690 European Journal of Cell Biology 78, 690-697 (1999, October) . © Urban & Fischer Verlag · Jena hHp://www.urbanfischer.de/journals/ejcb

Mutations in the heatshock cognate 70 protein (hsc4) modulate Notch signaling

Huey K. Hinga, Lakshmi BangaloreC

, Xin Sunb and Spyros Artavanis-Tsakonasl) a Department of Biological Chemistry, UCLA School of Medicine, Los Angeles, CAIUSA b Department of Anatomy and Program in Developmental Biology, University of California, San Francisco, CAIUSA C Howard Hughes Medical Institute and Departments of Biology and Cell Biology, Boyer Center for Molecular

Medicine, Yale University School of Medicine, New Haven, COlUSA

Received July 8, 1999 Accepted July 10, 1999

Notch signaling - heatshock cognate protein - hsc4

In our effort to dissect the Notch signaling mechanism we have conducted a screen for mutations that reduce Notch signaling activity. We recovered nine complementation groups as modi­fiers of the hypomorphic Notch allele notchow. Apart from the known Notch signaling modulators Notch, Delta and master­mind we isolated alleles in vestigial, wingless, scalloped and clipped, genes known to affect wing morphogenesis. In addi­tion, we identified mutations in Bag, the gene encoding clath­rin heavy chain and a dominant mutation oC the cytosolic 70 kDa heatshock cognate protein encoded by the hsc4 gene, as Notch signaling modifier. We Cocused our attention on the lat­ter mutation because it displays dramatic genetic interactions with mutations oC the Notch receptor as well as several addi­tional Notch signaling pathway elements. We discuss how hsc4, a gene thought to be involved in subcellular trafficking, may affect the number oC Cunctional Notch receptors on the cell surface.

Introduction

Notch signaling defines an evolutionarily conserved cell inter­action mechanism that controls the acquisition of cell fates in a broad range of tissues . This signaling pathway appears to guide the developmental path of a precursor cell by modulat­ing its ability to respond to developmental signals, thus influ­encing differentiation, proliferation or apoptotic decisions. Notch signals act in a context-dependent manner interacting with other signaling pathways to implement a particular devel­opmental program [1]. The receptor of this fundamental and

1) Dr. S. Artavanis-Tsakonas, Massachusetts General Hospital Cancer Center, Building 149, 13th Street, Charlestown , MA 021291USA, e­mail: tsakonas@helix.mgh .harvard .edu .

pleiotropic cell interaction mechanism is encoded by the Notch locus (N). Genetic and molecular studies led to the identifica­tion of a number of genes encoding basic components of the Notch signal transduction pathway as well as genes capable of modulating Notch signals through their direct or indirect inter­action with the core components of the pathway. The interac­tion of the Notch receptor with its ligands Delta (Dl) or Serrate (Ser) eventually regulates nuclear activities via Suppressor of Hairless (Su(H)) a transcription factor which acts as the major downstream effector of Notch signaling [2, 18]. Modulators of Notch signaling include the cytoplasmic protein Deltex, which interacts directly with Notch and acts as a positive regulator of Notch signaling, the negative regulator Hairless (H), a nuclear factor thought to act through direct association with SuCH) and Mastermind, a nuclear protein of unknown function [2 , 4, 21]. It is clear that the activity of the pathway can be modu­lated by interactions at the level of the ligands, the receptor, and the cytoplasmic and nuclear effectors. It is also apparent that the activity of Notch signals is influenced by regulating the maturation and trafficking of the ligand and the receptor to and from the surface of the cell [6].

In our attempts to identify novel elements of the pathway as well as genes capable of modulating Notch activity in a general or tissue-specific manner, we have carried out a number of genetic modifier screens. Here we report the results of a screen aimed at identifying dominant enhancers and suppres­sors of notchoidl (nd l

), a recessive , hypomorphic Notch allele affecting wing margin development. Notch plays a central role in the establishment of the dorsaUventral boundary of the wing disc, which serves as an organizing center for wing mor­phogenesis. Apart from known genes of the Notch pathway, we have identified novel genes as modifiers of ndl

. We describe the characterization of one of the enhancers, which displays dramatic interactions with Notch pathway genes. Molecular cloning shows that the enhancer is a dominant allele of the heatshock cognate 4 gene (hsc4) that encodes the Hsc70 protein, one of the Hsp70 cognates [24].

0171-9335/99/78/10-697 $12.00/0

EJCB Mutations in the heatshack cagnate 70 protein (hsc4) modulate notch signaling 691

Materials and methods

Enhancer screen Canton-S males were fed 2S mM ethyl methanesulfonate and mated to nd1lnd1 females. Hemizygous nd1lY males and heterozygous nd11 + females were reared at 2S °C and screened under a dissecting micro­scope for enhancement of the nd1 wing phenotype. Modifier mutations were mapped and recovered over the appropriate FM6, CyO or TM3 balancer chromosomes.

