FEBS Letters 584 (2010) 153–158

journal homepage: www.FEBSLetters .org

Overexpression of the single-stranded DNA-binding protein (SSB) stabilisesCAG�CTG triplet repeats in an orientation dependent manner

Federica Andreoni a, Elise Darmon a, Wilson C.K. Poon b, David R.F. Leach a,*

a Institute of Cell Biology, School of Biological Sciences, University of Edinburgh, Darwin Building, King’s Buildings, Edinburgh, EH9 3JR, UKb SUPA and School of Physics, University of Edinburgh, James Clerk Maxwell Building, King’s Buildings, Mayfield Road, Edinburgh EH9 3JZ, UK

a r t i c l e i n f o

Article history:Received 30 September 2009Accepted 9 November 2009Available online 16 November 2009

Edited by Berend Wieringa

Keywords:Trinucleotide repeat instabilitySingle-stranded DNA-binding proteinSbcCD

0014-5793/$36.00 � 2009 Federation of European Biodoi:10.1016/j.febslet.2009.11.042

Abbreviations: TNR, trinucleotide repeat; SSB, sprotein; amp, ampicillin; ssDNA, single-stranded DNA

* Corresponding author. Address: Room 415, DarwUniversity of Edinburgh, Mayfield Road, EH9 3JR, Edi650 8650.

E-mail address: d.leach@ed.ac.uk (D.R.F. Leach).

a b s t r a c t

The stability and deletion-size-distribution profiles of leading strand (CAG)75 and (CTG)137 trinucleo-tide repeat arrays inserted in the Escherichia coli chromosome were investigated upon overexpres-sion of the single-stranded DNA-binding protein (SSB) and in mutant strains deficient for the SbcCD(Rad51/Mre11) nuclease. SSB overexpression increases the stability of the (CAG)75 repeat array andleads to a loss of the bias towards large deletions for the same array. Furthermore, the absence ofSbcCD leads to a reduction in the number of large deletions in strains containing the (CTG)137 repeatarray.� 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction

Repeated DNA sequences are found throughout the human gen-ome in both genes and intergenic regions [1–3]. One class of re-peated sequence is represented by trinucleotide repeats (TNRs)which are composed of stretches of three nucleotides repeated intandem and whose expansion underlies several neurological andneurodegenerative diseases [4]. A TNR found in gene coding re-gions is CAG�CTG and its expansion is responsible for nine neuro-degenerative illnesses, classified as polyglutamine disorders [5,6].Interestingly, a bias towards expansions has been observed in germand somatic cells while deletions seem to occur more frequently inrapidly dividing organisms such as bacteria and yeast [3,7,8]. Thefact that TNRs can form DNA secondary structures supports thewidely accepted hypothesis that polymerase slippage is the pri-mary cause of instability [9,10]. Extrusion of DNA loops may occurduring replication of CAG�CTG tracts, leading to contractions if thesecondary structure forms on the template strand or to expansionsif it forms on the nascent strand [11,12]. During replication, DNAloops have a higher chance to form on the lagging strand templatewhere stretches of single-stranded DNA (ssDNA) are present be-

chemical Societies. Published by E

ingle-stranded DNA-binding

in Building, Kings Buildings,nburgh, UK. Fax: +44 (0) 131

tween Okazaki fragments. In vitro studies showed that CTG repeatsform more stable secondary structures than CAG repeats. Withinslipped strand structures, CTG extrusions form DNA hairpins whileCAG extrusions give rise to random coil structures that are oftencovered by the single-stranded DNA-binding (SSB) protein [13].This may underlie the higher level of instability associated toTNR arrays in which the CAG repeat is found on the leading strandtemplate. Orientation dependent instability in Escherichia coli hasbeen explained based on hairpin-formation dynamics. SSB proteinof E. coli is an essential protein that binds ssDNA during replication,recombination and repair and can be involved in impeding the for-mation of DNA hairpins. The role of SSB destabilisation on leadingstrand (CTG)100 and (CTG)180 repeat arrays instability was investi-gated in plasmids using a temperature sensitive mutant ssb-1,showing that destabilising SSB greatly increases the instability ofthe arrays [14].

