International Journal for Parasitology 17 "0887# 656Ð664 S9919!6408:87 ,08[99¦9[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ Printed in Great Britain PII] S9919!6408"87#999166 Molecular phylogeny of the families Campulidae and Nasitrematidae "Trematoda# based on mtDNA sequence comparison M[ Ferna ndez a $\ F[J[ Aznar a \ A[ Latorre b \ J[A[ Raga a a Departamento de Biolog( a Animal\ b Departamento de Gene tica\ Universitat de Vale ncia\ Dr[ Moliner\ 49\ 35[099!Burjasot\ Valencia\ Spain Received 12 July 0886^ received in revised form 18 January 0887^ accepted 29 January 0887 Abstract Historically\ the systematic arrangement of the genera within the family Campulidae\ and its relationship with its allied family Nasitrematidae have been rather confused\ particularly because only adult morphology has been available to classical taxonomic analysis[ In this paper we provide a partial phylogeny of the genera of these families based on mtDNA from _ve campulid species] Campula oblonga\ Zalophotrema atlanticum\ Hadwenius tursionis\ Oschmarinella rochebruni and Orthosplanchnus fraterculus^ and one nasitrematid\ Nasitrema globicephalae[ Fasciola hepatica and Dicrocoelium dendriticum were used as outgroups[ Maximum parsimony and neighbour!joining methods were applied[ Both methods produced similar trees where H[ tursionis appeared as the basal campulid\ with a sequential divergence of Z[ atlanticum\ N[ globicephalae\ C[ oblonga\ O[ rochebruni and O[ fraterculus[ Results suggest that Nasitrematidae as de_ned should loose its familial status and the current subfamilial division of the family Campulidae is at least partly arti_cial and should not be maintained[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ Key words] Digenea^ Campulidae^ Nasitrematidae^ mtDNA^ Biogeography^ Phylogeny 0[ Introduction The families Campulidae and Nasitrematidae are composed of digeneans occurring world!wide in marine mammals\ particularly cetaceans ð0L[ According to the most recent revisions ð1\ 2L\ the former family comprises seven genera arranged in Note] Nucleotide sequence data reported in this paper are available in the EMBL\ GenBankTM and DDJB data bases under the accession numbers AF923440\ AF923441\ AF923442\ AF923443\ AF923444\ AF923445 and AF923446[ $Corresponding author[ Tel[] ¦23[5[2872110^ fax] ¦23[5[2753261^ e!mail] Mercedes[FernandezÝuv[es[ four subfamilies] Campula and Zalophotrema "subfamily Campulinae#^ Lecithodesmus "Lecitho! desminae#^ Orthosplanchnus\ Hadwenius\ and Osch! marinella "Orthosplanchninae#\ and Hunterotrema "Hunterotrematinae#[ The family Nasitrematidae is composed of two monogeneric subfamilies ð1L] Nasitrematinae\ which includes the genus Nasi! trema\ and Cetitrematinae\ which includes Ceti! trema[ Traditionally\ the families Nasitrematidae and Campulidae have been regarded as very close taxa ð1L[ However\ their exact relationship has not been determined yet[ Recently\ Brooks et al[ ð3L con! sidered the Nasitrematidae as an {included group| within the family Campulidae\ meaning that
Transcript
International Journal for Parasitology 17 "0887# 656Ð664
S9919!6408:87 ,08[99¦9[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ Printed in Great BritainPII] S9919!6408"87#999166
Molecular phylogeny of the families Campulidae andNasitrematidae "Trematoda# based on mtDNA sequence
aDepartamento de Biolog(�a Animal\ bDepartamento de Gene�tica\ Universitat de Vale�ncia\ Dr[ Moliner\ 49\ 35[099!Burjasot\Valencia\ Spain
Received 12 July 0886^ received in revised form 18 January 0887^ accepted 29 January 0887
Abstract
Historically\ the systematic arrangement of the genera within the family Campulidae\ and its relationship with itsallied family Nasitrematidae have been rather confused\ particularly because only adult morphology has been availableto classical taxonomic analysis[ In this paper we provide a partial phylogeny of the genera of these families based onmtDNA from _ve campulid species] Campula oblonga\ Zalophotrema atlanticum\ Hadwenius tursionis\ Oschmarinellarochebruni and Orthosplanchnus fraterculus^ and one nasitrematid\ Nasitrema globicephalae[ Fasciola hepatica andDicrocoelium dendriticum were used as outgroups[ Maximum parsimony and neighbour!joining methods were applied[Both methods produced similar trees where H[ tursionis appeared as the basal campulid\ with a sequential divergenceof Z[ atlanticum\ N[ globicephalae\ C[ oblonga\ O[ rochebruni and O[ fraterculus[ Results suggest that Nasitrematidae asde_ned should loose its familial status and the current subfamilial division of the family Campulidae is at least partlyarti_cial and should not be maintained[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[
