MOLECULAR BIOGEOGRAPHY ANDGENETIC STRUCTURE OF DOMESTICATED
CATTLE
David Evan MacHugh
A thesis submitted to the University of Dublin for the degree of Doctor of Philosophy
Department of Genetics,Trinity College,University of Dublin March 1996
Declaration
I hereby certify that this thesis, submitted to the University of Dublin for the degree
of Doctor of Philosophy, has not been submitted as an exercise for a degree at any other
university. I also certify that the work described here is entirely my own.
This thesis may be made available for consultation within the university library and
may be photocopied or loaned to other libraries for the purposes of consultation.
________________
David E. MacHugh
March 1996
Table of Contents
Acknowledgements......................................................................... iAbbreviations................................................................................ iiSummary....................................................................................... iii
Chapter 1 General Introduction
1.1 Outline of research project ................................................ 11.2 Cattle domestication .......................................................... 31.3 Genetic variation studies.................................................... 181.4 Simple tandem repeats: microsatellites................................ 24
Chapter 2 Cattle Populations Surveyed
2.1 Introduction...................................................................... 302.2 European breeds ............................................................... 342.3 African breeds................................................................... 402.4 Asian breeds...................................................................... 452.5 Cattle genetic diversity in West Africa................................ 47
Chapter 3 Materials and Methods
3.1 Sampling strategies............................................................ 56
3.2 Field sample collection and DNA extraction...................... 633.3 Microsatellite typing and data collection............................ 75
Chapter 4 General Results
4.1 Introduction...................................................................... 864.2 Basic allelic data ............................................................... 874.3 Analysis of heterozygosity................................................. 944.4 Deviations from Hardy-Weinberg equilibrium................... 1004.5 Analysis of gametic disequilibrium.................................... 1044.6 Analysis of genetic differentiation..................................... 1084.7 Conformation with mutation/drift models .......................... 1124.8 Phylogenetic analysis......................................................... 1234.9 Multivariate statistical analysis............................................ 1384.10 Discussion......................................................................... 143
Appendices: Allele frequencies and histograms .................. 147
Chapter 5 Analysis of Genetic Variation in European Cattle
5.1 The origin of European cattle............................................ 191
5.2 Genetic analysis of European cattle ................................... 1935.3 Discussion......................................................................... 204
Chapter 6 Analysis of Gene Flow in African Cattle
6.1 The history of domesticated cattle in Africa ...................... 2076.2 The genetics of admixture and gene flow........................... 2096.3 Estimation of population admixture in cattle ..................... 2116.4 Hybrid composition of individual animals......................... 2246.5 Discussion......................................................................... 229
Chapter 7 General Discussion and Conclusions
7.1 General discussion............................................................. 2347.2 Conclusions....................................................................... 250
Literature cited ............................................................................. 258
Figures
Chapter 1
Fig. 1.1: Wild and domesticated species within the Bovini group................................ 6Fig. 1.2: Distribution of the three aurochs subspecies circa 12,000 BP........................ 8Fig. 1.3: Postulated migratory routes of cattle across Asia, Africa and Europe........... 16Fig. 1.4: Distribution of extant cattle types in Asia, Africa and Europe...................... 17Fig. 1.5: A typical (dC-dA)n dinucleotide microsatellite region ................................. 24Fig. 1.5: Model for slippage within a simple sequence region.................................... 27
Chapter 2
Fig. 2.1: Photographs of typical breeds of European, African and Asian cattle.......... 33Fig. 2.2: Approximate geographic origins of European breeds sampled.................... 35Fig. 2.3: Approximate geographic origins of African and Asian breeds sampled....... 44Fig. 2.4: Annual precipitation in the West African region.......................................... 49Fig. 2.5: Regions of Africa infested with species of Glossina (tsetse flies)................... 50Fig. 2.6: Approximate geographic origins of cattle breeds found in West Africa ....... 51Fig. 2.7: Geographic origins of cattle populations sampled in West Africa ................ 55
Chapter 3
Fig. 3.1: Surface plot of allele frequency error versus observed allele frequency and sample size................................................... 58
Fig. 3.2: Surface plot of genetic distance (FST1) standard errorversus sample size and number of loci scored.............................................. 60
Chapter 4
Fig. 4.1: Scanned photograph and schematic of an autoradiogramshowing HBB microsatellite amplified in a range of animals........................ 88
Fig. 4.2: Scanned photograph and schematic of an autoradiogramshowing ILSTS005 microsatellite amplified in a range of animals............... 88
Fig. 4.3: Scanned photograph and schematic of an autoradiogramshowing TGLA116 microsatellite amplified in a range of animals............... 89
Fig. 4.4: Scanned photograph and schematic of an autoradiogramshowing ETH225 microsatellite amplified in a range of animals.................. 89
Fig. 4.6: The stepwise mutation model ...................................................................... 113Fig. 4.7: N-J tree summarising DA distances among the 20 cattle populations............ 125Fig. 4.8: N-J tree with DA distances among the 12 non-admixed populations ............ 127Fig. 4.9: N-J tree with DSW distances among the 12 non-admixed populations .......... 128Fig. 4.10: N-J tree with DSW distances among the 12 non-admixed populations
and three related species.............................................................................. 129
Fig. 4.11: N-J dendrogram summarising DASM for 90 individual animalsfrom 12 breeds of cattle and three related species........................................ 133
Fig. 4.12: N-J dendrogram summarising DSWASM for 90 individual animalsfrom 12 breeds of cattle and three related species........................................ 135
Fig. 4.13: Principal components of transformed allele frequencies.............................. 140Fig. 4.14: Principal components of kinship coefficients............................................... 141
Chapter 5
Fig. 5.1: N-J dendrogram summarising DASM for 286 individual animalsfrom seven European and three Indian breeds............................................. 200
Fig. 5.2: PCs of transformed allele frequencies in Europe.......................................... 202Fig. 5.3: PCs of allele distributions for individual animals.......................................... 203
Chapter 6
Fig. 6.1: Allele frequency spectra for ILSTS001 microsatellite.................................. 213Fig. 6.2: Regression of zebu allele frequencies in Maure cattle.................................. 216Fig. 6.3a-c: Introgression of various genomic systems in African cattle.......................... 221Fig. 6.4: Genetic introgression of zebu-specific alleles in West African cattle............. 226Fig. 6.5: Genetic introgression of N’Dama-specific alleles in West African cattle....... 227Fig. 6.6: Schematic illustrating zebu genomic introgression ...................................... 230
Chapter 7
Fig. 7.1: Schematic showing cattle phylogeny and admixture.................................... 237Fig. 7.2: A Harappan seal showing an image of a zebu bull....................................... 240Fig. 7.3: Mismatch analysis of 370 bp cattle mtDNA sequences................................. 243Fig. 7.4a-b:Domesticated cattle in African Neolithic art................................................. 245Fig. 7.5: Comparison curves for various genetic distances
and mtDNA 370 bp D-loop region sequence divergence............................. 253
Tables
Chapter 3
Table 3.1: Sources of samples taken from seven European breeds.................. 64-65Table 3.2: Sources of samples taken from three Asian breeds......................... 66Table 3.3: Sources of samples taken from two East African breeds................. 67Table 3.4: Sources of samples taken from two West African (Nigeria) breeds. 68Table 3.5: Sources of samples taken in West Africa........................................ 69-71Table 3.6: Microsatellite loci used to assay genetic variation in the cattle surveyed 77-78Table 3.7: Microsatellite loci tested but not used for total genetic survey......... 79
Chapter 4
Table 4.1: Number of alleles observed by population,biogeographical grouping and locus ............................................. 91
Table 4.2a-d: Observed heterozygosities and gene diversities............................... 96-99
Table 4.3: Summary of the three tests for HWE proportionsfor all locus/population combinations............................................ 102
Table 4.4: Pairwise gametic disequilibrium analysis by breed......................... 105
Table 4.5: Matrix of all pairwise combinations of loci showinggametic disequilibrium P-values condensed across breeds.............. 107
Table 4.6: Estimators of genetic subdivision for the 20 loci............................ 109
Table 4.7a-c: Observed allelic spectra data with SMM and IAM expectations....... 117-120
Chapter 5
Table 5.1: Estimators of genetic subdivision in European cattle...................... 193Table 5.2: Average gene flow per generation (Nem)
for various European cattle groupings............................................ 196
Table 5.3: Breed assignment from 100 simulated genotypes........................... 198
Chapter 6
Table 6.1: Zebu-diagnostic allele frequencies in four groups.......................... 212Table 6.2: Genetic introgression in African cattle populations........................ 220Table 6.3: N’Dama-diagnostic allele frequencies in four groups.................... 225
Acknowledgements
This thesis is dedicated to my parents Derek and Sheelagh, whose constant supportand encouragement made this possible.
This thesis, more than most required the assistance, advice and expertise of manydifferent people, within the Genetics department and also in many far-flung regions aroundthe world. This assistance has ranged from chasing cattle around forests and corrals in WestAfrica, obtaining molecular biology supplies in the middle of Sudan to help withunderstanding the subtleties of the stepwise model of neutral mutation. These people are toonumerous to mention, however I am nonetheless, very grateful. There are however a numberof people who I am indebted to and would like to acknowledge.
First and foremost, Dan Bradley. His friendship, enthusiasm, support, scientificinsight and infinite patience contributed immensely to my research and ensured that Icompleted my thesis. Paddy Cunningham, for giving me the opportunity to participate in avery interesting project, for always being enthusiastic, helpful and supportive, and in particularfor making me realise that cattle are not just walking cheeseburgers! Ronan Loftus became avery good friend through our work together, sometimes in very difficult situations. He wasalways resourceful and his diplomacy and sense of humour got us out of a number of tightscrapes. I think I learned more from Ronan about how to get things done than anyone else Iknow.