Genetic mapping and three-point test-cross E(nd)195 were mapped between the markers red and Stubble (Sb) by either following its ability to enhance the nd1 phenotype, or its recessive lethality. To do so, these markers were first crossed into the nd1 back­ground, allowed to recombine with the E(nd)195 chromosome and then back-crossed to nd1lYor nd11Y; red males. To map the recessive lethality, the following deficiencies and transposition were used: Tp(3;Y)r/06

•85cI

MKRS (87D;88E), Df(3R)red1ITM6B (88B1; 88D3-4), Df(3R)ea831RPJI TM2 (88E7-13; 89A1), Df(3R)sbdI05ITM6B (88F9-89A1; 89B9-1O) and Df(3R)bxd1OOIDp(3;3)P5, Sb (89BS-6; 89E2-3). These crosses showed that E(nd)195 mapped to the 88E region (Fig. SA).

To further locate the enhancer within 88E, a three-point test-cross was carried out between E(nd)195, PZ[ry+ 4713J (88E1-2) and Sb. Vir­gins nd1lnd1; ry P4713 + Sblry + 195 + were crossed with nd1lY; r/061 r/06 to score for recombination between E(nd)l95 and PZ[ry+ 4713J (Fig. SB). Of 2734 individuals scored, 9 individuals were found in which there were recombination between PZ[ry+ 4713J and E(nd)195. Hence, E(nd)195 is separated from PZ[ry+ 4713J by 0.4 eM. Whenever PZ[ry+ 4713J became linked to E(nd)195 it variably lost Sb indicating that E(nd)195 is located to the right of PZ[ry+ 4713]. We refer to the six ry P4713 195 recombinants as S4A chromosomes and the three ry Sb recombinants as S4B chromosomes.

Revertant screens Males of the genotype, st Ki p" 1951TM3 were fed with 2S mM ethyl methanesulfonate (EMS) in 1 % sucrose overnight or exposed to 3 kV of X-rays and crossed with virgins of the genotype, w Jx241w di24. Off­spring were screened for the presence of males with kinked bristles, indicating that E(nd)195 has reverted to the null state. Such males were crossed with dx virgins again to test for breed true and to estab­lish a stock. One revertant, E13, was found from the EMS screen and one revertant, XK1, was found from the X-ray screen.

For the P element screen, virgins of the genotype, st Ki pp ry P4713 1951TM3 were crossed with males of the genotype, wlY,· .12-3ITM6. In the next generation, males of the genotype, sf Ki p" ry P4713 195 1.12-3 were crossed with virgins of the genotype, w dr41w dr'. Offspring were then screened for the presence of males with kinked bristles. Three P element-induced revertants were recovered, PA2, PB2 and PG4.

Molecular cloning off(nd)J95 Entry into the hsc410cus was done independently by plasmid rescue of PZ[ry+ 3550J and subcloning of the breakpoints of Df(3R)PG4. For the plasmid rescue of PZ[ry+ 3550J, genomic DNA was digested to completion with XbaI and Nhel. The digested DNA was purified, cir­cularized by ligation and used to transform DHSa to kanamycin resis­tance. A 3.7 kb piece of DNA flanking PZ[ry+ 3550J, which includes the 700 bp promoter and about 3 kb of the open reading frame of the adjacent transcript was recovered.

To subclone Df(3R)PG4 breakpoints, genomic DNA from Df(3R)PG4ITM3 flies were digested to completion with BamHI and EcoRI and electrophoresed in an agarose gel. The 3.6 kb band, con­taining rosy sequences from the transposed PZ element (the position of which was previously determined by Southern blotting) was gel purified and ligated to Bluescript to make a mini-library. Colonies were screened with a probe from the rosy gene. Five positively hybrid­izing colonies were recovered out of approximately 2000 colonies. A 400bp DraIII-EcoRI fragment distal to the right breakpoint was sub­cloned from the 3.6kb fragment.

Probes were synthesized from the genomic fragments recovered from PZ[ry+ 3550J and Df(3R)PG4 and used to screen a Canton-S genomic library. Phages recovered using the two probes overlapped extensively indicating that the P elements in Df(3R)PG4 and PZ[ry+ 3550J are inserted very close together. Three overlapping phages, ,-ES, ,-E3 and ,-R2 were characterized which together defined 30 kb sur­rounding the P element insertion sites (Fig. 6). Southern blot analyses of PA2, PB2, Df(3R)PG4, PZ[ry+ 3550J and XK1 show that they all break within an 8kb region. Phage DNAs were used to screen an embryonic cDNA library and two transcription units were found that are divergently transcribed away from a 700 bp promoter.