The families Campulidae and Nasitrematidae arecomposed of digeneans occurring world!wide inmarine mammals\ particularly cetaceans ð0Ł[According to the most recent revisions ð1\ 2Ł\ theformer family comprises seven genera arranged in
�Note] Nucleotide sequence data reported in this paper areavailable in the EMBL\ GenBankTM and DDJB data basesunder the accession numbers AF923440\ AF923441\ AF923442\AF923443\ AF923444\ AF923445 and AF923446[
four subfamilies] Campula and Zalophotrema"subfamily Campulinae#^ Lecithodesmus "Lecitho!desminae#^ Orthosplanchnus\ Hadwenius\ and Osch!marinella "Orthosplanchninae#\ and Hunterotrema"Hunterotrematinae#[ The family Nasitrematidaeis composed of two monogeneric subfamilies ð1Ł]Nasitrematinae\ which includes the genus Nasi!trema\ and Cetitrematinae\ which includes Ceti!trema[
Traditionally\ the families Nasitrematidae andCampulidae have been regarded as very close taxað1Ł[ However\ their exact relationship has not beendetermined yet[ Recently\ Brooks et al[ ð3Ł con!sidered the Nasitrematidae as an {included group|within the family Campulidae\ meaning that
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664657
{{although the phylogenetic relationships of the taxalisted under these headings ð{included groups|Ł arenot so unclear as to warrant incerta sedis status\their precise relationship to the family concernedcannot be discerned with the characters we haveused||[
Contrary to many other digenean taxa\ the cur!rent taxonomic relationships within\ and between\these families are based exclusively upon adultmorphological features ð4Ł[ This is because there areobvious di.culties in gathering additional infor!mation about larval stages and life!cycles in para!sites inhabiting marine habitats[ Moreover\specimens for study are usually scarce\ and manysupposedly key morphological features are sub!jected to degenerative changes\ as samples comefrom serendipitous collections ð2Ł[ As a conse!quence\ the current taxonomy of the Campulidaeand Nasitrematidae is particularly confused[ In thispaper\ we analyse the relationships within theCampulidae\ and between this family and the Nas!itrematidae\ using a molecular phylogeneticapproach to avoid the de_ciencies in morphology[
1[ Materials and methods
We used the sequences of the tRNAlys and thesubunit 2 of the nicotinamideÐadenineÐdinucleo!tide dehydrogenase "ND2# mitochondrial gene ofsix ingroup taxa "_ve campulids and one nasitrem!atid# and two outgroups "one fasciolid and onedicrocoeliid# "Table 0#[
1[0[ DNA extraction\ ampli_cation\ cloning andsequencing
All the specimens had been previously preservedin 69) ethanol[ We extracted total DNA followingthe Lumb et al[ ð5Ł protocol with some changes[Worms were immersed in TE 0×bu}er "09mMTrisÐHCl\ 0mM EDTA pH 7[9# for 13 h[ Each sam!ple was homogenised in TE bu}er with proteinaseK "9[1mgml−0# and 0)×099 Triton[ The mix wasincubated at 26>C for 3Ð4 h[ The DNA was phenol!chloroform extracted ð6Ł\ and resuspended in anappropriate volume of TE bu}er[ The tRNA!lys¦ND2 genes were ampli_ed by the PCR using
two pairs of primers[ We designed one of them fromthe ND2 gene sequence of F[ hepatica ð7Ł"4?!GCGTTAGCAGGATCCTGTGATATAG!2?forward "primer 0#\ 4?!CCAAAGCTTAAATCA!TCGTTAGCAG!2? reverse "primer 1##\ the lengthof the PCR product being 379 bp[ We designed thesecond pair of primers from two previoussequences\ obtained with the _rst pair of oligo!nucleotides\ from Campula oblonga and Oschmari!nella rochebruni "4?!CTACTAGTGAGATTGATCT"T:C#CGTCGGT!2? forward "primer 2#\ 4?!CTACTAGTCCCACTCAAC"G:A#TAACC"T:C#T!2? reverse "primer 3##[ The reverse primer containedthe stop codon of the gene and was included in theanalyses[ The PCR product had 357 bp[ Ampli!