Neuregulin 1 Type III/ErbB Signaling Is Crucial for Schwann Cell Colonization of Sympathetic Axons

Neuregulin 1 Type III/ErbB Signaling Is Crucial forSchwann Cell Colonization of Sympathetic AxonsStephan Heermann1,4*, Julia Schmucker2, Ursula Hinz1, Michael Rickmann2, Tilmann Unterbarnscheidt3,

Markus H. Schwab3, Kerstin Krieglstein4,5

1 Department of Neuroanatomy, University of Heidelberg, Heidelberg, Germany, 2 Department of Neuroanatomy, University of Gottingen, Gottingen, Germany,

3 Department of Neurogenetics, Max Planck Institute of Experimental Medicine, Gottingen, Germany, 4 Department of Molecular Embryology, Institute of Anatomy and

Cell Biology, University of Freiburg, Freiburg, Germany, 5 FRIAS, University of Freiburg, Freiburg, Germany

Abstract

Analysis of Schwann cell (SC) development has been hampered by the lack of growing axons in many commonly used invitro assays. As a consequence, the molecular signals and cellular dynamics of SC development along peripheral axons arestill only poorly understood. Here we use a superior cervical ganglion (SCG) explant assay, in which axons elongate aftertreatment with nerve growth factor (NGF). Migration as well as proliferation and apoptosis of endogenous SCG-derived SCsalong sympathetic axons were studied in these cultures using pharmacological interference and time-lapse imaging.Inhibition of ErbB receptor tyrosine kinases leads to reduced SC proliferation, increased apoptosis and thereby severelyinterfered with SC migration to distal axonal sections and colonization of axons. Furthermore we demonstrate that SCcolonization of axons is also strongly impaired in a specific null mutant of an ErbB receptor ligand, Neuregulin 1 (NRG1) typeIII. Taken together, using a novel SC development assay, we demonstrate that NRG1 type III serves as a critical axonal signalfor glial ErbB receptors that drives SC development along sympathetic axons.

Citation: Heermann S, Schmucker J, Hinz U, Rickmann M, Unterbarnscheidt T, et al. (2011) Neuregulin 1 Type III/ErbB Signaling Is Crucial for Schwann CellColonization of Sympathetic Axons. PLoS ONE 6(12): e28692. doi:10.1371/journal.pone.0028692

Editor: Nic D. Leipzig, The University of Akron, United States of America

Received March 31, 2011; Accepted November 14, 2011; Published December 16, 2011

Copyright: � 2011 Heermann et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: Deutsche Forschungsgemeinschaft, SFB 592-TPA22. The funders had no role in study design, data collection and analysis, decision to publish, orpreparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Schwann cells (SC), the main glial cell type of the peripheral

nervous system, are derivatives of the neural crest, a transient

structure emerging from the dorsal neural tube [1,2]. Normal SC

function is essential for the development and long term integrity of

peripheral nerves. The number of SCs in peripheral nerves is

adjusted to the number of axons, regulated by proliferation as well

as apoptosis of SC precursors. Several factors have been identified

that influence proliferation and survival of SCs as well as SC

myelination, including TGF-beta [3] and Neuregulin (NRG) 1

[4,5,6,7]. In contrast however, the molecular signals that control

SC precursor migration along nerve fibers are not well

understood. It is presumed that SC precursors originate from a

pool of migrating neural crest cells which move to nerve trunks of

developing efferent and afferent fibers and migrate along these

fibers to ensheath the nerve [8]. NRG1 might influence SC

migration, as demonstrated for rat SCs [9,10] and also for a

conditionally immortalized SC precursor cell line [11]. Genetic

screens in zebrafish have revealed that ErbB2 and ErbB3, which

serve as glial tyrosine kinase receptors for NRG1 in the PNS [12]

are essential for SC migration along the zebrafish lateral line organ

[13]. However, the molecular processes regulating development in

zebrafish may not fully recapitulate those in mammals and analysis

of SC migration in mammals is hampered by the inaccessibility of

peripheral nervous tissues, such as the sciatic nerve or the

sympathetic ganglia for time-lapse imaging in vivo. As a

consequence artificial in vitro assays such as the ‘‘Scratch Assay’’

or the ‘‘Boyden Assay’’ are frequently used to address SC

migration during development. Although these systems provide

the opportunity to obtain quantitative data, they miss two

important features. First, they lack axons the substrate along

which SC migrate physiologically, and second, they normally do

not address proliferation and apoptosis. In this investigation we

took advantage of the ganglion explantation technique [14]. Only

few studies have used a similar approach to analyze SC

development [9,15]. Using growing axons from explanted SCGs

in combination with time-lapse imaging we studied the molecular

processes involved in SC migration, proliferation and cell death

along developing sympathetic axons.

Materials and Methods

Ethics StatementAll animal work was carried out in agreement with the local

ethical committees. The University of Heidelberg/Regierung-

sprasidium Karlsruhe Referat 35 has approved this study (ID: T-

07/10 and T-59/08).’’

Collagen gel preparationCollagen gels were prepared according to a protocol of T.