Sequencing hsc4J95 Mutant DNA was recovered by polymerase chain reaction from geno­mic DNA of hsc41951TM3 heterozygotes. Primers were designed according to the published sequence comparision between all the Dro­sophila hsc70 homologs [21], so as to minimize cross hybridization. The primer pairs are hs-97 (CTATCGTTTTGGGCACAG) and ha+993 (GATGACCGACTTGTCCAGCTT), which give a 1090 bp fragment as well as hs+943 (GACCCCGTGGAGAAGGCT) and ha+1989 (GTATGGTTGCATTGAGGTG), which give a 1047 bp fragment.

Results

A screen for modifiers of nd' The ndl mutation is a temperature-sensitive hypomorphic N allele [19]. Intragenic recombination analysis mapped ndl at the extreme proximal (3' end) of the locus. Early reports from our laboratory have associated the ndl mutation with a mis­sense mutation in the intracellular region [30]. However, recent analysis based on direct sequencing of PeR-amplified fragments from the ndl mutant did not confirm the earlier con­clusion. Three independent PeR-amplified clones, corre­sponding to the entire intracellular region were sequenced on both strands. Examination of the sequences did not reveal any amino acid mutations in the open reading frame when com­pared with wild-type sequences. It thus appears that the molecular lesion causing the hypomorphic ndl mutation maps outside of the coding region.

ndl is associated with notches in the wing margin, a pheno­type shown to be enhanced by mutations in other genes of the Notch signaling pathway, such as dx, mam and Su(H) [30, 10]. In an attempt to identify genes capable of modulating Notch signaling activity we have carried out a screen for modifiers of the ndl wing phenotype at 25 °e. Since ndl flies were judged to be too weak to be an effective target for mutagenesis, wild­type Canton-S males were mutagenized instead and crossed to nd1lndl virgin females. This cross, permitted the identification of modifiers in hemizygous ndllY males as well as heterozy­gous ndlJ+ females. We screened 66000 male progeny and roughly the same number of heterozygous females. Most of the 94 recovered modifiers behaved as dominant enhancers of the ndl wing phenotype and only a few acted as suppressors.

Modifiers of nd' As expected, we recovered loss-of-function mutations in genes of the Notch pathway as modifiers of ndl

. Seven novelloss-of­function N and four mam alleles were recovered as enhancers (E(nd)) while 13 Dl mutations were isolated as suppressors (Fig. 1). Three genes known to be involved in wing morpho­genesis were recovered as enhancers of ndl

. The first was vesti­gial (vg), which formed the largest complementation group,

692 H.K. Hing, l. Bongolore et 01.

Map position of dominant modifiers:

N sd !l.g Chromosome X ...J1_.,.-__ ')...J.J...( ___ -<>

dx

vg ~ ')~m

Chromosome II ,, ____ ,-L-, __ ~>__---J....I...-----

Su(H)

fJ2

Chromosome III J,

E(nd)] 95

I Dl (

)( E(sp/) Ser

Fig. 1. Map positions of dominant modifiers recovered from the ndl.

Chromosome sizes are relative to scale, and genes (loci) are placed roughly to their map position on the chromosome. Loci above the chromosomes are the ones recovered from our screen, whereas loci below are the ones not recovered from our screen, but have been implicated in interactions with ndl. We underlined the loci which had not been shown to interact with ndl prior to our screen.

containing 32 alleles. vg has been shown to be a direct tran­scriptional target of SuCH) [12, 16]. Four alleles of wingless (wg) were isolated as moderate enhancers [13] and one allele of scalloped (sd) was identified as a strong enhancer of nd l

. A complementation group consisting of ten independent X­linked enhancers of ndl were shown to be allelic to Bag (Bg), the gene encoding Drosophila clathrin heavy chain [5]. All Bg alleles are hemizygous lethal, showing a dominant wing blis­tering phenotype in heterozygous females and an enhanced "forked wing" phenotype in a transheterozygous combination with ndl (Fig. 2E).

Finally, two novel modifiers of nd1 were recovered: E(nd)88 and E(nd)195. The first, E(nd)88 mapped to the third chromo­some and was defined by six alleles. Homozygous E(nd)88 flies show a recessive wing-margin-Ioss phenotype reminiscent to that associated with clipped (cp) mutations (Fig. 2D). Unlike nd', the anterior and posterior wing margin is usually lost while the distal margin remains. Complementation tests confirmed that E(nd)88 is allelic to cpo Mapping of cp with respect to PZ(ry+) insertions, places cp between P1572 (74Cl-2) and Pl712 (75B1-2) and not to the 75D4-5 to 79A4-Bl region as previously reported. E(nd)88 and extant cp alleles were found not only to interact with N but with dx as well. They can domi­nantly enhance the dx phenotype, resulting in narrow wings and fused ocelli (data not shown). The other modifier is E(nd)195, which consists of one allele (Fig. 2e). We focused our attention on E(nd)195 because this mutation showed dra­matic interactions with several Notch pathway genes.