_cation reactions contained 1[4ml of DNA\ 0mMof each dNTP\ 04mM of each primer\ 14mM ofMgCl1\ in a _nal volume of 49ml[ The high _delityPCR protocol was obtained from Kwiatowski et al[ð8Ł\ slightly modi_ed[ DNA was denatured for 4minat 84>C before adding 4 units of Taq DNA poly!merase "Promega#[ Reactions were subjected to 49cycles of the following steps] 84>C\ 0min\ 34>C\1min and 61>C\ 1min[ PCR products were phenol!chloroform extracted\ ethanol precipitated andresuspended in 19ml of TE bu}er[ BamHI and Hin!dIII sites for the _rst pair of primers and SpeI sitefor the second were used to insert the PCR productsinto pUC07:08[ We ampli_ed the DNA from Dicro!coelium dendriticum by a combination of the twosets of primers designed "primers 1 and 2#\ and thefragment was cloned into pUC07 vector with XbaI"compatible with SpeI# and HindIII sites[ We manu!ally sequenced the DNA according to the dideoxymethod by using universal and reverse primerscomplementary to the internal pUC sequences ð09Ł[For each sample\ at least two clones were sequencedand both strands of the DNA[
1[1[ Sequence analysis
We used the CLUSTAL V program ð00Ł to alignthe sequences[ The exhaustive search option inPAUP v 2[0 "Swo}ord DL[ PAUP] Phylogeneticanalysis using parsimony\ version 2[0[ IllinoisNatural History Survey\ 0882# calculated three par!ameters to detect phylogenetic signal] "0# number ofmost parsimonious trees\ "1# number of mutational
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664 658
Table 0Species used in the analysis of the ND2 gene[ Host\ locality and source of the parasites are indicated
DBAUV � Departamento de Biolog(�a Animal\ Universidad de Valencia^ PBS � Paci_c Biological Station "Nanaimo\ Canada#^UAC � Universidad Austral de Chile[
steps to the next most parsimonious trees and "2#the skewness parameter "`0# of the tree length dis!tribution[ This statistic is a measure of the dis!tribution asymmetry ð01Ł[ Phylogenetic signaloccurs when `0 ³ 9[ Critical values for `0 for acertain number of taxa and characters are shownin Hillis and Huelsenbeck ð02Ł[ We also exploredstationarity ð03Ł to check whether some nucleotidecompositional bias existed\ using the MARKOVprogram[
Phylogenetic analyses were performed usingmaximum parsimony ð04Ł\ with exhaustive search inPAUP\ and Lake|s ð05Ł invariants or {{evolutionaryparsimony||\ also implemented in PAUP[ Lake|sinvariants test groups of four species and wasapplied to clarify unresolved branches of the phy!logeny "see Results#[ Parsimony analyses were car!ried out either with the tRNAlys¦ND2 sequenceor the coding gene ND2[ We also applied the neigh!bour!joining distance method ð06Ł\ using MEGA v0[90 program ð07Ł[ Genetic distances were estimatedfollowing Kimura|s ð08Ł 1!parameter model[Sequences were also translated into amino acids\using Fasciola hepatica mtDNA genetic code[Dayho} PAM distances were calculated ð19Ł andneighbour!joining was applied to infer thephylogeny\ using Phylip v 2[2 "Felsenstein\ J[ PhylipManual Version 2[2\ University of California\0889#[
The statistical con_dence of a particular clusterof sequences\ both in parsimony and neighbour!joining\ was evaluated by the bootstrap procedure"0999 replicates#[ Bootstrap proportions higherthan 69) were considered signi_cant[ We analysedthe sequences with only transversions\ whichaccumulate at slower rates than transitions ð10Ł[Transversions and transitions were used to infer therelationships within the ingroup species\ both inparsimony and distance methods[
2[ Results
Alignment of the ND2 sequences was 252 baseslong\ including gaps "Fig[ 0A#[ Note that theinitiation codon for F[ hepatica and D[ dendriticumis ATG\ whereas for the rest of digeneans is GTG[Two hundred and twelve nucleotides showed vari!ation\ 77 of which were phylogenetically informa!tive "40 occurred among the ingroup taxa only#[The overall nucleotide frequencies were 9[024A\9[499T\ 9[980C and 9[163G[
The sequences displayed phylogenetic signal"`0 �−9[599045 for all taxa^ `0 �−0[969104 forthe ingroup taxa only# and stationarity "matrix notshown#[ Transversions were not saturated neitherwithin the ingroup nor the outgroup taxa "Fig[ 1#[However\ we obtained some evidence of tran!