Ebendal [16], with slight modifications. Briefly, 455 ml of 106MEM (Gibco), 112 ml of NaHCO3 (7.5%) (Gibco) and 50 ml of

glutamine (200 mM) (Gibco) and 383 ml of 0.15- 1 M NaOH

PLoS ONE | www.plosone.org 1 December 2011 | Volume 6 | Issue 12 | e28692

(Roth) were prepared as a concentrated medium. 210 ml of this

concentrated medium were gently mixed with 800 ml of a dialyzed

collagen stock solution, prepared from rat-tails. 50 ml of this

mixture were applied to cell culture wells (96 well plates, Nunc)

and maintained in cell culture incubator (37uC, 5% CO2 and

humid conditions) until a solid matrix was assembled.

Mice and tissue preparationTime pregnancy matings of NMRI and s100 GFP mice were

performed overnight with the day of the vaginal plug in the

morning considered as day 0.5. At embryonic day 16.5 (E16.5) or

18.5 (E18.5) respectively, mothers were sacrificed by cervical

dislocation and the embryos were harvested by cesarean section.

In addition, time pregnant mice were ordered from Charles River

(matings performed over day). NRG1 type III heterozygous mice

[17] were crossbred for 3 nights. Embryos were harvested for

SCG-dissection between E16.5 and E18.5 according to the same

protocol as the NMRI mice. Genotyping of genomic DNA was

performed using Chr8 sense Primer: 59-ACTTTCTTCTTCC-

CATTCTGT -39, Chr8 antisense Primer: 59-TTTCTCTTGAT-

TCCCACTTTG -39 and NEO antisense Primer: 59-TTTA-

CTCTTCCTTACGGTCTA -39.

Superior cervical ganglia (SCGs) of the embryos were dissected,

consecutively cleaned in DPBS (Gibco) and placed on collagen

gels.

Cell culture experiments and treatmentsSCGs on collagen gels were kept in serum free Neurobasal cell

culture medium containing glutamine (2 mM), B27 (16) and PSN

(penicillin/streptomycin/neomycin) (16) under humid conditions

in 37uC and 5% of CO2. SCG explants of E16.5 and E18.5

embryos showed the same characteristics under culture conditions.

All experiments were carried out under presence of nerve growth

factor (NGF, R&D, stock in PBS with 0.1% BSA: 50 ng/ml,

working concentration: 30 ng/ml) to facilitate optimal nerve

growth from the SCG explants into the collagen gel matrix. In

addition to NGF, EGFR/ErbB-2/ErbB-4 inhibitor (ErbB inhib-

itor/ErbB-inh)(Calbiochem, stock in DMSO: 4 mg/ml, working

concentration: 0.8 ng/ml) was used to inhibit ErbB signaling at

the level of the receptor (ErbB2/4). Experiments with the ErbB

inhibitor were carried out in different variations. In the first

variant the inhibitor was added at DIV (Day in vitro) 0 and the

experiment duration was either until DIV5 or until DIV8, in the

latter case with change of medium at DIV4. In the second variant

the inhibitor was added at DIV4/5 and the duration of the

experiments were until DIV9/10. For the third variant the

inhibitor was added at DIV3 with the experiment being

terminated at DIV4. In an additional set of experiments an

inhibitor of apoptosis, a caspase inhibitor (casp-inh, Caspase

inhibitor Z-VAD-FMK, Promega, 20 mM stock) was co-applied

with the ErbB-inhibitor at a concentration of 40 mm. Where

indicated Bromodeoxyuridin (BRDU 1:500, Fluka/Sigma) was

added to the medium for the last 6 hours of the experiment.

Experiments with Neuregulin 1 type III deficient SCGs were

performed for 6 days with time lapse imaging throughout the

whole period.

Time-lapse imaging and supplementary movie filesWhere stated, SCG explants were imaged in near live time. The

time-lapse movies were recorded with the following frame rates.

Movie S1 with 10 minutes, movie S2 with 30 minutes, movies S3

and S4 with 10 minutes, movies S5, S6, S7, S8, S9, S10 with

10 minutes and movies S11 and S12 with 20 minutes. Files were

assembled with jepg compression via ImageJ software (scale

bars = 100 mm). Time-lapse imaging was performed with a Leica

time-lapse imaging setup LASAF6000 and a Nikon time-lapse

imaging setup (Nikon Imaging Center Heidelberg). The tissue was

meanwhile incubated under humid conditions, 5% of CO2 and

37uC.

Image analyzes, quantification and statistical evaluationFor quantitative analyses of distances from the last SC to the

axonal tip and the proliferation index after ErbB-inh treatment

(BRDU/DAPI) the explants were cryosectioned and sampled. For

measuring distances 18 control and 18 ErbB-inh treated SCG

explants were used for estimation of the proliferation index 19

control and 18 ErbB-inh treated explants. For quantification of the

distance from the SCG explant to the furthest migrated SC and

the axonal length, explants were processed as whole mounts. To

facilitate optimal conditions for image acquisition with subsequent

measurements, the whole mount SCG explants were dried on

microscope slides. Distances and lengths were measured from the

explants to the periphery. For quantification of migration distances

in the case of ErbB-inh/Casp-inh cotreatment 21 control and 20

inhibitor treated ganglia were analyzed. For quantification of

Tunel positive vesicles after ErbB-inh/Casp-inh cotreatment 4

control and 5 treated ganglia were analyzed.