The genetics of E(nd)J95 E(nd)195 is recessive lethal and heterozygotes often showed rough eyes, nicked wings and extrasensory organs. The domi­nant phenotype of E(nd)195 was enhanced at 18°C compared with 25°C. Supernumerary macrochaetae were seen in all major bristle clusters and extra campaniform sensilla were observed along the third longitudinal wing vein. These pheno­types are suggestive of reduction in Notch signaling [7, 27]. To

Fig. 2. Phenotypic interaction between ndl and novel dominant modifiers. (A). Canton S. (B). nd1lndl (C). ndl

; E(nd)J951+ (D). ndll y; cpl+ (E). nd1

, Bglnd.

determine if indeed E(nd)195 reduces Notch signaling, we crossed it to various N alleles and to genes known to be involved in the Notch pathway. The results of these crosses are shown in Figure 3 and summarized in Figure 4.

EJC8 Mutations in the heatshock cognate 70 protein (hsc4) modulate notch signaling 693

G

While E(nd)195 enhances loss-of-function mutations in N and genes of the Notch pathway, it suppresses the phenotype of the gain-of-function N allele, spl [3)]. The E(nd)195 muta­tion suppresses both the bristle phenotype (Fig. 4F) as well as the rough eye phenotype associated with spl (Fig. 4B). Flies heterozygous for the deficiency of Dl, Df(3R)DIBx6

, showed thickened wing veins and deltas where veins join the wing mar­gin (Fig. 3G). The transheterozygote E(nd)195 +/+ DlBX6

showed severe wing nicking and blisters (Fig. 3H) as well as enhanced rough eyes (data not shown). Hence, E(nd)195 enhances the phenotypes of Dl mutants. Mutations in dx have wing phenotypes similar to those of Dl [9, 22, 29], but unlike Dl, dx is recessive viable. The double mutant, dx/Y; E(nd)195/ + dies as pharate adult. Escapers have tiny wings, small eyes and malformed legs and die shortly after eclosure. E(nd)195 is also lethal in transheterozygous combination with Beaded of Goldshmidt (BdG

) the dominant negative mutation of Ser [14]. In all cases, the synergistic effects between E(nd)195 and

Notch pathway elements, including the lethality associated with dx and Ser, are suppressed by removing a copy of H, which encodes a negative regulator of Notch signaling [3]. For

Fig. 3. E(nd)195 suppresses the phenotype of spl and its actions are antagonized by additional copies of the wild-type hsc4 gene. Flies homozygous for the spl mutation of Notch show small rough eyes (A) and split bristles (C). In the double mutant, spl/Y; E(nd)195/+, the bristle as well as rough eye phenotypes are suppressed (8) and (F). In contrast, the addition of one (D) or two (E) copies of a transgene encoding hsc4 restores the spl rough eye phenotype. (D) spl/Y; P[hsc4}/+; E(nd)195/+ and (E) spl/Y; P[hsc4}/P[hsc4J; E(nd) 195/+. (G) Wing from a Delta heterozygote, Df(3R)DIBX6/st Ki pp, showing wing vein thickenings and deltas. E(nd)195 enhances the wing vein phenotype of Delta; (H).

example, the triple mutant, nd1/nd1; E(nd)195 +1+ H2, has normal sized wings and the triple mutant, dx/dx; E(nd)195 +/+ H2, is viable (data not shown). The genetic interactions we observe are therefore consistent with the notion that E(nd)195 reduces the level of Notch signaling activity.

Meiotic mapping and molecular characterization of the E(nd)J9Slocus Meiotic mapping using either the nd1 enhancement or the recessive lethality associated with E(nd)195 as the phenotypic criterion indicate that E(nd)195 maps to 3-56.5, or in the region of 88E (Fig. 5 and see Materials and methods). Com­plementation tests between E(nd)195 and P element inser­tions in the 88E region, obtained from the Drosophila Genome Project, showed that E(nd)195 and PZ[ry+ 3550J are allelic. The ability of PZ[ry+ 3550J to complement E(nd)195 is restored when the P element is excised by transposition, indicating that PZ[ry+ 3550J and E(nd)195 affect the same gene. However, the PZ[ry+ 3550J mutation does not interact with Notch pathway genes, raising the possibility that the E(nd)195 mutation may be a gain-of-function allele. To

694 H.K. Hing, L. Bongolore el 01.

bristles wing veins eye

spl 01

~ / wing nd 1 I( 195 > Se r lethal

/ (~dX nd 2

eye lethal

H Fig. 4. Summary of the genetic interactions of E(nd)195. E(nd)195 modifies the activities of Notch signaling pathway during eye, wing, and bristle development. While it exacerbates mutations that reduce Notch activity such as nd1