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664669
Fig[ 0[ Alignment of] a# ND2 sequences\ b# tRNAlys sequences and c# ND2 amino acid sequences from 6 digeneans[ Bases and aminoacids identical to that on the top line indicated by {{[||[ Alignment gaps indicated by {{!||[
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664 660
Fig[ 0*continued[
sitional saturation in comparisons between theingroup and the outgroup taxa\ but not among theingroup taxa "Fig[ 1#[
Figures 2 and 3 display the topologies obtainedusing only transversions\ by applying neighbour!joining from distances calculated using the Kimura1!parameter algorithm "Table 1#\ and maximumparsimony "tree length 060^ consistency index9[725#\ respectively[ Results with the tRNA!lys¦ND2 sequence were identical "see alignmentof the tRNAlys in Fig[ 0B^ trees not shown#[ Bothmethods produced a similar picture\ where Ortho!splanchnus fraterculus and Oschmarinella roche!bruni formed a clade supported by a very high pro!portion of bootstrap[ Campula oblonga joined themwith a bootstrap proportion of 84Ð86) and Zal!ophotrema atlanticum clustered with the three pre!ceding taxa in less than 69) of the replicates[ In
Fig[ 1[ Transitions "Ž# and transversions "r# di}erences amongpairs of ND2 sequences plotted against the ) nucleotide dis!tances "Kimura 1!parameter method# of the pairs of sequences[
Fig[ 2[ Phylogenetic tree inferred from ND2 sequences using theneighbour!joining approach\ with only transversions[ O[ fra!terculus] Orthosplanchnus fraterculus\ O[ rochebruni] Osch!marinella rochebruni\ C[ oblonga] Campula oblonga\ N[globicephalae] Nasitrema globicephalae\ Z[ atlanticum] Zal!ophotrema atlanticum\ F[ hepatica] Fasciola hepatica\ D[ den!driticum] Dicrocoelium dendriticum[ D[ dendriticum and F[hepatica were used as outgroups[ Bootstrap values are shown atinternodes[
Fig[ 3[ Phylogenetic tree inferred from ND2 sequences usingparsimony\ with only transversions[ D[ dendriticum and F[ hep!atica were used as outgroups[ Bootstrap values are shown atinternodes[ See species name in Fig[ 2[
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664661
Table 1Nucleotide distances of Kimura 1!parameter for transitions "upper diagonal# and trans!versions "lower diagonal# between pairs of species[
Co � Campula oblonga\ Za � Zalophotrema atlanticum\ Ht � Hadwenius tursionis\ Of �Orthosplanchnus fraterculus\ Or � Oschmarinella rochebruni\ Ng � Nasitrema glob!icephalae\ Fh � Fasciola hepatica\ Dd � Dicrocoelium dendriticum[
parsimony\ Nasitrema globicephalae joined theabove taxa in 40) of the bootstrap replicates[Hadwenius tursionis appeared as the basal taxon"Fig[ 3#[ However\ in neighbour!joining\ a poly!tomy appeared indicating that all the taxa to theright of that internode formed a monophyletic cladein 80) of bootstrap trees "see Fig[ 2#[
When we removed D[ dendriticum in the neigh!bour!joining tree\ the polytomy was solved\ obtain!ing the same topology as in parsimony "Fig[ 4#[ Allthe internodes when D[ dendriticum was removed\both in neighbour!joining and parsimony\ weresupported by bootstrap values higher than 69)[
We applied Lake|s invariants method to all poss!ible quartets of species\ which included N[ globi!cephalae\ since the position of this species was notclearly established by the neighbour!joiningmethod "Fig[ 2#[ The method selected only oneunrooted topology as correct\ obtained with thetRNAlys¦ND2 sequence[ The four!species top!ology rendered the clades H[ tursionisÐD[ den!