During replication, the SbcCD nuclease (Rad50/Mre11 homo-logue) cleaves a hairpin structure formed on the lagging strandtemplate by a DNA palindrome, leading to the formation of adouble-strand break (DSB) [15]. This cleavage does not lead toinstability of the palindrome, presumably because repair byrecombination is conservative and the palindrome investigatedwas not flanked by direct repeats (longer than the restriction sitesused in its construction) [15]. This observation is consistent withthe cleavage of DNA hairpin substrates by SbcCD protein in vitro[16]. SbcCD also stimulates the deletion of palindromic DNA sepa-rating direct repeats and alters the distribution of deletion end-points [17]. Furthermore, the deletion end-points are affected by

lsevier B.V. All rights reserved.

Table 1Escherichia coli strains.

Strain Genotype Source

DL1995 MG1655 LacZv� lacIq ZeoRv+ lacZ::(CAG)75 [18]DL2305 MG1655 LacZv� lacIq ZeoRv+ lacZ::(CTG)137 [18]DL3297 DL1995 cynX::GmR This workDL3298 DL2305 cynX::GmR This workDL3311 BW27784 lacZ::(CAG)75 cynX::GmR (P1 from DL3297) This workDL3548 DL3311 DsbcDC This workDL3714 DL3311 + pAM34/ssb This workDL3715 DL3548 + pAM34/ssb This workDL3785 BW27784 lacZ::(CTG)137 cynX::GmR (P1 from DL3298) This workDL3788 DL3785 + pAM34/ssb This workDL3799 DL3785 DsbcDC This workDL3800 DL3799 + pAM34/ssb This work

154 F. Andreoni et al. / FEBS Letters 584 (2010) 153–158

SbcCD even in the absence of a DNA palindrome, suggesting thatthe misfolding of a random coil can be recognised by SbcCD inthe context of strand-slippage [17]. A bias towards the formationof large deletions for a leading strand CAG repeat array, in the pres-ence or absence of SbcCD, was consistent with the formation oflarge DNA secondary structures in single-strands composed ofCTG repeats [18]. A similar bias towards large deletions was ob-served for the CTG leading strand orientation. However, in the ab-sence of SbcCD and of proofreading by DnaQ this bias was lost. Thissuggested that the bias towards large deletions for the CTG leadingstrand orientation was influenced by SbcCD but was less easily ex-plained by secondary structure formation given that the single-strands implicated were predicted to be composed of CAG repeats[18].

In order to address the hypothesis that DNA secondary struc-tures formed in ssDNA are implicated in the deletion of CAG�CTGrepeat arrays we have tested the prediction that overexpressionof SSB inhibits repeat array contraction. We have also investigatedthe effect of the presence or absence of SbcCD on instability todetermine whether the effects on deletion sizes observed in thesbcDC recQ background are reproduced in the presence of proof-reading. We show here that overexpression of the SSB protein sta-bilises a (CAG)75 repeat array in both sbcDC+ and sbcDC�

backgrounds. Additionally, SSB overexpression induces a changeof the deletion-size-distribution profile of this (CAG)75 repeat ar-ray. A loss of the bias towards large deletions was observed, sug-gesting a role for SSB in preventing the formation of large DNAhairpins in ssDNA. On the other hand overexpression of SSB hasno effect on the frequency of deletion formation for a (CTG)137 re-peat array. This provides evidence against the formation of hairpinDNA structures in ssDNA for this orientation of the repeat array. Aspreviously observed in the absence of proofreading, SbcCD does af-fect the deletion-size-distribution of a (CTG)137 repeat array. Thisapparently contradictory observation requires explanation giventhe lack of evidence for stable hairpin structures for this orienta-tion of the array from our SSB assay.