The expert assistance, hospitality and friendship of Mark Shriver was particularlyimportant when I finished my laboratory work. Even though I only worked with him for fewweeks, I don’t think I would have been able to produce this thesis in its present form withouthis comprehensive theoretical knowledge. There are a number of other people I am gratefulto for help with theoretical and computational aspects of the project. These are Paul Sharp,Andrew Lloyd, Ken Wolfe and various INCBIers over the years. One person in particular whohelped me immensely was Garret Taylor. He wrote an innovative computer program toproduce some of the technicolour phylogenetic trees in this thesis.
A special thanks to Dave Sullivan, Louis and Paul. Our project demanded a greatdeal of their time. However, they always got their own back on the football pitch. Thanks toTommy Dunne also. Not only is he the greatest football manager since Bill Shankly, he alsoproduced immaculate photocopies of this thesis in record time. Two other people I would liketo thank are Ciaran Meghen and Chris Troy (the second generation of bovine boys). Theyhelped with some sample collection and Chris contributed some of his results from his fourth-year project to data on the Kerry breed (and no, I will never don a wetsuit).
Our collaborators in other parts of the world include; John Norris, the Irish ForeignAffairs representative in Sudan (without whom, we would have no Sudanese samples), Dr. V.J.Shankar in India, Drs. Rizgalla and Badi in Sudan, Dr. Ngere in Nigeria. In particular, I wouldlike to thank Dr. Racine Sow in Senegal for his hospitality and help in scouring the Sahara forthe last remnants of the Maure breed.
Particular thanks to Sarah for having to put up with me while I was writing this s❃✞✗.For existential, extracurricular and extraneous assistance and succour I would like to thankmy brother Evan, Ross McManus, Mark Lawlor, Charlie Spillane, Simon and Eleanor Lunt,David Gallagher, John King, Paul McElroy, David Kendrick, Karl Coffey, Myles Devlin,Peader Ryan and anyone else who knows me and had to suffer boring tales of big cow huntingin Africa.
In memory of my grandfather who can now finally call me Doctor
Abbreviations
AI Artificial inseminationbp Before present (uncalibrated radiocarbon date)BP Before present (calibrated radiocarbon date)bp base pairs (nucleotides)BIT British Isles taurineCET Continental Europe taurineDA Modified Cavalli-Sforza genetic distanceDASM Allele-sharing genetic distanced.f. Degrees of freedomD-loop Displacement loopDS Nei’s standard genetic distanceDSW Stepwise-weighted genetic distanceDSWASM Stepwise allele-sharing genetic distanceDTT DithiothreitolEAZ East African zebuEDTA Ethylenediaminetetra-acetic acidFST Standardised variance in allele frequencies among populationsGST Coefficient of gene differentiationHWE Hardy-Weinberg equilibriumIAM Infinite alleles model of neutral mutationkb kilobase pairsMHC Major histocompatibility complexmtDNA Mitochondrial DNAMya Million years agoNe Effective population sizeNIZ North Indian zebuOTU Operational taxonomic unitPCR Polymerase chain reactionRAPD Random amplified polymorphic DNARFLP Restriction fragment length polymorphismSDS Sodium dodecyl sulphateSMM Stepwise mutation modelSTR Simple tandem repeat
Tris Trizma® base
VNTR Variable number of tandem repeatWAT West African taurineWAZ West African zebu
Summary
DNA samples were taken from 728 cattle representing 20 populations from Europe,
Africa and India. These populations included seven breeds of European Bos taurus taurine
cattle, five populations of West African N’Dama Bos taurus taurine cattle, five breeds of East
and West African Bos indicus zebu cattle and three breeds of Indian Bos indicus zebu cattle.
In addition, a small number of samples were taken from three related species. These were
banteng (Bos [Bibos] banteng), American bison (Bison bison) and European bison (Bison
bonasus). These samples were assessed for genetic variation using 20 different polymorphic
microsatellite DNA loci. A wide range of genetic analyses were then performed on the
resultant data.
A high level of genetic variation was observed. In total, 168 individual length variant
alleles were observed across all loci in the 728 cattle. The heterozygosity averaged over all
loci in the total sample was 0.551±0.004. Among the continental groups, the four taurine
breeds from the British Isles displayed the least genetic variation, both in terms of allelic
diversity and heterozygosity. Conversely, the five African zebu breeds displayed the highest
genetic variation. Ten of the 20 microsatellite loci displayed discrete length variants which
were observed at high frequency in Indian zebu breeds and at intermediate frequencies in
African zebu breeds. These alleles were either absent or present at low frequency in African
and European taurine populations.
Phylogenetic analysis indicated that the Bos taurus and Bos indicus clades diverged at
least 600,000 years ago. This is in good agreement with previous analyses of mitochondrial
sequence variation in cattle and provides strong evidence that the two types of cattle were
domesticated independently by two separate Neolithic cultures. Supplementary multivariate
statistical analyses confirmed this pattern, highlighting the distinction between taurine and
zebu populations.
The unusual population structure of modern European cattle breeds was evident when
they were considered separately for a number of different analyses. In particular, the
homogeneous structure of certain breeds was reflected in phylogenetic analysis of individual
animals. Simulation studies of breed designation using observed microsatellite allele
frequencies also supported this finding.
The historical introgression of Asian zebu cattle into African taurine populations was
investigated using the distribution of microsatellite alleles in African and Indian populations.
When the results of these analyses were considered in conjunction with previous studies of
mitochondrial and Y-chromosomal variation, a remarkable pattern of male-mediated gene
flow was observed. Also, the extent of zebu admixture was found to vary significantly among
different populations of valuable disease-tolerant N’Dama cattle.
1.1 Outline of research project
The primary goal of the work described in this thesis is to elucidate and clarify the
genetic relationships among the major types of domesticated cattle in Africa, Europe and the
Indian subcontinent. In particular, the genetic divergence between humpless taurine cattle
(Bos taurus) and humped zebu cattle (Bos indicus) will be considered. Genetic data can
contribute to an understanding of the evolutionary history of domesticated cattle and also
provides a conceptual framework within which this history can be reconstructed. A secondary
aim of the research is to characterise the genetic introgression or gene flow taking place
between zebu cattle of Asian origin and valuable indigenous disease-tolerant populations of
taurine cattle in Africa.
DNA samples were taken from 20 cattle populations, ten from Africa, seven from
Europe and three from the Indian subcontinent. In addition, a small number of DNA samples
were obtained from three other related species, the American bison (Bison bison); the
European bison (Bison bonasus) and the banteng (Bos [Bibos] banteng). Simple sequence
DNA motifs known as microsatellites were chosen as genetic markers to investigate the genetic
structure and phylogenetic relationships among the 20 cattle populations and the three related
species sampled. These short repetitive DNA sequences display length polymorphism which
segregates in a discrete Mendelian fashion among individual organisms. The distribution and
patterns of variation at these genetic loci therefore reflects genealogical associations and
ultimately phylogenetic affinities between related populations and taxa.
It was hoped that analysis of microsatellite variation in these populations would reveal
fundamental aspects of the evolution of the nuclear genome in domesticated cattle. For
example, clarification of the chronology and events surrounding the domestication of cattle in
the early Neolithic period (circa 10,000-8,000 BP). A survey of DNA sequence variation in the
bovine mitochondrial genome carried out in tandem with the research described here has
indicated that there were at least two foci of cattle domestication in Asia and possibly a third
independent domestication event in Africa (LOFTUS et al., 1994a; 1994b; BRADLEY et al.,
1996). Analysis of nuclear DNA polymorphisms would be expected to provide additional, but
complimentary data in this regard.
The project should also provide useful information concerning the levels of genetic
variation in cattle populations subject to vastly different ecological and economic milieus.
These environments range from the highly intensive production systems inherent to the
development of modern European breeds, to the traditional production conditions associated
with native cattle populations in Africa.
Analysis of genetic variation in domesticated cattle should also inform on the
substantial hybrid vigour o r heterosis observed in reproductive crosses between taurine and
1
z e b u c a t t l e . T h e genetic distance or phylogenetic affinities among distantly related
populations is thought to correlate with the level of heterosis observed between related
interfertile taxa. Population genetic analysis may therefore provide a predictive model for
future investigations of heterosis between divergent cattle breeds.
The pattern of nuclear genetic variation assayed through studies of microsatellite
polymorphisms should also contribute to an understanding of the biological, environmental
and sociological forces underlying the genetic erosion taking place in indigenous populations
of taurine cattle in West Africa. These cattle populations possess a unique, genetically
inherited tolerance to the symptoms of trypanosomiasis, a wasting disease caused by flagellate
protozoans of the genus Trypanosoma and transmitted by tsetse flies (Glossina sp.). This
disease imposes a severe constraint on cattle husbandry on vast tracts of high quality
agricultural land over much of Africa. Trypanotolerant taurine populations therefore
represent a valuable genetic resource and should be preserved as distinct genetic entities which
may contribute to future agricultural development in sub-Saharan Africa. These breeds are
currently under threat from genetic absorption and displacement by zebu populations
migrating from the increasingly arid northern regions and indiscriminate crossbreeding has
become a common demographic feature of cattle populations across a range of West African
countries.
Surveys of microsatellite variation should provide a rational genetically-based
description of cattle populations in West Africa and may also provide the tools to quantify and
characterise the genetic threat posed by the introgression of zebu genomes into taurine
populations.
2
1.2 Cattle domestication
Domestication: a revolutionary advance in human-animal interactions
“The essence of domestication is the capture and taming by man of animals of aspecies with particular behavioural characteristics, their removal from theirnatural living area and breeding community, and their maintenance undercontrolled breeding conditions for mutual benefit.” S. BÖKÖNYI (1989).
