Phosphatidylinositol (4,5) bisphosphate - UCL Discovery

Phosphatidylinositol (4,5) bisphosphate:

an essential lipid involved in membrane

dynamics and nuclear physiology

Shona Louise Osborne

Thesis submitted for the degree of Doctor of Philosophy at the

University of London

April 2001

Molecular Neuropathobiology Laboratory University College

Imperial Cancer Research Fund Gower Street

44 Lincoln’s Inn Fields London WCIE 6BT

London WC2A 3PX

ProQuest Number: 10011184

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a com plete manuscript and there are missing pages, th ese will be noted. Also, if material had to be removed,

a note will indicate the deletion.

uest.

ProQuest 10011184

Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.

All rights reserved.This work is protected against unauthorized copying under Title 17, United States Code.

Microform Edition © ProQuest LLC.

ProQuest LLC 789 East Eisenhower Parkway

P.O. Box 1346 Ann Arbor, Ml 48106-1346

_______________________________________________________________Abstract

Abstract

Phosphatidylinositol (4,5) bisphosphate (Ptdlns(4,5)?2) regulates many cellular

processes, as an intact molecule and as a precursor for InsP], diacylglycerol and

PtdIns(3,4,5)P3. One example where PtdIns(4,5)P2 itself is required is the calcium-

dependent exocytosis of secretory granules, although the site of PtdIns(4,5)P2 synthesis

and the identity of PtdIns(4,5)P2 effector(s) have yet to be determined. The synaptic

vesicle protein synaptotagmin I (Syt I) is a strong candidate for calcium sensor in

neurotransmitter release. Syt I contains two tandem C2 domains. In the presence of

calcium, the first C2 domain (C2A) binds acidic phospholipids, while the second (C2B)

binds PtdIns(4,5)P2. The C2B also mediates the calcium-dependent homo

oligomerisation of Syt I. Syt II is highly homologous to Syt I and is also found on

synaptic vesicles. We have shown that Syt I and II can be present in the same synaptic

vesicle. In addition, both native and recombinant cytoplasmic Syt I and II hetero-

oligomerise in the presence of calcium, suggesting different Syt isoforms can combine

to create synaptic calcium sensors with novel calcium-dependent binding properties.

To investigate PtdIns(4,5)P2 distribution at the synapse, we produced monoclonal

antibodies against PtdIns(4,5)P2. Immunofluorescence in the absence of detergent

reveals a punctate staining in the neurite tips of NGF-differentiated PC 12 cells. In the

presence of detergent, there is an intense nuclear staining in PCI2 cells and other cell-

types from different species. The characterisation of this detergent-resistant nuclear

PtdIns(4,5)P2 is described. Nuclear PtdIns(4,5)P2 co-localises with the splicing factor

SC35 in interphase. Its distribution changes during mitosis. In late telophase, detergent-

resistant PtdIns(4,5)P2 concentrates in discrete SC35-containing structures that are

excluded from the reforming daughter nuclei. Nuclear PtdIns(4,5)P2 is associated with

both snRNAs and proteins, including splicing factors and RNA Polymerase II.

Immunodepletion and add-back experiments demonstrate that PtdIns(4,5)P2 and

interacting factors are necessary, but not sufficient, for pre-mRNA splicing in vitro,

suggesting PtdIns(4,5)P2 may be involved in pre-mRNA processing in vivo.

Acknowledgements

Acknowledgements

First of all I would like to thank Giampietro Sohiavo for providing continuous guidance,

motivation and intellectual challenge throughomt this time. I am also very grateful to the

other members of the MNP lab, past and pressent. Thanks especially to Claire Thomas

for her help and support, in particular when I \was finding my feet in the beginning, for

the characterisation of the antibody, without which a large part of this work would not

have been possible, and the collaboration with the nuclear Ptdlns(4,5)?2 work. Thanks

to Fred Meunier for encouragement, constructtive criticisms and for providing me with

an outlet for frustrations on the squash court. Then Judit Herreros, Teresa Iglesias,

Giovanna Lalli, and Giovanni Lesa for theiir generosity and for making the lab an

enjoyable place to spend the days, weeks, mionths and years. In addition, thanks to

Sharon Tooze, Graham Warren and the membeirs of their respective labs for discussion.

Thanks to Laurence Pelletier, Jim Shorter, Jcoyce Müller, Jyoti Srivastava and Leah

Vardy for providing light relief in and out of ICRF.

And to Hannah Corbett and Emily Roe for their friendship, support and patience over

the last too many years to mention.

Then finally to my parents and my big-little brcother for always being there when I need

them.

Table o f Contents

Table of Contents

Abstract........................................................................................................................2

Acknowledgements......................................................................................................3

Table of Contents........................................................................................................ 4

List of Figures.............................................................................................................. 9

List of Tables..............................................................................................................11

Abbreviations............................................................................................................ 12

Publications................................................................................................................15

Chapter 1: Introduction.................................................................................... 16

1.1 Phosphoinositides, a diverse family of intracellular signalling molecules 17

1.2 PtdIns(4,5)P2 is generated at multiple intracellular locations by the action of

specific kinases........................................................................................................... 20

1.2.1 Ptdlns 4-kinases........................................................................................................... 20

1.2.2 PtdIns(4)P 5-kinases................................................................................................... 21

1.2.3 Phosphatidylinositol Transfer Proteins (PITPs)...........................................................22

1.3 PtdIns(4,5)P2 as a target for lipid kinases and phospholipases.......................231.3.1 Phospholipase C ..........................................................................................................23

1.3.2 PI 3-kinases.................................................................................................................23

1.4 PtdIns(4,5)P2 as a regulator of protein localisation and activity....................25

1.5 PtdIns(4,5)P2 and membrane trafficking.......................................................... 26

1.6 Regulated exocytosis............................................................................................261.6.1 Neurotransmitter release.................................. 26

1.6.2 The synaptic vesicle cycle...........................................................................................27

1.7 PtdIns(4,5)P2 synthesis is required for ATP-dependent priming...................32

1.8 PtdIns(4,5)P2-effectors in neuroexocytosis....................................................... 34

1.8.1 Rabphilin.....................................................................................................................34

1.8.2 Mints........................................................................................................................... 35

1.8.3 CAPS.......................................................................................................................... 36

1.8.4 Synaptotagmin I and II.................................................................................................36

1.8.5 Other synaptotagmin family members.........................................................................40

1.9 PtdIns(4,5)P2 is involved in multiple steps of SSV endocytosis........................43

1.9.1 Coat recruitment.......................................................................................................... 44

1.9.2 Formation of endocytic vesicles and clathrin coat removal.........................................46

1.10 PtdIns(4,5)P2 and regulation of the actin cytoskeleton................................. 47

1.11 Phosphoinositides in the nucleus......................................................................491.11.1 Synthesising PtdIns(4,5)P2 in the nucleus................................................................ 50

4

Table o f Contents

1.11.2 Nuclear phospholipase C and the breakdown of nuclear PtdIns(4,5)P2..................... 51

1.11.3 Involvement of D-3 phosphoinositides in nuclear function.......................................52

1.12 Organisation of nuclear PtdIns(4,5)P2.............................................................53

1.13 PtdIns(4,5)P2 and the regulation of nuclear processes.................................. 55

1.14 The coordination of splicing and transcription within the nucleus............. 57

1.14.1 RNA Pol II and capping.............................................................................................58

1.14.2 RNA Pol II and 3’ end processing............................................................................. 59

1.14.3 RNA Pol II and splicing.............................................................................................59

1.15 The splicing factor compartment (SFC)......................................................... 62

1.16 Objectives........................................................................................................... 65

Chapter 2: Materials and Methods................................................................. 67

2.1 Materials.............................................................................................................. 682.1.1 Chemicals....................................................................................................................68

2.1.2 Antibodies...................................................................................................................68

2.1.3 Constructs and recombinant proteins.......................................................................... 69

2.2 Methods.................................................................................................................692.2.1 Electrophoresis and Western blotting.......................................................................... 69

2.2.1.1 Coomassie Blue staining...................................................................................... 69

2.2.1.2 Silver staining...................................................................................................... 69

2.2.1.2 Western blotting....................................................................................................70

2.2.2 Protein sequencing...................................................................................................... 70

2.2.3 Antibody production and purification......................................................................... 71

2.2.4 Synaptic vesicles purification......................................................................................71

2.2.5 Preparation of samples for Electron Microscopy......................................................... 73

2.2.6 SSV immunoisolation................................................................................................. 73

2.2.7 Immunoprécipitation................................................................................................... 74

2.2.7.1 Native synaptotagmins......................................................................................... 74

2.2.7.2 Recombinant synaptotagmins................................................................................75

2.2.8 Peptide mapping using the Cleveland method.............................................................76

2.2.9 Generation of recombinant synaptotagmins.................................................................76

2.2.9.1 Syt //// cytoplasmic domains.................................................................................78

2.2.9.2 ECFP/EYFP-Syt I/II cytoplamic domain fusion proteins..................................... 79

2.2.9.10 Full-length Synaptotagmin I and II.................................................................. 79

2.2.10 Fluorescence Resonance Energy Transfer.................................................................80

2.2.10.1 Measuring FRET in vitro................................................................................... 82

2.2.10.2 Measuring FRET in vivo: Fluorescence Lifetime Imaging Microscopy (FLIM) 83

2.2.11 Liposome-binding and dot-blot binding assays......................................................... 84

5

Table o f Contents

2.2.12 Immunofluorescence................................................................................................. 85

2.2.13 Electron microscopy analysis.................................................................................... 87

2.2.14 [ ^P]- and [^^S]-metabolic labelling of cells...............................................................87

2.2.15 Extraction of [^^P]-labelled phosphoinositides.......................................................... 88

2.2.16 Immunoprécipitation................................................................................................. 89

2.2.17 In vitro phosphoinositide kinase assays.....................................................................91

2.2.18 In vitro splicing assays.............................................................................................. 91

2.2.19 Immunodepletion of nuclear extracts........................................................................ 92

2.2.20 Elution and add-back experiments............................................................................ 93

2.2.21 PtdIns(4,5)P2 phosphatase assays.............................................. 93

2.2.22 Phosphatase treatment of nuclear extracts.................................................................94

2.2.23 Immunoprécipitation of splicing complexes..............................................................94

Chapter 3: Calcium-dependent oligomerisation o f Syt I/II ........................95

3.1 Introduction......................................................................................................... 96

3.2 Results.................................................................................................................. 973.2.1 Generation and characterisation of Syt isoform-specific antibodies............................97

3.2.2 Preparation of Small Synaptic Vesicles (SSV).......................................................... 100

3.2.3 Different Syt isoforms are present on the same synaptic vesicle............................... 102

3.2.4 Synaptotagmins I and II hetero-oligomerise in a calcium-dependent manner............106

3.2.5 Full-length Synaptotagmin forms B-mercaptoethanol insensitive oligomers.............110

3.2.6 Calcium-dependent hetero-oligomerisation is a property of the cytoplasmic domains 112

3.2.7 Analysis of calcium-dependent hetero-oligomerisation by FRET............................. 115

3.2.8 Measuring Syt oligomerisation in PCI2 cells............................................................ 121

Chapter 4: Synaptotagmin oligomerisation discussion........................... 131

4.1 Introduction....................................................................................................... 132

4.2 Different populations of SSV can be distinguished by their complement of

Syt isoforms..............................................................................................................133

4.3 Calcium-dependent hetero-oligomerisation of native and recombinant Syt I

and II......................................................................................................................... 134

4.4 Calcium-dependent oligomerisation of Syt I and IV?....................................137

4.5 Calcium-dependent oligomerisation is required for exocytosis....................137

4.6 Hetero-oligomerisation alters calcium-dependent exocytosis....................... 138

4.7 Phosphoinositides, Syt oligomerisation and exocytosis..................................139

4.8 A molecular model for the involvement of Syt oligomers in exocytosis 142

Chapter 5: Nuclear PtdIns(4y5)P2 localises to SF C s ................................144

5.1 Introduction..................................................................................................... 145

Table o f Contents

5.1.1 fluorescent analogues.................................................................................................145

5.1.2 fluorescent lipid-binding molecules.......................................................................... 145

5.1.3 specific antibodies..................................................................................................... 147

5.2 Results...............................................................................................................147

5.2.1 Characterisation of antibodies against RdIns(4,5)P2................................................. 147

5.2.2 2C11 recognises PtdIns(4,5)P2 in the nucleus of different cell-types........................ 148

5.2.3 Bimodal distribution ofPtdIns(4,5)P2 in PC12 cells................................................. 153

5.2.4 Localisation of peripheral PtdIns(4,5)P2 in fibroblasts...............................................155

5.2.5 PtdIns(4,5)P2 localises to electron dense structures in the nuclei of interphase cells. 160

5.2.6 2C11 co-localises with splicing factors in interphase cells ........ 163

5.2.7 Mitotic re-distribution of detergent-resistant PtdIns(4,5)P2.......................................166

5.2.8 2C11 co-localises with SC35 and RNA Pol IIo in mitosis.........................................168

5.2.9 Transcription-independent association of PtdIns(4,5)P2 with splicing factors...........173

Chapter 6: Nuclear PtdIns(4y5)P2 and pre-mRNA splicing,....................175

6.1 Introduction....................................................................................................... 176

6.2 Results.................................................................................................................1766.2.1 PtdIns(4,5)P2 is present in the nucleus and can be immunoprecipitated by 2C11......176

6.2.2 Nuclear proteins co-immunoprecipitate with PtdIns(4,5)P2.......................................180

6.2.3 Proteins involved in pre-mRNA splicing co-immunoprecipitate with PtdIns(4,5)P2.182

6.2.4 PtdIns(4,5)P2 associates with a 140 kDa protein in HeLa nuclear extracts................185

6.2.5 Association of a type I PtdIns(4)P-5 kinase activity with nuclear PtdIns(4,5)P2.......188

6.2.6 2C11 co-immunoprecipitates snRNAs.......................................................................190

6.2.7 The in vitro splicing assay.........................................................................................193

6.2.8 Immunodepletion of PtdIns(4,5)P2 and associated factors inhibits splicing...............194

6.2.9 Re-addition of PtdIns(4,5)P2 and associated factors restores splicing....................... 198

6.2.10 Exogenous PtdIns(4,5)P2 does not effect splicing in vitro...................................... 201

6.2.11 Inositol phosphatase treatment of nuclear extracts.................................................. 203

6.2.12 PtdIns(4,5)P2 associates with active spliceosomes.................................................. 206

Chapter 7: Nuclear PtdIns(4,5)P2 discussion............................................. 208

7.1 Introduction....................................................................................................... 209

7.2 Nuclear PtdIns(4,5)P2 associates with SFCs................................................... 210

7.3 A novel tripartite proteolipid-nucleic acid complex within the nucleus 211

7.4 Nuclear PtdIns(4,5)P2 and pre-mRNA splicing..............................................212

7.5 Possible functions for nuclear PtdIns(4,5)P2.................................................. 213

7.5.1 PtdIns(4,5)P2 as a substrate for nuclear phospholipase C and PI 3-kinase................ 213

7.5.2 PtdIns(4,5)P2 and the regulation of nuclear structural proteins..................................215

7.6 PtdIns(4,5)P2 and splicing factor localisation during mitosis.......................2177

Table o f Contents

1.1 Concluding remarks and future perspectives...............................................219

Chapter 8: References....................................................................................222

References.................................................................................................................223

List o f Figures

List of Figures

Figure 1.1 Phosphoinositide signalling pathways. 18

Figure 1.2 PtdIns(4,5)P2 regulates a diverse range of intra-cellular processes. 19

Figure 1.3 Stages in the SSV life-cycle. 28

Figure 1.4 Protein-protein interactions in SSV exocytosis. 30

Figure 1.5 Synaptotagmin, a calcium sensor for neurotransmitter release. 38

Figure 1.6 Pre-mRNA splicing. 60

Figure 1.7 Nuclear organisation of splicing factors. 63

Figure 2.1 Recombinant synaptotagmin constructs used in this study. 77

Figure 2.2 Fluorescence resonance energy transfer (FRET). 81

Figure 3.1 Phylogenetic analysis of the Syt family. 98

Figure 3.2 Antibody characterisation. 99

Figure 3.3 Purification of rat brain cortical SSV. 101

Figure 3.4 Syt I and II co-localise in a SSV preparation from rat brain cortex. 103

Figure 3.5 Syt I and II are present on the same SSV. 105

Figure 3.6 Co-immunoprecipitation of Syt I, II and IV. 107

Figure 3.7 Syt I and II oligomerisation is calcium-dependent. 109

Figure 3.8 Syt forms SDS and reducing agent-insensitive oligomers. 111

Figure 3.9 Co-immunoprecipitation of recombinant Syt I and II 114

cytoplasmic domains.

Figure 3.10 FRET can be used to detect protein-protein interactions in vitro. 116

Figure 3.11 FRET measurement of the calcium-dependent oligomerisation 118

of Syt Icyto and Syt Ilcyto-

Figure 3.12 Efficiency of energy transfer between Cy3-Syt Ilcyto and 120

Cy5-Syt Icyto-

Figure 3.13 Protein-protein interactions can be detected in vivo using FRET. 122

Figure 3.14 PCI2 cells differentiate to a neuronal-like phenotype in the 124

presence of NGF.

Figure 3.15 Recombinant Syt I and II are targeted to vesicular structures 125

in PC 12 cells.

F igure 3.16 EYFP-Syt I distribution in NGF-differentiated PC 12 cells. 127

Figure 3.17 Fluorescence Lifetime Imaging Microscopy of transiently 128

List o f Figures

transfected PC 12 cells.

Figure 5.1 2C11 is specific for Ptdlns(4,5)?2. 149

Figure 5.2 2C11 is able to recognise PtdIns(4,5)P2 inserted in a lipid bilayer. 149

Figure 5.3 2C11 labels the nuclei of detergent-permeabilised cells. 151

Figure 5.4 2C11 is recognising nuclear PtdIns(4,5)P2. 152

Figure 5.5 2C11 immunostaining varies depending on the permeabilisation 154

protocol used.

Figure 5.6 2C11 can be used to visualise peripheral PtdIns(4,5)P2 in 156

fibroblast-like cells.

Figure 5.7 TGN38 and 2C11 do not co-localise in NRK cells. 158

Figure 5.8 2C11-positive structures are not early endosomes. 159

Figure 5.9 PtdIns(4,5)P2 is localised in electron-dense structures in HeLa 162

nuclei.

Figure 5.10 The localisation of nuclear PtdIns(4,5)P2 is dependent on intact 162

RNA.

Figure 5.11 PtdIns(4,5)P2 co-localises with markers of the Splicing 165

Factor Compartment (SFC).

Figure 5.12 Cell-cycle dependent changes in the localisation of detergent- 167

resistant PtdIns(4,5)P2.

Figure 5.13 PtdIns(4,5)P2 is localised in electron dense structures in late 169

telophase.

Figure 5.14 PtdIns(4,5)P2 co-localises with SC35 and RNA Pol IIo in late 170

telophase.