2. Materials and methods

2.1. Repeat length and orientation

(CAG)75 and (CTG)137 TNR arrays were analysed in this work.The orientation of the TNRs refers to the leading strand templateand their length was chosen to have a comparable basal-instabilitylevel.

2.2. Strains and plasmids

All the strains used in this work were constructed by plasmidmediated gene replacement (PMGR) [19] or by P1 transduction.To facilitate transduction of the TNR arrays, a gentamycin resis-tance gene was inserted into the cynX gene using plasmidpDL2812 [15]. P1 lysates were made from strains DL3297 andDL3298 (Table 1), containing (CAG)75 and (CTG)137 repeat arraysrespectively. For overexpressing SSB, the E. coli ssb gene and pro-moter were amplified using ssb-F1 AAAAACTGCAGCTACCGGCGA-TCACAAAC and ssb-R1 AAAAAGAATTCGGCTGGCAGATGCCTTAATCprimers. pAM34/ssb was constructed by inserting the PCR productat EcoRI and PstI restriction sites in pAM34 [20]. DsbcDC mutantswere constructed by PMGR using plasmid pTOFsbcDC [21].

2.3. Cell lysates

1 mL of OD600nm = 0.6 cell culture was spun down and cellswere resuspended in 200 lL lysis buffer (1 mM Tris–HCl pH 6.8,

100 mM DTT, 2% SDS, 0.1% bromophenol blue, 10% glycerol), boiledfor 10 min and stored at �20 �C.

2.4. Western blots

5 lL of cell lysate were loaded on 15% polyacrylamide gels. Pro-teins were transferred to a nitrocellulose membrane which wasblotted using a-SSB antibody (1:40 000) and a-rabbit antibody(1:5000). The signal was detected on a radiographic film usingECL reagent (Pierce).

2.5. Instability assay

An instability assay was carried out over time to follow theinstability level of (CAG)75 and (CTG)137 repeat arrays during cellgrowth. A single colony was picked from a streak of the desiredstrain and inoculated in 5 mL LB or LB supplemented with 1 mMIPTG and 100 lg/mL ampicillin (amp) to trigger the expression ofpAM34/ssb. After overnight growth, cells were diluted in freshmedium to an OD600nm of 10�5. Samples were taken for analysisafter overnight growth (generation 0) and after 20, 40, 60, 80 and100 generations. Strains DL3311, DL3548, DL3785 and DL3799were grown in LB and plated on LB-agar. Strains containingpAM34/ssb, DL3714, DL3715, DL3788 and DL3800, were grown un-der two different conditions. A first group was grown in presenceof IPTG and amp for the first overnight only and then grown inLB for the rest of the experiment to select for loss of pAM34/ssb.A second group was grown in presence of IPTG and amp for thewhole duration of the experiment to select for retention of plasmidpAM34/ssb. Cells were plated at generation 0, 20, 40, 60, 80, 100and 96 colonies per plate had the length of their TNR array mea-sured using FAM-Ex-test-F TTATGCTTCCGGCTCGTATG and Ex-test-R GGCGATTAAGTTGGGTAACG primers, as previously de-scribed [21].

2.6. Gene mapper analysis

Individual PCR reactions were diluted 1:5 in ddH2O. 1.5 lL of afluorescent size standard (Gene Scan-500LIZ and Gene Scan-1200LIZ for (CAG)75 and (CTG)137, respectively) was added to1 mL HiDi reagent (ABI) and 1 lL of the diluted PCR productswas added to 9 lL of the size standard-HiDi mix. The TNR lengthwas analysed as previously described [21].

2.7. Deletion-size distribution analysis

To analyse the deletion-size-distribution profile of the strainsused in this work, deletions events occurring on plates and in li-quid culture were considered. Only single deletion events were in-cluded in the analysis.