For quantification of migration distances after ErbB-inh

treatments, 23 inhibitor treated and 22 control explants were

used, for quantification of the axonal length 12 control and 12

ErbB-inh treated explants. Migration distances after aphidicolin

were quantified by using 12 control and 12 aphidicolin treated

explants. For quantification of apoptosis, 9 control and 8 ErbB-inh

treated explants were used and for quantification of proliferation

after aphidicolin treatment before imaging, 4 control and 8

aphidicolin treated explants. For both latter analyses whole

mounts were sampled. Distances and cell counts were performed

software based, using the NIH software ImageJ. Separate SCG

explants were taken as separate experiments for statistical

evaluation. Statistical data analyzes were performed by t-tests

using Graph Prism software (Graphpad.com).

Immunohistochemical analyzesExplant containing collagen gels were fixed with 4% PFA at the

end of an experiment, where indicated, and either further

cryoprotected in 30% sucrose solution over night with consecutive

free floating cryosectioning (80–120 mm thickness freezing micro-

tome) (Reichardt- Jung) or directly taken for whole mount

processing.

Immunohistochemistry, using standard protocols for antibodies

against TH (Chemicon, rabbit, polyclonal, 1:1000–2000, mouse

anti-TH, 1:400) S100 (Sigma, mouse, monoclonal, 1:100) pHH3

(Milipore, rabbit polyclonal, 1: 400) was performed. Briefly,

sections were blocked in PBS containing 10% normal donkey

serum and 2% Triton6100 for 2 hours with consecutive antibody

incubation in blocking solution over night. The next day, after

washing, the sections were incubated with labeled secondary

antibodies (donkey anti rabbit/donkey anti mouse/FITC/

Alexa488/CY3). Further, sections were mounted on gelatine

coated microscope slides and air-dried. In the end nuclear

counterstaining (DAPI, 1:10000) was performed for 5 minutes

with consecutive washing and mounting in aqueous mounting

medium (DAKO/Mowiol). Explants used for whole mount

immunohistochemistry were dried on microscope slides, for best

analyses in two dimensions. Images were taken by either

conventional fluorescence microscopy with Zeiss and Olympus

microscopes or with confocal microscopy with a Leica confocal

SPE. BRDU Immunohistochemistry was performed with an

Nrg1 III/ErbB Crucial for Axonal SC Colonization


antibody (Abcam sheep polyclonal 1:100) according to the

manufacturers recommendations with slight variations. Briefly,

sections were incubated in 1N HCL 10 min on ice, in 2N HCL

10 min at room temperature and 10 min at 37uC followed by

incubation in 150 mM borate buffer (pH 8,4). Blocking was

performed with 10% NDS (Normal Donkey Serum) and 2%

Triton X-100 in PBS for 1.5 hours. The following steps were

according to standard immunohistochemistry, mentioned above.

Tunel stainings were performed according to manufacturers

description (Dead End Fluorometric Tunel System, Promega)

with slight adjustments owing to whole mount stainings.

RT-PCRFor RT-PCR, SCG tissue, explanted at embryonic day 16,

harvested at DIV3 was taken. RNA was isolated according to a

standard protocol and reversely transcribed. PCR for Neuregulin

1 subtypes was performed with the following forward primer, for

Neuregulin 1 type I: GCCGAAGGCGACCCGAGC, for Neur-

egulin 1 type II: ACAGCAGGTACATCTTCTTCATGGA and

for Neuregulin 1 type III: TCAGGAACTCAGCCACAAACAA-

CAG, combined with the reverse primer: TTTTGCAGTACGC-

CACCACACACAT respectively. Adult wildtype cortex (ctx) was

used as positive control.

Results

Time lapse imaging of Schwann cell migration alongsympathetic axons

To analyze SC migration, explants of embryonic (E16–18.5)

mouse superior cervical ganglia (SCGs) were grown on a collagen

matrix (Fig. 1E). In the presence of NGF (30 ng/ml), axons

elongate from the SCG explants into the matrix (Fig. 1A, F, G, H),

followed by a wave of migrating cells from the ganglion towards

the periphery (Fig. 1B, movie S1). Penetration of axons into the

matrix can be appreciated in the 3D reconstruction performed

with a confocal z-stack scan (Fig. 1 G, H, movie S13). For time

lapse imaging also a transgenic mouse line was used in which SCs

and SC precursors were marked by GFP expression under control

of the human S100 promoter [18] (movie S1 and S6).

Furthermore, by immunostaining for S100, migrating cells were

identified as S100-positive SCs (Fig. 1 B, C and D). Thus, this

assay has two major advantages. First, it models in vivo SC

migration along outgrowing axons. Second, it is accessible to time

lapse imaging (movie S1, S2, S5, S6). These features demonstrate

the experimental power of the SCG explant assay compared to

other SC migration assays frequently used in mouse or other

rodents.

ErbB inhibition prevents colonization of distal axonalcompartments

ErbB signaling was shown to be active during SC development

in the somatic peripheral nervous system [19]. Thus, we wanted to

address whether ErbB signaling is also relevant for SC develop-

ment in the sympathetic nervous system. To this end, we blocked

ErbB signaling with a pan-specific ErbB inhibitor (ErbB-inh,) [20].