Plant and animal domestication are justifiably considered to be major human cultural
innovations which rank in importance with the manufacture of tools, the conquest of fire or
the development of language. Homo sapiens is not alone in subverting the biological status of
another species through a process of domestication. Certain ant species maintain fungus
“gardens” as a source of food, while other ant species exploit aphids in a semi-symbiotic
interaction in which the ant colony gains honeydew and the aphids gain protection from other
insect predators. However, the domestication of plants or animals by ancient human
populations is unique in many respects because it required conscious planning and an
understanding of the behaviour and reproductive biology of another species.
The period of time over which the majority of humanity changed from a hunter-
gatherer existence to a sedentary agricultural lifestyle has been termed the Neolithic transition
or more dramatically, the Neolithic revolution. This change in human subsistence set in
motion the train of events which eventually led to modern technological civilisation.
The historical events and processes surrounding animal domestication have
continually fascinated scientists from many disciplines and numerous theories have been
proposed to account for this fundamental change in human-animal interaction. However,
most serious workers in the area would agree that the first steps towards domestication of
animals took place in southwest Asia in the region encompassed by the Fertile Crescent, a
broad arc running from Jordan in the southwest to the Zagros mountains in present-day Iran.
Many commentators have attributed animal domestication to humankind’s ingenuity
and assert that it occurred in a coordinated and premeditated fashion (ISAAC, 1962). Other
workers have argued that it was a natural consequence of the ecological and human
demographic transitions which took place at the end of the last glaciation approximately
12,000 BP. These ideas include CHILDE’ s oasis or propinquity theory which contends that the
encroaching desert in southwest Asia resulted in humans and animals competing for water
resources and that this ecological pressure fundamentally altered their interrelationship and
eventually led to animal domestication (CHILDE , 1952). Another approach to the problem of
the origins of domestication and agriculture was taken by BINFORD (1972, [cited WENKE,
1990]). His edge-zone hypothesis is based on culture as an adaptive device. He assumed that
as human populations expanded in the Fertile Crescent, different groups impinged on each
3
other, encouraging the development of novel systems for more efficient resource-utilisation,
i.e. plant and animal domestication.
Although there is still no clear consensus concerning the precise changes in human
behaviour and ecology which gave rise to sedentary agriculture and animal husbandry, the
evidence is overwhelming that the primary trigger was climatic. Recent evidence has
confirmed that the 12 millennia since the end of the last glaciation have been the most stable
climatically since the appearance of modern humans (GREENLAND ICE-CORE PROJECT (GRIP)
MEMBERS , 1993). It has therefore been suggested that this particular stage in human evolution
may have been the only time in human history when settled agriculture could have developed
(WHITE , 1993). Human behavioural, intellectual and communication capabilities were
probably pre-attuned to agricultural innovation for tens of thousands of years prior to the
Holocene period. However, it was only in the post-glacial period that a new ecological
interaction became possible when, for the first time in almost 100,000 years, the climatic
conditions in key regions became favourable. This contention is supported by the
independent, and almost simultaneous emergence of agricultural civilisations in southwest
Asia, southeast Asia, central America and South America (WENKE , 1990).
A primary difficulty which archaeologists and zooarchaeologists face when assessing
chronological evidence for animal domestication is distinguishing between wild and
domesticated animal forms. However, there are established criteria for determining the status
of animal remains at an archaeological site; whether they were domesticated and also if they
were originally domesticated locally. These have been discussed by BÖKÖNYI (1969),
summarised by MEADOW (1989) and are as follows:
Evidence for animal-keeping in a prehistoric settlement:
(1) the proportion of age groups of a domesticable species is not the same asfound in the wild population;
(2) the proportions of the sexes of a domesticable species is not the same as foundnormally in the wild population;
(3) domesticated species appear which have no wild ancestors in that particularregion, at least since the Pleistocene;
(4) morphological changes appear in domesticated animals;
(5) there are artistic representations of domesticated animals;
(6) there are objects associated with animal husbandry.
Evidence for local domestication in faunal remains at a site:
(1) remains of both wild and domesticated forms on the site;
(2) the existence of transitional forms between the wild ancestor and thedomesticated animal;
(3) temporal changes in the proportions of age and sex groups in the wild form;
(4) representations of scenes of capture.
4
The oldest evidence for animal domestication appears in archaeological sites of the
Natufian period, a Mesolithic culture of the Levant (circa 12,000-10,000 BP) (ISAAC, 1962;
MEADOW, 1989). During this period a symbiotic relationship between humans and the wolf
(Canis lupus) developed which gave rise to the domesticated dog (Canis familiaris). The
earliest site where skeletal material from domesticated dogs has been recovered is at the Upper
Palaeolithic cave of Palegawra in present-day Iraq which dates to approximately 12,000 BP
(WHITEHOUSE , 1983). The next stage in the Neolithic transition was a marked change in the
dominant food source of certain ancient Middle Eastern Neolithic cultures from a reliance on
gazelle and deer to ovicaprids (sheep and goats). This can be detected as faunal shifts which
occurred in the Middle East between 10,000-8,000 BP (DAVIS, 1982). After this period sheep
and goat remains became the most common faunal remains at the majority of ancient human
settlements in southwest Asia.
The last of the major domesticated species in southwest Asia to be domesticated were
cattle and pigs. This seems to have taken place during the 9th millennium BP in a number of
ancient human settlements scattered across the Middle East and the Levant (DAVIS , 1982). The
domestication of wild cattle is discussed in more detail in a later section.
Classification of cattle and related species
Domesticated cattle belong to the Bovidae family within the order Artiodactyala or
even-toed ungulates which also includes groups such as the antelopes, sheep and goats. The
Bovidae first appeared in the Miocene (circa 20 Mya) and underwent a rapid radiation which
is considered to have been unparalleled in other large mammals (GATESY et al., 1992). This
may have been caused by the first appearance of large grassland ecological niches during the
Miocene epoch.
The systematic classification of bovids has not been satisfactorily resolved due to the
rapid cladogenesis of the group, convergent evolution and also debatable monophyly for the
family as a whole. The most useful diagnostic feature of bovids are the presence of non-
deciduous horn cores and horn sheaths which, it is argued, naturally distinguish them as a
separate monophyletic clade. Molecular evidence however, would suggest that the Bovidae
may actually be paraphyletic in origin (MIYAMOTO & GOODMAN , 1986; KRAUS & MIYAMOTO,
1991, GATESY et al., 1992).
Domesticated cattle are members of the Bovini tribe within the Bovidae family. Other
members of the Bovini tribe include the Bison (Bison bison), the European Bison or Wisent
(Bison bonasus), the Banteng (Bos [Bibos] banteng), the Gaur (Bos [Bibos] gaurus), the Yak
(Pöephagus mutus) and the Kouprey (Bos [Bibos] sauveli). There are two recognised forms
of domesticated cattle, the humpless taurine cattle of Europe, West Africa and northern Asia,
5
(Bos taurus) and the humped zebu cattle of southern Asia and Africa (Bos indicus).1
Attempts to classify the Bovini tribe have also been beset by the problems of rapid
radiation and parallel evolution. Bison and Bos have been considered separate genera on the
basis of craniological evidence and other morphological characteristics (EPSTEIN , 1971).
Recent evidence from allozyme studies and mitochondrial DNA sequence analysis would place
Bison and Pöephagus as subgenera of Bos along with the Bibos species (HARTL et al., 1988;
MIYAMOTO & BOYLE, 1989; MIYAMOTO et al., 1989). The fact that all the members of the
Bovini are interfertile to varying degrees would also argue for congeneric status (BAKER &
MANWELL, 1991). Figure 1.1 shows a classification scheme for the various members of the
Bovini based on classical morphological grounds and also on more recent molecular studies.
Figure 1.1: Wild and domesticated species within the Bovini group
Bos primigenius aurochs (extinct)
Bos [Bibos] banteng(wild banteng)
Bos [Bibos] gaurus(wild gaur)
Bos [Bibos] sauveli(kouprey)
Pöephagus mutus (yak)
Bison bison (American bison)
Bison bonasus (European bison)
Bos
Pöephagus
Bison
Bovini
Bos taurustaurine breeds
Bos indicus zebu breeds
Bos [Bibos] banteng(Bali cattle)
Bos [Bibos] frontalis(Mithan cattle)
Pöephagus grunniens(domesticated yak)
Group Genus Domesticatedspecies
Wild species
Fig. 1.1: The lineage leading to domesticated cattle is shown in black
6
1 Although domesticated banteng (Bali cattle) and domesticated gaur (Mithan) are usuallytermed cattle in common parlance, the term “cattle” in this thesis will always refer to Bos taurus,Bos indicus and their hybrids.
It is universally accepted that the wild ancestor of all extant domesticated cattle was
the extinct aurochs, Bos primigenius (ZEUNER , 1963a; GRIGSON, 1978; 1980; EPSTEIN &
MASON , 1984; PAYNE, 1991). The aurochs is thought to have evolved in Asia from a Pliocene
ancestor Bos acutifrons (PILGRIM , 1947). This aurochs spread from Asia, west into Europe and
south into North Africa. The aurochs had an extremely large geographic range and fossil
remains have been found in sites as distant as Britain and China. The large spatial range of
Bos primigenius inevitably gave rise to distinct geographical subspecies or races.
Currently it is recognised that there were at least three aurochs subspecies. There was
a northern Eurasian subspecies which is termed Bos primigenius primigenius, a North African
subspecies, Bos primigenius opisthonomous and a southern Asiatic subspecies called Bos
primigenius namadicus (PAYNE, 1970; EPSTEIN & MASON , 1984). Both the African and
southern Asiatic species are though to have become extinct approximately 2,000 years ago,
while the European aurochs is thought to have survived into the 17th century in a Polish game
reserve. Figure 1.2 shows approximate geographical distributions of the three aurochs
subspecies during the Upper Palaeolithic about 12,000 BP.