F. Andreoni et al. / FEBS Letters 584 (2010) 153–158 155

3. Results and discussion

3.1. Overexpression of SSB stabilises the (CAG)75 repeat array

Cells harbouring pAM34/ssb contained approximately 30–40times more SSB protein than normal and SSB overexpression didnot affect cell growth or viability (data not shown). The SSB level

1

0 20 40

2

0 20 40

3

0 20 40

aGeneration

(CAG)75

(CTG)137

1 Wild type SSB level

Initial SSB overexpression2

Continual SSB overexpression3

Fig. 1. SSB level monitoring. The SSB protein level was assessed at generation 0, 20, 40,experiment. (2) SSB was overexpressed during the first overnight growth (generation 0)overexpressed during the whole course of the experiment. (a) Generation 0–40 and (b)

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0 20 40 60 80 100

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0 20 40 60 80 100

(CTG)137 sbcDC+

Wild type SSB level

Initial SSB overexpression

Continual SSB overexpression

Linear regression: wild type SSB level

Linear regression: initial SSB overexpression

Linear regression: Continual SSB overexpression

(CAG)75 sbcDC+

a

cGeneration number

Generation number

Pro

po

rtio

n o

f in

stab

ility

Pro

po

rtio

n o

f in

stab

ility

Fig. 2. Proportion of instability. (a) (CAG)75 repeat instability in sbcDC+ background (b)sbcDC+ background (d) (CTG)137 repeat instability in sbcDC� background. The lines (linear)the standard error of the mean.

was monitored by western blot during the course of the experi-ments (Fig. 1). SSB overexpression increased the stability of the(CAG)75 repeat array in both sbcDC+ and sbcDC� backgrounds(Fig. 2a and b). At wild type SSB levels, the instability steadily in-creased as a function of the generation number while an initialoverexpression of SSB led to a lower instability level, followed byan increase in instability when the SSB level was brought back to

60 80 100 60 80 100 60 80 100

b1 2 3

60, 80 and 100. (1) A wild type SSB level was maintained during the course of the. A wild type SSB level was maintained for the rest of the experiment. (3) SSB wasgeneration 60–100.

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0 20 40 60 80 100

(CAG)75 sbcDC-

(CTG)137 sbcDC-

b

d

Generation number

Pro

po

rtio

n o

f in

stab

ility

Pro

po

rtio

n o

f in

stab

ility

Generation number

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0 20 40 60 80 100

(CAG)75 repeat instability in sbcDC� background (c) (CTG)137 repeat instability inrepresent the best fit lines. The experiment was repeated twice and error bars show

156 F. Andreoni et al. / FEBS Letters 584 (2010) 153–158

wild type level. Continual SSB overexpression over 100 generationsresulted in a very low level of instability of the array. The instabil-ity level of (CTG)137 was not affected by overexpressing SSB ineither sbcDC+ or sbcDC� backgrounds (Fig. 2c and d). According toa widely accepted model, orientation dependent instability iscaused by the different propensities of CAG and CTG repeats to

Fig. 3. (CAG)75 and (CTG)137 deletion-size distribution curves. Deletion-size distributiolength (percentage of parental length), against the percentage of the event frequencydistribution of the points was approximated using a fourth order polynomial.

form hairpins [13]. CTG repeats form more stable hairpin struc-tures resulting in greater instability problems and therefore theCAG orientation, where CTG repeats lie on the lagging strand tem-plate, would be less stable than the CTG orientation. While we can-not exclude unknown indirect effects of SSB overexpression onrepeat array instability, the SSB-dependent decrease of instability

ns were drawn by plotting the length of the deleted array relative to the parentalrelative to the total number of deletion events. The best fit curve modelling the

F. Andreoni et al. / FEBS Letters 584 (2010) 153–158 157

in (CAG)75 strains is consistent with the explanation that SSB canimpede the formation of CTG hairpins on the lagging strand tem-plate by binding ssDNA at the replication fork (Fig. 4a and b0).The stabilising effect of SSB overexpression was not observed forthe (CTG)137 repeat array indicating that the mechanism leadingto instability is different for the two orientations. Therefore, wehypothesise that, at natural or elevated SSB levels, hairpin-forma-tion may not be a predominant cause of instability for the(CTG)137 repeat array for which expansions and contractions maybe caused by the formation of unstructured CAG extrusions, lead-ing to polymerase slippage [22]. This result would imply that SSBcan impede the formation of DNA hairpins in CTG single-strandsbut cannot prevent deletion formation in unstructured DNA extru-sions (Fig. 4).