Numerous SCs can be seen migrating along axons in solely NGF-

treated SCG explants (movie S3). In contrast, only bare axons are

visible when explants are additionally treated with the ErbB-inh

starting at DIV0 (movie S4). Interestingly, when kept in culture for

a long period (until DIV5/DIV8) SCs can be found again

migrating along axons. This indicates that the ErbB-inh when

added at DIV0 is not killing the entire pool of SC precursors

within the ganglion. To analyze whether inhibition of ErbB

signaling can block the migration of SCs that have already

colonized sympathetic nerves, ErbB-inh treatment was started

with a delay following a pretreatment with NGF only. Traveling

distances of SCs were quantified by measuring two parameters.

One parameter was the mean distance between the most distally

located axon associated SC nucleus and the tip of the axon

(scheme, Fig. 2B). The second parameter was the mean distance

from the SCG explant to the most distally localized SC (scheme,

Fig. 2D), which reflects the distance SCs have migrated. The

distance from the most distally localized SC nucleus to the tip of

the axon is increased dramatically after ErbB-inh treatment (3.5

fold) compared to the controls. Also SC nucleus-free axonal

regions were seen after Erb-inh treatment, ranging from 130–

370 mm. To determine migration distances, SCG explants were

treated with ErbB-inh at DIV3 until the assay was terminated at

DIV4. The mean distance of the furthest SC nucleus to the

explant (Fig. 2D and E) was measured. Importantly, after ErbB-

inh treatment the mean distance from the margin of the explant to

the most distal SC (Fig. 2D/E) was reduced to 70%, compared to

Figure 1. Schwann Cell Migration Assay using NGF inducedaxon outgrowth from SCG explants. SCG explants derived frommouse E16–E18 were cultured on collagen gels and treated with NGF(30 ng/ml). A: Overview, immunohistochemistry for TH (green) withDAPI nuclear counterstaining, explant at DIV4 (scalebar = 500 mm). B:Overview, immunohistochemistry for S100 (red) explant at DIV4(scalebar = 200 mm). C/D: Immunohistochemistry for TH (green) withnuclear counterstaining DAPI (blue). Clear (red) S100 positive cells areattached to the TH positive axons (arrows). (scalebar = 50 mm) Note thatafter sectioning and performance of immunohistochemistry, Schwanncells can also be found close to the axonal endings.doi:10.1371/journal.pone.0028692.g001



Figure 2. ErbB signaling is important for Schwann cell migration. A: Immunohistochemistry (DIV9/10), TH (green) and DAPI (blue) of an NGFtreated control (ctr) and and NGF/ErbB-inh treated (starting DIV4/5) sample (scale bars = 50 mm). Ctr: NGF treated SCG explant, ErbB-inh: combinedNGF and ErbB-inh treated SCG explant (E16.5). Note the presence of SC nuclei in the proximity to the axonal endings (arrowheads) in the control,whereas in the ErbB-inh treated probe large uncovered areas are visible (asterisks). B: scheme showing the first method for quantification of thedistance between the distal Schwann cell nucleus and the axonal tip. C: Quantification of the distances between the distal SC nucleus and the axonaltip. Quantification has been performed for inhibitor treatments starting at DIV4/5 (t-test: p value,0,0001). Distances are given in percentage to therespective NGF treated controls which are set as 100%. Graphs are presented as mean and +/2 SEM. Note the drastic increase of the distances. D:Scheme showing the second method for quantification of distances between SCG explants and SC nuclei treated from DIV3 to DIV4 on. E:Quantification of mean distances between SCG explant and the furthest SC nucleus. (t-test: p value,0,0001). The solely NGF treated controls were setto 100%. Graphs are presented as mean and +/2 SEM. F: TH immunohistochemistry (green) of a control and a ErbB-inh treated sample. G:Quantification of axonal lengths between ctr and ErbB-inh treated samples. The mean axonal length of the control was set to 100%. (t-test: pvalue = 0.3105) Graphs are presented as mean and +/2 SEM.doi:10.1371/journal.pone.0028692.g002



controls (Fig. 2E). These data strongly suggest that blocking ErbB

receptors slows SC colonization of distal axonal compartments.

Importantly, axonal length might be influenced by SCs or itself

influence the distances between the leading SCs, the explant and the

axonal tip. To this end, TH-ir positive axons were measured from

the border of explants to the periphery at DIV4 after treatment with

the ErbB-inh at DIV3. When compared to controls only a very mild

increase in axonal length was observed (Fig. 2F/G).

ErbB signaling promotes SC proliferationSince proliferation and survival of SCs may affect their

migraton, we asked whether ErbB signaling affects SC mitosis.

Thus, we employed a delayed treatment of SCG explants (DIV4/5

until DIV9/10) with ErbB-inh and added BRDU to the culture

medium for the last 6 hours of the experiment. For quantitative

analysis the explants were cut and immunostained for TH and

BRDU combined with a DAPI nuclear counterstaining (Fig. 3A).