F igure 5.15 Nuclear re-entry of PtdIns(4,5)P2 is one of the latest events at the 172

end of mitosis.

Figure 5.16 The association of nuclear PtdIns(4,5)P2 with SFCs is independent 174

of transcription.

Figure 6.1 PtdIns(4,5)P2 is found within the nuclei of different cell-types. 179

Figure 6.2 2C11 co-immunoprecipitates several proteins from HeLa 181

nuclear extracts.

Figure 6.3 RNA Pol IIo and Sm proteins associate with nuclear PtdIns(4,5)P2.183

Figure 6.4 Sequence alignment of human a-actinin 1 and 4 185

10

List o f Figures

Figure 6.5 PtdIns(4,5)P2 binds a 140 kDa protein in HeLa nuclear extracts. 187

Figure 6.6 PtdIns(4)P 5-kinase activity associates with nuclear PtdIns(4,5)P2. 189

Figure 6.7 Nuclear PtdIns(4,5)P2 associates with snRNAs. 191

Figure 6.8 Immunodepleting nuclear extracts with 2C11 inhibits the splicing 195

of B-globin RNA.

Figure 6.9 Immunodepleting nuclear extracts with 2C11 inhibits the splicing 197

of 0-crystallin RNA.

Figure 6.10 PtdIns(4,5)P2 and associated factors are necessary for splicing. 199

Figure 6.11 PtdIns(4,5)P2 and associated factors are not sufficient for the 200

splicing of intron-containing RNAs.

Figure 6.12 Exogenous PtdIns(4,5)P2 or IPPs do not affect splicing efficiency. 202

Figure 6.13 Inositol phosphatase treatment of nuclear extracts. 204

Figure 6.14 2C11 co-immunoprecipitates pre-formed splicing complexes. 207

Figure 7.1 PtdIns(4,5)P2 is an important regulator of nuclear physiology. 220

List of Tables

Table 1.1 The synaptotagmin family 41

11

Abbreviations

Abbreviations

a-SNAP soluble NSF attachment protein

Arps actin-related proteins

BSA bovine serum albumin

CAPS calcium activated protein for secretion

CCD charge-coupled device

CCV clathrin-coated vesicle

CTD carboxy terminal domain of RNA Pol II

DAG 1,2-diacylglycerol

DRB 5,6-dichloro-1 -B-D-ribofuranosylbenzimidazole

DTT dithiothreitol

ECFP enhanced cyan fluorescent protein

ENTH epsin N-terminal homology

ERM ezrin, radixin, moesin

EYFP enhanced yellow fluorescent protein

FRAP fluorescence recovery after photobleaching

FRET fluorescence resonance energy transfer

FYVE Fab Ip, YOTB, Vaclp, EEAl

GFP green fluorescent protein

GroPIns glycero-derivative of phosphatidylinositol

GroPIns(4,5)P2 glycero-derivative of phosphatidylinositol (4,5) bisphosphate

GSH glutathione

GST glutathione S-transferase

HA influenza virus hemagluttinin epitope

HRP horseradish peroxidase

IGC interchromatin granule cluster

InsPs inositol (1,4,5) trisphosphate

IPP inositol polyphosphate

LDCV large dense core vesicle

MIG mitotic interchromatin granule

Mints Munc-18 interacting proteins

NDF nucleolar derived foci

NGF nerve growth factor

12

Abbreviations

NPC nuclear pore complex

NRK normal rat kidney cells

NSF N-ethylmaleimide sensitive factor

OG octyl-fî-D-glucosopyranoside

PA phosphatidic acid

PBS phosphate buffered saline

PC12 rat phaeocromocytoma cells

PCR polymerase chain reaction

PF perichromatin fibril

PFA paraformaldehyde

PH pleckstrin homology

PI phosphoinositide

PI 3-kinase phosphoinositide 3-kinase

PIKE PI 3-kinase enhancer

PIPKI type 1 phosphatidylinositol (4)P 5-kinase

PIPKII type 11 phosphatidylinositol (5)P 4-kinase

PITP phosphatidylinositol transfer protein

PKC protein kinase C

PLC phospholipase C

PMSF phenylmethylsulfonyl fluoride

PTB phosphotyrosine binding

PtdCho phosphatidylcholine

PtdEtan phosphatidylethanolamine

Ptdlns phosphatidylinositol

PtdIns4K phosphatidylinositol 4-kinase

PtdIns(4,5)P2 phosphatidylinositol (4,5) bisphosphate

PtdIns(3,4,5)P3 phosphatidylinositol (3,4,5) trisphosphate

PtdSer phosphatidylserine

RNA Pol II RNA polymerase 11

RNA Pol Ila unphosphorylated RNA Pol 11

RNA Pol IIo hyperphosphorylated RNA Pol 11

SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis

SFC splicing factor compartment

SNAP-25 synaptosomal associated protein of 25 kDa

SNARE soluble NSF attachment protein receptor

Abbreviations

snoRNA small nucleolar RNA

snRNA small nuclear RNA

snRNP small nuclear ribonucleoprotein particle

SSV small synaptic vesicle

synprint synaptic protein interaction site

Syt synaptotagmin

S y t I c y t o / S y t I lc y to recombinant synaptotagmin I/II cytoplasmic domains

TCA trichloroacetic acid

TGN trans-Go\g\ network

TLC thin layer chromatography

VAMP vesicle associated membrane protein

VSV-G vesicular stomatitis virus glycoprotein

14

Publications

Publications

Osbome. S.L.. J. Herreros, J., Bastiaens, P.I.H, Schiavo, G. (1999) Calcium-dependent

oligomerization of synaptotagmins I and II- Synaptotagmins I and II are localized on the

same synaptic vesicle and heterodimerize in the presence of calcium. J Biol Chem 274,

59-66.

Schiavo, G., Osbome. S.L.. Sgouros, J.G. (1998) Synaptotagmins-more isoforms than

functions. Biochem Biophys Res Comms 248, 1-8.

Herreros, J., Lalli, G., Osbome. S.L.. Montecucco, C., Rossetto, O., Schiavo, G. (1999)

Functional characterisation of tetanus and botulinum neurotoxins binding domains. J

Cell Soi 112, 2715-2724. * these authors contributed equally to the work

Schiavo, G, Herreros, J., Iglesias, T., Lalli, G., Osborne. S.L.. Thomas, C.L. (1999)

Molecular analysis of regulated secretion. In: Molecular Mechanisms o f Transcellular

signaling. Ed. J.P. Thiery. lOS Press, 221-235.

Osborne. S.L.. Thomas, C.L., Gschmeissner, G., Schiavo, G. (2001) Nuclear

PtdIns(4,5)P2 assembles in a mitotically-regulated particle involved in pre-mRNA

splicing. J Ce// Sci In Press.

15

Chapter 1: Introduction

16

Chapter 1____________________________________________________ Introduction

1.1 Phosphoinositides, a diverse family of intracellular signalling molecules

Cellular lipids have traditionally been regarded as passive elements acting as a barrier

between different cellular compartments and the extracellular milieu. More recently, it

has become apparent that membrane lipids play important regulatory functions in

addition to this structural role. One class of lipids in particular, the phosphorylated

derivatives of phosphatidylinositol (Ptdlns), have become the focus of attention for their

ability to regulate an impressive number of essential cellular processes despite

constituting only a minor fraction of total cellular phospholipids (Martin, 1998). The six

carbon inositol ring of Ptdlns is unique in that it can be reversibly phosphorylated at the

D-3, D-4 and D-5 positions to generate a diverse family of signalling molecules, the

phosphatidylinositol monophosphates, bisphosphates and phosphatidylinositol (3,4,5)

trisphosphate (PtdIns(3,4,5)P]). All of the seven possible phosphorylated species have

been identified in cells (Figure 1.1) and are collectively referred to as phosphoinositides

(Pis).

Historically, PtdIns(4,5)P2 has been the most studied PI for its role as the precursor of

the second messengers, InsPs and DAG. More recently, PtdIns(4,5)P2 has become the

focus of attention as a precursor of PtdIns(3,4,5)P], itself an important signalling

molecule, and for its ability to regulate a variety of target molecules. PtdIns(4,5)P2-

binding domains have been identified in a number of proteins. By regulating the

localisation and/or activity of these, PtdIns(4,5)P2 influences such diverse processes as

actin cytoskeletal dynamics (Sechi and Wehland, 2000), membrane trafficking

(Odorizzi et a l, 2000; Cremona and De Camilli, 2001) and ion channel activity

(Kobrinsky et al, 200(Jjîgure 1.2). Furthermore, the regulatory role of Pis is not

restricted to membranes, as there is evidence for their stabilisation in proteolipid

complexes in the cytoplasm and the nucleus (Divecha et al, 1993; Fukami et al, 1994;

17

Ptdlns

PI3K PI4K PIPKI

Ptdins(3)P Ptdlns(4)P

)|3K y \ P I P K I

Ptdlns(5)P

PIPKIPIPKII PIPKI PIPKII

glycerol

O 'P -O -

Ptdins

Ptdlns(3,4)P2 Ptdlns(3,5)P2 P td ln s(4 ,5 )P 2

PLC

PIPKI PI3K

Rdlns(3,4,5)P3

PI3K = PI 3-kinase

PI4K = Ptdlns 4-kinase PIPKI = type I Ptdlns(4)P 5-kinase PIPKII = type II Ptdlns(4)P 5-kinase

PLC = phospholipase C

D A G K = DAG-kinase

DAG

D A G K

PA

Tlns(1,3,4,5)P4

Tlns(1,3,4,5,6)P5

TinsPe

Figure 1.1 Phosphoinositide signalling pathways. The structure of phosphatidylinositol (Ptdlns) is illustrated in the inset, top right hand comer. The 6 carbon ring of the inositol headgroup can be phosphorylated on position 3, 4 and 5 generating Ptdlns mono, bis and trisphosphates. The major route of PtdIns(4,5)P2 synthesis, marked by bold arrows, is via the sequential phosphorylation of Ptdlns at the D-4 and D-5 positions. PtdIns(4,5)P2 occupies a central position in inositol based signalling pathways, acting as a target for PI 3-kinases for the production of PtdIns(3,4,5)P3, or as a substrate for phospholipase C isoforms which generates the second messengers InsPg and DAG. InsPg can in turn be phosphorylated at positions 2, 3 and 6, producing inositol polyphosphates (IPPs). For clarity, inositol phosphatases have been omitted from this scheme.T Vi'cxs looo}.

PH domain

M embrane targeting

M em brane trafficking

Regulation of ion channel activity ^

binding p ro te i^

Regulation of actin cytoskeleton

O -P -O -

(g)-

Ptdlns(4,5)P2

Intracellular signalling c a s c a d e s

Ptdlns(3,4,5)P3

PKC activationDAG

lns(1,4,5)P3

Intracellular Ca^+ Inositol polyphosphates h om eostasis

Figure 1.2 PtdIns(4,5)P2 regulates a diverse range of intra-cellular processes. Via interactions with PH domains and other PtdIns(4,5)P2 binding motifs, PtdIns(4,5)P2 influences the localisation and/or activity of target proteins and as a result affects membrane trafficking, actin cytoskeletal dynamics and ion channel activity. PI 3-kinases can phosphorlyate Ptdlns(4,5)P2 further, generating Ptdlns(3,4,5)P3^ an important component of many intracellular signalling pathways. PtdIns(4,5)P2 is also a target for phospholipase C isoforms, which generate InsPg and DAG. InsPg triggers the release of Ca2+ from intracellular stores and DAG is required for the activation of conventional and novel PKC isoforms. InsPg can be phosphorylated further by inositol polyphosphate kinases.


Hinchliffe et al, 1996). While the presence of nuclear Pis remains controversial, strong

evidence is accumulating in favour of the existence of nuclear PI signalling pathways

that can be regulated independently of the cytoplasmic pathways (Divecha et al, 1993;

Maraldi et al, 2000; Irvine, 2000).

I will begin by briefly introducing the main enzymes involved in PtdIns(4,5)P2

metabolism and will then expand on the cellular roles of PtdIns(4,5)P2, focussing in

particular on its involvement in membrane dynamics and its possible functions within

the nucleus.

1.2 PtdIns(4,5)P2 is generated at multiple intracellular locations by the action of

specific kinases

While Ptdlns itself is synthesised on the cytosolic face of the smooth endoplasmic

reticulum, the subsequent phosphorylations to generate Pis occurs at multiple sites

throughout the cell. Consistent with this, Pl-kinases have been localised to multiple

intracellular sites including the plasma membrane, Golgi apparatus, ER, secretory

vesicles, endosomes and the nucleus (Fruman et al, 1998).

1.2.1 Ptdlns 4-kinases

The major route of PtdIns(4,5)P2 synthesis occurs via the sequential phosphorylation of

Ptdlns on the D-4 and D-5 positions by a Ptdlns 4-kinase (PtdIns4K) and a PtdIns(4)P

5-kinase (PtdIns(4)P5K) respectively. Ptdlns 4-kinases are ubiquitously expressed

enzymes that associate with a variety of intracellular membranes (Fruman et al, 1998).

There are two classes of mammalian PtdIns4K, type II and III. The type II p55

PtdIns4K has recently been cloned and encodes a large conserved family (Barylko et

a l , 2001). Two isoforms of type III kinases have been identified, PtdIns4Ka and

20


PtdIns4KB. These differ in their intracellular localisations, suggesting they are able to

independently regulate distinct cellular processes (Wong et a l, 1997). Yeast possess

two type III PtdIns4K homologues, Stt4 and Pikl, equivalent to the mammalian

PtdIns4Ka and B respectively. Both enzymes are essential but appear to function

independently as genetic analysis has revealed roles for Stt4 in cytoskeletal dynamics

and for Pikl in membrane trafficking (Walch-Solimena and Novick, 1999; Hama et al,

1999; Audhya et a l, 2000).

1.2.2 PtdlnsM^P 5-kinases

Two types of PtdIns(4)P 5-kinases, PIPKI and PIPKII, differing in both their size and

enzymatic properties, were identified initially (Bazenet et a l, 1990). However, a more

detailed analysis of the substrate preferences revealed that the Type II PtdIns(4)P 5-

kinase is actually a PtdIns(5)P 4-kinase (Rameh et al, 1997b). In addition to their being

able to generate PtdIns(4,5)P2, both PtdIns(5)P 4-kinases and PtdIns(4)P 5-kinases can

catalyse the synthesis of multiple Pis in vitro, albeit to a lesser extent (Rameh et a l ,

1997b; Zhang et a l, 1997; Tolias et a l, 1998; Figure 1.1). It is not clear however,

whether any of these minor activities occur in vivo. Three isoforms, a, B and y, of both

kinases have been identified in mammalian cells (Loijens and Anderson, 1996; Ishihara

et a l, 1996; Ishihara er a/., 1998).

Despite the absence of primary sequence homology with protein kinases, the crystal

structure of PIPKIIB reveals a striking similarity between the two catalytic sites, with

both possessing similar ATP binding and catalytic motifs (Rao et a l, 1998). The two

catalytic sites of the dimeric enzyme are positioned at a flattened membrane interface

suggesting how PIPKII could phosphorylate its substrates within the membrane bilayer.

21


Yeast also possess two enzymes with homology to PtdIns(4)P 5-kinases, Mss4p and

Fab Ip. However, Mss4p is the only true PtdIns(4)P 5-kinase as Fab Ip is actually a

PtdIns(3)P 5-kinase (Cooke et a l, 1998). Mss4p mutants, like Stt4p mutants, have

defects in the organisation of the actin cytoskeleton (Desrivieres et al, 1998; Homma et

al, 1998) suggesting Mss4p only phosphorylates PtdIns(4)P produced by Stt4p, further

highlighting the compartmentalisation of PI signalling pathways.

1.2.3 Phosphatidvlinositol Transfer Proteins fPITPsI

Phosphatidylinositol transfer proteins (PITPs) were initially identified as cytosolic

proteins able to transfer Ptdlns monomers between lipid bilayers in an energy-

independent manner in vitro (Cockcroft, 2001). Three mammalian cytosolic PITPs, a,

13, and RdgB13 have been identified. All are ubiquitously expressed but differ in their

sub-cellular distributions, with PITPa being found mainly in the cytoplasm and nucleus

and PITP13 being preferentially localised to the Golgi apparatus (De Vries et a l, 1995;

De Vries et a l, 1996). The yeast PITP orthologue, Secl4p, lacks sequence homology

with mammalian PITPs. However, despite this the two are functionally interchangeable

(Hay and Martin, 1993). In addition, two highly related atyptical PITPs have been

identified (RdgBal and RdgBall). These proteins are 160 kDa integral membrane

proteins containing a functional N-terminal PITP domain (Lev et a l, 1999).

PITP has also been shown to be involved in intracellular signalling pathways by

promoting the hydrolysis of PtdIns(4,5)P2 by phospholipase C (Thomas et a l, 1993;

Cunningham et a l, 1995) and PI 3-kinase-mediated PtdIns(3,4,5)P3 production (Kular

et a l, 1997). In addition, PITP is an essential cofactor in a number of membrane

trafficking steps including regulated exocytosis (Hay and Martin, 1993), intra-Golgi

transport (Paul et a l, 1998) and the biogenesis of secretory granules and vesicles

22


(Ohashi et al, 1995; Jones et al, 1998). Although the exact mechanism of action in vivo

remains to be determined it is becoming increasingly apparent that PITPs function in the

coupling of Ptdlns delivery to PI synthesis at spatially-restricted membrane

microdomains (Cockcroft, 2001).

1.3 PtdIns(4,5)P2 as a target for lipid kinases and phospholipases

1.3.1 Phospholipase C

In the ‘classical’ PI signalling pathway, PtdIns(4,5)P2 acts as a substrate for

phospholipase C isoforms. Mammalian phospholipases C (PLCs) are divided into three

groups, B, Y and d, based on their structure (Katan and Williams, 1997). All three groups

require calcium for their catalytic ftmction with PLC3, the only isoform with a yeast

homologue, being the most sensitive to calcium. PLC catalyses the generation of the

second messengers Ins(l,4,5)P3 and diacylglycerol (DAG). InsPg can mobilise calcium

from internal stores upon binding to its receptor and is also a target for inositol

polyphosphate kinases which synthesise inositol polyphosphates (IPPs; Berridge, 1993;

Zhang and Majerus, 1998). DAG is an important regulator of PKC activity. DAG-

activated PKC isoforms include the conventional PKCs (a, Bi, Bn, y) and the novel

PKCs (d, 6, T|, 8 and p/PKD) which differ in their sensitivities to activation by calcium

(Mellor and Parker, 1998).

1.3.2 PI 3-kinases

PtdIns(4,5)P2 is also a substrate for cellular PI 3-kinases that phosphorylate the inositol

ring on the D-3 position, generating PtdIns(3,4,5)P] in response to a wide range of

extracellular stimuli. PtdIns(3,4,5)P] is an important signalling molecule and affects

cell-survival, proliferation, migration and the budding of intracellular vesicles (Rameh

23


and Cantley, 1999). PI 3-kinases are classified into three groups based on their structure

and substrate specificities (Domin and Waterfield, 1997).