There has been considerable discussion regarding the actual taxonomic status of the
different aurochs races. Based on detailed craniometric analysis, GRIGSON (1980) has
proposed that Bos primigenius namadicus a n d Bos primigenius primigenius should be
classified as separate species. EPSTEIN & MASON (1984) disputed this proposal, claiming that
the distinction between races is not particularly clear-cut, being based on body size and horn
shape (both of which can be affected by environmental influences). This view is also shared
by ZEUNER (1963a) and PAYNE (1991) who argue that geographical range is the basis of the
classification and not biological taxonomic status.
7
Bos primigenius primigenius
Bos primigenius opisthonomus
Bos primigenius namadicus
Figure 1.2: Distribution of the three aurochs subspecies circa 12,000 BP.
Fig. 1.2: The Euroasian aurochs (Bos primigenius primigenius) is shown in yellow. The southern Asiatic aurochs (Bos primigenius namadicus) is shown in red. The North African aurochs (Bos primigenius opisthonomous) is shown in green. These distributions are modified from PAYNE (1970) and are very approximate.
8
From all contemporary accounts and artistic impressions, it is obvious that the
aurochs was a difficult and perilous animal to hunt and attempts to domesticate them were
probably fraught with danger. Julius Caesar wrote about wild aurochs: “It is not possible to
accustom the Uri to men or to tame them, not even though they be caught young. In size they
are a trifle smaller than elephants; in kind, colour and shape they are bulls. Great is their
strength and great is their speed.” This description may partly explain why the aurochs was
the last major ruminant species to be domesticated by Neolithic communities.
As stated previously, there are two major groups of domesticated cattle, humpless
taurine and humped zebu cattle. There are a number of possibilities concerning the origin of
the word zebu . It may derive from the Tibetan zea o r zeba which both mean camel hump.
Alternatively, it may originate from gebo o r geba, the Portuguese for humped. In the first
systematic classification, Linnaeus originally considered humped and humpless cattle to be
separate species, Bos taurus and Bos indicus. This classification has been the subject of intense
debate for a great many years. Most authorities contend that, because they are completely
cross-fertile and display a cline in both morphological and molecular variation, they should be
considered merely geographical variants of the same species (EPSTEIN , 1971; EPSTEIN &
MASON , 1984; PAYNE; 1991). A different opinion was evident amongst some zoologists and
geneticists who asserted that the differences observed, both in morphology and in the
frequencies of certain allozyme variants support specific status for each of the two types (NAIK,
1978; MANWELL & BAKER , 1980; BAKER & MANWELL, 1991). This issue has not been
satisfactorily resolved and is one area where molecular genetic analysis of DNA variation can
make a substantial contribution.
The morphological and physiological differences observed between zebu and taurine
cattle reflect adaptation to markedly different environments. Bos indicus cattle generally
inhabit the hot arid or semi-arid regions of Asia and Africa. Bos taurus cattle on the other
hand, are usually confined to temperate zones with higher levels of rainfall and denser
vegetation. Zebu cattle differ from taurine cattle in a number of significant aspects; they
possess a hump, either in a thoracic (1st to 9th thoracic vertebrae) or cervico-thoracic (6th
cervical to the 5th thoracic vertebrae) position, a pendulous dewlap and a navel flap. The
function of the hump is unknown and because of its composition (a mixture of muscle,
connective tissue and fat), it is unlikely to serve as a water storage device. Zebu cattle also have
a lower basal metabolic rate, lower water requirements, larger and more active sweat glands and
are generally more resistant to ticks and intestinal parasites than taurine animals (EPSTEIN ,
1971; TURTON , 1991). In addition they display subtle differences in behaviour from taurine
animals. They produce different vocal sounds from taurine cattle and also possess a much
stronger herd instinct. Taurine cattle will tend to disperse when placed in a field. Zebu cattle
will usually remain in a herd formation when they are placed in an open space.
9
The origins of domesticated cattle
Archaeologists and prehistorians have been trying to reconstruct the events
surrounding cattle domestication for the past century. The scarcity of early faunal material
and the wide range of phenotypic variability displayed by extant cattle populations has
confounded the issue and the subject remains highly contentious. Consequently, various
theories have been proposed, offering alternative spatial and chronological models for the
origin and spread of domesticated cattle. KOLESNIK (1936, [cited PAYNE, 1991]) proposed a
multi-regional model which suggested that domesticated cattle emerged from a number of
domestication centres located throughout the Old World, specifically in western and central
Asia, northeast India, the Levant, and central Europe. REED (1977), on the basis of aceramic
artistic representations, contended that cattle were first domesticated in the southern Balkans
approximately 8,000 BP.
The earliest documented evidence for cattle domestication comes from Çatal Hüyük,
a very large Neolithic site located in Anatolia in present-day Turkey. The lowest levels of this
site (dated to approximately 8,400 bp) show some evidence for domestic manipulation.
However, the first clear size diminution occurs further up the sequence (circa 7,800 bp)
(PERKINS , 1969). Domestication of cattle does not seem to be have been a localised
phenomenon at this time as other sites show evidence for domesticated cattle almost as early as
Çatal Hüyük (WHITEHOUSE , 1983). These include Nea Nikomedeia in Macedonia, Argissa in
Thessaly and Knossos in Crete. Most authorities however, consider that the first steps towards
cattle domestication were taken in southwest Asia. This interpretation is supported by evidence
from faunal remains, artistic representations and temporal shifts in faunal distributions at
archaeological sites (EPSTEIN & MASON, 1984).
The events subsequent to original domestication events are still the subject of an
intense and sometimes acrimonious debate and two major schools of thought have emerged.
The first argues that the progenitors of Bos indicus cattle were a local adaptation of pre-
domesticated Bos taurus cattle (EPSTEIN , 1971; EPSTEIN & MASON , 1984; PAYNE, 1991). An
alternative explanation is that Bos indicus cattle were domesticated independently and
separately, probably somewhere on the Indian subcontinent (ZEUNER , 1963b; GRIGSON, 1980;
MEADOW, 1984; 1993). EPSTEIN & MASON conclude that Bos taurus cattle are modified forms
of the Asiatic aurochs (Bos primigenius namadicus) resulting from domestication by Neolithic
farmers in the Middle East approximately 8,000 years ago. These animals were originally
longhorned and subsequently spread to many parts of the world in conjunction with
migrations by human groups such as the Vedic Aryans, Semitic, Hamitic and the Ural-Altaic
peoples. They reason that both shorthorn and zebu cattle were subsequent modifications of
the original domesticated stock which occurred in response to changing ecological and
economic pressures. A critical element of the EPSTEIN -MASON single-origin theory is the idea
10
that the zebu hump is a morphological feature which was developed by humans as an aesthetic
device, perhaps with some religious or economic significance.
In support of their single-origin theory, EPSTEIN & MASON (1984) cite archaeological
evidence found in Mesopotamia which depicts zebu cattle. This find purportedly predates any
finds from the Indian subcontinent. Also, ceramic artistic representations from the early
Harappan civilisations at Mohenjo-Daro and Harappa (circa 4,500 BP) show both humped
zebu and humpless taurine cattle. EPSTEIN & MASON therefore argue that humped cattle were
developed from longhorn taurine cattle about 6,000 years ago by early cattle husbanders on
the semi-arid steppe on the eastern fringe of the Great Salt desert in present-day Iran. These
cattle and their herders subsequently migrated to the Indus valley civilisations where zebu
cattle became the predominant type of cattle because of their superior adaptation to the arid
conditions found on the subcontinent. Figure 1.3 at the end of this section shows a
diagrammatic representation of the EPSTEIN -MASON model for the origin and subsequent
dispersion of domesticated cattle from southwest Asia.
The opposing school of thought which contends that humped zebu cattle were
developed from a different wild ancestor is generally supported by archaeologists,
archaeozoologists and geneticists. GRIGSON (1978; 1980) considers that the considerable
differences in craniometric and other osteological measurements can only be explained by
separate domestications from two quite distinct groups of aurochses. She suggests that Bos
taurus was originally derived from the northern Eurasian aurochs (Bos primigenius
primigenius) and that the southern Asian aurochs (Bos primigenius namadicus) provided the
progenitor for Bos indicus cattle. In support of this theory she provides convincing evidence
that the osteological measurements of extant taurine cattle are more similar to comparable data
from fossil B. p. primigenius remains and that the same measurements from modern zebu
cattle are more similar to B. p. namadicus fossils.
Archaeological evidence from an early Neolithic site at Mehrgarh in Baluchistan,
southern Pakistan provides strong evidence that zebu cattle were domesticated independently
from Bos primigenius namadicus populations (MEADOW, 1984; 1993). Evidence also exists
from other regions in India. ALLCHIN (1969) studied ancient ash mounds (dumping sites for
carbonised cattle dung used as fuel which often contain faunal remains), and concluded that
late Palaeolithic hunter-gatherers may have domesticated cattle in various sites scattered
throughout India. The archaeological evidence for cattle domestication on the Indian
subcontinent is discussed more thoroughly in section 7.1.
There is a large body of genetic data which lends support to a dual-domestication
theory. This work ranges from allozyme and blood-group studies carried out in the 1960’s
and 1970’s to more recent DNA-based molecular surveys (MANWELL & BAKER , 1980; BAKER
& MANWELL, 1991; LOFTUS et al., 1994a; 1994b; BRADLEY et al., 1994; 1996). This work is
11
discussed in more detail in section 1.2.