When we determined the BRDU/DAPI proliferation ratio

(Fig. 3B) we observed a reduction to less than 50% in the ErbB-

inh treated explants. To address whether proliferation and

migration functionally interact, we aimed at uncoupling both

processes. To this end we used Aphidicolin, a cytostatic drug,

which retains cells in the early S phase of mitosis by blocking DNA

polymerases [21]. The impact of Aphidicolin on SC proliferation

was directly validated by immunostaining for phosphorylated

histone 3 (pHH3), a marker for cell mitosis. Quantification showed

a massive reduction of pHH3-positive axon associated SCs (Fig. 3

C/D). We want to note that even though Aphidicolin acts as a

cytostatic drug we observed dead SC nuclei, especially after a

longer treatment over two days. es S7/S7a show explants treated

Figure 3. ErbB signaling is affecting Schwann cell proliferation. A: delayed treatment of SCG explants (starting at DIV4/5) and additionallyanalyses of BRDU incorporation. Immunohistochemistry, TH (green), BRDU (red) and DAPI (blue) of control (ctr) and ErbB-inh treated (ErbB-inh)samples. Whereas in the control many nuclei (DAPI/blue) are also positive for BRDU (red) (arrowheads), in the ErbB-inhibitor treated sample there areonly very few nuclei positive for BRDU (arrowhead). B: Analysis of the DAPI/BRDU ratio. After treatment with ErbB-inh SC proliferation is decreaseddrastically. T-test: p-value = 0,0001. Graphs are presented as mean and +/2 SEM. C: Immunohistochemistry TH (green), phH3 (red) and DAPI (blue).Control (ctr) Aphidicolin (Aph), note the difference in the number of phH3 positive cells. D: Analysis of the proliferation index (pHH3/DAPI). B:Quantification of proliferation index (pHH3/DAPI) (t-test: p value,0,0001) Graphs are presented as mean and +/2 SEM. E: DAPI nuclear staining of acontrol (ctr) and a Aphidicolin (Aph) treated sample. F: Quantitative analyses of migration distances between control and Aphidicolin treated sample.(t-test: p value = 0.0062) Graphs are presented as mean and +/2 SEM. Note that a mild reduction of the migration distance is visible after Aphidicolintreatment.doi:10.1371/journal.pone.0028692.g003



with Aphidicolin. Throughout imaging SC migrating could be

observed, in Aphidicolin treated explants (movie S5/S6),

whereas directed SC migration was halted after a treatment

with ErbB-inh (movie S7/S8, see movies S5 and S6 as controls).

However, although SC migration was not blocked by Aphidi-

colin treatment (movie S9/S10), migration distance was

modestly reduced (Fig. 3 E/F).

ErbB signaling affects SC migration indirectlyTo address the effect of ErbB inhibition on SC apoptosis,

explants were analyzed by Tunel staining and quantification of

apoptotic vesicles in sampled areas. A dramatic increase of

apoptotic vesicles in ErbB-inh treated samples compared to

controls (Fig. 4A) was observed. To investigate whether increased

cell death affects the migratory potential of the surviving SC pool,

we employed a combined delayed treatment with the ErbB-inh

and a Caspase inhibitor (Casp-inh) to block apoptosis. The anti

apoptotic activity of the Casp-inh was estimated by Tunel staining

and quantification of apoptotic vesicles in sampled areas in

comparison to control explants. The Casp-inh applied in

combination with the ErbB-inh significantly reduced apoptosis

(Fig. 4B) to levels comparable to controls. Surprisingly however,

after blocking both ErbB signaling and apoptosis, no difference in

migration distances could be observed (Fig. 4C) when compared to

control explants. This suggests an indirect negative effect of ErbB

inhibition on SC migration and colonization of distal axonal

compartments.

The type III variant of NRG1 is crucial for SC colonizationMultiple NRG1 isoforms are produced by alternative splicing

and grouped into three subclasses according to the presence of

distinct N- terminal domains [22]. We examined which of these

isoforms may act upstream of glial ErbB receptors during SC

migration in the sympathetic nervous system. To identify NRG1

isoforms expressed in SCGs during development, RT-PCR was

performed on SCG RNA prepared at DIV3 from SCGs explanted

at E16.5. SCGs displayed prominent NRG1 type III expression,

whereas type I was only weakly expressed and type II virtually

absent (Fig. 5A). We therefore analyzed SC migration in SCG

explants derived from NRG1 type III deficient mice and control

littermates (E16.5–18.5). In NRG1 type III-deficient SCG explants

normal axonal outgrowth was detected (Fig. 5 B–E, movie S12,

ctr: movie S11).

In contrast, we observed a strongly reduced number of

migrating SCs along elongating axons of NRG1 mutants when

compared with control explants (Fig. 5 B–E). As a result we

observed SCs in proximal regions (Fig. 5 F–K), but distal regions

of NRG1 type III mutant axons almost completely lacked SCs

(Fig. 5 F–H), with only a few exceptions (Fig. 5 I/K). We conclude

that axonal NRG1 type III is required for the SC colonization of

distal compartments of sympathetic axons.

Discussion

A more detailed understanding of the molecular mechanisms

that regulate SC development has been hampered by methodo-

logical restrictions. Many studies to date used ‘‘Boyden assays’’ or

‘‘Scratch assays’’ to analyze SC migration. Here, we employed a

SC migration assay, which has been adapted from the classical

ganglion explant technique [14]. This assay more closely mimics

development in vivo, as it contains axons the physiological

substrates for SC migration and allows SC migration out of an

explanted SCG along outgrowing axons to the periphery. Only

few others have used similar approaches [9,15].