, it rescues the mutation leading to hyperac­tivity of Notch such as spl. In addition to Notch alleles, E(nd)195 inter­acts with Delta, deltex and Serrate. The genetic interactions with Beaded-Serrate and with deltex are lethal and can be suppressed by the removal of the negative regulator of Notch signalling Hairless.

explore this hypothesis, we attempted to revert E(nd)195 to the null state by EMS, X-ray and P element-mediated muta­genesis. We took advantage of the lethal interaction between E(nd)195 and dx, and screened for mutations in E(nd)195 that allowed dxlY; E(nd)1951+ flies to live to adulthood. We recov­ered one EMS-induced revertant, EB, and one X-ray-induced revertant , XKl. Of 95000 E(nd)195 chromosomes subjected to dysgenic crosses, three revertants, PG4, PA2 and PB2 were recovered. This indicated that E(nd)195 is a dominant allele of PZ[ry+ 3550J.

Entry into the E(nd)195 locus was done independently by plasmid rescue of PZ[ry+ 3550J and subcloning of the break­points of the PG4 revertant (see Materials and methods). Iso­lation and characterization of 30 kb DNA surrounding the P element insertion sites shows two divergently transcribed open reading frames separated by a 700 bp noncoding region (Fig. 6) . The proximal open reading frame encodes a 9 kb transcript and the distal open reading frame encodes the heatshock cog­nate 4 gene (hsc4), which has been previously cloned by low stringency hybridization using sequences from the heatshock protein gene (hsp70) [24].

E(nd)J95 is encoded by hsc4 To determine the transcription unit corresponding to E(nd)195, we transformed flies with a 14kb fragment of geno­mic DNA P[hsc4J, between the coordinates -2 and + 12 (Fig. 6). P[hsc4J encompasses the hsc open reading frame, 5' regu­lator sequences and 4 kb downstream from the stopcodon. This transgene rescues the recessive lethality of PZ[ry+ 3550J and E(nd)195, unambiguously correlating both mutations with the hsc4 gene. Most importantly, the transgene is also able to modify the genetic interactions of E(nd)195. For example, it suppresses the enhancement of ndI by E(nd)195, restoring the wings of ndIIY; P[hsc4JI+; E(nd)1951+ to normal sizes. Simi­larly, it suppresses the lethal interactions between dx and E(nd)195, allowing dxlY; P[hsc4]1+; E(nd)1951+ flies to live to adulthood. Since the transgene suppressed, rather than enhanced the interactions of E(nd)195 with the Notch path-

A ry 52

red 195 53.6 56

Sb 58.2

~·t1-"'-----'-f-l ~}m1 ry506-85c _ &bd

recn bxd

Gap?

B Cla.s Genotype _...:p_h._no....;\y:;.,pe __ numbers Notes

roey enhancer stubble

ry 4713 Sb .. .. 1569 parental

ry 195 + 1115

ry 4713 .. + .. 25

recombinants ryl95 Sb 16

ry 4713 195 .. .. S4A

ry Sb .. S4B

Results: 195 mapa 0.4 eM to the right of P[ry+ 4713]

Fig. 5. E(nd)195 maps to the cytological band 88E. (A) Meiotic recombination places E(nd)195 at 3-56.5 between the loci red and Stubble (Sb) , a map position corresponding approximately to the cyto­logical interval 88D-89A of the giant salivary gland chromosome. To locate the recessive lethality, complementation tests with the foJlowing strains were carried out: Tp(3; Y)rl06.JJ5cIMKRS (87D;88E), Df(3R)redllTM6B (88Bl; 88D3-4), Df(3R)ea831RPlITM2 (88E7-13; 89Al), Df(3R)sbdJ05ITM6B (88F9-89Al; 89B9-1O) and Df(3R)bxd1IXlI Dp(3;3)P5, Sb (89B5-6; 89E2-3). However, neither the duplication covers, nor the deficiencies uncover E(nd)195. This suggests that there is probably a gap between the breakpoints of Dp(3;Y)rl06

.JJ5c and Df(3R)ea831RPl in 88E and that E(nd)195 probably resides within the gap. (B) To further locate E(nd)195 within 88E a three-point test-cross was carried out between E(nd)195, PZ{ry+ 4713J and Sb. This was done in the nd1 and rosy background to monitor the segregation of E(nd)195 and PZ[ry+ 4713J, respectively. Of 2734 individuals scored 9 individuals were found in which there were recombination between PZ{ry+ 4713J and E(nd)195, putting E(nd)195 at 0.4 cM away. When­ever PZ{ry+ 4713J became linked to E(nd)195 it variably lost Sb indi­cating that E(nd)195 is located to the right of PZ{ry+ 4713]. The six ry P4713 195 chromosomes are also called S4A chromosomes and the three ry Sb chromosomes caJled S4B chromosomes.

way genes, E(nd)195 acts as a negative regulator of the path­way. Consistent with this, the suppression of the gain-of­function spl phenotype E(nd) 195 can be reverted by hsc wild­type copies (Fig. 3D, E). The amount of Notch signaling seems to be directly correlated with the amount of hsc4 gene product since the mutant phenotypes are only partially res­cued by one copy, but fully rescued by two copies of the Pfhsc4J transgene (data not shown) .