Whatever the initial origins of the various types of domesticated cattle, it is very clear
from archaeological data that many local varieties existed at an early stage. A good
illustration of this is the widespread representation of many different types of cattle in the art
of ancient Egypt. A wall painting dating from the 18th dynasty (circa 3,350 BP) from Thebes
entitled Inspecting the Cattle at Nebamen, depicts a wide variety of cattle types with a range of
different colourations and morphologies (GRIGSON , 1991). A consistent theme which has been
noted by many authors was the gradual appearance and eventual predominance of populations
of shorthorn cattle. These cattle were the result of gradual size diminution and a reduction in
horn length. The word “shorthorn” is a literal translation of the Greek brachyceros which
was first used to describe the shorthorn cranial conformation. This was later revised to Bos
primigenius longifrons which in the view of many workers, became a subspecific designation
in its own right (EPSTEIN , 1971; EPSTEIN & MASON , 1984).
The earliest records of shorthorn cattle are encountered in Mesopotamia, where they
began to replace the longhorn populations approximately 5,000 BP. Shorthorn cows with their
calves at foot are depicted in a milking scene on an early dynastic mosaic frieze in a temple at
al-’Ubaid in the ancient city of Ur and which dates to approximately 4,850 BP (EPSTEIN &
MASON , 1984). Although shorthorn cattle undoubtedly dispersed from the Mesopotamian
region into other regions of Asia, Africa and Europe, some workers think that shorthorn cattle
were developed independently from many different longhorn populations in a range of
different locales and that the name Bos primigenius longifrons is perhaps a systematic
misnomer (GRIGSON, 1978). Cattle of a shorthorn type also appeared in Europe at an early
date during the fifth millennium BP, particularly in the Alpine region associated with Neolithic
lake dwellings. It is highly likely that these cattle were developed independently from
longhorn populations by Neolithic pastoralists in Europe.
Domesticated cattle spread with Neolithic farmers very rapidly during the millennia
after the initial Neolithic transition in southwest Asia. The wide-ranging migrations of Semitic,
Hamitic, Indo-European and Ural-Altaic pastoralists assisted in the effective dispersal of cattle
throughout the Old World. The Semitic peoples migrated throughout southwest Asia, the
Mediterranean coast and the Arabian Peninsula; the Hamitic peoples migrated into North, West
and East Africa and certain regions of southwest Asia. The Indo-Europeans migrated west
towards Europe and southwards into the Indian subcontinent. The Ural-Altaic tribes moved
north and east into central and northwest Asia. The extensive communication and trade links
among the nascent civilisations of the Euphrates, Nile and Indus river valleys would have also
contributed to the dispersal and intermingling of many different cattle types. Figure 1.3 (at
the end of this section) shows the standard EPSTEIN -MASON interpretation of the spread of
domesticated cattle throughout the Old World.
12
As mentioned previously, both taurine and zebu cattle may be found in the
archaeological record of the Harappan civilisation. However, the earlier Neolithic cultures of
Baluchistan at Mehrgarh near the Bolan river which predate the Harappan civilisation by more
than 3,000 years (JARRIGE & MEADOW, 1980), have revealed only faunal remains classified as
Bos indicus (MEADOW, 1984; 1993). There is also a clear faunal shift from large wild
progenitors to a smaller domesticated form (see section 7.1). This finding satisfies most of the
objections raised by EPSTEIN & MASON (1984) concerning the Indus Valley as the original
source of domesticated zebu cattle. The taurine cattle depicted in artifacts from Harappa and
Mohenjo-Daro were probably imported from the Euphrates civilisation across the Iranian
Plateau.
Whatever the origin of domesticated zebu, once established, they spread throughout
the Indian subcontinent very rapidly, probably assisted by their arid-adapted physiology
(PAYNE, 1991). During the last 4-5,000 years zebu have been the only type of cattle present
on the subcontinent. Due to the spread and influence of Hinduism, they also dispersed east to
Burma (Myanmar), Thailand, Malaysia and Vietnam, eventually forming the majority of the
cattle breeds in these regions.
It is widely believed that domesticated cattle entered Europe with pastoralists
migrating from southwest Asia. The migrations of these ancient peoples are still reflected in
the distribution of genetic variation among extant human populations (CAVALLI-SFORZA et al.,
1994). Within Europe there is considerable archaeological and historical evidence for the
introduction of domesticated cattle from this direction (EPSTEIN & MASON, 1984). It seems
likely however that southeast Europe was not the only entrance point for domesticated cattle.
Cattle may also have crossed the Straits of Gibraltar from North Africa and entered the Iberian
Peninsula (EPSTEIN , 1971).
Introductions of shorthorn cattle are thought to have occurred along similar routes to
their longhorn predecessors (see figure 1.3) , i.e., through southwest Asia and north Africa
(PAYNE, 1991). It is thought that shorthorn animals may have spread rapidly throughout
Europe at the expense of longhorn animals by virtue of their superior milk yields. Shorthorn
cattle were first introduced into the British Isles during the Bronze Age (4th millennium BP)
and became common by the Iron Age (3rd millennium BP). During this time the cattle of
northern and central Europe became even smaller, some animals barely reaching 100 cm at
the shoulder (EPSTEIN & MASON, 1984). It is though that during this period, the various
populations of Celtic shorthorn were developed. These ancestral landraces eventually gave rise
to modern populations such as the Irish Kerry and Welsh Black breeds.
The growing urban populations in Europe after the bubonic plague epidemic of the
14th century and later, during the Industrial Revolution necessitated an increase in milk and
meat production to cope with greater demand. This triggered a move towards more rational
13
breed description and eventually the formalisation of breed types and genealogies in
herdbook systems. During this time, intensive agricultural systems began to emerge
throughout Europe and many local cattle breeds and populations became endangered or
extinct (the origin of European cattle populations is discussed more thoroughly in section
5.1).
Domesticated taurine cattle are thought to have entered Africa in successive waves
from southwest Asia, in a similar fashion and at a similar time to the early cattle of Europe.
Populations of zebu cattle migrated into Africa at a later date from Arabia and the Indian
subcontinent. Although there was an indigenous African aurochs, Bos primigenius
opisthonomous, it is widely accepted that this subspecies was not domesticated independently
(EPSTEIN , 1971; EPSTEIN & MASON , 1984; PAYNE, 1991). There has been some speculation in
the literature however, that this native African aurochs actually formed or contributed to the
early domesticated populations on the continent (for reviews see GRIGSON, 1991; WENDORF &
SCHILD , 1994).
The first authenticated domesticated cattle in Africa appeared in the early civilisations
of the Nile Valley about 6,500 BP (EPSTEIN & MASON , 1984). These longhorn cattle dispersed
with Hamitic peoples south through present-day Sudan, west along the northern coastal region,
southwest into West Africa and also centrally through a much-reduced Saharan region (see
figure 1.3). Cave art from the Tassili and Tibesti highlands indicate that at this time cattle were
present in regions of the Sahara with practically no rainfall today (see section 7.1). The cattle
which entered West Africa evolved an inherited tolerance or resistance to trypanosomiasis (see
section 1.1) and were able to thrive in the southern forested regions. These longhorn cattle
eventually gave rise to the modern N’Dama breed.
In North Africa, shorthorn cattle began to replace the original longhorn populations
at approximately the same time as in southern and central Europe. They entered Egypt by
way of the Isthmus of Suez towards the middle of the 5th millennium BP. For a considerable
period, longhorn cattle prevailed over the shorthorn type. Gradually however, the shorthorn
populations increased in numbers as military successes of the Pharaohs in southwest Asia
brought new shorthorn herds back to the Nile Valley. Accordingly, during the Hyksos period
(circa 1700-1,580 BC), shorthorn cattle became the predominant type in North Africa
(EPSTEIN , 1971). Shorthorn cattle eventually dispersed throughout north, east and west Africa.
In West Africa, they also developed a tolerance to trypanosomiasis and were capable of
inhabiting forested regions with a high tsetse challenge (PAYNE, 1970).
The first zebu cattle to enter Africa are thought to have been cervico-thoracic
humped cattle which entered across the Isthmus of Suez and from Arabia into Somalia and
Ethiopia. These introductions are thought to have taken place during the 4th millennium BP
(PAYNE, 1970). These initial introductions did not have a significant impact on the native
14
taurine populations until local pastoralists realised the zebu’s innate physiological adaptations
to arid conditions. Thereafter, zebu migrants and taurine cattle were crossed to form
populations of sanga cattle. Internal African migrations such as those of the Bantu peoples
(circa 700 AD) and the Hottentots (circa 1,500 AD) were responsible for dispersals of sanga
cattle into southern and central African regions (EPSTEIN , 1971).
Thoracic-humped zebu cattle did not enter Africa in any great numbers until the
Islamic Arab conquests of 669 AD (HOURANI , 1991). Again, like their cervico-thoracic
predecessors, they were mainly imported through the Horn of Africa into Somalia and
Ethiopia. The newly imported zebu cattle began to displace sanga cattle due to their arid-
adapted physiology and also because they gave higher milk yields (PAYNE, 1991). Zebu cattle
continued to be introduced into Africa as long as Arab power was maintained in north and east
Africa. They were brought to West Africa along the Sahelian corridor between the Sahara
desert to the north and tsetse-infested forests to the south. They were crossed with local
taurine animals to form local intermediate populations such as the White Fulani of northern
Nigeria. They were unable to impinge on the taurine cattle deep within the West African
equatorial regions because they lacked the ability to withstand the effects of trypanosomiasis,
unlike the indigenous taurine cattle.
The spread of zebu cattle in east and southern Africa was facilitated by the
occurrence of periodic rinderpest epizootics in these regions. Taurine animals are much more
susceptible to this viral disease than zebu cattle and usually die when infected. The last major
rinderpest epizootic took place during the 1890’s and is thought to have wiped out as much as
80% of the cattle populations of East Africa (DENBOW & WILMSEN , 1986). The origins and
spread of the various types of cattle in Africa are discussed in more detail in sections 6.1 and
7.1.