3.2. SSB overexpression causes a loss of the bias towards largedeletions in (CAG)75 strains

CAG�CTG deletion-size distribution was shown to be biased to-wards large deletions in the E. coli chromosome, consistent with

a

b

c

Slippage-mediated and/orSbcCD-mediated deletion

Fig. 4. Secondary structure dynamics and trinucleotide repeat (TNR) instability. During r(b) or hairpin structures (b0) that may cause DNA slippage (c and c0), leading to deletioslippage has occurred and give rise to an additional deletion product (c or c0). When CTformation of large hairpins, more stable than small ones, is predicted, explaining the bimpede the formation of such large hairpins, consequently leading to a decrease in the ncleavage of such hairpins would be masked by the fact that a substantial number of largwhen CAG repeats lie on the lagging strand template (CTG orientation), the DNA may formformation is independent of the SSB level. When the polymerase slips across large unstruwhose stability will be increased as a function of the repeat length and that can be aAlternatively, the SbcCD protein may be able to recognise and cleave the unstructured loodependent on the length of the substrate [16], either cleavage of (c or c0) would expcontribution to the stability of the strand-slippage intermediate of larger structures is pstrand because of their weaker structure forming potential and therefore inability to forepresent newly synthesised strands of DNA, green dots represent the SSB protein.

contractions caused by the formation of large DNA structures[18]. This finding was confirmed in our experiments (Fig. 3a ande). However, SSB overexpression in (CAG)75 strains altered the pro-file of the deletion-size distribution curve that changed from beingnegatively-skewed to nearly flat-shaped (Fig. 3b and d). This resultsupports the hypothesis that SSB overexpression can prevent theformation of large CTG hairpins on the lagging strand templatein vivo (Fig. 4a and b0). Such an effect was not observed for the(CTG)137 repeat array (Fig. 3f). CAG repeats on the lagging strandmay in fact be able to give rise to extrusions whose formation isindependent of SSB overexpression. Deletion of such extrusionswould be possible by polymerase slippage (Fig. 4).

3.3. Absence of SbcCD alters the deletion-size-distribution profile of the(CTG)137 repeat array

It has previously been shown that in a sbcDC dnaQ double mu-tant carrying a (CTG)95 repeat array, the deletion-size distributionbias towards big deletions was disrupted [18]. Here we show thatsbcDC mutant with an otherwise wild type genetic background,

b’

IncreasedSSB level

Slippage-mediated and/or SbcCD-mediated deletion

c’

eplication (a) CAG�CTG repeats (red lines) could form unstructured extrusions loopsns. The SbcCD nuclease may act on unstructured loops or hairpin structures afterG repeats lie on the lagging strand template (CAG orientation), a bias towards the

ias towards large deletions observed in (CAG)75 strains. Overexpressing SSB wouldumber of large deletions (interchange between a and b0). The effect of SbcCD on thee deletions observed would be caused by polymerase slippage. On the other hand,unstructured extrusion loops (b) whose size is predicted to be unbiased and whose

ctured loops (c), these may have the chance to organise into hairpin structures (c0)ttacked and cleaved by SbcCD, giving rise to a higher number of large deletions.p (c) in the context of the strand-slippage intermediate. Since the SbcCD nuclease is

lain why the bias towards large deletions is partially lost in an sbcDC mutant. Aredicted to be particularly noticeable when the CAG repeats are on the looped outrm hairpins in the absence of the slipped strand closing off the loop. Blue arrows