Type I enzymes are heterodimers of a 110 kDa catalytic subunit and a regulatory

subunit (50 and 100 kDa), responsible for the targeting and/or activation of the enzyme

(Fruman et a l, 1998). In vitro, they are able to utilise Ptdlns, PtdIns(4)P, PtdIns(5)P and

PtdIns(4,5)P2 as substrates. However, in vivo, their major activity appears to be

restricted to the generation of PtdIns(3,4,5)P3 from PtdIns(4,5)P2 (Stephens et al, 1991;

Kara et a l, 1994). Type I enzymes can be activated in response to either tyrosine kinase

or heterotrimeric G-proteins (Fruman et a l, 1998).

Type II PI 3-kinases phosphorylate predominantly Ptdlns, PtdIns(4)P and also

PtdIns(4,5)P2 (but only when phosphatidylserine (PtdSer) is used as a carrier) in vitro

(Domin et a l, 1997). Recent studies have demonstrated that activated type II kinases

can also generate PtdIns(3,4,5)P] in vivo suggesting that multiple pathways for

producing PtdIns(3,4,5)Ps exist (Gaidarov et al, 2001).

The final group, type III PI 3-kinases are unique in that they can only use Ptdlns as a

substrate. Like Type I PI 3-kinases, the membrane association and activity of the

enzyme is controlled by regulatory subunits (Fruman et a l, 1998). Mammalian type III

PI 3-kinases and the yeast homologue, Vps34, are both implicated in constitutive

intracellular membrane trafficking events through the generation of PtdIns(3)P (Corvera

and Czech, 1998). The regulatory effects of Pis on both signal transduction and

membrane trafficking is thought to be a consequence of their recruiting and/or

activation of specific effector proteins. In the case of PtdIns(3)P, these effector proteins

share a common PtdIns(3)P binding domain, the FYVE domain, named after the first

four proteins it was identified in: Fab Ip, YOTB, Vaclp, EEAl (Stenmark et al, 1996).

24


1.4 PtdIns(4,5)P2 as a regulator of protein localisation and activity

PtdIns(4,5)P2-binding sites can be separated into two broad categories, the first and best

characterised is comprised of pleckstrin homology (PH) domains and the related

phosphotyrosine binding (PTB) domains and the second of short sequences enriched in

basic and hydrophobic residues (Martin, 1998). PH domains are modules of -120 amino

acids that have relatively low sequence homology, yet share a highly conserved tertiary

structure (Lemmon and Ferguson, 2000). PH domains have been identified in a number

of protein families involved in cytoskeletal regulation (e.g. B-spectrin), signal

transduction (e.g. Bruton’s tyrosine kinase), membrane trafficking (e.g. dynamin),

GTPase effector proteins and adaptor proteins (Lemmon and Ferguson, 2000). Different

PH domains vary in their specificities and affinities of PI binding (Rameh et a l , 1997a;

Freeh et al, 1997; Kavran et al, 1998; Dowler et al, 2000). The PH domains of PLCO,

CAPS (Calcium-Activated Protein for Secretion) and dynamin are particularly

noteworthy as they show a high specificity for PtdIns(4,5)P2 (Lemmon et al, 1995;

Salim et al, 1996; Loyet et al, 1998). Fusion proteins containing PH domains have

been used as a probe to determine the cellular localisation and follow the dynamics of

Pis in vivo. This will be discussed in more detail in the introduction to Chapter 5. PTB

domains are also able to bind Pis, for example the PTB domain of Mints bind

PtdIns(4,5)P2 with high affinity (Okamoto and Sudhof, 1997)C-SC^

The second class of PtdIns(4,5)P2-binding modules contain 10-20 amino acid sequences

rich in basic and hydrophobic residues but lacking primary sequence homology. Such

regions are found in cytoskeletal proteins such as a-actinin (Fukami et al, 1996) and in

certain C2 domain-containing proteins. C2 domains were initially identified as a

calcium-dependent phospholipid binding domain in PKC. However, different C2

domains differ in their binding properties and in whether or not they are regulated by

25


calcium (Nalefski and Falke, 1996). Synaptotagmin, the putative calcium-sensor for

neurotransmitter release, contains two C2 domains, one of which binds Ptdlns(4,5)?2

and inositol polyphosphates (Fukuda et al, 1994; Schiavo et al, 1996) via a lysine rich

sequence. Synaptotagmin is a potential PtdIns(4,5)P2-effector in intracellular membrane

fusion in higher eukaryotes, which will be discussed in depth in section 1.8.4.

1.5 PtdIns(4,5)P2 and membrane trafficking

The sequential budding and fusion of membrane-bound vesicles underlies the targeted

delivery of both membrane bound and soluble components to their appropriate

destinations within the cell. These steps are fundamental for cell growth, division,

sexual reproduction, the uptake and delivery of nutrients and neuronal communication.

Pis play important roles in a number of different membrane trafficking steps (Martin,

1997a; Corvera et al, 1999). PtdIns(4,5)P2 itself has been implicated in homotypic

vacuole fusion in yeast (Mayer et al, 2000), regulated exocytosis (Hay et al, 1995),

endocytosis (Jost et a l , 1998), phagocytosis (Botelho et a l , 2000) and Golgi dynamics

(Godi et al, 1999). Of these, the involvement of PtdIns(4,5)P2 in regulated exocytosis

was the first to be identified and remains the best characterised. I will begin by

introducing regulated exocytosis, using neurotransmitter release as a well-studied

example, before presenting the evidence supporting an involvement of PtdIns(4,5)P2 in

regulated exocytosis. Then, in section 1.8,1 will introduce potential protein effectors of

PtdIns(4,5)P2 identified at the synapse.

1.6 Regulated exocytosis

1.6.1 Neurotransmitter release

Neurotransmitter release involves the calcium-dependent fusion of neurotransmitter-

containing small synaptic vesicles (SSV) with the pre-synaptic plasma membrane

26


(Matthews, 1996). As a result, neurotransmitter is released into the synaptic cleft, across

which it diffuses before binding to specific receptors on the post-synaptic cell. Fast

neurotransmitter release differs from other membrane fusion steps in its requirement for

high (pM) concentrations of calcium, its speed and its plasticity (Llinas et al, 1992;

Heidelberger et al, 1994; Zucker, 1999). Consistent with its high degree of

specialisation, neurotransmitter release has been shown to be a multi-step process

requiring the coordinated action of a large number of gene products (Martin, 1997b).

However, despite its highly specialised nature, it remains a paradigm for the study of

membrane fusion events in general, as many of the proteins involved in

neurotransmitter release belong to large families of proteins, conserved from yeast to

man (Rothman, 1994). These include NSF (N-ethylmaleimide sensitive factor), SNAPs

(soluble NSF attachment proteins), SNARE (soluble NSF attachment protein receptors)

proteins and the Rab family of small G proteins (Schiavo et al, 1999). Additional

synapse-specific proteins and interactions are thought to confer the properties of speed,

calcium-dependence and plasticity upon this conserved machinery.

In addition to SSVs, neurons also possess peptide neuropeptide-containing large dense-

core vesicles (LDCV). Although the calcium-sensitivity and speeds of exocytosis differ

for SSV and LDCV exocytosis, many of the essential mechanisms are similar (Martin,

1997b). LDCVs are the major secretory vesicle in neuroendocrine cells and a great deal

of information on calcium-dependent secretion has been accumulated through the study

of their exocytosis in neuroendocrine cells.

1.6.2 The svnaptic vesicle cvcle

Based on studies of SSV and LDCV exocytosis, neurosecretion has been separated into

a number of steps, broadly defined as vesicle translocation and docking, priming and

27

Coated pit formation

Uncoating Fission

dynaminSynaptojanln AP-2AP-180epsinRecycling

Endocytosis

ATP

PIPKIPITP

Docking PrimingSynaptotagm in

CAPS

Fusion

Figure 1.3 Stages in the SSV life cycle. Neurotransmitter-filled synaptic vesiclesdock at specific sites of the pre-synaptic membrane, the active zones, in the vicinity of voltage-gated calcium channels. Before docked vesicles become fusion-competent, they proceed through an ATP-dependent priming step involving PITP and PIPKI. The exact site of PtdIns(4,5)P2 synthesis is not known. Putative PtdIns(4,5)P2-effectors include synaptotagmin and CAPS. Calcium influx triggers the rapid fusion of the SSV and pre-synaptic membranes, releasing neurotransmitter into the synaptic cleft. Following exocytosis, vesicles are rapidly endocytosed via a clathrin and dynamin- dependent mechanism. PtdIns(4,5)P2 is required for coat assembly and the formation of clathrin coated vesicles. PtdIns(4,5)P2-binding proteins involved endocytosis are shown in red. Dephosphorylation of PtdIns(4,5)P2 by synaptojanin is required for uncoating.


fusion (Martin, 1997b; Figure 1.3). Two pools of synaptic vesicles can be differentiated

by electron microscopy, the reserve pool and the morphologically docked vesicles. The

reserve pool is comprised of SSVs more than about 200 run from the active zone, that

are thought to be held in place by an interaction between the SSV-associated protein

synapsin and actin filaments (Ceccaldi et al, 1995). Phosphorylation of synapsin is

believed to disassemble the complex leading to mobilisation of the SSV which is

important for maintaining the supply of SSV during prolonged stimulation (Llinas et al.,

1991).

The docking of SSV at the pre-synaptic plasma membrane occurs via an as yet

unidentified machinery that brings the membranes close enough to allow SNARE

proteins on opposing membranes to interact (Bajjalieh, 1999). A combination of

morphological and electrophysiological studies have demonstrated that not all docked

vesicles are fusion competent. The acquisition of fusion competence during priming is

achieved via a number of sequential protein-protein and protein-lipid interactions

occurring after docking and prior to the fusion event itself (Figure 1.4). Priming is an

ATP-dependent process and there is evidence that at least some of the ATP is required

for the synthesis of PtdIns(4,5)Pz (Eberhard et al, 1990; Hay et al, 1995). This will be

discussed in detail in the next section.

A substantial amount of evidence indicates that the final membrane fusion event

requires the formation of a complex between SNARE proteins on the SSV and pre-

synaptic membrane. The three synaptic SNAREs are the SSV protein VAMP (vesicle

associated membrane protein or synaptobrevin) and the plasma membrane proteins

syntaxin and SNAP-25 (synaptosomal associated protein of 25 kDa; Sollner et al,

1993). SNARE proteins interact to form an extremely stable SDS and heat-resistant

29

Rab3A-rabphilin-3A a SNAPRab GDI

NSF-N

Synaptotagmin

NSF-D2

SNARE complex

nSecI-syntaxin

Bmnger, Curr. Op. Struct. Biol, 2001

f synaptobrevin

^ synaptophysin

— syntaxin W nSecI ^ SNAP-25

synaptotagmin

Rab3A

Rabphilln 3A

Ca--channel

NSF

a-SN A P

Figure 1.4 Protein-protein interactions in SSV exocytosis. Initially, syntaxin is bound to nSec 1 and synaptobrevin is probably bound to a factor such as synaptophysin. A yet to be identified molecular machinery brings the vesicle and plasma membrane into close proximity, allowing SNAREs on opposite membranes to form /ra«5-complexes. Synaptobrevin then binds to syntaxin and SNAP-25. At the priming stage, the system becomes competent to undergo fusion upon Ca2+-influx, involving a Ca2+-binding protein such as synaptotagmin. At the recycling stage, a-SNAP and NSF bind to the SNARE complex and the SNARE complex is then dissociated upon ATP hydrolysis. Surrounding the schematic are the crystal structures of the SNARE complex (blue: synaptobrevin; red: syntaxin; green: SNAP-25), the N-terminal domain of syntaxin, which is shown as a separate structure (the structure of the linker between the syntaxin N-terminal domain and the core SNARE complex is unknown), the nSecl-syntaxin complex (red: syntaxin; brown: nSecl), a- SNAP, the N-terminus and second ATP-binding domain of NSF, NSF-N and NSF-D2 respectively, the complex between the small G protein Rab3A and the effector binding domain of rabphilin-3A (red: Rab3A;brown: rabphilin-3A),Rab GDI and the C2A and C2B domains of synaptotagmin III. Pi, inorganic phosphate.


ternary complex. The crystal structure of the protease-resistant core of the complex

revealed a coiled-coil structure made up of 4 parallel a-helices, with 2 helices

contributed by SNAP-25 and one each from syntaxin and VAMP (Sutton et al, 1998;

Figure 1.4). The three membrane anchors localise to the same end of the complex and as

a result, it has been proposed that the zippering up of the SNARE proteins from the

amino to the carboxy terminus brings the vesicle and target membrane into close

enough proximity (within 4 nm) to allow fusion to occur (Hanson et al, 1997; Lin and

Scheller, 1997; Sutton et al, 1998). In fact, SNARE complex formation is sufficient to

mediate lipid bilayer fusion in vitro suggesting that SNAREs are indeed the minimal

fusion machinery (Weber et al, 1998; McNew et al, 2000).

Although SNARE complex formation is thought to be sufficient to drive membrane

fusion in regulated exocytosis (Littleton et al, 1998; Chen et al, 1999), in some

systems, notably homotypic vacuole fusion in yeast and homotypic fusion of sea-urchin

cortical vesicles, SNARE complex formation, although being necessary for fusion, is

not sufficient (Ungermann et al, 1998; Tahara et a l, 1998). In the case of vacuole

fusion, although the formation of trans SNARE complexes is required for fusion

(Nichols et al, 1997), these complexes can be dissociated without affecting the rate or

extent of fusion (Ungermann et al, 1998). Instead, the formation of the fusion pore

requires the free Vo subunit of the vacuolar proton pump and occurs downstream of

SNARE complex formation (Peters et al, 2001). Whether such downstream effectors of

SNARE complexes are also involved in other membrane fusion steps remains to be

determined.

Following membrane fusion, lipid and protein components of the SSV are recovered

through rapid endocytosis and recycling within the nerve terminal. PtdIns(4,5)P2 also

31


plays an important role in the endocytic pathway (Cremona and De Camilli, 2001;

Figure 1.3).

1.7 PtdIns(4,5)P2 synthesis is required for ATP-dependent priming

The first demonstration that Ptdlns(4,5)?2 was involved in regulated secretion,

independent of its acting as a substrate for phospholipase C, came from studies of

catecholamine release in permeabilised adrenal chromaffin cells where the observed

requirement of ATP for secretion could be partially explained by the need to generate

PtdIns(4,5)P2 (Eberhard et al, 1990). Subsequently, two of the three cytosolic factors

required for the ATP-dependent priming secretory granule exocytosis from ‘cracked’

PCI2 cells were identified as PITP and a type I PtdIns(4)P 5-kinase (Hay and Martin,

1993; Hay et al, 1995). More recently, a secretory granule associated Ptdlns 4-kinase

was also shown to be required for calcium-dependent exocytosis in adrenal chromaffin

cells (Wiedemann et a l , 1996). Priming, like inositol phosphorylation, is fully

reversible (Hay and Martin, 1992). The accelerated reversal of priming that occurs in

the presence of cytosol and Mg^ is mimicked by the addition of a recombinant type II

inositol phosphate 5-phosphatase suggesting that PtdIns(4,5)P2 is also important for the

maintenance of the primed state (Jefferson and Majerus, 1995).

The site of the PtdIns(4,5)P2 synthesis required for exocytosis remains controversial.

While Ptdlns 4-kinase activity associates with secretory granules, PtdIns(4)P 5-kinase

activity is predominantly associated with chromaffin cell plasma membranes

(Wiedemann et a l, 1996). It is possible that docking brings the secretory vesicle

membrane close enough for the PtdIns(4)P to be phosphorylated by the plasma

membrane kinase. Alternatively, a separate, and as yet unidentified, Ptdlns 4-kinase

could associate with the plasma membrane and contribute to the synthesis of a plasma

32


membrane pool of PtdIns(4,5)P2. The synthesis of PtdIns(4,5)P2 on secretory granules

during ATP-dependent priming has been reported in PC 12 cells (Martin, 1997a). On the

other hand, a recent report demonstrated that a PtdIns(4,5)P2 specific GFP-PH domain

that is able to inhibit secretion in chromaffin cells localises predominantly to the plasma

membrane (Holz et al, 2000).

More limited evidence is available for the requirement for PI synthesis in the calcium-

dependent exocytosis of synaptic vesicles. A Ptdlns 4-kinase activity has been identified

on purified synaptic vesicles (Wiedemann et al, 1998). No PtdIns(4)P-5 kinase activity

was detected on purified SSV (Gross et al, 1995; Wiedemann et al, 1998) consistent

with the lack of PtdIns(4)P-5 kinase activity on LDCV membranes (Wiedemann et a l ,

1996). There are however conflicting results regarding the involvement of PI synthesis

in SSV exocytosis. In one study, the inhibition of Ptdlns 4-kinase activity was reported

to inhibit the calcium-dependent release of glutamate from synaptosomes (Wiedemann

et al, 1998). A second independent study using a similar strategy reported the inhibition

of calcium-dependent release from rat brain synaptosomal LDCVs, while glutamate

release was unaffected (Khvotchev and Sudhof, 1998).

Indirect evidence for a requirement for PI synthesis in neurotransmitter release has

come from the study of frequenin, a calcium-binding myristoylated protein related to

recoverin (Burgoyne and Weiss, 2001). Frequenin homologues are found in the nervous

system of Drosophila, Xenopus and mouse where they are known to modulate synaptic

function (Pongs et al, 1993; Olafsson et al, 1995; Olafsson et al, 1997). Recently the

Sacchromyces cerevisiae frequenin homologue (Frql) was shown to be a calcium-

independent regulator of Ptdlns 4-kinase activity (Hendricks et al, 1999). Vertebrate

frequenin is able to substitute Frql in this system suggesting that frequenin also

33


functions as a regulator of Ptdlns 4-kinase activity in higher organisms. In support of

this, rat frequenin co-immunoprecipitates with the mammalian Pikl homologue,

PtdIns4KB when over-expressed in MDCK cells (Weisz et al, 2000).

PtdIns(4,5)P2 synthesis appears to be important for other regulated membrane fusion

steps, including antigen-stimulated exocytosis in mast cells (Way et al, 2000). The

requirement for Pis is conserved through evolution. In yeast, secretion requires the

activity of the Ptdlns 4-kinase, Pikl (Hama et al, 1999; Walch-Solimena and Novick,

1999; Audhya et al, 2000). It seems unlikely however that the PtdIns(4)P generated is

converted to PtdIns(4,5)P2 as Mss4p mutants have cytoskeletal but not secretory defects

(Desrivieres et al, 1998; Homma et al, 1998). PtdIns(4,5)P2 is however required in

yeast for homotypic vacuolar fusion (Mayer et al, 2000). No putative PtdIns(4,5)P2-

binding proteins have been found in vacuole fusion in contrast to neuro secretion where

a number of potential PtdIns(4,5)P2-effectors have been identified that play important

roles at different stages in the release process.