Fig[ 4[ Phylogenetic tree inferred from ND2 sequences using theneighbour!joining approach\ with only transversions\ when D[dendriticum was removed from the analysis[ See species name inFig[ 2[
driticum and Z[ atlanticumÐN[ globicephalae "Fig[5#[ Lake|s invariants results are thus concordantwith parsimony results "Fig[ 3# and distances whenD[ dendriticum was removed "Fig[ 4#[
Since transitions were not saturated within theingroup "Fig[ 1#\ and the relationships within thesetaxa were not completely clari_ed when using trans!versions\ we performed the same analyses with theingroup taxa only\ using transversions and tran!sitions "including\ therefore\ more information thanusing only transversions#[ Moreover\ sequenceswere translated into amino acids "Fig[ 0C# sincethese might be more conserved than transversions[The trees obtained by neighbour!joining and par!simony using transitions and transversions "withthe ingroup taxa only# and using the aa sequences"with the ingroup taxa only and with all the taxa#\rendered the same ingroup relationships "Fig[ 6#[The positions of N[ globicephalae and Z[ atlanticumdi}er between the tree in Fig[ 6 and those in Figs2Ð4[ See the signi_cant bootstrap values\ especiallyhigh in the neighbour!joining tree with the aasequences "_rst value from left to right at internodes
Fig[ 5[ Unrooted topology selected by Lake|s invariants method[See species name in Fig[ 2[
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664 662
Fig[ 6[ Topology obtained using amino acid sequences "neigh!bour!joining#\ and with transversions and transitions "neigh!bour!joining and parsimony# within the ingroup taxa[ The treehas been rooted according to previous topologies which includedthe outgroup taxa[ Bootstrap values from left to right] neigh!bour!joining using amino acid sequences\ neighbour!joining andparsimony using transversions and transitions[ The internode ofO[ fraterculus and O[ rochebruni is 099 in all analyses[ Branchlenghts have been obtained from amino acid sequences analysis[See species name in Fig[ 2[
in Fig[ 6#[ We will base our discussion on ingrouptaxa relationships shown in Fig[ 6 since it has beenconstructed with more information than thoseshown in Figs 2 and 3[
3[ Discussion
The molecular phylogeny obtained here does notconform with the current taxonomy of the familyCampulidae\ regarding the subfamilies Ortho!splanchninae and Campulinae[ Both subfamiliesare paraphyletic groups according to the molecularphylogeny[ Besides\ N[ globicephalae was includedin a monophyletic clade with the rest of species\ andmight be regarded as a member of Campulidae[Because of the confusing taxonomic history ofmany campulid species\ it would have been best forus to use the type species of each genus[ Unfor!tunately\ our specimens had to be obtained asopportunity arose\ and only Campula oblonga is a
type species[ Nevertheless\ it is noticeable that thedi}erent analytical approaches produced similarresults\ which may indicate that our data bearphylogenetic information[ Only the position of N[globicephalae was not clearly determined in theneighbour!joining tree using transversions "see Fig[2#[ However\ when the outgroup D[ dendriticumwas eliminated from the analyses\ the polytomy wassolved and the bootstrap values were higher "seeResults#[ The Kimura 1!parameter distances amongD[ dendriticum and the rest of species showed thehighest values "Table 1# and the use of too distantoutgroups may result in spurious phylogenies ð11Ł[Moreover\ the biased composition in the ND2 gene"see Results#\ as well as the transitional saturationobserved as the divergence increases "see Fig[ 1#\might explain the distortion produced when usingD[ dendriticum[ However\ when using transitionsand transversions within the ingroup species only\this possible distortion was minimised[