158 F. Andreoni et al. / FEBS Letters 584 (2010) 153–158

also has a similar effect on the deletion-size-distribution profile ofa (CTG)137 repeat array (Fig. 3g and h). In the absence of SbcCD, thebias towards large deletions is partially lost, suggesting the pres-ence of SbcCD-dependent and SbcCD-independent pathways thatcan lead to large deletions for this orientation. The effect is small,but cannot be ignored even though it indicates an effect of SbcCDon the repeat array orientation that is not expected to form stablehairpins. Furthermore, given the results presented here, this is theorientation of the repeat array that does not form detectable hair-pins as revealed by overexpression of SSB. To understand this ef-fect, it is important to consider the nature of the structurerecognised by SbcCD. If a hairpin structure in ssDNA were to berecognised and cleaved, this would result in the formation and re-pair of a DSB, as we have observed for a DNA palindrome [17]. Thatthis reaction can occur efficiently without causing instability hasbeen established in the case of the palindrome [17]. On the otherhand, if the structure cleaved by SbcCD is a looped out strandwhere replication has copied and slipped across the base, the prod-uct is loss of the looped out DNA and no DSB. This is consistentwith the observation that SbcCD increased the frequency of dele-tion of palindromes only when flanked by direct repeats and al-tered the deletion end-points whether the direct repeats areseparated by a palindrome or a sequence of normal DNA [17].We propose therefore that SbcCD recognises large looped outstrands within the replication slippage intermediate and enhancesthe formation of large deletions, whether or not there is an intrin-sic ability to form a stable hairpin in ssDNA. We can detect thisstimulation of large deletions by SbcCD in the orientation that doesnot form hairpins in single-strand DNA precisely because of the ab-sence of an intrinsic folding tendency. The other orientation of therepeat array with the potential to form folded structures in single-strands generates a deletion profile biased towards large deletionsirrespective of the presence or absence of SbcCD but sensitive toSSB overexpression. This is illustrated in Fig. 4. In conclusion, over-expression of SSB provides further evidence that single-strandscomposed of CTG repeats can form DNA secondary structuresin vivo whereas similar structures are not detected for single-strands composed of CAG repeats. Furthermore, despite our lackof evidence for structure formation in single-strands composed ofCAG repeats, this sequence is subject to processing by the SbcCDnuclease and we hypothesise that this is within the context of anintermediate stabilised by a newly replicated strand that hasslipped across the structure.

Acknowledgments

We would like to acknowledge Dr. Rabaab Zahra for providingstrains containing the repeats and for all the valuable help, Dr. JohnEykelenboom for providing pAM34/ssb plasmid, Martin White forcritical reading of the manuscript, Prof. Roger McMacken (Johns

Hopkins) for providing us with a-SSB antibody. This work was sup-ported by Engineering and Physics Sciences Research Council(EPSRC) and Medical Research Council (MRC).

References

[1] Jeffreys, A.J., Holloway, J.K., Kauppi, L., May, C.A., Neumann, R., Slingsby, M.T.and Webb, A.J. (2004) Meiotic recombination hot spots and human DNAdiversity. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359, 141–152.

[2] Yant, S.R., Wu, X., Huang, Y., Garrison, B., Burgess, S.M. and Kay, M.A. (2005)High-resolution genome-wide mapping of transposon integration inmammals. Mol. Cell Biol. 25, 2085–2094.

[3] Durkin, S.G. and Glover, T.W. (2007) Chromosome fragile sites. Annu. Rev.Genet. 41, 169–192.

[4] Sinden, R.R., Potaman, V.N., Oussatcheva, E.A., Pearson, C.E., Lyubchenko, Y.L.and Shlyakhtenko, L.S. (2002) Triplet repeat DNA structures and humangenetic disease: dynamic mutations from dynamic DNA. J. Biosci. 27, 53–65.