Figure 1.3 (overleaf) illustrates the most widely accepted interpretation of the spread
of domesticated cattle in Asia, Africa and Europe. As mentioned earlier, this scenario has been
promulgated by one school of thought which believes that zebu cattle were developed
artificially from domesticated taurine animals (EPSTEIN , 1970; EPSTEIN & MASON, 1984; PAYNE,
1991). This model has been criticised previously (see GRIGSON , 1991) as not reflecting the
true archaeological evidence. Although criticised, this is still the most most widely accepted
view and as such represents a basis for null hypotheses to test observations resulting from
surveys of genetic variation. Figure 1.4 shows another map which illustrates approximate
current distributions for the various types of cattle and their hybrids in Asia, Africa and
Europe.
15
Bos taurus (Longhorn)
Bos taurus (Shorthorn)
Bos indicus (Zebu)
Sanga (hybrid)
Figure 1.3: Postulated migratory routes of cattle across Asia, Africa and Europe.
Fig. 1.3: Closed shapes show the centres of origin of the various types of cattle. This interpretation is based on the diagrams published in PAYNE (1970) and EPSTEIN & MASON (1984). The chronologies of the various migrations are detailed in the previous section.
16
17
Taurine (humpless)
Zebu (humped)
Zebu/taurine crossbreds
Bos [Bibos] sp. and crossbreds
Fig. 1.4: This map shows approximate distributions for the various types of domesticated cattle found in Asia, Africa and Europe. Also shown are distributions for the closely related Bos [Bibos] species such as banteng, gaur and kouprey. This diagram is modified from PAYNE (1970) and EPSTEIN & MASON (1984).
Figure 1.4: Distribution of extant cattle types in Asia, Africa and Europe.
1.3 Genetic variation studies
Using genetic polymorphisms to study evolution and variation in populations
During the last forty years, it has become clear that biochemical assays of genetic
variation at the molecular level can provide rich insights into the genetic structure and
evolutionary history of biological organisms.
The first demonstrations of genetic variation at the biochemical level were described
at the beginning of the century by LANDSTEINER (1901, [cited CAVALLI-SFORZA et al., 1994])
and NUTTALL (1904, [cited AVISE , 1994]). These pioneering studies showed that individual
humans displayed heritable variation at the ABO blood group system. These concepts were
later applied in the first systematic surveys of genetic variation in different human groups by
HIRSZFELD & HIRSZFELD (1919, [cited CAVALLI-SFORZA et al., 1994]). However, it was not until
the 1960’s that the study of evolutionary processes using molecular techniques really came of
age. Although PAULING et al., (1949) had demonstrated the molecular nature of a mutation
leading to sickle-cell anaemia in humans, it was not until 1966 that the widespread nature of
protein polymorphism was first proven (HARRIS, 1966; LEWONTIN & HUBBY, 1966). These
researchers used multilocus protein electrophoresis which involves the separation of non-
denatured proteins by net charge in an electric field, followed by application of histochemical
stains, to reveal the enzyme or other protein products of particular genes. These initial
surveys, carried out in two very different organisms (Drosophila and humans), revealed that
animal genomes harboured an unsuspected wealth of genetic variation. This realisation, in
conjunction with theoretical studies, eventually led to the formulation of the neutral theory of
molecular evolution (KIMURA , 1968a). Studies of multilocus protein or allozyme variation,
with minor modifications and refinements, became the standard tool for investigations of
biochemical genetic variation for the following twenty years.
A few years prior to the demonstration of the huge reservoir of genetic variation in
biological organisms, another vital component of molecular evolutionary genetics was
described; the concept of the molecular clock. ZUCKERLAND & PAULING (1962, [cited NEI,
1987]) were the first to propose that various proteins and DNA sequences might evolve at
stochastically constant rates over time, in an analogous fashion to radioactive decay. They
reasoned that this constancy may provide internal biological “chronometers” for dating past
evolutionary events and for correlating genetic dissimilarity with time. SARICH & WILSON
(1967) applied a molecular clock to the results of an immunological study to show that
contrary to accepted anthropological convention, humans and chimpanzees may have
diverged only 5 Mya. This finding was later supported by numerous molecular studies and
also by further palaeontological work.
The first technique for estimation of differences at the actual genomic DNA level was
18
developed in the 1960’s, initially to study the organisation of eukaryotic genomes (BRITTEN &
KOHNE , 1968), but which was subsequently applied to questions of molecular evolution and
systematics (for review see SIBLEY & AHLQUIST , 1990). This technique known as DNA•DNA
hybridisation, is based on the thermodynamic reannealing properties of heterologous single-
stranded DNA sequences. During the 1980’s it was used to clarify and reconstruct the
phylogenetic histories of a number of species, most notably those of avian and hominoid
species (for reviews see SIBLEY & AHLQUIST , 1990; SIBLEY et al., 1990). However, in recent
years the technique has lost ground due to theoretical and practical difficulties and has been
superseded by more direct DNA sequence-based approaches (AVISE , 1994).
Molecular biology was revolutionised by the discovery of bacterial restriction
endonucleases which cleave duplex DNA at particular oligonucleotide sequences (MESELSON
& YUAN, 1968). Several hundred of these enzymes have now been characterised and they
proved to be very useful tools for molecular evolution and population genetics. In
conjunction with the technique of Southern hybridisation (SOUTHERN , 1975), they have
provided a very powerful method to assay genetic variation at the DNA level. Polymorphisms
at the DNA sequence level can be visualised as changes in the cleavage patterns of DNA
fragments which have been t reated with a par t icular res tr ic t ion enzymes. These
polymorphisms are usually termed restriction fragment length polymorphisms (RFLPs)
(BOTSTEIN et al., 1980). Although RFLP analysis has been used with some notable success for
studies of molecular evolution in the nuclear genome (e .g . WAINSCOAT et al., 1986), the
majority of population genetic surveys carried out using restriction enzymes have tended to
focus on the cytoplasmic mitochondrial genome. This organelle has provided the bulk of
phylogenetic information at the DNA level for the past 15 years (AVISE , 1994) and is discussed
in more detail later in this section.
An another important breakthrough in molecular biology which emerged during the
1970’s was the development of methods for direct determination of the sequence of a purified
DNA fragment (MAXAM & GILBERT , 1977; SANGER et al., 1977). DNA sequence analysis
thereafter became a vital component of molecular evolutionary genetics. For the first time
evolutionary inference was possible using the primary genetic information. Generally, studies
of DNA sequence evolution were initially restricted to studies of higher level taxonomic
divergences. This was because sequencing applications were limited by the laborious
procedure of cloning and sequencing within microbial vectors. The level of information
gained from comparisons between closely related taxa was generally outweighed by the cost in
resources and time required to generate the data.
The advent of the polymerase chain reaction (PCR) (MULLIS et al., 1986; SAIKI et al.,
1988) dramatically changed this equation and facilitated direct economically feasible DNA
sequence determination from a large number of individual organisms. This has had a
19
profound effect on studies of mitochondrial DNA (mtDNA) variation and has led to a huge
literature of high resolution mtDNA sequence surveys within and among closely related taxa
(e.g. VIGILANT et al., 1991; STONEKING et al., 1992).
Animal mtDNA is a closed circular molecule, typically 15-20 kb in length and is
composed of about 37 genes. A control region or displacement loop (D-loop) of about 1 kb
initiates replication and transcription. Mitochondrial DNA, and in particular some segments of
the control region evolve with exceptional rapidity and have proved to be useful for high
resolution analyses of population structure (AVISE , 1994). The molecule does not undergo
any form of recombination, making it particularly useful for reconstructing phylogenies
unobscured by genetic exchange. It is transmitted exclusively through maternal lineages in
most species (GILES et al., 1980).
Genotypes for mtDNA thus represent rapidly evolving, non-recombining characters,
asexually transmitted via females through the pedigrees of what otherwise may be sexually
reproducing species. mtDNA genotypes are usually referred to as haplotypes with multiple
alleles and their inferred evolutionary interrelationships interpreted as estimates of matriarchal
phylogeny. Intraspecific studies of mtDNA variation have been applied in many species and
have been particularly instrumental in formulating theories about the origins of modern
humans (CANN et al., 1987; for review see WILLS , 1995).
During the 1980’s the attention of genomic scientists was focussed on a new class of
hypervariable regions of DNA which were first revealed using Southern blot analyses of
repetitive elements in the human genome which became known as minisatellites (JEFFREYS et
al., 1985). The DNA probes originally employed by JEFFREYS and his coworkers hybridise to
conserved core sequences (10-15 bp in length) scattered in numerous arrays about the human
genome as part of a system of dispersed tandem repeats, in what are referred to as variable
number of tandem repeat (VNTR) loci. Each repeat unit is about 16-64 bp in length.
Changes in the repeat copy number arising from high rates of unequal crossing-over during
meiosis gives rise to a hypervariable pattern of increases and decreases in the lengths of
particular arrays. The methodology surrounding this technique (particularly when applied to
human forensics) became known as DNA fingerprinting.
Although hypervariable minisatellite arrays were uncovered in many animal and plant
taxa (including cattle), with a few notable exceptions, they have never really been successfully
applied to population genetic problems. The complexity of the gel profiles which contain
perhaps 20 or more scorable bands, the high mutation rate to new length variants and the
difficulty in obtaining consistent results has generally precluded the wide application of this
technique to evolutionary genetics.
PCR-based methodologies have been developed which allow amplification of single
VNTR arrays from the genome (JEFFREYS et al., 1988). However, this type of approach has
20
been superseded by the discovery of a new class of genetic marker which can be assayed using
PCR. This class of genetic marker was developed in the late 1980’s and is commonly known
as the microsatellite (LITT & LUTTY, 1989; TAUTZ , 1989; WEBER & MAY, 1989). The survey of
genetic variation described in this thesis is based on analysis of microsatellite variation and
accordingly they are described in detail in section 1.3.