To determine the molecular lesion of E(nd)195, the coding region of hsc4 was amplified by PCR and sequenced. Sequence analysis demonstrated that E(nd)195 is associated with a cytosine to thymine change at position 443. This point mutation changes the alanine at residue 148 to a valine. This alanine is a part of a sequence of eight amino acids (TVPAYFND) within the ATP-binding domain of Hsp70 that is highly conserved in all Hsp70-like proteins from E. coli to mammals [25]. Since the molecular data show that E(nd)195 is an allele of hsc4 we rename E(nd)195 as hsc4195 and the rever-

Ilea Mutations in the heatshock cognate 70 protein (hsc4) modulate notch signaling 695

Breakpoints of the revertants PG4, PA2, PB2 and XK1

5 5 1 H 2.4

H H 5 Xb

Proximal

8 Kb

AE3

-18 -16 -14 -12 -10 -8 -6 -4

Fig. 6. The 30 kb region surrounding the hsc4 locus. Genomic DNA fragments of this locus recovered from the enhancer trap line PZ[ry+ 3550J and the breakpoint of Df(3R)PG4 (see experimental proce­dures) were used as probes to identify the phages AES, AE3 and AR2. Together the three phages cover a 30 kb region encompassing at least two open reading frames which are divergently transcribed. The proxi-

tant alleles as hsc4PA2, hsc4PB2

, hsc4PG4 and hsc4xK1 and the enhancer trap allele as hsc43550

•

Discussion

Genetic interactions between Notch alleles and mutations in other genes have proven to be a powerful tool in identifying genes that are involved in Notch signaling [1, 29,10]. The most successful criteria used to indicate how important, direct and general the involvement of a particular modifier is in Notch signaling, has been the ability of the modifier to interact with other elements in the pathway and modulate Notch signaling in multiple tissues.

The nd1 phenotype used as the parameter for the present genetic screen is the result of lower Notch activity. We have shown previously that the nd1 mutation reduces the level of Notch activity in the wing to a threshold level, such that fur­ther reduction in the gene dosage of other Notch signaling components results in the drastic loss of wing material [30, 13]. nd1 maps genetically to the most proximal end (3' end) of the locus but the molecular lesion associated with it remains elu­sive. We failed to identify a lesion within the Notch open read­ing frame and therefore presume that the nd1 mutation may be associated with the 3' non-coding regions and thus influences the quantity but not the structure of the Notch receptor. A sec­ond allele, nd2

, with almost indistinguishable phenotype from nd1 seems to be associated with a frame shift at the 3' end of the coding region which adds 20 amino acids at the C terminus of the protein [30]. Such a lesion could affect the stability of the protein resulting also in lower levels of active receptor. Consistent with the notion that the nd phenotypes represent hypomorphic Notch alleles is also the fact that lowering the dosage of N, results in females (N/+) with notched wings simi­lar to the wings of the nd mutants.

XK1

P SE

Distal

hsc4 3550

IV AR2

-2 0 +2 +4 +6 +8 +10 +12

mal open reading frame encodes a large 9 kb transcript and the distal open reading frame encodes the hsc4 gene. Genomic Southern blots of PA2, PB2, PG4 and XKl show that their breakpoints are around the hsc4 open reading frame suggesting that E(nd)195 may be encoded by hsc4. Transposons carrying the genomic DNA from phage AR2 rescue aU the phenotypes associated with E(nd)195.

The screen for nd modifiers was validated by the fact that it uncovered the known Notch signaling elements Delta and mas­termind, in addition to Notch. mam has been identified in every N modifier screen carried out so far, although the precise role of mam in Notch signaling is still unknown [1]. Loss-of­function mutations of either Notch or mastermind were identi­fied as enhan~ers of the nd1 phenotype. In contrast, loss-of­function Delta mutations were identified as suppressors. Sev­eral studies established the existence of a transcriptional feed­back mechanism between Notch and Delta in lateral signaling. If indeed, the nd1 mutation affects the levels of the wild-type receptor, then a reduction of the ligand could restore critical balance between the receptor and the ligand. Given the hypo­morphic nature of the notchoid mutation, hsc4195 behaves as a negative regulator of Notch signaling. The genetic interactions displayed by hsc4195 allele and Notch pathway genes are broad indicating that this dominant hsc4 mutation impairs Notch sig­naling in the development of diverse tissues.