1.8 PtdIns(4,5)P2-effectors in neuroexocytosis

A number of proteins implicated in different stages of calcium-dependent exocytosis in

neuroendocrine cells have been identified as PI-binding proteins. These include

synaptotagmin (Schiavo et al, 1996), CAPS (Loyet et al, 1998), Mints (Munc-18

interacting proteins; Okamoto and Sudhof, 1997), and the Rab3 interacting protein

rabphilin (Chung et al, 1998).

1.8.1 Rabphilin

Rabphilin, a putative Rab3 effector at the synapse, contains an N-terminal Rab3

interacting domain, a central phosphorylation domain and two C-terminal C2 domains

34


(Fykse et al, 1995). Rabphilin binds PtdIns(4)P and PtdIns(4,5)P2 in a calcium-

dependent manner (Chung et al, 1998) and peptides corresponding to the PI binding

domain of the rabphilin C2B inhibit LDCV exocytosis in permeabilised chromaffin

cells (Chung et a l, 1998). Rabphilin knockout mice do not however display any

obvious abnormalities in synaptic transmission indicating that this protein is either

redundant or does not play an essential role in calcium-evoked neurotransmitter release

(Schluter et al, 1999). In chromaffin cells, the observed inhibition of exocytosis caused

by the Pl-binding peptide could therefore be a consequence of interfering with the

binding of Pis to other proteins.

1.8.2 Mints

Mints are synaptic proteins suggested to act in the organisation of pre-synaptic active

zones and the coupling of certain voltage-gated calcium channels to the exocytic

machinery through their interactions with Munc-18 (a syntaxin binding protein), other

PDZ domain containing adaptor proteins such as CASK and Veli (Butz et al, 1998),

neurexins (Biederer and Sudhof, 2000) and splice variants of neuronal calcium channels

(Maximov et a l, 1999). Mints bind PtdIns(4)P and PtdIns(4,5)P2 at low calcium

concentrations via their PTB domains (Okamoto and Sudhof, 1997). The relevance of

this to the functioning of Mints in neuroexocytosis is yet to be elucidated. One possible

role could be to promote the binding of plasma membrane Mints to vesicular

PtdIns(4,5)P2 produced during the ATP-dependent priming step, suggested to be a

means of positioning the vesicle in close proximity with the pre-synaptic plasma

membrane (Okamoto and Sudhof, 1997).

35


1.8.3 CAPS

CAPS, the mammalian homologue of Unc-31, is a 145 kDa neuroendocrine specific

calcium-binding protein essential for calcium-dependent exocytosis of LDCV in PC 12

and adrenal chromaffin cells (Ann et al, 1997; Elhamdani et al, 1999). In the absence

of calcium, CAPS binds PtdIns(4,5)P2, triggering a conformational change in the

protein. Both PtdIns(4,5)P2 binding and the conformational change are reversed by

calcium concentrations between 10 and 100 pM (Loyet et a l, 1998). Studies in semi

intact synaptosomes demonstrated that a substantial fraction of CAPS is associated with

LDCV and the synaptic plasma membranes but not with SSV membranes (Berwin et

al, 1998). Accordingly, anti-CAPS antibodies selectively inhibit noradrenaline but not

glutamate release from semi-intact synaptosomes (Berwin et al, 1998; Tandon et al,

1998).

1.8.4 Svnaptotagmin I and II

Synaptotagmins (Syts) are a large family of proteins of which Syt I and the highly

homologous Syt II remain the best characterised isoforms. Syt I and II are

PtdIns(4,5)P2-binding proteins present in both SSV and LDCV membranes. Genetic

evidence from Syt mutants in Drosophila, C. elegans and mouse have demonstrated that

Syt I is essential for calcium-dependent neurotransmitter release (Nonet et al, 1993;

Littleton et al, 1993; DiAntonio and Schwarz, 1994; Geppert et al, 1994). Evoked

release is dramatically decreased in mutants but not completely abolished suggesting

that Syt I is not the sole calcium sensor for exocytosis. Other Syt isoforms could

account for this residual release. To date, fourteen Syt isoforms have been identified in

mammals and seven Syt isoforms in the Drosophila genome (Desai et al, 2000). Syt II,

for example, has 75% sequence identity to Syt I, similar calcium-sensing properties and

an overlapping pattern of expression (Geppert et al, 1991).

36


Syt I is comprised of an intravesicular amino terminal domain that is glycosylated in Syt

I and II, a single transmembrane region, a flexible linker sequence separating the

transmembrane region from two consecutive C2 domains, the C2A and C2B and a

conserved carboxy terminal domain (Perin et al, 1991; Geppert et al, 1991; Figure 1.5

A). The crystal structure of the C2A domain of Syt I and the C2A and C2B of Syt III

have recently been solved (Sutton et al, 1995; Sutton et al, 1999; Figure 1.5 B). The

C2A of Syt I is an eight-stranded B-sandwich connected by flexible loops that form the

binding sites for three calcium ions. Both the C2A and C2B are structurally similar with

the exception of a seven amino acid alpha helix in the C2B that is also found in the C2B

of rabphilin (Ubach et al, 1999). They also differ slightly in the shape of the calcium

binding pocket, the electrostatic potential and the number of bound divalent cations

(Sutton et al, 1999). These structural differences could underlie the distinct binding

properties of the two C2 domains.

The C2A domain of Syt I, like the C2 domain of PKC, binds acidic phospholipids in a

calcium-dependent manner (Perin et al, 1990; Davletov and Siidhof, 1993; Figure 1.5

C) and also triggers the penetration of Syt into lipid bilayers (Bai et al, 2000). The

importance of the calcium-dependent phospholipid binding in excitation-secretion

coupling in vivo was recently demonstrated using reverse genetics to introduce a point

mutation into Syt I, close to one of the calcium-binding sites in the C2A. This resulted

in a two-fold decrease in the affinity of the C2A for calcium in a calcium-dependent

phospholipid binding assay (Fernandez-Chacon et a l, 2001). Furthermore, mice

engineered with this mutation were viable and fertile but showed a decrease in the

calcium-responsiveness of neurotransmitter release measurable as a two-fold decrease

in the release probability (Femandez-Chacon et al, 2001).

37

B

C2A

SSVlumen

Cytoplasm

C2A C2B

3 4 5 6 7

100 AAC2B

1= poorly conserved intra vesicular region2= trans-membrane domain3= multiple palmitoylated cysteines4= flexible linker region5= first 02 homology domain6= second 02 homology domain7= conserved 0-terminal region

# = ion

= C 2B -u n iq u e a -h e llx

P S P t d l n s ( 4 , 5 ) P ,

02A 02B 02A 02B

^ 0 mM C a ^■ 0.1 mM Ca '*'

C2A C2B Ca2*

Syntaxin

Synaptotagm in

SNAP-25

Oa^* Channels

SV2

B- SNAP

AP-2

Figure 1.5 Synaptotagmin, a calcium sensor for neurotransmitter release.A) Schematic of the domain structure of synaptotagmin I (Syt I). Syt I is a type I trans-membrane protein of the SSV. The C2A and C2B domains interact with different protein and lipid effectors in a Ca2+-dependent and independent manner. B) Crystal structure of the the C2A and C2B of Syt III. Coordinates of the structure were obtained from <http://www.rscb.org/pdb/> (PDB ID: IDQV) and presented using Swiss PDB-viewer v.3.5. The two C2 domains have a similar structure with the exception of a 7 amino acid a-helix in the C2B (black arrow). Green spheres correspond to coordinated Mg ions in the Ca2+-binding pockets. C) Synaptotagmin I is a calcium-dependent phospholipid binding protein. Despite the high sequence and structural homology, the C2A binds acidic phospholipids in the presence of Ca2+ while the C2B preferentially binds PtdIns(4,5)P2 in the presence of Ca2+. D) Syt 1 interacts with different synaptic proteins. Note that SV2 dissociates from Syt in the presence of Ca2+, which is indicated by the red cross.

http://www.rscb.org/pdb/


The C2B also binds phospholipids in a calcium-dependent manner, but in this case

binding is specific for Ptdlns(4,5)?2, Ptdlns(3,4)?2 and PtdIns(3,4,5)P3 (Schiavo et al,

1996). Syt I preferentially binds PtdIns(3,4,5)P3 at low levels of calcium, similar to

those found in resting nerve terminals and PtdIns(4,5)P2 at high calcium concentrations,

equivalent to those required for neurotransmitter release at mammalian synapses

(Schiavo et al, 1996; Figure 1.5 C). Syt also binds inositol polyphosphates (IPPs) in a

calcium-dependent manner via a region overlapping with, or equivalent to, that involved

in Pl-binding (Fukuda et al, 1994). IPPs block neurotransmitter release at the squid

giant synapse (Llinas et a l , 1994), in mammalian cholinergic synapses (Mochida et a l ,

1997) and regulated exocytosis in adrenal chromaffin cells (Ohara-Imaizumi et al,

1997). Significantly, this block can be prevented in each case by the co-injection of an

antibody that blocks InsP4 binding to the C2B of Syt (Llinas et al, 1994; Mochida et

al, 1997; Ohara-Imaizumi et al, 1997). Interestingly, different Syt C2B domains differ

in their ability to bind IPPs and Pis. Syt III, like Syt I, binds PtdIns(4,5)P2 in the

presence of calcium but does not bind PtdIns(3,4,5)P3 in the presence or absence of

calcium (Schiavo et al, 1999). Pis and IPPs could therefore differentially modulate the

function(s) of different Syt isoforms.

The two C2 domains of Syt also interact, in calcium-dependent and independent ways,

with a number of proteins with central roles in neurotransmission (Figure 1.5 D). Syt

binds syntaxin and SNAP-25 via its C2 domains both individually (Chapman et al,

1995; Schiavo et al, 1997) and when incorporated in SNARE complexes, when Syt is

able to simultaneously bind SNARE complexes and phospholipid containing liposomes

(Davis et a l , 1999). The interaction with SNARE complexes most likely occurs through

the C-terminal, membrane attachment end of the SNARE complex (Kee and Scheller,

1996; Gerona et al, 2000). Based on these and other structural observations, it has been

39


suggested that Syt could act as a clamp to prevent complete zippering of the SNARE

complex, prior to calcium influx. Following the calcium trigger, Syt would dissociate

from the SNARE complex, allowing complete complex formation and membrane

fusion. Through interactions with other binding partners, for example phospholipids,

Syt could also function to actively promote fusion (Siidhof and Rizo, 1996; Sutton et

al, 1999).

The short latency between calcium influx and neurotransmitter release requires an

intimate association between calcium channels and the release machinery (Robitaille et

a l, 1990; Stanley, 1997). One way this could be provided is by the association of

SNARE proteins and synaptotagmin with voltage-gated calcium channels in a multi

protein complex at the synapse (Leveque et al, 1994; el Far et al, 1995; Martin-Moutot

et al, 1996). The region of the C2B implicated in PI and IFF binding also interacts with

calcium-channels via a region named the ‘synprint’ (synaptic protein interaction site)

located on the cytoplasmic loop between domains II and III of the a i pore-forming

subunit of the calcium channel (Fukuda et al, 1995a; Rettig et al, 1996; Chapman et

a l , 1998). This region of the C2B is also required for the calcium-dependent

oligomerisation of Syt (Chapman et al, 1996; Sugita et al, 1996) and the calcium-

independent binding to AF-2 (Zhang et al, 1994), an interaction important for the

endocytosis of synaptic vesicles and described in more detail in section 1.9.1. Which

interaction occurs at any one time will be dictated by the availability of the substrates

and the relative binding affinities.

1.8.5 Other svnaptotagmin familv members

Fourteen mammalian Syt isoforms have been identified to date (Table 1.1). These all

share a common domain structure, with the exception of B/K which lacks the

40

Isoform Distribution C az^dependent PS binding

Ca2+-dependent syntaxin binding IFF binding C az^dependent

oligom erisation

Syt I N e u r o e n d o c r in e EC5 0 = 3-6 /iM ECso>200//M S tro n g ECso = 3-10 f M

Syt II N e u r o e n d o c r in e EC5 0 = 3-6 pM EC5 0 > 200 f M S tro n g EC5 0 — 2-10 f M

Syt III N e u r o e n d o c r in e EC5 0 = 3-6 /iM EC$o<10plVI N o n e ECgo = 150/iM

Syt IV U b iq u ito u s N o n e N o n e S tr o n g Y e s

SytV N e u r o e n d o c r in e EC5 0 = 3-6 f M EC5 o > 2 0 0 /iM N o n e Y e s

Syt VI U b iq u ito u s N o n e N o n e W eak Y e s

Syt VII U b iq u ito u s EC5 0 = 3-6 f M EC5 o < 1 0 pM S tro n g V/ x

Syt VIII U b iq u ito u s N o n e N o n e S tro n g N o n e

Syt IX U b iq u ito u s N o n e N.D. S tro n g Y e s

SytX N e r v o u s s y s t e m N.D. N .D . N o n e C a ^ H n d e p e n d e n t

Syt XI U b iq u ito u s N o n e N o n e S tro n g C a2+ -ln d ep en d en t

Srg 1 N e r v o u s s y s t e m N.D. N.D. N .D . N.D.

B/K B ra in /K ld n ey N .D . N.D. N .D . N.D.

Syt XIII U b iq u ito u s N o n e N.D. N.D. N o n e

Table 1.1 The synaptotagmin family. Different Syt isoforms have distinct expression patterns and Ca2+-dependent and independent binding features. Different C2A domains interact with acidic phospholipids and syntaxin to varying extents. C2B domains can be grouped according to their ability to bind inositol polyphosphates (IPPs) or their ability to oligomerise in the presence of Ca2+. In some instances there are discrepancies in the literature, most notably for the Ca2+-dependent oligomerisation of Syt VII (Fukuda and Mikoshiba, 2000b; Desai et al, 2000). The binding characteristics have not been determined for all isoforms (N.D.).


transmembrane domain (Kwon et al, 1996), but can be sub-divided according to their

different distributions, either being restricted to the nervous system or neuroendocrine

tissues (Syt I, II, III, V, X and Srgl) or being expressed ubiquitously (Syt IV, VI-IX, XI

and XIII). They can also be classified according to the calcium-dependence of their

interactions with syntaxin (Li et al, 1995), their ability to oligomerise in the presence of

calcium (Chapman et al, 1996; Chapman et al, 1998; Osborne et al, 1999; Fukuda and

Mikoshiba, 2000a) and their ability to bind inositol polyphosphates and

phosphoinositides (Ibata et al, 1998; Schiavo et al, 199^(fable 1.1). In addition to Syt

I and II, other Pl-binding Syt isoforms expressed in the nervous system are candidate

PtdIns(4,5)P2 effectors in neurotransmitter release. In addition, ubiquitously expressed

Syt isoforms may be involved in the regulation of other membrane trafficking steps,

possibly involving interactions with Pis. Syt VII, for example, has been implicated in

the calcium-dependent exocytosis of lysosomes in NRK cells (rat kidney fibroblasts;

Martinez et al, 2000) and Syt IV in secretory granule maturation (Eaton et al, 2000).

Syt IV, like Syt I and II, is expressed in the nervous system. Syt IV differs from Syt I

and II in that one of the five Ca^^-binding aspartates in the C2A-domain is substituted

for a serine. As a consequence, the C2A-domain of Syt IV does not show any Ca^ -

dependent phospholipid or syntaxin-binding activity (von Poser et al, 1997; Thomas et

al, 1999b). Syt IV C2B is however able to bind IPPs suggesting that it too may

function as a PtdIns(4,5)P2 effector (Fukuda et a l, 1995a). Syt IV is of particular

interest as it is expressed at high levels transiently during development and its

expression is up-regulated in an activity-dependent manner in PC 12 cells and the

hippocampus (Vician et al, 1995; Berton et a l, 1997). Thus, Syt IV expression

correlates with periods of synaptic plasticity and remodelling, suggesting a specialised

42


role for Syt IV in the modulation of synaptic function. There is some evidence for this,

as upregulating Syt IV expression in Drosophila decreases evoked neurotransmitter

release and Syt IV knock out mice show specific defects in hippocampal-dependent

learning (Littleton et al, 1999; Ferguson et al, 2000).

Genetic evidence from Drosophila, based on the complementation of mutant alleles, is

consistent with Syt functioning as a multimeric complex in neurotransmitter release

(Littleton et al, 1994) and the formation of Syt oligomers appears to be essential for its

function in neurotransmitter release in vivo (Littleton et al, 1999; Littleton et al, 2001).

All Syt isoforms tested have the potential to homo- and hetero-oligomerise to a greater

or lesser extent in vitro (Chapman et al, 1998; Osborne et al, 1999; Littleton et al,

1999; Fukuda and Mikoshiba, 2000b). The distinct but overlapping distributions of

different Syt isoforms, suggests that Syt isoforms with different calcium-binding

features could combine to create a variety of calcium sensors characterised by distinct

calcium sensitivities (Osborne et al, 1999). As a result, the calcium-dependence of

membrane fusion steps, such as that underlying neurotransmitter release could be

precisely and sensitively regulated.

1.9 PtdIns(4,5)P2 is involved in multiple steps of SSV endocytosis

SSV exocytosis is followed by the rapid recycling of protein and lipid membrane

constituents. A major pathway involves the clathrin-dependent endocytosis of synaptic

vesicles (Brodin et al, 2000). Other clathrin-independent pathways may exist (Fesce et

a l , 1994) but their significance remains unclear. Clathrin-dependent endocytosis

predominantly occurs in actin-rich endocytic zones surrounding the active zone

(Dunaevsky and Connor, 2000). Two sets of proteins are required, those comprising the

clathrin coat and a number of ‘accessory’ proteins that act to coordinate coat

43


recruitment, vesicle formation and scission from the membrane and vesicle uncoating

(Brodin et al, 2000). PtdIns(4,5)P2 plays an important role in all these steps, mainly via

the recruitment, and in some cases the activation, of coat and accessory proteins.

PtdIns(4,5)P2, by virtue of its ability to induce negative curvature in the membrane, may

also contribute to the membrane deformation required for coated vesicle formation.

1.9.1 Coat recruitment

The recruitment of a clathrin coat to the membrane requires the clathrin adaptor proteins

AP-2, a heterotetramer of a, 13, q and a sub-units, and AP-180. Both AP-2 and AP-180

interact with membranes via interactions with Pis. The N-terminal region of the AP-2

subunit oc-adaptin binds PtdIns(4,5)P2 and PtdIns(3,4,5)P3 (Gaidarov et al, 1996;

Gaidarov and Keen, 1999) and this Pl-binding region is required for the membrane

targeting of AP-2. The PtdIns(4,5)P2-binding site in AP-180 was recently identified as a

cluster of positive residues in the ENTH (Epsin N-Terminal Homology) domain (Ford

et al, 2001). AP-180 is able to simultaneously bind PtdIns(4,5)P2 and clathrin and

moreover, clathrin lattices form on PtdIns(4,5)P2-containing monolayers in the presence

of AP-180 (Ford et al, 2001). Furthermore, altering PI levels in a cellular context,

either by sequestering Pis or increasing synthesis, inhibits or enhances coat formation

respectively (Jost et a l, 1998; Arne son et al, 1999). Epsin itself is essential for

endocytosis in yeast and mammalian cells. Epsin also binds PtdIns(4,5)P2, and to a

lesser extent PtdIns(3,4,5)Ps, via its ENTH domain although the PtdIns(4,5)P2 binding

site differs from that of API 80 (Itoh et al, 2001).