[5] Sutherland, G.R. and Richards, R.I. (1995) Simple tandem DNA repeats andhuman genetic disease. Proc. Natl. Acad. Sci. USA 92, 3636–3641.

[6] Cummings, C.J. and Zoghbi, H.Y. (2000) Trinucleotide repeats: mechanismsand pathophysiology. Annu. Rev. Genomics Hum. Genet. 1, 281–328.

[7] Kovtun, I.V. and McMurray, C.T. (2001) Trinucleotide expansion in haploidgerm cells by gap repair. Nat. Genet. 27, 407–411.

[8] Kovtun, I.V., Liu, Y., Bjoras, M., Klungland, A., Wilson, S.H. and McMurray, C.T.(2007) OGG1 initiates age-dependent CAG trinucleotide expansion in somaticcells. Nature 447, 447–452.

[9] Mirkin, S.M. (2007) Expandable DNA repeats and human disease. Nature 447,932–940.

[10] Pearson, C.E., Nichol Edamura, K. and Cleary, J.D. (2005) Repeat instability:mechanisms of dynamic mutations. Nat. Rev. Genet. 6, 729–742.

[11] Gacy, A.M., Goellner, G., Juranic, N., Macura, S. and McMurray, C.T. (1995)Trinucleotide repeats that expand in human disease form hairpin structuresin vitro. Cell 81, 533–540.

[12] Kunkel, T.A. (1993) Nucleotide repeats. Slippery DNA and diseases. Nature365, 207–208.

[13] Pearson, C.E., Tam, M., Wang, Y.H., Montgomery, S.E., Dar, A.C., Cleary, J.D. andNichol, K. (2002) Slipped-strand DNAs formed by long (CAG)*(CTG) repeats:slipped-out repeats and slip-out junctions. Nucleic Acids Res. 30, 4534–4547.

[14] Rosche, W.A., Jaworski, A., Kang, S., Kramer, S.F., Larson, J.E., Geidroc, D.P.,Wells, R.D. and Sinden, R.R. (1996) Single-stranded DNA-binding proteinenhances the stability of CTG triplet repeats in Escherichia coli. J. Bacteriol. 178,5042–5044.

[15] Eykelenboom, J.K., Blackwood, J.K., Okely, E. and Leach, D.R. (2008) SbcCDcauses a double-strand break at a DNA palindrome in the Escherichia colichromosome. Mol. Cell 29, 644–651.

[16] Connelly, J.C., de Leau, E.S. and Leach, D.R. (1999) DNA cleavage anddegradation by the SbcCD protein complex from Escherichia coli. NucleicAcids Res. 27, 1039–1046.

[17] Bzymek, M. and Lovett, S.T. (2001) Evidence for two mechanisms ofpalindrome-stimulated deletion in Escherichia coli: Single-strand annealingand replication slipped mispairing. Genetics 158, 527–540.

[18] Zahra, R., Blackwood, J.K., Sales, J. and Leach, D.R. (2007) Proofreading andsecondary structure processing determine the orientation dependence of CAGx CTG trinucleotide repeat instability in Escherichia coli. Genetics 176, 27–41.

[19] Merlin, C., McAteer, S. and Masters, M. (2002) Tools for characterization ofEscherichia coli genes of unknown function. J. Bacteriol. 184, 4573–4581.

[20] Gil, D. and Bouche, J.P. (1991) ColE1-type vectors with fully repressiblereplication. Gene 105, 17–22.

[21] Darmon, E., Lopez-Vernaza, M.A., Helness, A.C., Borking, A., Wilson, E., Thacker,Z., Wardrope, L. and Leach, D.R. (2007) SbcCD regulation and localization inEscherichia coli. J. Bacteriol. 189, 6686–6694.

[22] Miret, J.J., Pessoa-Brandao, L. and Lahue, R.S. (1997) Instability of CAG and CTGtrinucleotide repeats in Saccharomyces cerevisiae. Mol. Cell Biol. 17, 3382–3387.