and later in two remotelocations of Lipetsk oblast (2011, 2012) on pear and apple treesin private and commercial gardens. The third cluster is in theStavropol territory (Caucasian Mineral Waters) and the North Cau-casus (Kabardino-Balkaria and Karachaevo-Cherkessia) with pearand quince production. Severe quarantine measures (2008–2010)attempted to reduce fire blight on Malus, Pyrus and Cydonia inprivate gardens and in orchards. In the fourth cluster, the LowerVolga area which has a continental climate with winters as coldas −40 ◦C, a short spring and a very hot and dry summer (Samaraoblast; 2008, 2011). Several old apple orchards in remote areaswere eradicated, but outbreaks were detected in young plantationsafter two years latent infection in two farms (2012). In the Saratovoblast (Khvalynsk, 2009, 2011) fire blight was detected in apple andpear orchards and on wild Malus, Pyrus and Crataegus spp. Samaraand Saratov oblasts are both infected with Pseudomonas syringae,
which often resembles E. amylovora infections of pear blossomsand shoots. Near Volgograd (2009) fire blight affected Cydonia andCrataegus in private and botanical gardens with almost 100 yearsold collections in part from America. Quince showed symptoms
n June and mature apple trees carried single small shoot necrosis,nd young apple trees can occasionally have typical symptoms. Thempact of fire blight in this area is variable. We have mostly ana-yzed strains from the central southern parts of Russia. The PFGEattern type Pt2 was also observed in the south in Turkey and in
ran.Slovenia was found to be free of fire blight until 2001. A low
ncidence of the disease was reported in 2001 and 2002 in theorenjska region. Despite strict phytosanitary measures imple-ented after discovery of the first focus, the bacterium spread
n 2003 (Knapic et al. 2004). Further spread of the disease andarger outbreaks were later recorded in years 2003 and 2007. Apartrom these larger outbreaks, fire blight currently appears only spo-adically in Slovenia. All Slovenian isolates were identified andonfirmed before as E. amylovora using isolation and morphologybservation on NSA and King’s B media, agglutination test, PCRPirc et al. 2009) and pathogenicity tests with immature pear fruits.solates for this study were selected on their variable number ofandem repeats profiles (T. Dreo et al., unpublished data). The ana-yzed strains were isolated in orchards near the Slovenian capitalf Ljubljana within 100 km distance. Their PFGE pattern types areither Pt2 or Pt3. Plasmid pEI70 was not found in Pt2 strains fromlovenia.
Fire blight was first detected in Austria in 1993. Since its firstccurrence in Vorarlberg (southwest), close to the German border,he disease has spread in the north of Austria to other parts of theountry (Keck et al. 2006). During the last disastrous outbreak inorarlberg in 2007, a substantial amount of the affected produc-
ion area had to be cleared. The disease has more recently beenbserved in Carinthia (southeast) at altitudes as high as 1500 mL.-M. Bartosik, personal communication). The E. amylovora strainsrom Carinthia (EaKae) showed the PFGE pattern type Pt3 and twof them carried plasmid pEI70.
. Discussion
Erwinia amylovora causes fire blight on Rosaceous plants and is aighly homogeneous species. We characterized a number of strains
rom fire blight outbreaks in Russia, Poland, Slovenia and southeastustria (Carinthia) for their molecular properties and for the levelf amylovoran synthesis. The identification of these strains as E.mylovora was verified by both characteristic PFGE patterns andALDI-TOF MS. Screening of the strains in Table 1 is a broad iden-
ification attempt with MALDI-TOF MS analysis for E. amylovorarom European sources and isolates from other regions. Only onetrain was misidentified before, and it turned out to be Brenneriauercina. The E. amylovora strains differed not only in their PFGEatterns but also in the presence of plasmid pEI70. This plasmid istably maintained in E. amylovora, and autonomously transferred tother E. amylovora strains (Llop et al. 2011). The number of SSRs oflasmid pEA29 (Kim and Geider 1999) and the amount of amylovo-an synthesized, the hypersensitive response on tobacco, swarmingn agar, and virulence on apple have been associated with strainignatures (Wang et al. 2010). These and other physiological prop-rties were described before as strain characteristics (Halupeckit al. 2006). Among the Russian, Slovenian and Austrian strains,a674/94 from Northern Austria, NIB Z 895 from Slovenia and theussian strain VNIIKR KE6 from the Baltic area were high amylovo-an producers, whereas EaPL367/96 from adjacent Poland and EaH2rom adjacent Hungary were low producers.