The C2B of Syt binds AP-2 via a calcium-independent and high affinity, dual

interaction with the p2 and a-adaptin sub-units (Zhang et al, 1994; Haucke et al,

2000). The importance of the C2B in endocytosis, presumably as a consequence of its

44


interaction with AP-2, is highlighted by the decreased numbers of SSV, indicative of a

recycling defect, in Drosophila and C. elegans mutants lacking the C2B domain

(DiAntonio et al., 1993; Littleton et al, 1993; Jorgensen et al, 1995). The Syt-AP-2

interaction is stimulated by tyrosine containing motifs (Yxxcj)), such as those found in

the SSV protein SV2 and the Drosophila pre-synaptic proteins stoned A and B, all of

which interact with Syt (Schivell et al, 1996; Phillips et al, 2000; Fergestad and

Broadie, 2001). In fact, stoned A and B have recently been demonstrated to facilitate the

internalisation of synaptic vesicle components from the plasma membrane (Stimson et

al, 2001). Interestingly, the interaction between AP-2 and Syt is disrupted by InsPô

(Mizutani et al, 1997) and promoted by PLD activity (Haucke et al, 2000), which is

known to increase synthesis of PtdIns(4,5)Pi by PIPKI, via the generation of PA

(Jenkins et al, 1994). Thus an interaction between Syt and PtdIns(4,5)P2 might also be

important in endocytosis.

Non-neuronal Syt isoforms may also be involved in the formation of clathrin coated

vesicles (CCV) at the cell-surface. Deletion of the C2B of Syt I and VII inhibits

receptor-mediated endocytosis in HeLa cells (von Poser et a l , 2000) and AP-2 binding

to an unidentified Syt-like protein was also promoted by tyrosine based motifs in non

neuronal cells (Haucke et al, 2000). Syt isoforms may also be involved in intracellular

CCV formation, for example the clathrin-dependent budding of transport vesicles from

the trans-GoXgi network (TON). Altogether these results suggest a pivotal role of the

Syt-AP-2 interaction in clathrin recruitment and point to a modulatory role of Pis in this

process.

45


1.9.2 Formation of endocytic vesicles and clathrin coat removal

PtdIns(4,5)P2 is also involved in processes downstream of coat recruitment which lead

to the formation of endocytic CCV. PtdIns(4,5)P2-binding proteins not only inhibit

coated pit formation, but also CCV formation (Jost et al, 1998). Dynamin is a GTPase

required, together with amphiphysin, endophilin and other accessory proteins, for the

pinching off of CCV from the plasma membrane (Marks et al, 2001). Dynamin binds

PtdIns(4,5)P2 via its PH domain (Salim et a l, 1996), which displays high affinity

PtdIns(4,5)P2 binding when oligomerised (Klein et al, 1998). PtdIns(4,5)P2 binding to

the dynamin PH domain increases the GTPase activity in vitro (Zheng et al, 1996; Lin

et al, 1997) and moreover is required for endocytosis (Vallis et al, 1999; Lee et al,

1999; Achiriloaie et al, 1999).

As the formation of the clathrin coat requires PtdIns(4,5)P2, so the uncoating of

endocytosed CCV requires its removal. Synaptojanin is a type III inositol phosphatase

able to dephosphorylate InsP], InsP4 , PtdIns(4,5)P2 and PtdIns(3,4,5)P3 (McPherson et

al, 1996; Woscholski et al, 1997). Synaptojanin interacts with SH3 containing proteins

involved in endocytosis including amphiphysin and endophilins (McPherson et al,

1996; de Heuvel et al, 1997; Ringstad et al, 1997) which could mediate its recruitment

to the endocytic vesicle. Insight into the involvement of synaptojanin in endocytosis

came with the generation and analysis of synaptojanin knockout mice. These animals

have neurological defects and die shortly after birth (Cremona et al, 1999). Neurons of

mutant animals have higher levels of PtdIns(4,5)P2 and accumulate coated vesicles in

the terminals. In vitro, decreased synaptojanin phosphatase activity is associated with

increased association of clathrin coats with PtdIns(4,5)P2-containing liposomes

(Cremona et al, 1999), suggesting that synaptojanin is required for the uncoating of

CCV via the dephosphorylation of PtdIns(4,5)P2. C. elegans synaptojanin mutants also

46


display defects in vesicle uncoating and additionally in vesicle budding, recovery of

vesicles from endosomes and their tethering to the cytoskeleton (Harris et al, 2000).

Finally, disruption of synaptojanin recruitment and/or function by antibodies and

peptides at lamprey giant synapses also causes clathrin-coated vesicles ond^pit» to

accumulate (Gad et a l , 2000). Hovêver, recent studies have also implicated

PtdIns(3,4,5)P3 and other D-3 Pis in SSV endocytosis. The up-regulation of enzymes

synthesising PtdIns(3,4,5)P3 results in the accumulation of coated vesicles (Gaidarov et

al, 2001) suggesting that increased levels of PtdIns(3,4,5)P3 in addition to PtdIns(4,5)P2

could contribute to the synaptojanin mutant phenotype.

Actin cytoskeletal rearrangements are involved in multiple endocytic steps. Genetic

evidence in yeast has implicated actin in endocytosis (Kubler and Riezman, 1993).

Moreover, dynamic rearrangements of the actin cytoskeleton, probably coordinated by

sequential PtdIns(4,5)P2 synthesis and breakdown, are important for phagocytosis in

macrophages (Botelho et al, 2000). At the nerve terminal, most pre-synaptic actin is

found in a region adjacent to the active zone where the majority of clathrin-dependent

endocytosis occurs (Dunaevsky and Connor, 2000) and it is well-established that there

is cross-talk between the synaptic endocytic apparatus and the actin cytoskeleton (Witke

et a l, 1998; Qualmann et al, 2000; Harris et a l, 2000). PtdIns(4,5)P2 is intimately

involved in the regulation of actin cytoskeleton dynamics, as discussed below, and may

therefore be important for coordinating the membrane and cytoskeletal rearrangements

required for endocytosis at the nerve terminal.

1.10 PtdIns(4,5)P2 and regulation of the actin cytoskeleton

PtdIns(4,5)P2 interacts with a number of actin-regulatory proteins, for example a-

actinin and vinculin (Fukami et a l, 1994), and as a consequence influences their

47


localisation and/or their activity (Sechi and Wehland, 2000). The effects of

PtdIns(4,5)P2 on the cytoskeleton are not restricted to sites of contact with the plasma

membrane, as the formation of proteolipid complexes between PtdIns(4,5)P2 and such

proteins is able to stabilise PtdIns(4,5)P2 in the absence of a lipid bilayer (Hinchliffe et

al, 1996). In yeast, mutations of the Ptdlns 4-kinase Stt4p or the PtdIns(4)P 5-kinase

Mss4p result in defects in regulation of the actin cytoskeleton (Desrivieres et al, 1998;

Homma et al, 1998; Audhya et al, 2000). Similarly, altering PtdIns(4,5)P2 levels in

mammalian cells can cause changes in the actin cytoskeleton. For example, increasing

PtdIns(4,5)P2 promotes stress fibre formation and the strength of actin cytoskeleton-

plasma membrane interactions, while decreasing PtdIns(4,5)P2 has the opposite effect

(Shibasaki et al, 1997; Sakisaka et al, 1997; Rancher et al, 2000; Yamamotoa et al,

2001). Similarly, studies using GFP-PH domains to localise PtdIns(4,5)P2 have

demonstrated that PtdIns(4,5)P2 concentrates in dynamic, F-actin rich regions of the

plasma membrane (Tall et al, 2000). PtdIns(4,5)P2-dependent changes in the actin

cytoskeleton are not restricted to the plasma membrane, as the over-expression of a type

I PtdIns(4)P 5-kinase promotes the formation of vesicle associated actin tails,

presumably through an increase in local PtdIns(4,5)P2 synthesis (Rozelle et al, 2000).

These results indicate that the overall effect of PtdIns(4,5)P2 is to promote actin

polymerisation.

Rho family GTPases play important roles in the regulation of the actin cytoskeleton and

there is evidence that their effects might be mediated in part by influencing PI

metabolism (Hinchliffe, 2000). Activation of Racl causes membrane ruffling and

lamellipodia formation by stimulating actin uncapping and this effect requires an

interaction between Racl-GTP and PIPKIa (Tolias et al, 2000). Small G-proteins of

the ARF family also appear to be linked to Pl-signalling pathways. These proteins are

48


involved in cytoskeletal rearrangements underlying membrane ruffling and the initiation

of coat recruitment in membrane budding reactions. ARF6 and possibly other members

of the ARF family interact functionally with PIPKI (Fensome et al, 1996; Honda et al,

1999) and are able to stimulate the recruitment of Ptdlns 4-kinases and PtdIns(4)P 5-

kinases to Golgi and plasma membranes (Godi et al, 1999; Honda et al, 1999; Jones et

al, 2000). ARF6 appears to act downstream of Rac in PIPKI activation (Zhang et al,

1999). ARF6 has also been implicated in clathrin mediated endocytosis (D'Souza-

Schorey et al, 1995). However, no ARF protein has been demonstrated to be involved

in clathrin-dependent endocytosis at the nerve terminal, although an ARF GTPase

exchange factor has been localised to the synapse (Ashery et al, 1999).

1.11 Phosphoinositides in the nucleus

Evidence has been accumulating that inositol based signalling pathways are also present

within the nucleus of eukaryotic cells where they affect fundamental cellular processes

including growth, survival and differentiation (Divecha et a l, 1993; Irvine, 2000;

Maraldi et a l, 2000). Multiple nuclear Pis have been identified and [^^P]-labelling

studies have demonstrated that the extent of incorporation into Pis depends on the stage

in the cell-cycle and the differentiation state of the cells. Moreover, these changes can

occur independently of variations in whole-cell incorporation suggesting that the

nuclear PI cycle is distinct from the cytoplasmic cycle (Divecha et al, 1991; York and

Majerus, 1994; Imoto et al, 1994; Maraldi et al, 1999).

Isoforms of many of the enzymes involved in peripheral PI signalling have also been

localised to the nucleus. Their nuclear localisation can be constitutive or regulated by

extracellular stimuli. It is becoming increasingly apparent that PtdIns(4,5)P2 plays a

central role in nuclear inositol signalling as it does in the periphery. However, little is

49


known of the nuclear targets of PtdIns(4,5)P2 and how PtdIns(4,5)P2 modulates nuclear

physiology.

1.11.1 Synthesising PtdInsM.5)P? in the nucleus

[^^P]-labelling studies in purified nuclei indicate that the major route of synthesis of

PtdIns(4,5)P2 is through the phosphorylation of PtdIns(4)P (Vann et al, 1997) and

consistent with this, both Ptdlns 4-kinase and PtdIns(4)P 5-kinase activities have been

found in the nucleus (Payrastre et al, 1992). The nuclear isoform of Ptdlns 4-kinase

responsible for such activity in mammalian cells has not yet been identified, although in

yeast, Pikl, the homologue of PtdIns4KB, is found within the nucleus (Garcia-Bustos et

a l , 1994). PIPKIa has been localised by immunofluorescence to the nuclei of

mammalian cells (Boronenkov et al, 1998). PIPKII isoforms have also been found in

the nucleus, although it is not clear whether only the B or both the a and B isoforms are

present (Boronenkov et al, 1998; Ciruela et al, 2000). The presence of PIPKII in the

nucleus could suggest the existence of alternative pathways for the synthesis of

PtdIns(4,5)P2 within the nucleus, conceivably with functions different to those of

PIPKI-derived PtdIns(4,5)P2 (Irvine, 2000).

PITPa has also been localised in the nucleus (De Vries et al, 1995; De Vries et al,

1996) and interestingly, intra-nuclear levels of PITPa have been shown to be regulated

by the differentiation state of Friend erythroleukemia cells (Rubbini et al, 1997). PITP

within the nucleus might function in the transport of PI to sites of intra-nuclear PI

metabolising enzymes and/or in the presentation of the substrate to those enzymes as

has been proposed for cytoplasmic PITP (Cockcroft, 2001).

50


1.11.2 Nuclear phospholipase C and the breakdown of nuclear PtdInsr4.5)P?

Components of the ‘classical’ PtdIns(4,5)P2 signalling pathway, involving the PLC-

dependent breakdown of PtdIns(4,5)P2, are found within the nucleus. While the main

nuclear isoform ofPLC is PLCBl, in particular the splice variant PLCBlb, two isoforms

of PLC0 (PLC01 and PLC04) may also be localised, at least transiently, within the

nucleus (Liu et al, 1996; Yamaga et al, 1999). Interestingly, nuclear levels of PLCBl

change according to the cell state, increasing during growth and decreasing upon

differentiation (Maraldi et al, 1995). Moreover, PLCBl has been shown to be essential

for the onset of DNA synthesis in response to IGF-1 and for cell cycle progression

(Faenza et al, 2000).

Targets of PLC-generated DAG include the conventional and novel PKCs (Mellor and

Parker, 1998). Most PKC isoforms have been found in the nuclei of cells (Martelli et

al, 1999). Like PLC, the nuclear localisation can be constitutive or due to stimulus-

dependent translocation. Nuclear PKC has been implicated in cell proliferation,

differentiation and apoptosis via phosphorylation of various target proteins including

DNA polymerases, topoisomerases, histones and lamins (Martelli et al, 1999). In the

cytoplasm, PLC-generated InsPg is known to mobilise calcium from intracellular stores

via activation of the InsPg receptor (Berridge, 1993). Although there is evidence for the

presence of InsP] receptors in the inner nuclear membrane, it is not clear whether intra

nuclear InsP] functions to regulate nuclear calcium levels independently of changes in

cytoplasmic calcium levels (Irvine, 2000).

InsPs is also the target of inositol polyphosphate kinases which sequentially

phosphorylate InsP] at different positions on the inositol ring generating the soluble

IPPs, InsP4 , InsPs and InsPô (Zhang and Majerus, 1998). IPPs are produced within the

51


nucleus and recent data has begun to give an insight into their roles there. Nuclear InsPe

was recently demonstrated to be an essential co-factor for the repair of DNA double

strand breaks by non-homologous end joining, by binding directly to DNA-PK

(Hanakahi et al, 2000). Additionally, genetic studies in yeast have provided indirect

evidence for the involvement of nuclear inositol polyphosphates in controlling the

transcription of genes involved in arginine metabolism via the ArgR-Mcml

transcription complex and in mRNA export (York et al, 1999; Odom et al, 2000;

Saiardi et al, 2000). Similarly, mammalian cells over-expressing a nuclear targeted

inositol polyphosphate-4 phosphatase also have defects in mRNA export (Feng et al,

2001). mRNA export is a multi-step process, requiring the efficient synthesis,

processing and targeting of RNA to the nuclear pore complex (NPC), as well as the

actual transport through the NPC. It is not clear from the above studies which aspect(s)

are inhibited by decreasing the levels of IPPs.

1.11.3 Involvement of D-3 phosphoinositides in nuclear function

As mentioned previously, PtdIns(4,5)Pi can be phosphorylated by Ptdlns 3-kinases.

These enzymes are also found within the nucleus (Zini et al, 1996; Neri et al, 1994; Lu

et al, 1998). The presence of Type I PI 3-kinases within the nucleus can be regulated by

extracellular signals (Neri et al, 1994; Maraldi et a l, 1997; Marchisio et al, 1998;

Metjian et al, 1999). In certain cases, the nuclear translocation of this enzyme has been

shown to cause a concomitant increase in the nuclear levels of D-3 Pis (Neri et al,

1994; Tanaka et al, 1999). Several targets of peripheral PtdIns(3,4,5)P3 have been

localised to the nucleus including Akt/PKB, PDKl, PKCe and PKCÇ (Borgatti et al,

1996; Meier et al, 1997; Mohamed et al, 2000) and there is also evidence that a

PtdIns(3,4,5)P3 binding protein can function in the nucleus (Tanaka et a l, 1999).

Furthermore, recent work has demonstrated that nerve growth factor (NGF) induces the

52


production of nuclear PtdIns(3,4,5)P3 and that this is required for the nuclear

translocation of PKCÇ in PCI2 cells (Neri et al, 1999).

Nuclear PI 3-kinase activity can also be regulated in situ. PIKE (PI 3-kinase enhancer)

is a nuclear GTPase that stimulates the activity of nuclear PI 3-kinase in a GTP-

dependent manner (Ye et al, 2000). The PIKE-dependent activation of PI 3-kinase is

required for the NGF-induced G1 arrest of PC12 cells (Ye et al, 2000). The importance

of nuclear PtdIns(3,4,5)P3 signalling during neurotrophin-induced differentiation is

underscored by the finding that PTEN, a 3’-phosphatase whose major target is

PtdIns(3,4,5)P3, is also found in the nucleus of NGF-treated PC12 cells and is required

for cell-survival (Lachyankar et al, 2000).

Other D-3 phosphoinositides may also function within the nucleus. A PtdIns(3,4)P2-

specific antibody has been used to demonstrate the presence of PtdIns(3,4)P2 at the

nuclear surface following stimulation with H2O2 or in cells over-expressing an activated

PI 3-kinase (Yokogawa et al, 2000) and PtdIns(3)P has been visualised in the nucleolus

of mammalian cells using a recombinant FYVE domain (Gillooly et al, 2000).

Interestingly, the plant Vps34p orthologue that synthesises PtdIns(3)P from Ptdlns, is

also found in the nucleus and predominantly the nucleolus where it co-localises with

sites of active transcription (Bunney et al, 2000), suggesting a conserved role for

nucleolar PtdIns(3)P through evolution.

1.12 Organisation of nuclear PtdIns(4,5)P2

A number of the nuclear PI metabolising enzymes, including PLCBl, PIPKI and

PIPKII, as well as PtdIns(4,5)P2 itself, have been localised to splicing factor-containing

domains within the nucleoplasm (Zini et al, 1993; Mazzotti et al, 1995; Boronenkov et

53


al., 1998; Osborne et al, 2001). In addition, PtdIns(4,5)P2 has been localised by

electron microscopy to heterochromatin, the heterochromatin/interchromatin borders

and fibrillar centres of the nucleoli (Mazzotti et al, 1995; Osborne et al, 2001).