We identify signaling by ErbB receptor tyrosine kinases as a

major regulator of SC development in the sympathetic nervous

system with respect to SC proliferation, survival and colonization

of distal axonal areas. Pharmacological blockade of ErbB2/4

potently reduced SC proliferation and induced apoptosis.

Figure 4. ErbB inhibition interferes with SC migration indirect-ly. Quantitative analyses of Tunel positive vesicles of NGF treatedcontrol versus ErbB-inh treated samples (t-test: p value,0.0001). Graphsare presented as mean and +/2 SEM. A strong increase in Tunel positivevesicles is visible in the ErbB inhibited explants. B: Quantitative analysesof Tunel positive vesicles after a combined treatment with ErbB-inh andCasp-inh (t-test: p value = 0.8553). Graphs are presented as scatter blotwith mean. Note that the Casp-inh potently inhibits apoptosis. C:Quantitative analyses of migration distances after a combinedtreatment with ErbB-inh and Casp-inh (t-test: p value = 0,2706). Graphsare presented as scatter blot with mean to also show the inner groupvariance.doi:10.1371/journal.pone.0028692.g004



Furthermore, SC colonization of distal axonal compartments was

severely affected by ErbB inhibition as demonstrated by time-lapse

imaging as well as by quantification of migration distances.

To address the different phenotypes observed and to investigate

how these phenotypes interact, we employed several assays, in

which we pharmacologically uncoupled ErbB signaling from SC

proliferation and survival. The massive SC migration out of an

explant (movies S1/S2) indicates that proliferation is necessary to

provide the large number of migrating cells. However, since

inhibition of SC proliferation (without blocking ErbB signaling)

did not prevent migration (movies S9/S10) and only mildly

affected the colonization of distal axonal compartments in the

investigated time frame, we propose that SCs can migrate along

sympathetic axons in the absence of cell division, similar to

findings in the peripheral nervous system of zebrafish [13].

Furthermore, we investigated the interplay between SC apoptosis

and migration. Unexpectedly, while the inhibition of ErbB

signaling severely affected the migration of SCs to distal parts of

sympathetic axons (Fig. 2), normal SC migration was restored

when apoptosis was blocked together with ErbB signaling. This

Figure 5. Analyzes of Neuregulin 1 type III deficient SCG explants. A: RT-PCR for Neuregulin 1 splice variants from SCG RNA. Tissue wasexplanted at E16.5 and harvested at DIV3. Adult wildtype cortex was taken as positive control. Note that Neuregulin 1 type III is strongly expressed,whereas type I is only weak and type II is almost not expressed. B–K: Confocal images (scalebar 100 mm) B–E: Immunostainings of control explants, TH(green), s100 (red) with DAPI nuclear counterstaining (blue), D: close up of boxed area in C, nuerous SCs can be seen in proximity to axonal tips(arrows). F–K: Immunostainings of Nrg1 typeIII- KO explants, TH (green), s100 (red) with DAPI nuclear counterstaining (blue), G: close up of boxed areain F, SCs can be seen almost exclusively in proximal regions (F, G and H) with only few exceptions (arrows in L and M).doi:10.1371/journal.pone.0028692.g005



finding argues against an essential direct role for ErbB signaling in

the migration of SCs along sympathetic axons and is at odds to

studies in zebrafish [13]. However, since previous studies have

shown that much lower levels of ErbB signaling are required to

promote SC migration compared to proliferation [10], we cannot

exclude the possibility that residual ErbB activity persists in our

explant assay after pharmacological treatment, which might be

sufficient to restore migration when massive SC apoptosis is

blocked. Also other factors could compensate when ErbB signaling

is blocked but Schwann cell survival is maintained. Potential

candidates for this, also shown to influence SC motility, are GDNF

[11] NGF [23] and IGF-1 [24].

Finally, we provide data, which suggest the splice variant NRG1

type III, as the major axonal ligand for ErbB receptors to promote

SC colonization of sympathetic axons. Meyer et al [25] suggested

this splice variant to be expressed in sympathetic ganglia at E12.

Here we show that NRG1 type III continuous to be expressed at a

late embryonic stage. Migration assays using NRG1 type III-

deficient SCG suggested an essential role of NRG1 type III for the

directed migration of SCs along sympathetic nerves. Since a

reduced number of SCs persists in the proximity of explanted

NRG1 type III-deficient sympathetic ganglia, we argue that

impaired migration cannot be explained solely by the loss of

(premigratory) SCs. Findings in NRG1 type III null mutants from

a previous study [17] also demonstrated a lack of SCs in distal

areas of peripheral nerves. Reduced SC numbers in distal axonal

areas were explained by impaired proliferation and increased

apoptosis of SCs in the absence of NRG1 signaling, which acts as a

SC mitogen and survival factor in vitro [4,26,27].