Most E. amylovora strains possess the common plasmid pEA29.t carries genes encoding thiamine metabolism (McGhee and Jones
000), which may enhance growth of the pathogen in host plantissue. A few, still virulent strains without plasmid pEA29, possi-ly from a spontaneous curing, have been described (Llop et al.006; Mohammadi et al. 2009). A frequent variation in the 1 kb PstI
earch 168 (2013) 447– 454 453
fragment of plasmid pEA29 is a change in the repeat number ofthe 8 bp sequence “ATTACAGA” (Kim and Geider 1999). Natural E.amylovora populations are assumed to carry the same repeat num-ber for all strains in a narrow geographical area, although isolatesfrom adjacent plants in the same garden with fire blight can carrydifferent SSR numbers (Jock et al. 2003). Other studies (Ruppitschet al. 2004) consider SSR numbers to be characteristic for individualE. amylovora strains under lab conditions. In this study, we distin-guished most of the isolates from Russia, Slovenia and southeastAustria (Carinthia) by SSRs. The reason for the mutation in plas-mid pEA29 in VNIIKR KBE1 can be a recent recombination eventadjacent to the SSR sequence.
In addition to plasmid pEA29, E. amylovora may carry otherplasmids. A broad investigation of European strains describes theoccurrence of plasmid pEI70 and reports that it is present in themajority of E. amylovora strains from Italy and Slovenia (Llop et al.2011). The presence of either plasmid can increase aggressivenessof strains, and pEI70 shows autonomous transfer. A dominance ofpositive strains in some countries may indicate their more effi-cient spread compared to plasmid free strains. For the E. amylovorastrains tested here, pEI70 was not found yet in Pt2 strains. Theabsence of pEI70 in many Pt1 and Pt3 strains may indicate an evo-lutionary difference.
A clear differentiation of E. amylovora isolates was achieved withPFGE analysis, a method that is difficult to use for mass screeningbut is very powerful because it compares whole genomes, ratherthan individual markers. Restriction analysis with XbaI has beensuccessfully used for classification of European strains (Jock et al.2002). Four main pattern types were observed among strains fromEurope. Pt1 was found in Central Europe, Pt2 in Egypt and theEastern Mediterranean region to Hungary, Pt3 in Northern Italy,Belgium, Northern France and Central Spain and Pt4 was foundin Western France and Northern Spain. The comparison of XbaIrestriction sites in the total genomic sequences of the AmericanPt1 strain Ea273 (accession no. FN666575, Sebaihia et al. 2010) withthose in the genomic sequence of the French Pt3 strain CFBP 1430(Jock et al. 2002) (accession number FN434113, Smits et al. 2010)revealed that different XbaI banding patterns can be explained bylarge inversions in the genomes. PCR analysis indicated that therespective XbaI and SpeI sites are still present (M. Gernold and K.Geider, unpublished data). In this study, we successfully appliedpattern discrimination to E. amylovora strains isolated in Russia,Slovenia and southeast Austria (Carinthia). The pattern type in Rus-sia was mostly Pt2, which was previously found in Turkey (Zhangand Geider 1997) and more recently in Iran. An exception was astrain from Kaliningrad, which exhibited the pattern Pt1, previ-ously found in adjacent Poland (Jock et al. 2002). Therefore, weassume spread of fire blight from the south into western-centralRussia. Slovenia was accordingly infiltrated from Croatia in theeast, and from Northern Italy in the south. Pt3 in Carinthia canalso be explained by spread of fire blight from the adjacent partof Northern Italy. This study expands the data on PFGE patternsof E. amylovora isolates present in Europe to strains from Russia,Slovenia and southeast Austria (Carinthia) (Fig. 4). The situationin Northern Italy is divergent: Pt3 is dominant but in rare casesPt1 appears to have been introduced into the area of Bolzano fromAustria (Jock et al. 2002). In a recent survey of PFGE patterns for E.amylovora strains from Serbia (Ivanovic et al. 2012), Pt2 was domi-nant, although Pt3 was also detected. The occurrence of additionalpatterns (Pt6, 7, 8, 9) may indicate a tendency of E. amylovora toundergo genomic rearrangements. PFGE-analysis of E. amylovorafrom Bulgaria also showed a dominance of Pt2 with some Pt1
strains and new patterns (Atanasova et al. 2012). Pt5 was describedbefore in strains from Israel and Bulgaria together with patternsrelated to Pt3 from Belgium, the Netherlands and France (Jock et al.2002).
ig. 4. A scheme for possible distribution of fire blight based on the PFGE patternsn Central Europe, Russia and the Eastern Mediterranean region with Iran.