The fact that Pis and PI metabolising enzymes can be found in non-membranous

structures within the nucleus poses the problem of how the lipid can be delivered to

these sites and stabilised in the absence of a membrane bilayer. Synthesis of Ptdlns

occurs on the cytosolic side of the sER. The outer nuclear membrane is directly

continuous with the ER and is biochemically and functionally similar, so one reasonable

hypothesis is that Ptdlns could enter the inner nuclear membrane via a yet to be

identified mechanism, and from there could enter the nucleus. Deep invaginations of the

nuclear membrane have been shown to penetrate into the interior of nuclei (Fricker et

a l , 1997) suggesting that the lipids can reach their nuclear targets without having to

travel large distances. As mentioned before, PITPa has been identified in the nucleus

(De Vries et al, 1995; De Vries et al, 1996) and these lipid transporters could shuttle

Pis from the nuclear membrane to intra-nuclear sites. Alternatively, Pis could enter the

nucleus through NPCs by ‘piggy-backing’ in on binding proteins. The differential

localisation of Ptdlns 4-kinase and PtdIns(4)P 5-kinase activities to the inner and outer

‘nuclear matrix’ respectively (Payrastre et a l , 1992) suggests that Ptdlns is

phosphorylated en route to the nuclear interior.

In the cytoplasm, PtdIns(4,5)P: can exist outside the membrane bilayer via stable

associations with cy to skeletal proteins. Actin and numerous actin binding and

regulatory proteins are also found within the nucleus (Rando et a l , 2000), although a

nuclear matrix analogous to the cytoskeleton in appearance and function has not been

demonstrated in vivo (Pederson, 2000). Nuclear PtdIns(4,5)P2 could thus be stabilised in

54


proteolipid complexes comprising cy to skeletal proteins and/or other unidentified

PtdIns(4,5)P2-binding proteins.

1.13 PtdIns(4,5)P2 and the regulation of nuclear processes

Despite the large number of studies devoted to the study of the intra-nuclear localisation

of PtdIns(4,5)P2 and PI metabolising enzymes, little is known of the involvement of

PtdIns(4,5)P2 in specific nuclear processes. Levels of nuclear PtdIns(4,5)P2 fluctuate

during cell-cycle progression and differentiation suggesting PtdIns(4,5)P2 could be

involved in these processes (York and Majerus, 1994; Imoto et ah, 1994). More direct

evidence points to an involvement of PtdIns(4,5)P2 in the control of transcription.

PtdIns(4,5)P2 binds to Histone HI in a phosphorylation-dependent manner and this

interaction has been shown to relieve the Histone HI mediated repression of basal

transcription by RNA Pol II in vitro. PtdIns(4,5)P2 is also implicated in the control of

chromatin remodelling via the SWI/SNF-like BAF chromatin remodelling complex

(Zhao et al, 1998). This complex contains actin and actin-related proteins (Arps) which

are required for activity of the complex. In an in vitro run-down assay, PtdIns(4,5)P2

was sufficient to reproduce the rapid association of the complex with chromatin and the

nuclear matrix that is observed in lymphocytes in vivo following antigen stimulation

(Zhao et al, 1998). B-actin and the two Arps within the complex are the most likely

targets of PtdIns(4,5)P2, as PtdIns(4,5)P2 has no effect on other chromatin remodelling

complexes lacking actin and Arps. In yeast, both the SWI/SNF and RSC chromatin

remodelling complexes contain Arps and mutations in these gene products reveal that

they are also essential for the functioning of both complexes (Cairns et al, 1998). Thus

PtdIns(4,5)P2 may be involved in the regulation of more than one class of chromatin

remodelling complex, both in yeast and mammalian cells. However, a direct interaction

55


between PtdIns(4,5)P2 and chromatin remodelling complexes has yet to be

demonstrated.

Actin and Arps are not the only cytoskeletal proteins present within the nucleus, other

examples include Protein 4.1 and NuMa (Zeng et al, 1994b; De Career et al, 1995).

NuMa is a protein with similarities to myosins and intermediate filaments involved in

the organisation of the spindle pole during mitosis (Compton and Cleveland, 1994),

while Protein 4.1 is known to promote the interaction of spectrin-actin at the plasma

membrane (Hoover and Bryant, 2000). Protein 4.1 is of particular interest as it contains

an ERM domain (named after ezrin, radixin and moesin) that has the potential to bind

PtdIns(4,5)P2 (Niggli et al, 1995). Like actin and Arps, these two proteins are also

associated with a multi-subunit nuclear complex, in this case the spliceosome (Zeng et

al, 1994a; Lallena et al, 1998). Interestingly, actin has recently been demonstrated to

associate with specific mRNAs in vivo. Actin is recruited co-transcriptionally and

remains associated with the mRNA containing ribonucleoprotein particles within the

nucleoplasm and in the cytoplasm of Chironomus tetans salivary gland cells (Percipalle

et al, 2001).

Despite the presence of PIP kinases, PLC, PtdIns(4,5)P2 and potential PtdIns(4,5)P2

binding proteins in splicing factor containing structures, there is no evidence for an

involvement of PtdIns(4,5)P2 in pre-mRNA splicing. The link between nuclear

PtdIns(4,5)P2 and pre-mRNA splicing is the focus of the final part of my thesis and as

such I shall devote the remainder of the introduction to the regulation and organisation

of pre-mRNA splicing in the nucleus.

56


1.14 The coordination of splicing and transcription within the nucleus

The synthesis of mRNA in the nucleus is a multi-step process requiring transcription by

RNA Polymerase II (RNA Pol II), 5’ capping, pre-mRNA splicing and

cleavage/polyadenylation. Mature mRNAs are subsequently exported from the nucleus

to the cytoplasm where protein synthesis occurs on ribosomes (Nakielny and Dreyfuss,

1999). Although each of these processes can be reconstituted individually in vitro there

is accumulating evidence that they are coupled in vivo and for the most part occur co-

transcriptionally (Bentley, 1999; Proudfoot, 2000; Hirose and Manley, 2000).

RNA Pol II is an approximately 600 kDa complex composed of 12 different subunits

that are conserved from yeast to humans (Myer and Young, 1998). The crystal structure

of a 10 subunit complex of yeast RNA Pol II has been solved and has provided valuable

insights into the mechanism of elongation (Cramer et al., 2000). The largest subunit of

RNA Pol II contains a highly conserved domain at the carboxy-terminus (the CTD)

consisting of multiple repeats (from 26 in budding yeast to 52 in mammalian cells) of

the consensus amino acid sequence YSPTSPS. The CTD plays an important role not

only in elongation (Conaway et a l, 2000), but also in pre-mRNA processing.

Truncation of the CTD inhibits capping, splicing, 3’ end processing and termination of

transcription downstream of the poly(A) site in vivo (McCracken et al, 1997a;

McCracken et al., 1997b). Furthermore, overexpressing peptides with multiple CTD

repeats disrupts splicing in vivo, the extent of disruption being proportional to the

number of repeats (Du and Warren, 1997). Although the CTD is disordered within RNA

Pol II crystals, it appears to be located in the vicinity of the exit site of nascent RNA

from the complex (Cramer et a l , 2000), consistent with its proposed role in coupling

transcription to pre-mRNA processing (Bentley, 1999; Proudfoot, 2000; Hirose and

Manley, 2000).

57


The CTD can be phosphorylated at a number of points, the major phosphorylation sites

important for the physiological functions of RNA Pol II being Ser-2 and Ser-5 of the

YSPTSPS repeat (Bentley, 1999). Unphosphorylated RNA Pol II is referred to as RNA

Pol Ila, the hyperphosphorylated forms as RNA Pol Ho. RNA Pol Ha is the major form

of RNA Pol II at the promoter. 20-25 nucleotides after clearing the promoter, the CTD

becomes phosphorylated, coincident with the capping of the nascent RNA, and remains

phosphorylated during elongation. In yeast, the CTD is primarily phosphorylated on

Ser-5 at these early stages while Ser-2 phosphorylation is only detected in coding

regions (Komarnitsky et a l, 2000). Dynamic changes in the pattern of CTD

phosphorylation also occur in heat-shock when there is an increase in levels of Ser-2 but

not Ser-5 phosphorylation (Patturajan et al, 1998a). The CTD is proposed to act as a

platform for the assembly of transcription/processing complexes, so-called

transcriptosomes. The complement of proteins associated with the CTD is dynamically

controlled by the pattern of CTD phosphorylation (Komarnitsky et a l , 2000) and with a

possible 104 phosphorylation sites, the combinatorial potential is vast.

1.14.1 RNA Pol II and capping

Capping is carried out by sequential RNA triphosphatase, guanylyltransferase and

methyltransferase activities (Shuman, 1995). Genes transcribed by RNA Pol II with a

truncated CTD are not efficiently capped (McCracken et al, 1997a). Mammalian and

yeast guanylyltransferases directly bind RNA Pol Ho, but not RNA Pol Ha, in vitro and

in vivo and this is required for targeting the enzymes to the 5’ ends of transcribed genes

(McCracken et al, 1997a; Cho et al, 1998; Schroeder et al, 2000). However, RNA Pol

Ho does not just serve as a platform to localise the enzymes, as RNA Pol Ho

58


phosphorylated on Ser-5 can also activate mammalian guanylyltransferase in vitro (Ho

and Shuman, 1999).

1.14.2 RNA Pol II and 3’ end processing

Cleavage of the mRNA precursor and addition of the poly(A) tail occur when RNA Pol

II nears the 3’ end of a gene. Truncation of the CTD inhibits efficient polyadenylation

of RNA in transiently transfected cells (McCracken et al, 1997b). Two important

protein factors for 3’ end processing, the cleavage/polyadenylation specificity factor

(CPSF) and the cleavage stimulation factor (CstF), both interact with RNA Pol II via the

CTD (McCracken et al, 1997b). However, unlike the interaction with capping

enzymes, this was found to be independent of the phosphorylation state of the CTD.

Polyadenylation/3 ’ cleavage can be reconstituted in vitro and this system has been used

to demonstrate a role for the CTD of RNA Pol II in 3’ processing (Hirose and Manley,

1998). Immunodepletion of RNA Pol II inhibits 3’ cleavage and this can be rescued by

adding back the purified enzyme. Moreover, exogenous CTD stimulates the cleavage

reaction. In this case, although both RNA Pol IIo and RNA Pol Ila have stimulatory

effects, that of RNA Pol IIo is greater (Hirose and Manley, 1998).

1.14.3 RNA Pol II and splicing

The splicing of intron-containing pre-mRNAs occurs in spliceosomes. The spliceosome

is a dynamic multi-subunit structure assembling through intermediate complexes E, A,

B and C via the step-wise addition of small nuclear ribonucleoprotein particles

(snRNP^^Figure 1.6 A; Misteli, 1999). There are five main snRNPs, U l, U2, U4, U5

and U6, each of which contains a small nuclear RNA (snRNA) after which it is named,

as well as the seven common snRNP proteins (Sm proteins: B/B’, Dl, D2, D3, E, F, G)

and additional snRNP specific proteins. snRNAs have important catalytic and structural

59

Pre-mRNA

E com plex

U4/U6U5

U4/U6U5B2 com plex

C com plexes

A com plex

B1 com plex

(Misteli. Curr, Bioi., 1999)

B

3'hydro«ylot5-|ntron ^ ArAG attacks 3' splice site

▼

^ L g s s Lrrs,r“Lariat interm ediate

À-AG

Free intron

Spliced mRNA

(Newman, Curr. Biol., 1998)

Figure 1.6 Pre-mRNA splicing. A) Splicing of pre-mRNAs occurs in spliceosomes, large macromolecular complexes consisting of five small ribonucleoprotein particles (snRNPs) and a large number of non-snRNP splicing factors. Each snRNP contains a small nuclear RNA (snRNA) and a common set of snRNP proteins (Sm proteins) and up to ten additional snRNP-specific proteins. The stepwise assembly of the spliceosome occurs via intermediate complexes termed E, A, B and C. The late C complex stage, during which the catalytic steps takes place, is not shown. B) Splicing occurs via two successive trans-esterification reactions. In the first reaction the 2'OH of a specific adenosine (red) at the branch site near the 3' end of the intron attacks the 5' splice site (blue). This reaction releases the 5' exon (blue; with a 3' OH terminus) and leaves the 5' end of the intron joined by a 2'- 5' phosphodiester bond to the branch site adenosine (red). This intron-3' exon intermediate is therefore in the form of a lariat. In the second reaction, the 3' OH of the 5' exon intermediate (blue) attacks the 3' splice site, producing the spliced mRNA and the lariat-shaped intron product.


functions within the spliceosome (Newman, 1998). The spliceosome also contains a

number of non-snRNP splicing factors, such as the SR proteins, which all contain RS

domains (regions rich in arginine/serine dipeptides) and RNA-binding domains. SR

proteins are essential for constitutive splicing and are important for the regulation of

alternative splice site selection (Misteli, 2000b). In higher eukaryotes there is also a low

abundance spliceosome comprised of Ul 1, U12, U4-like and U6 -like and the

conventional U5 snRNAs that splices a sub-set of pre-mRNAs (Yu et a l, 1996). ATP-

hydrolysis is required at several points during the formation and operation of the

spliceosome (Misteli, 1999). However, the splicing reaction itself occurs via two

successive ^ra«5 -esterification reactions that are ATP-independent (Figure 1.6 B;

Newman, 1998).

The majority of splicing in vivo is thought to occur co-transcriptionally and, as for

capping and 3’ end processing, the CTD of RNA Pol II has been linked to RNA splicing

both in vitro and in vivo. The CTD is required for efficient splicing and the targeting of

splicing factors to sites of active transcription in vivo (McCracken et a l, 1997b; Du and

Warren, 1997; Misteli and Spector, 1999). Similarly, antibodies against the CTD and

CTD peptides inhibit splicing, while exogenous RNA Pol IIo stimulates splicing in vitro

(Yuryev et a l, 1996; Hirose et a l, 1999). RNA Pol IIo catalyses one of the earlier steps

in spliceosome formation (Hirose et a l, 1999) suggesting RNA Pol II may play a

regulatory role in splicing in addition to its organisational role.

Ser-2 phosphorylated RNA Pol IIo but not Pol Ila interacts with splicing factors in an

RNA-independent manner (Kim et a l, 1997) and is a component of active spliceosomes

(Mortillaro et a l, 1996; Vincent et a l, 1996), consistent with the studies in yeast where

Ser-2 Pol IIo is the major form during elongation (Komarnitsky et al, 2000). A number

61


of RS domain containing proteins, related to the SR family of splicing factors, have

been shown to interact with the CTD and although it has not been demonstrated, are

strong candidates for linking transcription and splicing (Yuryev et a l, 1996; Tanner et

a l, 1997; Bourquin et a l, 1997; Patturajan et a l, 1998b). Consistent with these

biochemical interactions with splicing factors and splicing factor-related proteins, Ser-2

phosphorylated RNA Pol IIo co-localises with splicing factors within splicing factor

compartments (Bregman et al, 1994; Mortillaro et al, 1996).

1.15 The splicing factor compartment (SFC)

The interchromatin space of mammalian cells is occupied by several nuclear domains

and bodies, mostly involved in the synthesis, processing and modification of RNA.

These include the nucleolus, Cajal bodies (previously coiled bodies (Gall et al, 1999)),

PML bodies and speckles or splicing factor compartments (SFCs; Lamond and

Eamshaw, 1998; Sleeman and Lamond, 1999; Matera, 1999). The nucleolus aside, there

are no widely used methods available for sub-nuclear fractionation, although recently,

the purification of morphologically well-defined IGCs was described (Mintz et a l ,

1999). As a result, most information on the constituents and functions of nuclear

structures has come from light and electron microscopic techniques.

SFCs are defined at the level of light microscopy as areas containing high

concentrations of splicing factors and occupy a substantial amount (up to 2 0 %) of the

total nuclear volume (Spector, 1990; Spector et a l, 1991). By immuno-electron

microscopy, SFCs correspond to clusters of ~20 nm granules, the IGCs, which are

surrounded by Peri chromatin Fibrils (PFs), thought to contain nascent transcripts

(Fakan, 1994). Non-snRNP splicing factors, such as the SR protein SC35, localise

predominantly to SFCs, while Sm proteins have a wider distribution in the nucleoplasm

62

coilin

Figure 1.7 Nuclear organisation of splicing factors. Within the nucleus, the interchromatin space is occupied by a number of nuclear bodies and domains that can be identified by immunofluorescence using specific markers. The essential non-snRNP splicing factor SC35 localises predominantly to the Splicing Factor Compartment (SFC). The core snRNP Sm proteins also localise to SFCs, but in addition display a significant amount of diffuse nucleoplasmic staining and concentrate in Cajal bodies (arrow heads). Cajal bodies are thought to be involved in snRNP biogenesis and can be identified using an antibody against coilin (arrowheads). All images are of paraformaldehyde-fixed HeLa cells and are projections of a series of 0.4 pm confocal z-sections. Bar=10 pm.


and Cajal bodies in addition to SFCs (Spector et al, 1991; Figure 1.7). A number of

other nuclear antigens have been localised to SFCs including snRNAs, RNA Pol IIo,

poly(A) RNA, 3’ processing factors, cytoskeletal elements, PIPKI, PIPKII and

ribosomal proteins (Huang and Spector, 1992; Huang et a l, 1994; Bregman et al, 1994;

Boronenkov et a l, 1998; Lallena and Correas, 1997; Mintz et a l, 1999; Calado and

Carmo-Fonseca, 2000).

The function of SFCs in relation to splicing is not well understood. A number of

observations point to SFCs as sites of storage and/or assembly of spliceosomes. Active

transcription occurs in PFs but not in IGCs (Fakan, 1994). Splicing factors redistribute

from SFCs to sites of active transcription in a phosphorylation-dependent manner

(Jimenez-Garcia and Spector, 1993; Gama-Carvalho et a l, 1997; Misteli et a l, 1997;

Misteli et a l, 1998) consistent with the transfer of splicing factors from sites of storage

to sites of active processing, while the opposite occurs in conditions where splicing is

inhibited. Treatment of cells with transcription inhibitors, for example the fungal

alkaloid a-amanitin, that prevent the production of splicing substrates, or treatment with

antisense oligonucleotides or antibodies that block splicing, causes SFCs to become

more rounded, to decrease in number and increase in size whilst the diffuse

nucleoplasmic staining decreases (Carmo-Fonseca et a l, 1992; O'Keefe et al, 1994).

A storage function for SFCs has also been inferred from work carried out on nuclei of

Xenopus oocytes. These nuclei contain 1-2 pm diameter splicing factor and RNA Pol

IIo containing structures termed B-snurposomes, thought to be the Xenopus equivalent

of IGCs based on their size, appearance and composition (Gall et a l, 1999). Both B-

snurposome and IGCs are composed of a cluster of 20-30 nm granules. Gall and

coworkers have proposed that every granule corresponds to a RNA Pol II

64


transcriptosome that is first assembled in Cajal bodies and stored in B-snurposomes

prior to being recruited to sites of active transcription (Gall et a l, 1999).