Another type of genetic analysis which has been used for population genetic surveys
in recent years is the random amplified polymorphic DNA (RAPD) approach. This was first
described by WILLIAMS et al. (1990) and involves screening genomic DNA for interpretable
polymorphisms using short (≅ 10 bp) primers of arbitrary sequence to PCR amplify a few
random anonymous genomic sequences. The method typically generates polymorphisms with
dominance-recessive characteristics and the technology suffers from many of the drawbacks
of DNA fingerprinting, particularly the issue of reproducibility (HEDRICK , 1992). Thus far, the
RAPD technique has remained popular within the plant population genetics community but
has failed to gain ground in a wider context.
There have been a range of other PCR-based techniques developed during the 1990’s
for analysis of genomic DNA variation. These techniques include such methods as single-
strand conformation polymorphisms (SSCPs) and amplified fragment length polymorphisms
(AFLPs). However, these methods have not been widely applied in evolutionary studies and
will not be discussed here.
Previous studies of genetic variation in domesticated cattle
Over the years, domesticated cattle have been the subject of numerous biochemical
surveys of genetic variation within and among populations. This interest has been spurred by
enthusiastic collaboration among veterinarians, breeders, animal scientists and geneticists.
Studies have been undertaken on a broad scale to encompass populations from different
regions of the globe (BRÆND, 1972; MANWELL & BAKER , 1980; VON GRAML et al., 1986) and
also at a more localised level among closely related populations within particular regions
(KIDD & PIRCHNER , 1971; KIDD et al., 1980; ASTOLFI et al., 1983).
Before a summary of previous studies of genetic variation is given, it is important to
clarify the cytological relationships among cattle and related species. The Bovini are very
similar in the number and gross morphology of their chromosomes (HALNAN, 1989). All
species have 2n = 60 with 58 acrocentric autosomes except the gaur and mithan which possess
2n = 58. The major morphological difference between cattle species is the Y-chromosome.
Taurine cattle, yak, gaur mithan and banteng all have a submetacentric Y-chromosome
(POPESCU , 1969; NAMIKAWA et al., 1983; WINTER et al., 1984 [all cited in BAKER & MANWELL,
1991]). However, humped zebu (Bos indicus) cattle and both species of bison have an
acrocentric Y-chromosome (GUPTA et al ., 1974). This difference in Y morphology has proved
21
useful for detecting genetic introgression between taurine and zebu cattle (for review see
BAKER & MANWELL, 1991).
The ten recognised blood groups in cattle have been used for many years as genetic
markers to detect differences and similarities between populations (BELL, 1983). In the early
years of genetic surveys in cattle, results from such studies were often interpreted as evidence
for bizarre genetic affinities between geographically disparate breeds. For example, based on
the frequency distributions of alleles at one genetic locus (haemoglobin, Hb), BANGHAM &
BLUMBERG (1958), concluded that Jersey cattle from the Channel Islands were closely related
to African zebu cattle. This was later shown to be an erroneous conclusion by BRÆND (1972)
who analysed a much larger range of blood groups and protein polymorphisms. Other studies
which have used blood groups to analyse the relationship among cattle breeds include a large
survey of genetic variation in Icelandic and Norwegian cattle (KIDD & CAVALLI-SFORZA, 1974).
They were able to demonstrate that genetic drift has been the primary force responsible for the
genetic divergence between the parental Norwegian population and the Icelandic population.
During the 1970’s a large number of studies of genetic variation were conducted
using blood groups and more increasingly, allozyme systems. A major outcome of this work
was the demonstration that Bos taurus and Bos indicus cattle were relatively divergent at the
protein level (BRÆND , 1972; MANWELL & BAKER, 1980). MANWELL & BAKER were the first
workers to represent this divergence phylogenetically and they concluded that the two types of
cattle deserved their Linnaean specific status on the basis of this genetic distinction. They also
superimposed their phylogenetic diagram on to a geographic map and produced a very
laboured biogeographic explanation for a single origin for all domesticated cattle in southwest
Asia (MANWELL & BAKER, 1980).
The first reports of molecular DNA-based surveys of genetic variation in cattle began
to appear in the 1990’s (BHAT et al., 1990; LOFTUS et al., 1992; 1994a; 1994b; SUZUKI et al.,
1993; BRADLEY et al., 1994; 1996; MACHUGH et al., 1994). LOFTUS and his colleagues were
able to show that analysis of mtDNA sequence variation provided an accurate estimate of the
divergence time between taurine and zebu cattle which clearly predated the Holocene period
and therefore indicated that zebu cattle were probably domesticated independently (see
sections 4.10 a n d 7.1). A more recent analysis of a much larger database of mtDNA
sequences suggests that African and European taurine cattle may also have been domesticated
independently in separate locales (BRADLEY et al., 1996, [see section 7.1]).
BRADLEY et al. (1994) demonstrated that the morphological divergence between the
taurine and zebu Y-chromosomes was reflected at the molecular level and that DNA-based
assays provided very accurate tools for quantifying genetic introgression between the two
subspecies. These analyses of molecular variation in African, Asian and European cattle also
showed that a remarkable sex-mediated process of genetic introgression had taken place
22
between taurine and zebu cattle in Africa. The molecular data suggested that the historical
hybridisation which took place between zebu and taurine cattle (see section 1.1) was primarily
between zebu males and taurine females. No trace of the zebu mitochondrial haplotype was
found in African cattle populations. However, the zebu Y-chromosome had penetrated to
fixation in zebu populations and was making serious inroads into populations classified as
taurine (BRADLEY et al., 1994). This work was supported by other molecular surveys carried
out in African cattle (SUZUKI et al., 1993; TEALE et al., 1995).
Microsatel l i tes were shown to be very useful tools for s tudies of genet ic
microdifferentiation in European cattle by MACHUGH et al., (1994). They showed that these
markers provided good estimates of a range of population genetic parameters and were also
useful for reconstructing a plausible evolutionary history of the breeds surveyed in the study.
23
1.4 Simple tandem repeats: microsatellites
The development of a highly polymorphic class of DNA marker
Microsatellites or simple tandem repeats (STRs) are ubiquitous iterated repeat regions
in eukaryotic genomes. They are composed of monotonous motifs consisting of repeats of
two to five nucleotides. These elements have been shown to display length variation which is
stably inherited in a Mendelian fashion. The most thoroughly studied type to-date have been
the (dC-dA)n•(dG-dT)n repeats which form the majority of dinucleotide repeats in mammalian
genomes. Figure 1.5 (below) shows the structure of a typical (dC-dA)n microsatellite.
Figure 1.5: A typical (dC-dA)n dinucleotide microsatellite region
CGTTACGGATCACACACACACACACACACACACACCTGATCAAGTAT|||||||||||||||||||||||||||||||||||||||||||||||GCAATGCCTAGTGTGTGTGTGTGTGTGTGTGTGTGGACTAGTTCATA
Fig. 1 .5 : The structure of a (dC-dA)n microsatellite and the surrounding unique sequence. The
(CA)n motif is shown in bold typeface and the unique flanking sequence is shown in plain typeface.
It has been estimated that there are at least 35,000 of these sequences in the haploid
human genome and that they are randomly dispersed, occurring every 100 kb approximately
(WEBER, 1990). These regions can be amplified via PCR and the length variation can be
assayed using standard electrophoretic techniques. In this form, they have become the
mainstay of international efforts to produce linkage maps of various mammalian genomes and
have also proved to be invaluable tools for the identification of genetic lesions associated with
inherited human disease. In addition, mutation at certain types of trinucleotide repeat loci has
been shown to be responsible for some of the more important human inherited disorders.
Recently, microsatellites have also become widely used for studies of kinship, population
variation and evolutionary inference.
The existence of simple repetitive elements (the building blocks of microsatellites) in
eukaryotic genomes has been documented since the 1970’s, though the large number and
almost ubiquitous distribution of these sequences throughout the genetic material of
eukaryotes was first highlighted by HAMADA et al. (1982), who found hundreds of copies of
poly-(dC-dA)n sequences in yeast and tens of thousands in vertebrates. This finding was
conf i rmed in 1984 by TAUTZ & RENZ , who systematically hybridised different simple
sequences to genomic DNA from a range of organisms and found many types of tandemly
arrayed simple sequences (TAUTZ & RENZ, 1984). Further work by TAUTZ and his colleagues
showed that many different simple sequence motifs occurred in eukaryotes and that they were
24
five- to ten-fold more frequent than equivalent random motifs (TAUTZ et al., 1986). Cryptic
repeats, scrambled arrangements of repetitive sequences, were also shown to occur in the
genome and to vary within and between species. The existence of these scrambled motifs led
the authors to speculate that replication slippage was the major genomic mechanism involved
in the propagation and mutability of such sequences.
Simple tandem repeats were first shown to be hypervariable components of the
genome by SAVATIER and his colleagues in 1985 (SAVATIER et al., 1985). They cloned and
sequenced a 5.5 kb fragment of the β-globin gene from chimpanzee DNA and compared it
with the corresponding human sequence. They found that di-, tri-, and pentanucleotide repeat
arrays varied dramatically in length between the two species, displaying amplification or
contraction of the number of basic repeat elements. It was not until 1989, however, that the
opportunity to exploit this variation was fully realised.
Three different reports appeared in the literature in that year detailing similar PCR-
based protocols for amplifying microsatellite regions from eukaryotic genomes (LITT &
LUTTY, 1989; TAUTZ, 1989; WEBER & MAY, 1989). The microsatellite regions were amplified
using two PCR primers homologous to the unique sequence flanking the microsatellite region,
radiolabelled, and the resultant PCR products were discriminated on the basis of length using
denaturing polyacrylamide gel electrophoresis. It was clearly evident from these initial reports
that microsatellites would become vitally important tools for future studies of eukaryotic
genomes. These markers were subject to discrete codominant Mendelian inheritance and most
loci displayed a relatively large number of length variants or alleles which could be
discriminated much more readily than other hypervariable marker systems such as
minisatellite polymorphisms.