However, this interpretation does not fully explain, why in our

study SCs are present in the vicinity of explanted ganglia but fail to

colonize distal areas. Considering our data regarding ErbB

receptor blockade, it is conceivable that reduced survival in the

proximal regions of axons leads to stalling or even backward

movement of viable migrating SCs, which would indirectly impair

the colonization of distal axonal compartments. Aberrant

migration (including ‘backward’ movement) has been observed

after pharmacological blockade of ErbB signaling in zebrafish

[13]. A reason for not observing large amounts of dead SCs along

NRG1 typeIII deficient axons as we did after ErbB blockade could

be due to the experimental setup. Interfering with ErbB signaling

of migrating wildtype SCs was performed at DIV3 and led to

massive SC death. In the other experimental setup, NRG1 typeIII

was genetically depleted and absent from the start of the

experiment. Therefore a steady state could have been adjusted

earlier. In addition, ErbB inhibition led to reduced proliferation.

Although SCs were able to migrate in general when cell division

was blocked, a reduced proliferation from the beginning of the

experiment could lead to a massively reduced number of SCs.

Finally we propose that due to reduced proliferation and survival

the few SC in the vicinity of NRG1 type III KO SCG explants

rather stall than migrate to distal compartments.

In summary the SCG explant culture is a powerful tool to

investigate SC development. We used this assay and characterized

the role of NRG1/ErbB signaling for SC proliferation, apoptosis

and colonization of distal axon compartements during peripheral

sympathetic axon development.

Supporting Information

Movie S1 S100-GFP (E17.5), imaging start DIV2, until DIV3.

(AVI)

Movie S2 NGF treated (E18.5), imaging start DIV1, imaging

duration 2 days.

(AVI)

Movie S3 Control to ErbB-inh (E16.5) movie 4, imaging start

DIV2, imaging duration 2 days.

(AVI)

Movie S4 ErbB-inh (E16.5), imaging start DIV2, imaging

duration 2 days (factors added DIV0).

(AVI)

Movie S5 Ctr (E17) to movies 7 and 9, imaging DIV3–DIV4.

(AVI)

Movie S6 (E17.5) ctr to movies 8 and 10, imaging DIV3–DIV4,

arrows show direction of SC migration.

(AVI)

Movie S7 ErbB-inh (E17), imaging DIV3–DIV4 (factors added

at DIV3).

(AVI)

Movie S8 (E17.5) ErbB-inh, imaging DIV3–DIV4 (factors

added at DIV3), arrows show direction of SC migration.

(AVI)

Movie S9 Aphidicolin (E17), imaging DIV3–DIV4 (factors

added at DIV3).

(AVI)

Movie S10 (E17.5) Aphidicolin, imaging DIV3–DIV4 (factors

added at DIV3), arrows show direction of SC migration.

(AVI)

Movie S11 Neuregulin 1 type 3-ctr (E16–18.5) to movie 12,

imaging start DIV0, duration for 6 days.

(AVI)

Movie S12 Neuregulin 1 type 3-KO (E16–18.5), imaging start

DIV0, duration for 6 days.

(AVI)

Movie S13 3D reconstruction of a confocal z-stack of an control

explant.

(AVI)

Acknowledgments

The authors would like to thank Prof. Klaus Unsicker in whose department

a part of the study was conducted. The authors would also like to thank

Klaus-Armin Nave for support of the project, Amit Agarwal and the mouse

facility of the MPI of Experimentelle Medizin (Gottingen) for breeding

Neuregulin 1 type III mutants and Marcel Florl for genotyping, Christian

Humml for kind input and lively discussions, NIH award NS29071 to LW

Role and DA Talmage for generation of the Neuregulin 1 type III mouse

line (tm1 lwr), ZTE, University of Gottingen, for NMRI mouse matings,

Welsley J. Thompson for providing S100-GFP mice, Thomas Misgeld for

making the latter mice available, Prof. Mirsky and Prof. Jessen for

discussion, Dr. Urmas Arumae for sharing protocols, Jutta Fey for excellent

technical assistance, Christian F. Ackermann, Ulrike Engel and the Nikon

Imaging Center at the University of Heidelberg.

Author Contributions

Conceived and designed the experiments: SH MR KK. Performed the

experiments: SH JS UH TU. Analyzed the data: SH JS UH. Contributed

reagents/materials/analysis tools: SH MR TU MHS KK. Wrote the

paper: SH MHS KK.



References

1. Jessen KR, Mirsky R (2005) The origin and development of glial cells in

peripheral nerves. Nat Rev Neurosci 6: 671–682.

2. Woodhoo A, Sommer L (2008) Development of the Schwann cell lineage: from

the neural crest to the myelinated nerve. Glia 56: 1481–1490.

3. D’Antonio M, Droggiti A, Feltri ML, Roes J, Wrabetz L, et al. (2006) TGFbeta

type II receptor signaling controls Schwann cell death and proliferation in

developing nerves. J Neurosci 26: 8417–8427.

4. Dong Z, Brennan A, Liu N, Yarden Y, Lefkowitz G, et al. (1995) Neu

differentiation factor is a neuron-glia signal and regulates survival, proliferation,

and maturation of rat Schwann cell precursors. Neuron 15: 585–596.

5. Grinspan JB, Marchionni MA, Reeves M, Coulaloglou M, Scherer SS (1996)

Axonal interactions regulate Schwann cell apoptosis in developing peripheral

nerve: neuregulin receptors and the role of neuregulins. J Neurosci 16:

6107–6118.