The available data about the biogeography andhost speci_city patterns of campulids and nas!itrematids is still rather sketchy\ and therefore\ itis not possible to ascertain detailed pathways ofevolutionary diversi_cation[ Nevertheless\ someavailable information\ albeit crude\ seems to be inagreement with the phylogeny proposed here\whereas it is hardly explained assuming the currentsystematics[
All the genera of campulids represented in thephylogeny\ except Orthosplanchnus\ are primarilyparasites of odontocetes\ having representatives inalmost all the families surveyed for parasites\ exceptin Kogiidae and Physeteridae "since the currentstatus of the latter is not very clear*see ð12Ł\ we willaccept the traditional conception of Physeteridae asan odontocete family#[ In this context\ the genusHadwenius is the most speciose\ occurs in the highernumber of the families of odontocetes studied forparasites "all except Iniidae\ Ziphiidae and Phy!seteridae# and exhibits the most wide geographicdistribution "cosmopolitan# of all genera con!sidered in the phylogeny "see Ferna�ndez M[ Estudiode la _logenia y biogeograf(�a de la familia Cam!pulidae Odhner\ 0815 "Trematoda] Digenea#[ Doc!toral Thesis\ Universitat de Vale�ncia\ 0885\ andreferences therein#[ This evidence would suggest agreat antiquity of the genus\ and it is in agreement
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664663
with the basal position of Hadwenius in the molec!ular tree[
With respect to Zalophotrema spp[ \ one of theirmain host groups are pinnipeds\ particularly Zal!ophus californianus\ in a restricted area in Baja Cal!ifornia ð13Ł[ Moreover\ Zalophotrema is also clearlyassociated with odontocetes of the genus Stenella\although the parasitological information on somespecies of this odontocete taxon is scarce\ mainlyin the Atlantic area "see ð14Ł#[ Its position in thephylogeny suggests an origin from campulids par!asitising cetaceans\ and therefore\ its presence inthe latter is due to a secondary capture fromdolphins[ This is sensible\ since the alternative situ!ation\ a common origin of campulids from pin!nipeds with Zalophotrema as the basal campulid\would make it impossible to explain the bio!geographical and host speci_city patterns observedin campulids[
The most recent origin of the genus Ortho!splanchnus in the molecular phylogeny is also highlycongruent with the detailed information about thebiogeography and host speci_city of this genus[These are the only campulids occurring almostexclusively in pinnipeds and\ except for O[ antarc!ticus\ all species are restricted to Arctic and Sub!arctic waters\ having diversi_ed along the Beringarea "Adams AM[ Taxonomy\ systematics\ andecology of helminths parasites of the Ringed seal\Phoca hispida Schreber\ in Alaskan waters[ Doc!toral Thesis\ University of Washington\ 0877#[ O[antarcticus has been recorded only on two occasionsin the Weddell seal\ Leptonichotes weddelli\ but inno other Antarctic seals ð15\ 16Ł[ In addition\ somecrucial characters used for its allocation to Ortho!splanchnus are unclear ð2Ł[ Doubts on the status ofO[ antarcticus might permit the assumption of anexclusive ArcticÐSubarctic origin for the genus[ Inthis context\ there is a surprising parallelism in timeand putative processes between the origin anddiversi_cation of Orthosplanchnus\ and those of ces!todes of the genus Anophryocephalus "see ð17Ł#[ Bothgenera have nearly identical geographical ranges\and most of their diversi_cation is concentratedin the BeringÐNorth Paci_c area[ Apparently\ theorigin of both associations with pinnipeds is veryyoung\ and appears to come from the colonisationfrom helminths of dolphins or porpoises in the