Microsatellites were taken up quickly by the genome mapping community as the
primary genetic marker for generating linkage maps of various mammalian genomes. Within
a number of years, hundreds of these markers had been characterised from several species and
by 1992 the first high density linkage maps were produced for humans and the mouse
(WEISSENBACH et al., 1992; DIETRICH et al., 1992). These markers have proved invaluable for
the localisation of many human genetic disorders and have greatly expedited the identification
of numerous disease lesions in the human genome. Paradoxically, trinucleotide microsatellites
were also implicated in a number of unusual genetic disorders which displayed increases in
symptom severity through time in genealogical pedigrees. This phenomenon is known as
anticipation and had puzzled medical geneticists for many years.
When the genes for these genetic disorders (usually neurodegenerative conditions
such as Huntington disease and spinobulbar muscular atrophy) were isolated and
characterised, it was found that the disease-causing lesion was a trinucleotide repeat region
which had expanded well beyond the length range found in the normal population, thus
25
disrupting the structure of the encoded protein (for review see WILLEMS , 1994). It was realised
that this expansion was a multistage process where certain individuals could possess
increasingly large and instable arrays which were increasingly predisposed to further mutation
as they were passed onto offspring. Once a certain threshold was passed, disease symptoms
emerged which increased in severity as the array length increased even further (see RICHARDS
& SUTHERLAND , 1994).
Livestock geneticists were quick to realise the potential that microsatellites offered for
studies of genomic variation in important domesticated animal species. It became evident that
these loci could provide highly informative markers for the construction of genetic linkage
maps which could be used in the search for quantitative trait loci associated with economically
important traits (GEORGES et al., 1995; WOMACK & KATA, 1995). Hundreds of microsatellites
were characterised from the bovine, ovine and porcine genomes and these eventually led to the
production of high density genetic linkage maps (BARENDSE et al., 1994; BISHOP et al., 1994;
EGGEN & FRIES, 1995).
The availability of a wide range of microsatellites from livestock species has also
generated interest in studies of variation and evolutionary relationships among livestock
populations and a number of such studies have appeared in the literature (BUCHANAN et al.,
1994; MACHUGH et al., 1994; FORBES et al., 1995).
Genetic and physiochemical properties of microsatellite repeat regions
The physical processes underlying simple sequence mutation have been the subject of
a great deal of debate for the past ten years (LEVINSON & GUTMAN , 1987; SCLÖTTERER &
TAUTZ , 1992; RICHARDS & SUTHERLAND , 1994; TAUTZ & SCLÖTTERER , 1994). I t is now
generally accepted that the primary mechanism which generates length variation at these loci is
slipped-strand mispairing during replication. Slippage implies displacement of the strands of
a denatured fragment followed by mispairing of complementary bases at the site of an existing
short repeat sequence. As repeats gain more units they theoretically provide a more efficient
substrate for slippage, and therefore for further expansion or contraction. In vi tro
experiments using synthetic oligonucleotides and a variety of polymerases indicate that the
rate of slippage is dependent on the size of the repeat unit (greatest for dinucleotides) and on
its sequence (slowest for dG-dC rich segments) (SCLÖTTERER & TAUTZ, 1992). Although it has
been suggested that microsatellite mutation rate displays a correlation with repeat length, the
data remains equivocal (WEBER, 1990; HUDSON et al., 1992; SHRIVER et al., 1993). Figure 1.6
(below) shows a standard model for the generation of sl ippage length variation at
microsatellite arrays.
26
Figure 1.6: Model for slippage within a simple sequence region
3' 5'
(a)
(b)
(c)
(d)
(e)
(f)
Fig. 1 .6: (a ) The model depicts a point during replication at which a transient gap is presentwithin a simple sequence motif (black region). ( b ) Slippage occurs at both sides of the gap,whereby it is assumed that a small bulge forms that is out of register by a single repeat unit. (c) Thebulge moves along the simple sequence stretch. On the left side of the gap, the bulgeencounters a single nucleotide replacement (small white position) that interrupts the simplesequence repeat. (d) The interruption prevents further slippage and the bulge moves in theopposite direction. ( e ) On the right side of the gap, the movement of the bulge is unhindered andproceeds until the unique flanking sequence (white region) is encountered. ( f ) Although thebulge is likely to go backwards from the flanking region as well, the gap may have become closed inthe meantime and the upper strand is, therefore, one repeat longer. In most cases, the mismatchrepair system would repair this structure, but occasionally the length change might escape thesystem and become fixed. The model is consistent with the in vitro slippage behaviour of simplesequences, which suggest that out-of-register bulges can move along simple sequence motifs(SCHLÖTTERER & TAUTZ, 1992). Furthermore, the model would explain why simple sequencestretches that include single nucleotide replacements show a lower propensity to acquiremutations (WEBER, 1990). The model also suggests an explanation for the mutational polarityobserved in cases such as the fragile X trinucleotide repeat (KUNST & WARREN, 1994).[Modified from TAUTZ & SCHLÖTTERER, 1994]
27
Estimates for mutation rates have appeared in the literature calculated from the
frequency of de novo length changes in pedigrees. There is a great deal of variation in these
estimates but they range from 10-5 - 10-2 events per generation (DALLAS , 1992; MAHTANI &
WILLARD , 1993; WEBER & WONG, 1993). Mutations observed within pedigrees typically involve
the gain or loss of one, or less frequently, a few repeat units.
The mutational and population genetic behaviour of microsatellite loci have been
under intense theoretical scrutiny for the last number of years and a range of papers have
appeared describing novel theoretical approaches to understanding the evolutionary modalities
of microsatellites. A common theme since the publication of two important papers in 1993
(SHRIVER et al., 1993; VALDES et al., 1993), has been the application of the stepwise mutation
model (SMM) to the analysis of microsatellite variation in populations. The SMM was
originally conceived to explain regularities in distributions of the frequencies of alleles that
could be distinguished by protein electrophoresis (OHTA & KIMURA , 1973). However, it has
recently been revised in an attempt to model length variation at microsatellite loci. The SMM
and its application to the dataset generated from the work described in this thesis is detailed
fully in section 4.7. Briefly, the SMM differs from the alternative infinite alleles model (IAM)
of neutral mutation, in that it assumes that there are only two adjacent states to which an allele
can mutate in a single step and that allelic states can be envisaged as a series of integer points
on a line. The evolutionary divergence between alleles is therefore proportional to the number
of mutational steps separating them. Thus, the SMM would seem to be an appropriate
analytical tool for surveys of microsatellite variation in evolutionary contexts.
In general, the allelic distributions at microsatellites were found to conform to the
SMM and a range of population genetic parameters were developed to take advantage of this
relationship (GOLDSTEIN et al., 1995a; 1995b; SHRIVER et al., 1995; SLATKIN, 1995). The
theoretical acceptance of microsatellites as tools for the study of genetic microdifferentiation
and evolutionary relationships has encouraged a large number of researchers to apply these
techniques in a wide variety of species.
Inevitably, the majority of surveys of microsatellite variation have been performed in
human populations (EDWARDS et a l. , 1992; BOWCOCK et a l. , 1994; DEKA et a l., 1995;
GOLDSTEIN et al., 1995b). However, a number of papers have emerged in recent years which
have demonstrated the power that analyses of microsatellite variation possess for studies of
genetic differentiation in many different taxa. Surveys have included such species as cattle,
sheep, chimpanzees, marine turtles, wolf-like canids, hairy-nosed wombats, polar bears and
even honey-bees (MACHUGH et al. , 1994; BUCHANAN et al. , 1994; MORIN et al., 1994;
FITZ SIMMONS et al., 1995; GOTTELLI et al., 1994; TAYLOR et al., 1993; PAETKAU et al., 1995;
ESTOUP et al ., 1995). The range and variety of these surveys will undoubtedly increase rapidly
as more researchers realise the benefits that these markers possess for studies of genetic
28
differentiation.
Amplification of dinucleotide repeat loci in the chimpanzee using human primers
indicates that microsatellites are highly conserved in terms of chromosomal location and that
polymorphism at these loci predates the divergence of humans and chimpanzees (DEKA et al.,
1994) . DEKA et al. also suggested that such conservation of genomic location intuitively
suggests functional conservation. HAMADA et al., (1984) have shown that dinucleotide repeats
can affect regulation of transcription of at least one gene in mammalian cells. It has also been
suggested that microsatellites may play a role in recombination (PARDUE et al., 1987).
However, if microsatellites were hotspots for recombination, it would be expected that
haplotypic information among linked microsatellites would be disrupted and this has been
shown not to be the case (HÄSTBACKA et al ., 1992; MORRAL et al., 1993; PENA et al., 1994).
Also microsatellites are more abundant in the mouse genome than in the human genome, in
spite of the fact that there is less recombination in the mouse genome (STALLINGS et al., 1991).
A possibility for a more general selective constraint on microsatellite loci, but one that
is not yet well understood, is that perhaps microsatellites have a functional role in large-scale
chromosomal structure. (dC-dA)n repeats have been shown to have Z-DNA forming potential
(HAMADA et al., 1982), and although the function of such DNA has not been completely
elucidated, it may facilitate packaging during chromosomal condensation in meiosis (GROSS &
GARRARD, 1986).
An important observation from one of the first reports describing simple sequences
provides strong evidence that microsatellites have no general function. TAUTZ & RENZ (1984)
detected simple sequences in the metabolically inactive micronucleus of the protozoan
Stylonychia, b u t not in the metabolically active macronucleus which is derived from the
micronucleus by chromosome diminution. Until a great many more studies on the
evolutionary and genomic mechanisms underlying microsatellite conservation and variation
are carried out, it will not be possible to explore the question of function properly. However,
functional constraint even if it exists, should not be a serious issue for evolutionary
comparisons between closely related populations and taxa.
29