6. Day WA, Koishi K, McLennan IS (2003) Transforming growth factor beta 1

may regulate the stability of mature myelin sheaths. Exp Neurol 184: 857–864.

7. Zhang L, Ma Z, Smith GM, Wen X, Pressman Y, et al. (2009) GDNF-enhanced

axonal regeneration and myelination following spinal cord injury is mediated by

primary effects on neurons. Glia 57: 1178–1191.

8. Lai C (2005) Peripheral glia: Schwann cells in motion. Curr Biol 15: R332–334.

9. Mahanthappa NK, Anton ES, Matthew WD (1996) Glial growth factor 2, a

soluble neuregulin, directly increases Schwann cell motility and indirectly

promotes neurite outgrowth. J Neurosci 16: 4673–4683.

10. Meintanis S, Thomaidou D, Jessen KR, Mirsky R, Matsas R (2001) The neuron-

glia signal beta-neuregulin promotes Schwann cell motility via the MAPK

pathway. Glia 34: 39–51.

11. Corenjo M, Nambi D, Walheim C, Sommerville M, Walker J (2010) Effect of

NRG1, GDNF, EGF and NGF in the migration of a Schwann cell precursor

line. Neurochem Res 35: 1643–51.

12. Garratt AN, Britsch S, Birchmeier C (2000) Neuregulin, a factor with many

functions in the life of a schwann cell. Bioessays 22: 987–996.

13. Lyons DA, Pogoda H, Voas MG, Woods IG, Diamond B, et al. (2005) erbb3

and erbb2 are essential for schwann cell migration and myelination in zebrafish.

Curr Biol 15: 513–524.

14. Levi-Montalcini R, Booker B (1960) Excessive Growth of the sympathetic

ganglia evoked by a protein isolated from mouse salivary glands. Proc Natl Acad

Sci U S A 46: 373–384.

15. Gumy LF, Bampton ETW, Tolkovsky AM (2008) Hyperglycaemia inhibitsSchwann cell proliferation and migration and restricts regeneration of axons and

Schwann cells from adult murine DRG. Mol Cel. Neurosci 37: 298–311.16. Ebendal T (1989) Use of collagen gels to bioassay nerve growth factor activity. In

Rush RA editor Handhook Series: Methods in the Neurosciences, Vol. 12.Chichcster: John Wiley & Sons. Ltd. pp 81–93.

17. Wolpowitz D, Mason TB, Dietrich P, Mendelsohn M, Talmage DA, et al. (2000)

Cysteine-rich domain isoforms of the neuregulin-1 gene are required formaintenance of peripheral synapses. Neuron 25: 79–91.

18. Zuo Y, Lubischer JL, Kang H, Tian L, Mikesh M (2004) Fluorescent proteinsexpressed in mouse transgenic lines mark subsets of glia, neurons, macrophages,

and dendritic cells for vital examination. J Neurosci 24: 10999–11009.

19. Morris JK, Lin W, Hauser C, Marchuk Y, Getman D, et al. (1999) Rescue of thecardiac defect in ErbB2 mutant mice reveals essential roles of ErbB2 in

peripheral nervous system development. Neuron 23: 273–283.20. Klutchko SR, Zhou H, Winters RT, Tran TP, Bridges AJ, et al. (2006) Tyrosine

kinase inhibitors. 19. 6-Alkynamides of 4-anilinoquinazolines and 4-anilinopyr-

ido[3,4-d]pyrimidines as irreversible inhibitors of the erbB family of tyrosinekinase receptors. J Med Chem 49: 1475–1485.

21. Ikegami S, Taguchi T, Ohashi M, Oguro M, Nagano, et al. (1978) Aphidicolinprevents mitotic cell division by interfering with the activity of DNA polymerase-

alpha. Nature 275: 458–60.22. Falls DL (2003) Neuregulins: functions, forms, and signaling strategies. Exp Cell

Res 284: 14–30.

23. Anton ES, Weskamp G, Reichardt LF, Matthew WD (1994) Nerve growthfactor and its low-affinity receptor promote Schwann cell migration. Proc Natl

Acad Sci U S A 91: 2795–2799.24. Cheng HL, Steinway M, Delaney CL, Franke TF, Feldman EL (2000) IGF-I

promotes Schwann cell motility and survival via activation of Akt. Molecular

and Cellular Endocrinology 170: 211–215.25. Meyer D, Yamaai T, Garratt A, Riethmacher-Sonnenberg E, Kane D, et al.

(1997) Isoform-specific expression and function of neuregulin. Development 124:3575–3586.

26. Brockes JP, Lemke GE, Balzer DR (1980) Purification and preliminarycharacterization of a glial growth factor from the bovine pituitary. J Biol Chem

255: 8374–8377.

27. Lemke GE, Brockes JP (1984) Identification and purification of glial growthfactor. J Neurosci 4: 75–83.



Date post:	28-Nov-2023
Category:	Documents
Upload:	global-studies
View:	0 times
Download:	0 times

Neuregulin 1 Type III/ErbB Signaling Is Crucial for Schwann Cell Colonization of Sympathetic Axons

Documents