The PFGE patterns of North American strains are heterogeneousJock and Geider 2004). Nevertheless, these strains can be classi-ed by the SNP pattern of three genes divergent from that of allon-North American Isolates (Gehring and Geider 2012). This dis-ribution might indicate, that spread of fire blight was caused by
rare escape of E. amylovora from North America to New Zealandrom where it may have spread to Europe and the Mediterraneanegion by commercial trade. SNP analysis may become a tool alsoescribing spread of fire blight in narrow areas supporting the databtained by PFGE analysis.
cknowledgements
We thank Marja-Liisa Bartosik for sending samples from symp-omatic pear trees in Carinthia, Austria, and S. Zimmermann inhe Hygiene Institute Heidelberg for providing access to Bruker
icroflex-Biotyper analysis as well as David L. Coplin for valuableomments on the manuscript. The Slovenian isolates were obtainedn the frame of official fire blight monitoring by an organizationf the Slovenian Phytosanitary Administration and Phytosanitarynspection.
eferences
tanasova I, Urshev Z, Hristova P, Bogatzevska N, Moncheva P. Characterization ofErwinia amylovora strains from Bulgaria by pulsed-field gel electrophoresis. ZNaturforsch C 2012;67:187–94.
ellemann P, Geider K. Localization of transposon insertions in pathogenicitymutants of Erwinia amylovora and their biochemical-characterization. J GenMicrobiol 1992;138:931–40.
ellemann P, Bereswill S, Berger S, Geider K. Visualization of capsule formationby Erwinia amylovora and assays to determine amylovoran synthesis. Int J BiolMacromol 1994;16:290–6.
ereswill S, Jock S, Aldridge P, Janse JD, Geider K. Molecular characterization of nat-ural Erwinia amylovora strains deficient in levan synthesis. Physiol Mol PlantPathol 1997;51:215–25.
onn GW, van der Zwet T. Distribution and economic importance of fire blight.In: Vanneste JL, editor. Fire blight the disease and its causative agent, Erwinia
amylovora. Wallingford, UK: CABI Publishing; 2000. p. 37–54.
enning W. On the decay of apple trees. NY Soc Prom Agric Arts Manuf Trans1794;2:219–22.
reo T, Zupancic M, Demsar T, Ravnikar M. First outbreaks of fire blight in Slovenia.Acta Horticult 2006;704:37–42.
earch 168 (2013) 447– 454
Falkenstein H, Bellemann P, Walter S, Zeller W, Geider K. Identification of Erwiniaamylovora, the fireblight pathogen, by colony hybridization with DNA from plas-mid pEA29. Appl Environ Microbiol 1988;54:2798–802.
Gehring I, Geider K. Differentiation of Erwinia amylovora and E. pyrifoliae strains withsingle nucleotide polymorphisms and by synthesis of dihydrophenylalanine.Curr Microbiol 2012;65:73–84.
Halupecki E, Bazzi C, Jock S, Geider K, Dermic D, Cvjetkovic B. Characterization ofErwinia amylovora strains from Croatia. Eur J Plant Pathol 2006;114:435–40.
Ivanovic M, Obradovic A, Gasic K, Minsavage G, Dickstein E, Jones J. Exploringdiversity of Erwinia amylovora population in Serbia by conventional and auto-mated techniques and detection of new PFGE patterns. Eur J Plant Pathol2012;133:715–27.
Jock S, Geider K. Molecular differentiation of Erwinia amylovora strains from NorthAmerica and of two Asian pear pathogens by analyses of PFGE patterns and hrpNgenes. Environ Microbiol 2004;6:480–90.
Jock S, Donat V, Lopez MM, Bazzi C, Geider K. Following spread of fire blight inWestern, Central and Southern Europe by molecular differentiation of Erwiniaamylovora strains with PFGE analysis. Environ Microbiol 2002;4:106–14.