Atlantic basin\ with a subsequent diversi_cationtowards the Paci_c area during the late Plioceneand Pleistocene[
Nasitrema spp[ have been found exclusively inodontocetes of the families Delphinidae and Pho!coenidae\ within a well!de_ned geographic rangeð18Ł[ They seem to occur mainly in the Indopaci_cOcean "never exceeding 39>NÐ39>S#\ and very par!ticularly in the North Paci_c area "see e[g[ ð29\ 20Ł#[The genus has never been recorded in the Circum!polar regions or the North West Atlantic and Med!iterranean basins[ According to this\ and regardingthe morphological similarity between Nasitremaand campulids\ the most parsimonious hypothesison the origin of this genus might be to assume thatNasitrema has originated from a campulid ancestorparasitising Delphinoidea in the Paci_c basin[
With respect to the rest of the genera representedin the phylogeny\ Campula and Oschmarinella\ thebiogeography and host speci_city information didnot provide a clear pattern as in the rest of campu!lids\ neither to support nor reject their position inthe molecular tree[
According to the above\ a complete systematicre!arrangement of the genera of the families Cam!pulidae and Nasitrematidae is urgent[ The evidenceshown here suggests that "0# Nasitrematidae asde_ned should lose its familial status\ since the typegenus\ Nasitrema\ appears as a member of the fam!ily Campulidae and "1# the current subfamilial div!ision of the family Campulidae is at least partlyarti_cial and should not be maintained[ The lackof phylogenetic information concerning the generaLecithodesmus\ Hunterotrema and Cetitrema pre!cludes us currently of giving new systematic pro!posals[ In addition\ further analysis on thecongruence of morphological\ molecular\ and bio!geographical data are also necessary[
Acknowledgements
We wish to thank Drs L[ Margolis\ D[I[ Gibson\R[ Bray and A[ Jones\ Profs[ M[D[ Dailey and M[Yurakhno and Mrs L[ Brieva for providing materialfor this work[ We are grateful to Dr[ Gibson forinformation provided during the elaboration of thiswork[ We thank Drs[ J[A[ Balbuena and E[ Barriofor revision of the paper[ Thanks are given to two
M[ Ferna�ndez et al[ : International Journal for Parasitolo`y 17 "0887# 656Ð664 664
referees for their comments[ Computer analyseswere carried out using the {{Servei de Bioin!forma�tica|| of the University of Valencia\ Spain[This work was supported by] grants PB85!9682 andPB85!9790 from DGES "MEC\ Spain# to AL andJAR\ respectively\ grant from the IberoamericanCooperation Institute of the Spanish Governmentto MF\ FJA and JAR and a predoctoral grant fromthe Conselleria d|Educacio� i Cie�ncia "GeneralitatValenciana# to the _rst author[ F[J[ Aznar holds apost!doctoral fellowship from the Ministry of Edu!cation and Culture of Spain[
References
ð0Ł Delyamure SL[ Helminthfauna of marine mammals "ecol!ogy and phylogeny#[ Moscow] Izdatel|stvo Akademii NaukSSSR\ 0844[
ð1Ł Skrjabin\ AS[ Remarks on the systematics of Campulidaeand Nasitrematidae[ In] Ministerstvo Rybnogo Khozya!ostva SSSR\ editor[ Kratkle tezisy dokladov II Vsesoyuz!nogo simpoziuma po parazitam i boleznyam morskikhzhivotnykh[ Simferopol] State Univ\ Ukrainian SSR\0865^45Ð47[
ð2Ł Adams AM\ Rausch RL[ A revision of the genus Ortho!splanchnus Odhner\ 0894 with considerations of the generaOdhneriella Skrjabin\ 0804 and Hadwenius Price\ 0821"Digenea] Campulidae#[ Can J Zool 0878^56]0157Ð0167[
ð3Ł Brooks DR\ O|Grady RT\ Glen DR[ Phylogenetic analysisof the Digenea "Platyhelminthes] Cercomeria# with com!ments on their adaptative radiation[ Can J Zool0874^52]300Ð332[
ð5Ł Lumb SM\ Bray RA\ Rollinson D[ Partial small subunit"07S# rRNA gene sequences from _sh parasites of the fam!ilies Lepocreadiidae and Fellodistomidae "Digenea# andtheir use in phylogenetic analyses[ Syst Parasitol0882^15]030Ð038[