The molecular relationship between Notch signaling and hsc4 is not clear even though the genetic interaction pattern we report here is suggestive of an important link. Heat shock proteins have clearly been implicated as chaperonins in cellu­lar protein folding but the exact role of Hsc70 proteins in cel­lular physiology remains elusive. Moreover, since mutations in hsc 70 have not been reported in multicellular organisms their developmental role is unknown. Our analysis indicates that hsc4 is an essential gene in development, a finding compatible with its Ubiquitous expression pattern [8, 23]. Hsc70 proteins have been implicated in the uncoating of ciathrin during endo­cytosis as well as the translocation of polypeptides across cel­lular membranes [8a, 11]. Vescicular structures containing Notch have been seen both in cell culture when Notch­expressing cells encounter Delta-expressing cells, as well as in vivo in cells thought to be active in Notch signaling [17].

The link between Notch signals and endocytic events is how­ever poorly understood. Consistent with the notion that endo-

696 H.K. Hing, l. Bongolore et 01.

cytosis may regulate Notch signals, genetic studies indicate that shibire, the locus encoding dynamin, is required for nor­mal Notch signaling during Drosophila neurogenesis [26]. A link between endocytosis and Notch is also suggested by the fact that mutations in Bag, the gene encoding the clathrin heavy chain have been identified as modifiers in the present screen. In general, Notch signaling is exceptionally sensitive to gene dosage. In fact, N is one of a handful of genes in Dro­sophila that show phenotypes in both haploid and triploid con­ditions [19]. We therefore expect that genes interfering with the trafficking of molecules to or from the plasma membrane may be capable of modulating Notch activity.

The biosynthesis of the Notch receptor involves at least one functionally crucial cleavage in the trans Golgi network and transport to the plasma membrane where it is presented as a heterodimer [6]. Several lines of evidence [1] suggest that the signaling of the receptor involves additional, ligand­dependent cleavages and the subsequent transport of the intracellular Notch fragments to the nucleus. Nuclear trans­port of the intracellular domain of Notch depends on nuclear localization signals which have been shown to exist within that region [20]. Interestingly, biochemical studies have directly implicated Hsc70 in specific binding to nuclear localization sequences and nuclear import [15].

Further experimentation will be necessary to establish the molecular nature of the genetic interactions we document between Notch and hsc4 but the present study provides the basis both for exploring further this relationship as well as examining the function and developmental significance of the hsp 70 protein cognates.

Acknowledgments. We would like to thank Masahiro Go, nan Xu, Bob Lake and Rob Mann for discussions and their help. Special thanks to Julien Royet for pointing out a reading mistake in the ORF of the published sequence of notchoid. Much of this work was carried out at the Cell Biology Department at Yale and was supported by the Howard Hughes Medical Institute and by NIH grant NS26084.

References

[1] Artavanis-Tsakonas, S., Rand, M. D., Lake, R.: Notch signaling: Cell fate control and signal integration in development. Science 284,770-776 (1999).

[2] Bailey, A. M., Posakony, J. w.: Suppressor of Hairless directly activates transcription of enhancer of split complex genes in response to Notch receptor activity. Genes Dev. 9, 2609-2622 (1995).

[3] Baker, N. E., Mlodzik, M., Rubin, G. M.: Spacing differentia­tion in the developing Drosophila eye: a fibrinogen-related lateral inhibitor encoded by scabrous. Science 250, 1370-1377 (1990).

[4] Bang, A. G., Bailey, A. M., Posakony, J. w.: Hairless promotes stable commitment to the sensory organ precursor cell fate by negatively regulating the activity of the notch signaling pathway. Dev. BioI. 172,479-494 (1995).

[5] Bazinet, c., Katzen, A. L., Morgan, M., Mahowald, A. P., Lem­mon, S. K.: The Drosophila clathrin heavy chain gene: clathrin function is essential in a multicellular organism. Genetics 134, 1119-1134 (1993).

[6] Blaumueller, C. M., Qi, H., Zagouras, P., Artavanis-Tsakonas, S.: Intracellular cleavage of notch leads to a heterodimeric recep­tor on the plasma membrane. Cell 90, 281-291 (1997).

[7] Cagan, R. L., Ready, D. E: Notch is required for successive cell decisions in the developing Drosophila retina. Genes Dev. 3, 1099-1112 (1989).

[8] Craig, E. A., Ingolia, T. D., Manseau, L. J.: Expression of Dro­sophila heat-shock cognate genes during heat shock and develop­ment. Dev. BioI. 2, 418-426 (1983).

[8a] DeLuca-Flaherty, c., McKay, D.B., Parham, P., Hill, B.L. (1990): Uncoating protein (hsc70) binds a conformationally labile domain of clathrin light chain LCa to stimulate ATP hydrolysis. Cell 62, 875-887.