Although most splicing is thought to occur co-transcriptionally, there is evidence that in

some cases splicing can occur within SFCs. Pre-mRNAs from certain genes are found

associated with SFCs and intron-containing viral RNAs can be recruited to SFCs from

their sites of transcription (Snaar et a l, 1999; Melcak et a l, 2000; Melcak et a l, 2001).

The assembly of (pre)spliceosomal complexes onto pre-mRNA is thought to result in

the observed speckled organisation (Melcak et a l, 2001). In addition, a stable

population of poly(A)-RNA associates with SFCs even in the absence of transcription

although the function of this is not known (Huang et a l, 1994). Thus although SFCs

may be storage sites under normal conditions they may also be able to support splicing

of select genes under certain conditions.

1.16 Objectives

Ptdlns(4 ,5 ) ? 2 synthesis is an essential component of the ATP-dependent priming step

preceding calcium-dependent neuroexocytosis (Hay et a l, 1995; Wiedemann et a l,

1996). The secretory vesicle protein Syt I is the best candidate for calcium sensor in

neurotransmitter release, in part due to its ability to interact with phosphoinositides in a

calcium-dependent manner (Schiavo et a l, 1996). Syt I oligomerises in the presence of

calcium (Chapman et a l, 1996; Sugita et a l, 1996) and genetic evidence form

Drosophila suggests Syt acts as a multimeric complex in vivo (Littleton et a l, 1994).

Syt oligomerisation could therefore be important for its calcium-dependent interactions

with effector molecules, including PtdIns(4 ,5 )P2 . Other Syt isoforms are expressed in

the nervous system, in some cases in a synaptic-activity dependent manner (Vician et

a l, 1995; Babity et a l, 1997). Different Syts have characteristic distributions and

binding properties (Schiavo et a l, 1998). If Syt dimers/oligomers are the functional

65


calcium-detecting unit, different Syt isoforms could combine to form a variety of

calcium sensors for exocytosis with distinct calcium-sensitivities. Chapter 3 describes

work investigating at the calcium-dependent oligomerisation of different Syt isoforms

in vitro and in living cells.

Importantly, it is not known whether the Ptdlns(4 ,5 ) ? 2 required for neurotransmitter

release is synthesised on the synaptic vesicle membrane, the pre-synaptic plasma

membrane or both. Moreover, it remains to be determined whether the Syt-

PtdIns(4 ,5 )P2 interaction is important for Syt functioning in vivo. This information is

vital for developing models of how Syt functions in neurotransmitter release. In

addition, a detailed knowledge of the localisation of PtdIns(4 ,5 )P2 provides valuable

insights into its functions and is crucial for understanding how PtdIns(4 ,5 )P2 can

selectively influence such a diverse range of processes. The number of specific probes

that can be used to monitor PtdIns(4 ,5 )P2 distribution within cells are limited, therefore

we have raised monoclonal antibodies that specifically recognises PtdIns(4 ,5 )P2 within

and outside the context of a lipid bilayer (Thomas et a l, 1999a). During the

characterisation of our anti-PtdIns(4 ,5 )P2 antibodies, we noticed a distinctive nuclear

staining in multiple cell-lines (Thomas et a l, 1999a). While nuclear PtdIns(4 ,5 )P2 has

been observed in the past (Divecha et a l, 1993; Mazzotti et a l, 1995; Boronenkov et

a l, 1998), few intra-nuclear targets have been identified and little is known of how

Ptdlns(4 ,5 )P2 influences nuclear processes. In Chapters 5 and 6 1 will be describing the

characterisation of this nuclear pool of Ptdlns(4 ,5 )P2 and its involvement in pre-mRNA

splicing.

66

Chapter 2: Materials and Methods

67

Chapter 2 Materials and Methods

2.1 Materials

2.1.1 Chemicals

Chemicals used were all of analytical grade or higher and were purchased from the

following companies unless otherwise stated: Sigma, Fluka, BDH, Calbiochem,

Amersham Pharmacia Biotech. Molecular biology reagents were from Qiagen, Promega

and Clontech unless otherwise stated. All radiochemicals were purchased from

Amersham Pharmacia Biotech. Fluorescent conjugated secondary antibodies and HRP

conjugated secondary antibodies were purchased from Molecular Probes and DAKO

respectively. Phosphate buffered saline (PBS), cell culture and bacterial growth medium

were all supplied by ICRF laboratory services.

2.1.2 Antibodies

The following antibodies were used in this work:

Antibody name Raised against/recognises Source

M48 Syt I cytoplasmic domain T.Sollner, SKI, N Y , U .S.A .

12CA5 HA ICRF monoclonal facility

P5D4 VSV-G ICRF monoclonal facility

69.1 VAM P-2 W AKO

SC35 non-snRNP splicing factor SC35 Sigma

H5 RNA Pol IIo, Ser-2 phosphorylated Research Diagnostics International

8W G I6 RNA Pol Ila Research Diagnostics International

9H10 hnRNP A l G. Dreyfuss, HHMI, PA, U.S.A.

Sm Sm proteins, snRNP components CDC, GA, U .S.A .

Y12 Sm proteins (primarily B /B ’) J. Steitz, HHMI, CT, U .S.A .

p80 coilin coilin, marker o f Cajal bodies A. Lamond, Dept. B iochem , Dundee, U.K.

CDC, Centres for D isease Control and Prevention; HA, influenza virus hemagglutinin epitope; HHMl, Howard H ughes M edical Institute; ICRF, Imperial Cancer R esearch Fund; SKI, Sloane-K ettering Institite; VSV-G , Vesicular Stomatitis Virus Glycoprotein.

68

2.1.4 Cell-linesAll cell-lines were obtaine from Imperial Cancer Research Fund cell services with the

exception of PCI 2 cells which are described in Herreros et ai, 2000.

Chapter 2___________________________________________ Materials and Methods

2.1.3 Constructs and recombinant proteins

Recombinant Inp52p 5-phosphatase catalytic domain (amino acids 530-927, Inp52p-

CD) was provided by R. Norman, Imperial Cancer Research Fund (ICRF) and

recombinant Mss4p by F. Cooke, ICRF. The 8 -crystallin construct was kindly provided

by G.Dreyfuss, Howard Hughes Medical Institute, PA, U.S.A. RNA markers were a gift

of F. Nicolas, ICRF and were prepared by in vitro transcription using a pBR322 DNA

Msp I digest as a template (New England Biolabs). NRK cells stably transfected with

TGN38-GFP and 2xFYVE-GFP were supplied by G. Banting, University of Bristol,

U.K.

2.2 Methods

2.2.1 Electrophoresis and Western blotting

One dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-

PAGE) enables the separation of proteins based on their relative molecular mass and

differential mobility through the acrylamide gel matrix. Separating gels were usually a

single percentage but where specified, linear gradient gels were prepared. Proteins were

visualised by Coomassie Blue staining. Silver staining or Western blotting.

22.7.7 Coomassie Blue staining

Gels were fixed and proteins stained using a solution of 0.2% Coomassie Blue in 45%

methanol, 10% acetic acid for 30 min. Destaining was carried out as long as was

necessary using 10% methanol, 7% acetic acid.

2.27.2 Silver staining

Gels were fixed by incubation for 30 min with 50% MeOH, 10% acetic acid, followed

by 30 min with 5% MeOH, 7% acetic acid and 30 min with 10% gluteraldehyde. Gels

were washed for 2 h with distilled water. Proteins were reduced with 5 pg/ml DTT for

30 min, stained with 0.1% silver nitrate and developed with 3% sodium carbonate,

69


0.0185% formaldehyde. The reaction was stopped with 2.3 M citric acid when the

desired intensity of staining was reached.

2.2.1.3 Western blotting

For Western blotting, proteins were transferred onto nitrocellulose membrane

(Schleicher and Schuell) at 100 V for 1 h in 200 mM glycine, 25 mM Tris base, 10%

MeOH. Transferred proteins were visualised by staining with 0.2% Ponceau S, 3%

trichloroacetic acid. Membranes were blocked by incubation for 1 h at room

temperature with 5% powdered milk (Marvel) or 5% blocking reagent (Amersham

Pharmacia Biotech) in TEST (135 mM NaCl, 100 mM Tris-HCl, pH 7.6, 0.05% Tween-

20). Primary and secondary horse radish peroxidase (HRP)-conjugated antibodies were

applied in fresh blocking solution. Washes were performed with TEST and antibodies

were visualised using Enhanced Chemi-Luminescence detection (ECL, Amersham

Pharmacia Biotech).

2.2.2 Protein sequencing

To avoid contamination of protein samples for sequencing with keratin, all solutions

were freshly prepared and filtered through 0.22 pm Millipore filters. Gel plates, combs

and spacers were washed with 1 M nitric acid prior to use. Proteins were visualised by

staining with Coomassie Blue and the appropriate bands were excised. Protein

sequencing was carried out in the ICRE protein sequencing facility by peptide mass

fingerprinting in collaboration with T. Naven and N. Totty. Briefly, proteins were

digested in-gel with trypsin and the resulting peptides were extracted and their masses

analysed using a MALDI-TOF mass spectrometer. Measured masses from protein

samples were compared against a theoretical digest of database proteins. In the case

where there is no match, peptides were separated by reverse phase liquid

chromatography and the sequences obtained from the fragmentation spectra were used

70


to identify the proteins present using a BLAST (Basic Local Alignment Search Tool)

search (http://www.ncbi.nlm.nih.gov/BLAST/).

2.2.3 Antibody production and purification

Peptides M V S ASHPE AL A AP VTT V AT C (corresponding to residues 1-19 of rat Syt I

with an additional cysteine at the C-terminus), CMRNIFKRNQEPIVAPAT (residues 1-

17 of rat Syt II) and CMAPITTSRVEFDEIPT (residues 1-16 of rat Syt IV; both

peptides with an additional cysteine at the N-terminus) were conjugated to maleimide-

activated keyhole limpet hemocyanin (Pierce) following the manufacturers

specifications. Polyclonal isoform-speciflc antibodies were raised in New Zealand

White rabbits by intramuscular injection of 1 mg of the corresponding peptide together

with incomplete Freund’s adjuvant. The antibodies were affinity purified by using

Sulfolink resin (3 ml, Pierce) previously coupled with 3 mg of the specific peptide and

eluted with 100 mM glycine-HCl, pH 2.5, 0.1% bovine serum albumin (Harlow and

Lane, 1988). This method yielded a satisfactory purification of anti-Syt I and -Syt II

antibodies, but not of anti-Syt IV, that either proved sensititive to both acidic and basic

elution protocols or did not elute from the peptide column. Anti-Syt IV antibodies were

partially purified by ammonium sulphate precipitation and protein-A sepharose affinity

chromatography (Harlow and Lane, 1988). The specificity of the purified antibodies

was evaluated by pre-incubating the antibodies with 5 mg/ml of the generating peptides

and by comparison with the pre-immune serum.

2.2.4 Svnaptic vesicles purification

Small synaptic vesicles (SSV) from rat brain cortex were prepared following the method

of Huttner and coworkers (Huttner et a l, 1983) with minor variation^ Adult rat brain

cortices were isolated and the white matter and meninges removed prior to

71

http://www.ncbi.nlm.nih.gov/BLAST/


homogenisation in ice-cold isotonic buffer containing ImM dithiothreitol (DTT) and

protease inhibitors (100 pM phenylmethylsulfonyl fluoride (PMSF) and 2 pg/ml

pepstatin A) using a Dounce homogeniser. Nuclei and unbroken tissue debris were

removed by low speed centrifugation. Crude synaptosomes were spun down from the

supernatant, resuspended in isotonic buffer then lysed by hypotonic shock by diluting

ten-fold with glass distilled water followed by homogenisation using a Dounce

homogeniser. Heavy membranes were removed by centrifugation and crude synaptic

vesicles were spun down from the supernatant by ultracentrifugation. The resulting

membrane-enriched fraction (LP2) was re-suspended in 40 mM sucrose containing

protease inhibitors as before and loaded into a linear, continuous (50-800 mM) sucrose

gradient. Following centrifugation, the fraction corresponding to a sucrose

concentration range between 200 and 400 mM and visible as a translucent band (FI) was

collected and loaded into a glycerol-coated controlled-pore glass beads column

(25x1000 mm; CPG, Lincoln Park) equilibrated in glycine buffer (4 mM HEPES-NaOH

pH 7.4, 300 mM glycine, 0.04%. NaNs). The column was eluted at 0.7 ml/min with the

same buffer and 8 ml fractions were collected. For the data presented in Figure 3.4,

proteins corresponding to each fraction (400 pi) were recovered by precipitation with

6.5% trichloroacetic acid (TCA) using 0.05% sodium deoxycholate as a carrier and

analysed by SDS-PAGE and Western blotting. For immunoprécipitation and

immunoisolation experiments, fractions corresponding to the second peak of absorbance

at 280 nm were pooled and centrifuged at 198,000 gav in a 50.2 Ti rotor for 2 h. The

SSV pellet was re-suspended in 1 ml of glycine buffer containing ImM DTT and

protease inhibitors and the suspension was homogenised by forcing it eight times

through a 25G (0.625 mm) needle. Protein concentration was determined using

Bradford protein assay reagent (Biorad) according to the instructions of the

72


manufacturer using a standard curve of 0 - 1 0 \xg purified immunoglobulins as a

reference.

2.2.5 Preparation of samples for Electron Microscopy

50 pg of FIJI and CPGn were fixed with 112 mM glutaraldehyde for 30 min on ice and

spun down for 30 min at 109,000 gav in a TLA 45 rotor (Beckman), 4 °C. The pellet was

washed once in cold PBS prior to processing for routine electron microscopy in

collaboration with R. Watson, ICRF. Briefly, samples were washed several times in

Sorenson buffer then incubated for 30 min in buffer containing 1% osmium tetroxide.

Samples were washed again and dehydrated in ascending ethanols prior to embedding

in araldite. Sections were post-stained using methanolic uranyl acetate and lead citrate

and examined and photographed using a JEOL 1010 TEM.

2.2.6 SSV immunoisolation

M48 monoclonal antibodies against Syt I (Matthew et a l, 1981) were purified using

DEAE blue resin (Bruck et a l, 1982) and dialysed extensively against distilled water.

The purified IgG fraction (0.4 mg) was coupled to Eupergit CIZ methacrylate

microbeads (1 pm diameter; Rohm Pharma; Osborne et a l, 1999). In selected

experiments, protein G sepharose fast flow beads (Amersham Pharmacia Biotech)

previously conjugated with M48 monoclonal antibodies, were used. M48-conjugated

and control beads were pre-incubated with 1 mg asolectin (Sigma) to block non-specific

lipid binding sites. Beads were incubated with 10 pg of purified SSV in the presence of

0.2 mg/ml ovalbumin and 5% glycerol in glycine buffer, again to decrease non-specific

association of SSV with the beads. The reaction was stopped by centrifugation, beads

were washed 3 times in glycine buffer and re-suspended in SDS-containing sample

buffer. Supernatant proteins were TCA precipitated as above. Proteins were analysed by

73


SDS-PAGE and Western blotting using anti-Syt II, anti-Syt IV and anti-VAMP 2

antibodies.

2.2.7 Immunoprécipitation

2.2.7.1 Native synaptotagmins

Column purified cortical SSVs (CPGn) and an impure vesicular fraction (LP2) from rat

cerebellum, were solubilised in 25 mM HEPES-KOH pH 7.6, 100 mM KCl, 1%

glycerol containing 100 pM PMSF, 2 pg/ml pepstatin and 4% octyl-b-D-

glucosopyranoside (OG) for 30 min at 4°C. Detergent-free buffer was added to give a

final OG concentration of 1.2% and the solutions were centrifuged to remove insoluble

material. Solubilised proteins were incubated with protein G agarose beads (Boehringer

Mannheim) previously conjugated with either M48 monoclonal antibodies (Matthew et

a l, 1981), anti-Syt I or anti-Syt II N-terminal antibodies, or with the protein G beads

alone. The reactions were stopped by centrifugation. The proteins in the supernatant

were TCA precipitated and re-suspended in SDS sample buffer. Beads were washed

three times in incubation buffer containing 0.8% OG and solubilised in SDS sample

buffer. Proteins were analysed by SDS-PAGE and Western blotting, using either anti-

Syt I, anti-Syt II or anti-Syt IV antibodies.

For the experiments investigating the calcium dependency of synaptotagmin

oligomerisation, similar procedures were used, except that Ca^^/EGTA (final

concentration 2 mM EGTA) buffers were added to the incubation buffer to yield the

free calcium concentrations indicated, calculated using the PC program calcium.exe

version 2 . 1 which allows you to calculate the free and total concentrations of divalent

metal ions in aqueous solutions containing multiple ligands and metals. 1 mM MgCli

was also added, and the immunoprécipitation step was carried out in 2% OG.

74


Immunoblots were either detected with ECL and quantified with the NIH image

(version 1.61) software, comparing the signal present in the immunoprecipitate with that

obtained from an antigen standard curve prepared by loading increasing amounts of

either Syt II or Syt IV (0.25, 0.5, 0.75 and 1 times the starting material; Schiavo and

Bisson, 1989) or using iodinated anti-rabbit secondary antibodies (17.6 pCi/pg, 1

pCi/ml, Amersham Pharmacia Biotech) and analysed using a Molecular Dynamics

Phosphorlmager. Syt recovery in the immunoprecipitate was calculated as the

percentage of total Syt II present in the sample. Both the sum of the immunoreactivity

present in the supernatant (S) and in the pellet (P) and the total input of the sample (T)

were used as denominators to calculate the percentage of Syt recovery and the two

values were compared. In all cases, the maximal standard deviation between the

measurements obtained with the two methods was less than 1 0 , with an average value of

6 . Both values were used to determine the EC50 of the calcium-dependence of Syt I/Syt

II co-immunoprecipitation and the variability between the two methods is taken into

account in the error bars in Figure 3.7.