ð6Ł Sambrook J\ Fritsch EF\ Maniatis T[ Molecular cloning[ Alaboratory manual[ New York] Cold Spring Harbor Lab!oratory Press\ 0878[
ð7Ł Garey JR\ Wolstenholme DR[ Platyhelminths mito!chondrial DNA] evidence for early evolutionary origin ofa tRNAserAGN that contains a dihydrouridine arm replace!ment loop\ and of serine!specifying AGA and AGG codons[J Mol Evol 0878^17]263Ð276[
ð8Ł Kwiatowski J\ Skarecky D\ Herna�ndez S\ Pham D\ QuijasF\ Ayala FJ[ High _delity of the polymerase chain reaction[Mol Biol Evol 0880^7]773Ð776[
ð09Ł Mierendorf RC\ Pfe}er D[ Direct sequencing of denaturedplasmid DNA[ In] Berger\ SL\ Kimmel\ AR\ editors[ Guideto molecular cloning techniques[ Methods in enzymology\vol[ 041[ San Diego] Academic Press\ 0876^445Ð451[
ð03Ł Saccone C\ Lanave P\ Pesole G[ Time and biosequences[ JMol Evol 0882^26]043Ð048[
ð04Ł Fitch WM[ Toward de_ning the course of evolution] mini!mum change for a speci_ed tree topology[ Syst Biol0860^19]395Ð305[
ð05Ł Lake JA[ A rate!independent technique for analysis ofnucleic acid sequences] evolutionary parsimony[ Mol BiolEvol 0876^3]056Ð067[
ð06Ł Saitou N\ Nei M[ The neighbor!joining method] a newmethod for reconstructing phylogenetic trees[ Mol BiolEvol 0876^3]395Ð314[
ð07Ł Kumar S\ Tamura K\ Nei K[ MEGA\ Molecular Evol!utionary Genetics Analysis\ version 0[90[ Institute ofMolecular Evolutionary Genetics[ The Pennsylvania StateUniversity\ 0882[
ð08Ł Kimura M[ A simple method for estimating evolutionaryrate of base substitution through comparative studies ofnucleotide sequences[ J Mol Evol 0879^05]000Ð019[
ð19Ł Dayho} MO[ Atlas of protein sequence and structure[Washington] National Biomedical Research Foundation\0868[
ð10Ł Moritz C\ Dowling TE\ Brown WM[ Evolution of animalmitochondrial DNA] relevance for population biology andsystematics[ Annu Rev Ecol Syst 0876^32]158Ð181[
ð11Ł Smith AB[ Rooting molecular trees] problems and stra!tegies[ Biol J Linn Soc 0883^40]168Ð181[
ð12Ł Milinkovitch MC\ Ort(� G\ Meyer A[ Novel phylogeny ofwhales revisited but not revised[ Mol Biol Evol[0884^1"2#]407Ð419[
ð13Ł Dailey MD[ The distribution and intraspeci_c variation ofhelminth parasites in pinnipeds[ Rapp P V Reun Cons IntExplor Mer 0864^058]227Ð241[
ð14Ł Abril E\ Balbuena JA\ Raga JA[ A new species of thegenus Zalophotrema "Digenea] Campulidae#\ Zalophotremaatlanticum n[ sp[\ from the liver of striped dolphin Stenellacoeruleoalba "Meyen\ 0722# "Cetacea] Delphinidae# inAtlantic waters[ Syst Parasitol 0880^07]022Ð027[
ð15Ł Beverley!Burton M[ Trematodes from the Weddell Seal\Leptonychotes weddelli "Lesson\ 0715# with a description ofOrthnosplanchnus weddelli n[sp[ "Trematoda] Campulidae#[Zool Anz 0861^078 0:1[S]38Ð59[
ð17Ł Hoberg EP\ Adams AM[ Phylogeny\ historical biog!eography\ and ecology of Anophryocephalus spp[ "Euce!stoda] Tetrabothriidae# among pinnipeds of the Holarcticduring the late Tertiary and Pleistocene[ Can J Zool0881^69]692Ð608[
ð18Ł Neiland KA\ Rice DW\ Holden BL[ Helminths of marinemammals[ I[ The genus Nasitrema\ air sinus ~ukes of delphi!nid cetacea[ J Parasitol 0869^45"1#]294Ð205[
ð29Ł Dailey MD\ Stroud R[ Parasites and associated pathologyobserved in cetaceans stranded along the Oregon coast[ JWildl Dis 0867^03]492Ð400[
ð20Ł Morimitsu T\ Tomoyuki N\ Minoru I\ Akira I\ MasashiK[ Parasitogenic octavus neuropathy as a cause of massstranding of Odontoceti[ J Parasitol 0875^61"2#]358Ð361[
![Binder 111, Isoparorchiidae A-Z [Trematoda Taxon Notebooks]](https://static.documents.pub/doc/80x56/63228c24aa6c954bc707bf05/binder-111-isoparorchiidae-a-z-trematoda-taxon-notebooks.jpg)
![Binder 039, Cyathocotylidae A-Z [Trematoda Taxon Notebooks]](https://static.documents.pub/doc/80x56/631bc7b4c2fddc481907b151/binder-039-cyathocotylidae-a-z-trematoda-taxon-notebooks.jpg)