[9] Diederich, R. J., Matsuno, K., Hing, H., Artavanis-Tsakonas, S.: Cytosolic interactions between deltex and Notch ankyrin repeats implicates deltex in the Notch signalling pathway. Development 120,473-481 (1994).

[10] Fortini, M. E., and Artavanis-Tsakonas, S.: The suppressor of Hairless protein participates in Notch receptor signaling. Cell 79, 273-282 (1994).

[11] Geogopoulos, C., Welch, W. J.: Role of major heat-shock pro­teins as molecular chaperones. Annu. Rev. Cell BioI. 9, 601-634 (1993).

[12] Go, M. J., Eastman, D. S., Artavanis-Tsakonas, S.: Cell prolifer­ation control by Notch signaling in Drosophila development. Development US, 2031-2040 (1998).

[13] Hing, H. K., Sun, X., Artavanis-Tsakonas, S.: Modulation of wingless signaling by Notch in Drosophila. Mech. Dev. 47, 261-268 (1994).

[14] Hudriede, N. A., Gu, Y., Fleming, R. J.: A dominant-negative form of Serrate acts as a general antagonist of Notch activation. Development 124, 3427-3437 (1997).

[15] Imamato, N., Matsuoka, Y., Kurihara, T., Kohno, K., Miyagi, M., Sakiyama, E, Okada, Y., Tsunasawa, S., Yoneda, Y.: Anti­bodies against 70-kD heat shock cognate protein inhibit mediated nuclear import of karyophilic proteins. J. Cell BioI. 119, 1047-1061 (1992).

[16] Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K., Magee, J., Carroll, S. B.: Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382, 133-138 (1996).

[17] Kooh, P. J., Fehon, R. G., Muskavitch, M. A. T.: Implications of dynamic patterns of delta and Notch expression for cellular inter­actions during Drosophila development. Development 117, 431-440 (1993).

[18] Lecourtois, M., Schweisguth, E: The neurogenic Suppressor of hairless DNA-binding protein mediates the transcriptional activa­tion of the Enhancer of split Complex genes triggered by Notch signaling. Genes Dev. 9, 2598-2608 (1995).

[19] Lindsley, D. L., Zimm, G. G.: The Genome of Drosophila mela­nogaster. Academic Press, San Diego (1992).

[20] Lieber, T., Kidd, S., Alcamo, E. Corbin, v., Young, M. w.: Antineurogenic phenotypes induced by truncated Notch pro­teins indicate a role in signal transduction and may point to a novel function for Notch in nuclei. Genes Dev. 7, 1949-1965 (1993).

[21] Lyman, D. E, Yedvodnick, B.: Drosophila Notch receptor activ­ity suppresses Hairless function during adult external sensory organ development. Genetics 141, 1491-1505 (1995).

[22] Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M., Artavanis-Tsakonas, S.: Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development U1, 2633-2644 (1995).

[23] Palter, K. B., Watanabe, M., Stinson, L., Mahowald, A. P., Craig, E. A.: Expression and localization of Drosophila melano­gaster hsp70 cognate proteins. Mol. Cell BioI. 6, 1187-1203 (1986).

[24] Perkins, L. A., Doctor, J. S., Zhang, K., Stinson, L., Perrimon, N., Craig, E. A.: Molecular and developmental characterization of the heat shock cognate 4 gene of Drosophila melanogaster. Mol. Cell. BioI. 10, 3232-3238 (1990).

[25] Rubin, D.M., Mehta, A.D., Zhu, J., Shoham, S., Chen, X., Wells, Q.R., Palter, K.B. (1993): Genomic structure and sequence analysis of Drosophila melanogaster HSC70 genes. Gene 128, 155-163.

EJCB Mutations in the heatshock cognate 70 protein (hsc4) modulate notch signaling 697

[26) Seugnet, L., Simpson, P., Haenlin, M.: Requirement for synamin during Notch signalling in Drosophila neurogenesis. Dev. BioI. 192,585-598 (1997).

[27) Shellenbarger, D. L., Mohler, J. D.: Temperature-sensitive peri­ods and autonomy of pleiotropic effects of 11Nts1, a conditional Notch lethal in Drosophila. Dev. BioI. 62,432-446 (1978).

[28) Verheyen, E., Purcell, K., Fortini, M., Artavanis-Tsakonas, S.: Analysis of dominant enhancers and suppressors of activated Notch in Drosophila. Genetics 144, 1127-1141 (1996).

[29) Xu, T., Artavanis-Tsakonas, S.: deltex, a locus interacting with the neurogenic genes Notch, Delta and mastermind in Drosoph­ila melanogaster. Genetics 126, 665--677 (1990).

[30) Xu, T., Rebay, I., Fleming, R. J., Scottgale, T. N., Artavanis­Tsakonas, S.: The Notch locus and the genetic circuitry involved in early Drosophila melanogaster neurogenesis. Genes Dev. 4, 464-475 (1990).