Jock S, Jacob T, Kim WS, Hildebrand M, Vosberg HP, Geider K. Instability ofshort-sequence DNA repeats of pear pathogenic Erwinia strains from Japanand Erwinia amylovora fruit tree and raspberry strains. Mol Genet Genomics2003;268:739–49.
Keck M, Richter S, Loncaric L, Ruppitsch W, Pechhacker H, Moosbeckhofer R, et al.Ten years of fire blight in Austria: survey and control measures. Acta Horticult2006;704:43–50.
Kim WS, Geider K. Analysis of variable short-sequence DNA repeats on the 29 kbplasmid of Erwinia amylovora strains. Eur J Plant Pathol 1999;105:703–13.
Knapic V, Potonik A, Skerlavaj V, Brecl A. First outbreaks of fireblight in Slovenia.EPPO Bull 2004;34:351–6.
Llop P, Donat V, Rodriguez M, Cabrefiga J, Ruz L, Palomo JL, et al. An indigenousvirulent strain of Erwinia amylovora lacking the ubiquitous plasmid pEA29. Phy-topathology 2006;96:900–7.
Llop P, Cabrefiga J, Smits TH, Dreo T, Barbe S, Pulawska J, et al. Erwinia amylovoranovel plasmid pEI70: complete sequence, biogeography, and role in aggressive-ness in the fire blight phytopathogen. PLoS One 2011;6:e28651.
McGhee GC, Jones AL. Complete nucleotide sequence of ubiquitous plasmid pEA29from Erwinia amylovora strain Ea88: gene organization and intraspecies varia-tion. Appl Environ Microbiol 2000;66:4897–907.
Mohammadi M, Moltmann E, Zeller W, Geider K. Characterisation of naturally occur-ring Erwinia amylovora strains lacking the common plasmid pEA29 and theirdetection with real-time PCR. Eur J Plant Pathol 2009;124:293–302.
Müller I, Lurz R, Kube M, Quedenau C, Jelkmann W, Geider K. Molecular and physio-logical properties of bacteriophages from North America and Germany affectingthe fire blight pathogen Erwinia amylovora. Microb Biotechnol 2011;4:735–45.
Pirc M, Ravnikar M, Tomlinson J, Dreo T. Improved fireblight diagnostics using quan-titative real-time PCR detection of Erwinia amylovora chromosomal DNA. PlantPathol 2009;58:872–81.
Puławska J, Kielak K, Sobiczewski P. Phenotypic and genetic diversity of selectedErwinia amylovora strains from Poland. Acta Horticult 2006;704:439–44.
Ruppitsch W, Stoger AR, Keck M. Stability of short sequence repeats and their appli-cation for the characterization of Erwinia amylovora strains. FEMS Microbiol Lett2004;234:1–8.
Sauer S, Freiwald A, Maier T, Kube M, Reinhardt R, Kostrzewa M, et al. Classificationand identification of bacteria by mass spectrometry and computational analysis.PLoS One 2008;3:e2843.
Sebaihia M, Bocsanczy AM, Biehl BS, Quail MA, Perna NT, Glasner JD, et al. Completegenome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946.J Bacteriol 2010;192:2020–1.
Smits THM, Rezzonico F, Kamber T, Blom J, Goesmann A, Frey JE, et al. Completegenome sequence of the fire blight pathogen Erwinia amylovora CFBP 1430 andcomparison to other Erwinia spp. Mol Plant-Microbe Interact 2010;23:384–93.
Wang D, Korban SS, Zhao Y. Molecular signature of differential virulence in naturalisolates of Erwinia amylovora. Phytopathology 2010;100:192–8.
Wensing A, Gernold M, Geider K. Detection of Erwinia species from the apple andpear flora by mass spectroscopy of whole cells and with novel PCR primers. JAppl Microbiol 2012;112:147–58.
Zhang Y, Geider K. Differentiation of Erwinia amylovora strains by pulsed-field gelelectrophoresis. Appl Environ Microbiol 1997;63:4421–6.
Zhang Y, Merighi M, Bazzi C, Geider K. Genomic analysis by pulsed-field gelelectrophoresis of Erwinia amylovora strains from the Mediterranean regionincluding Italy. J Plant Pathol 1998;80:225–32.