2.2.7.2 Recombinant synaptotagmins

Immunoprécipitations were carried out in HEPES-KOH 25 mM pH 7.5, KCl 100 mM,

glycerol 1%, DTT 0.1 mM, OG 0.8% with the appropriate Ca^^/EGTA buffers added to

yield the free calcium concentrations indicated. In selected samples, MgCb was added

to reach a free Mg " concentration of 0.5 mM. Samples were incubated for 1 h at 4°C

and then immunoprecipitated by adding an excess of monoclonal anti-HA antibody

12CA5 (Niman et a l, 1983) prebound to protein G-Sepharose Fast Flow beads

(Amersham Pharmacia Biotech). Beads were washed with incubation buffer containing

the appropriate free calcium concentration and 0.5 mM MgCli where indicated. Proteins

bound to beads were analysed by SDS-PAGE and visualised by Coomassie Blue

75

N a t i v e

Syt 1/Il

R e c o m b i n a n t

Syt 1/Il

Syt II

Syt 1/Il

Syt 1/Il

Syt 1/Il

GST

GST HA

G S T K G F P

iG S T K G F P XHA

OK

OK

Insoluble

Poor binding to GSM beads

OK

Figure 2.1 Recombinant synaptotagmin constructs used in this study. The domain structure of native Syt I/II is depicted in the upper panel. Syt II cytoplasmic domain (amino acids 103-422) was cloned from a rat brain cDNA library (Stratagene) and expressed in E. coli as a GST fusion protein for use in FRET experiments. For immunoprécipitation experiments, an N-terminal tag was introduced consisting of the influenza virus hemagglutinin epitope, HA. The GST-Syt I fusion protein (amino acids 95-421) used for immunoprécipitation and FRET experiments was kindly provided by C. Thomas. GST-fusion proteins were purified with GSH beads and released by cleavage with thrombin. The thrombin cleavage site is marked by the arrow. Syt I and II were fused to GFP variants, ECFP and EYFP for use in FRET experiments. These fusion proteins were insoluble, while the introduction of an HA tag between the GFP and Syt resulted in soluble proteins that bound poorly to GSH beads and were not cleaved by thrombin. For FLIM experiments, full length Syt I and II were cloned from a rat brain cDNA library (Clontech) and introduced into ECFP/ EYFP mammalian expression vectors.


staining or Western blotting. In both cases, Syt I recovery was quantified with the NIH

image software by comparing the signal present in the immunoprecipitate with that

obtained from a standard curve prepared by loading increasing amounts of recombinant

Syt I (50, 100, 150, 200 and 250 ng in the case of Western blotting and 0.2, 0.4, 0.6, 0.8

and 1 pg for Coomassie staining; Schiavo and Bisson, 1989). Data were expressed as a

percentage of the maximal Syt I present in the Syt II immunoprecipitate. Similar results

were obtained in experiments performed at 25°C and without detergent in the

incubation buffer (not shown).

2.2.8 Peptide mapping using the Cleveland method

In-gel digestion and peptide analysis was carried out based on the method of Cleveland

and co-workers (Cleveland et a l, 1977). Syt and the high molecular mass band were

purified by immunoprécipitation with M48 from bovine brain extract. Proteins were

stained by Coomassie Blue and the major 65 kDa and 200 kDa bands corresponding to

the Syt immunoreactivity were excised. Gel pieces were soaked for 10 min in 125 mM

Tris-HCl, pH 6 .8 , 0.1% SDS before loading in a 8-12% acrylamide gradient gel.

Samples were overlaid with 20 pi 125 mM Tris-HCl, pH 6 .8 , 0.1% SDS, 20% glycerol,

bromophenol blue, followed by 10 pi 24 pg/ml V8 protease {Staphylococcus aureus) in

125 mM Tris-HCl, pH 6 .8 , 0.1% SDS, 10% glycerol. The gel was stopped for 30 min

when samples reached the stacking-resolving interface to allow enzymatic digestion of

the proteins, after which time, gels were run as normal. Gels were silver stained to

visualise the pattern of peptides generated.

2.2.9 Generation of recombinant svnaptotagmins

A schematic of the recombinant proteins used in this study and described below is

depicted in Figure 2.1.

76

Restriction sites are underlined and the Syt II stop codon is boxed.


2.2.9.1 Syt I/II cytoplasmic domains

Recombinant Glutathione S-transferase (GST)-synaptotagmin II fusion protein was

prepared by inserting the DNA corresponding to residues 103-422 of rat Syt II

(GenBank Accession Number M64488), obtained by Polymerase Chain Reaction (PGR)

from a rat brain cDNA library (Stratagene) using the following primers:

Syt II 5’ GAATTCCCAAAGGCATGAAGAACGCCATG

Syt II 3’ c r A TnnCTâLCltrGTTCTTGCCCAGAAGAG

into the EcoRI/NcoI sites of the expression vector pGEX-KG (Guan and Dixon, 1991).

Sequences were checked by microsequencing. The equivalent portion of rat Syt I 95-

421 was already available in the laboratory and was kindly provided by C. Thomas. The

proteins correspond to the published sequences (Perin et a l, 1990; Geppert et a l, 1991),

except for the substitution of Glu 188 for Asp (Sutton et a l, 1995), Gly 374 for Asp and

He 393 for Met in rat Syt I, generated by single base changes. Independent sequencing

has confirmed that both Gly and Asp can be found at position 374 of rat Syt I, but failed

to detect the He 393 for Met substitution (Desai et a l, 2000). However, we are confident

that this is not an artifact as this substitution was present in a full length Syt I

obtained by PGR using different primers (see below).

For immunoprécipitation purposes, a tagged version of the rat Syt II-GST fusion protein

was prepared by inserting the sequence YPYDVPDYA (corresponding to the influenza

virus hemagglutinin epitope, HA) immediately after the thrombin cleavage site. GST-

fusion proteins were purified on glutathione-agarose beads (Sigma) and the cytoplasmic

domains of Syt I and Syt II were released by thrombin cleavage (Guan and Dixon,

1991). Proteins were purified by ion-exchange chromatography on a Mono-Q matrix

(Amersham Pharmacia Biotech), dialysed against HEPES-KOH 20 mM pH 7.6, KGl

78

r i

Restriction sites are underlined and the start and stop codons are boxed.


150 mM, glycerol 10%, DTT 0.1 mM and, after freezing in liquid nitrogen, stored at -

80°C.

2.2.9.2 ECFP/EYFP-Syt 1/11 cytoplamic domain fusion proteins

ECFP- and EYFP-cytoplasmic synaptotagmin fusion constructs were prepared by

inserting ECFP/EYFP DNA obtained by PGR of the EYFP vector (Clontech) and ECFP

vector (Miyawaki et a l, 1997) into BamHl/EcoRl restriction sites in GST-Syt Icyto and

Syt Ilcyto vectors to generate N-terminally tagged fusion proteins. Expression of the two

proteins was however very poor and the majority of the fusion protein that was

produced was insoluble. In an attempt to increase the expression and solubility, a spacer

in the form of an HA-tag was introduced in between the GST and the ExFP-Sytcyto

fusion proteins. The ECFP and EYFP were introduced into the GST-HA-Syt Ilcyto

vector via the BamHl/EcoRl sites. GST-HA-ExFP-Syt I was generated by substituting

Syt Icyto for Syt Ilcyto using EcoRl/Ncol sites.

2.2.9.10 Full-length Synaptotagmin 1 and 11

Full-length Syt I and II were cloned by PCR from a rat brain cDNA library (Clontech)

using the following primers:

Syt I 5’ c tcg ag g a a t t c a Æ tg{jTg a g tg c c à g tc a tc c .

Syt I 3’ AAGCTTn R c it rCTTGACAGCCAGCATGGCATCAAC.

Syt II 5’ CTCGAGGAATTCAA k T (i\GAAACATCTTCAAGAGGAACC.

Syt II3’ AAGCTTCTk C ltrGTTCTTGCCCAGAAGAGCATCCACTTC.

Sequences were verified by microsequencing and were as published (Perin et al, 1990;

Geppert et a l, 1991) except for the the substitution of Glu 188 for Asp, Gly 374 for Asp

and He 393 for Met in Syt I. These substitutions were also present when the cytoplasmic

domain of Syt I was cloned making it very unlikely that the amino acid substitutions are

79


artifacts from the PCR or from the sequencing reactions. The DNA was cloned into the

Xhol/Hindlll restriction sites of the pECFP-Cl and pEYFP-Cl vectors (Promega) to

generate N-terminally tagged fusion constructs. DNA was prepared using a Qiagen

maxiprep kit and re-suspended in distilled H2 O to give a final concentration of 1 mg/ml.

2.2.10 Fluorescence Resonance Energv Transfer

Protein-protein interactions can be detected in vitro and in vivo taking advantage of the

phenomenon of Fluorescence Resonance Energy Transfer (FRET; Bastiaens and Jovin,

1998; Selvin, 2000). FRET can occur between two fluorophores, a donor and an

acceptor, that have overlapping emission and excitation spectra respectively (Figure 2.2

A). The donor fluorophore is excited at a wavelength that does not excite the acceptor

directly. In the absence of an acceptor, all the excitation energy is emitted as light. In

the presence of acceptor and if the two fluorophores are physically close enough (in the

nanometre range), energy may be transferred directly from the donor to the acceptor

fluorophore (Figure 2.2 B). This transferred energy can be measured as a decrease in the

fluorescence of the donor fluorophore (quenching) and an increase in the fluorescence

of the acceptor (sensitised emission; Figure 2.2 B).

The efficiency of energy transfer is steeply dependent on distance (Figure 2.2 C) and

can only be detected if the distance between the two fluorophores is less than 1.5Ro,

where Ro is the Forster radius, the distance at which 50% energy transfer occurs.

Typical values of Ro are in the range of 2-7 nm. This means that if the two fluorophores

are on separate proteins energy transfer only occurs if the two proteins are interacting

and with the correct orientation.

80

B

Ex Em Ex Em DONOR ACCEPTOR100 —

8 0 —

o 6 0 -

0) 4 0 —

O 2 0 —

800400 500 600 700

wavelength (nm)

Donor

/(ex

s*.

ki

'FR ET

Acceptor

Sensitisedemission

0.5

0.01.0 2.0 3.00.0

R (units of Ro)

Figure 2.2 Fluorescence resonance energy transfer (FRET). A) FRET can occur between a donor and acceptor fluorophore with overlapping emission (Em) and excitation (Ex) spectra. The shaded area corresponds to the amount of spectral overlap. B) Upon absorption of light, a fluorophore can enter the excited state, S*. Spontaneous emission of fluorescence (kf) results in a decay back to the ground state, S. The amount of time spent in S* is the fluorescent lifetime and is constant for a particular fluorophore. If a suitable acceptor molecule is present, energy is transferred directly ( A t r e t ) from the donor to the acceptor, reducing the time the donor spends in S*. This transferred energy is then emitted by the acceptor (sensitised emission). FRET can therefore be measured as a decrease in the donor fluorescence, an increase in the acceptor fluorescence or as a decrease in the lifetime of the donor. FRET can only occur when two fluorophores are sufficientlyclose, less than 1.5 R where Rg is the distance where energy transfer efficiency is50% (generally 3-7 nm). C) The effiency of energy transfer is steeply dependent on the distance between the donor and acceptor fluorophores and as such FRET can effectively provide an ‘all or nothing’ measure of protein-protein interactions.


FRET can be measured in vitro using spectrophotometry, where decreases in donor

fluorescence are used as an indicator of FRET. Protein-protein interactions can be

detected in living cells using Fluorescence Lifetime Imaging Microscopy to measure

FRET (Bastiaens and Squire, 1999). The fluorescence lifetime of a fluorophore is a

measure of how long electrons remain in the excited state. Lifetimes are generally in the

order of picoseconds to nanoseconds. Lifetimes are sensitive to excited state reactions

such as FRET. Energy transfer from the donor to the acceptor fluorophore decreases the

amount of time the donor spends in the excited state, causing a measurable decrease in

the lifetime of the donor. The advantage of measuring changes in donor fluorescent

lifetimes over changes in the donor emission is that fluorescent lifetimes are

independent of chromophore concentration and light-path length, parameters that are

difficult to control inside cells.

2.2.10.1 Measuring FRET in vitro

The cytoplasmic domains of Syt I and II were dialysed extensively against 20 mM

bicine-NaOH pH 8.5, 100 mM KCl prior to labelling with N-succinimidyl-Cy3 (donor)

and N-succinimidyl-Cy5 (acceptor, Amersham Pharmacia Biotech) for 30 min at room

temperature using a protein/dye ratio of 1:17 (Bastiaens and Jovin, 1998). The reaction

was blocked by the addition of 100 mM glycine and incubation for 5 min at 4°C. Excess

dye was removed on a PDIO gel filtration column (Pharmacia) pre-equilibrated in 20

mM HEPES-NaOH pH 7.6, 100 mM KCl and the yield of labelling was determined

spectrophotometrically using extinction coefficients of 31,270 M'^cm’* for Syt Lyto and

28,830 M'^cm'^ for Syt Ilcyto both at 280 nm, and extinction coefficients of 150,000 M'

cm' at 554 nm for Cy3 and 250,000 M' cm' at 650 nm for Cy5.

82

Chapter 2 ___________________________________ Materials and Methods

Spectrophotometric experiments were performed by adding increasing amounts of

calcium to a 50 pi cuvette (Hellma, Jena) containing 0.1 pM Cy3-Syt Ilcyto in 20 mM

HEPES-NaOH pH 7.6, 100 mM KCl, 2 mM EGTA and either 0.5 pM Cy5-Syt Icyto or

unlabelled Syt Icyto- In selected samples, 0.5 mM free Mg " was also added to monitor

the effect of divalent cations other than Ca^ on the equilibrium. Fluorescence emission

spectra were recorded in a 710 PTI spectrofluorimeter (Photon Technology

International, South Brunswick, N.J.) with an excitation wavelength of 540 nm.

Excitation and emission slit-widths were set to 4 nm. The average Cy3 fluorescence in

the range 560-590 nm was then normalised for the maximum fluorescence emission

intensity at 570 nm. This correction allowed the comparison of different experiments

despite variations in the initial Cy3-Syt Ilcyto concentration. Data were expressed as

FRET efficiency (Ef) where Ef = 1 -Rfs and Rf’ corresponds to the Cy3 fluorescence in

the presence or in the absence of FRET acceptor (Rf> = F’cY3Syti/CY5Syüi/F’cY3Syti/sytii).

2.2.10.2 Measuring FRET in vivo: Fluorescence Lifetime Imaging Microscopy (FLIM)

PC 12 cells growing on poly-L-lysine coated coverslip dishes (Matek) were transfected

with either ECFP-Syt II and EYFP-Syt I or with ECFP-Syt II alone using the Transfast

transfection reagent (Promega) according to the manufacturers instructions.

Transfection conditions were optimised and a 2:1 Transfast.DNA ratio and 0.5 pg DNA

per dish was used in all experiments. Following transfection, cells were left for 48 h

prior to use in the presence of 75 ng/pl NGF to allow expression of the fusion proteins

and differentiation. Alternatively, NGF-differentiated PCI2 cells were microinjected in

the nucleus with a mixture of 60 ng/pl EYFP-Syt I and 40 ng/pl ECFP-Syt II and left

for 4 - 5 h prior to imaging to allow expression of the fusion proteins.

83

Chapter 2________ ____________________________________Materials and Methods

The set-up of the FLIM microscope is described in detail by Squire and collaborators

(Squire and Bastiaens, 1999). FLIM measurements were taken with the assistance of P.

Bastiaens. The microscope stage was pre-heated to 37 °C. Cells were placed in a high

Na*/low buffer (145 mM NaCl, 5 mM KCl, 1 mM MgCb, 2 mM CaCh, 5 mM

HEPES-NaOH pH 7.2, 11 mM glucose) for initial measurements. An excitation

wavelength of 457 nm was used that selectively excites ECFP. Cells with suitably high

levels of ECFP fluorescence were chosen, stage co-ordinates were stored and lifetime

series were taken. Two to three cells per coverslip were imaged. The medium was then

substituted for a low NaVlow stimulation buffer (90 mM NaCl, 60 mM KCl, 1 mM

MgCE, 2 mM CaC E, 5 mM HEPES-NaOH pH 7.2, 11 mM glucose) pre-warmed to

37°C. A second series of images were acquired for each cell post-stimulation. Tp and Tm

were calculated for each pixel and averaged to produce the lifetime maps (Squire and

Bastiaens, 1999).

2.2.11 Liposome-binding and dot-blot binding assavs

The following experiments were carried out in collaboration with Claire Thomas.

Liposomes containing either 99% (mole/mole) PC and 1% Ptdlns or 98% PC, 1%

Ptdlns and 1% Ptdlns(4,5)Pz together with 30 nCi [ " C]-PC (Amersham Pharmacia

Biotech) were prepared by resuspending the dry lipid mixtures in 20 mM HEPES-KOH,

pH 7.5, 250 mM KCl, 0.1 mM DTT, followed by sonication. The liposomes were spun

to eliminate aggregates and incubated for 1 h at room temperature with 2-5 pg of 2C11

antibody immobilised on Protein CSepharose beads. 2C11 is an IgM (Thomas et al,

1999a) and as a result binds poorly to Protein G beads. To overcome this, beads were

first coated with rabbit anti-mouse IgM antibodies as a bridging antibody and then

incubated with 2C11. Beads were then incubated with 0.5 mg/ml ovalbumin to block

non-specific binding sites prior to use. After incubation with liposomes, beads were

84


washed three times in 20 mM HEPES-KOH, pH 7.5, 0.1 mM DTT and the radioactivity

quantified by scintillation counting.

For the dot-blot assay, salmon sperm DNA or total cellular RNA were spotted on a

nylon Hybond N plus membrane (Amersham Pharmacia Biotech) and PtdIns(4 ,5 )P2 on

nitrocellulose (Schleicher and Schuell). Nucleic acids were cross-linked to the

membrane by heating for 2 h at 80°C. Filters were blocked for 1 h at room temperature

with 1% ovalbumin, 1% polyvinylpyrrolidone in PBS and then incubated with 2C11

(1:500) in the same buffer. HRf-conjugated anti-mouse secondary antibodies (1:2000,

Dako) were applied in 3% polyvinylpyrrolidone in PBS. Blots were developed using

ECL Plus (Amersham Pharmacia Biotech).

2.2.12 Immunofluorescence

The following experiments were carried out in collaboration with Claire Thomas.

Cells were grown on glass coverslips (pre-treated with poly-L-lysine for PC 12 cells)

overnight in normal growth medium prior to paraformaldehyde (PFA) fixation for 12-15

min (3.7% PFA in PBS, or 4% PFA, 2% sucrose for PC 12 cells). Where specified HeLa

cells were treated with the transcription inhibitors a-amanitin (50 pg/ml in normal

growth medium) and 5,6-dichloro-1 -beta-D-ribofuranosylbenzimidazole (DRB, 100 pM«1-

in normal growth medium) for 5 h^37°C prior to paraformaldehyde fixation. In certain

cases, DRB treated cells were washed and incubated for a further 1 h, 37°C in normal

growth medium prior to fixation. For experiments using mitotic cells, HeLa and NIH-

3T3 cells were synchronised by treatment with nocodazole (100 ng/ml) overnight,

tapped off and after washing, plated on poly-L-lysine coated coverslips and left to

recover for the appropriate times.

85

1 0 % fetal calf serum was added to the blocking solution for immunofluorescence

experiments on PC 12 cells.

In competition experiments, 2C11 was pre-incubated with liposomes prepared as in

Chapter 2.2.11 and containing 95% (mol/mol) PC and 5% (mol/mol) of different

phosphoinosidites (Echelon) in PBS or with 0.2 mg/ml GroPIns, GroPIns(4 ,5 )P2 or

Ins(l,4 ,5 )P3 (Sigma) in PBS for 1 h at room temperature. Where indicated, neomycin (1

mM) was added to the blocking solution. RNase A (1 mg/ml) and DNase I (100 pg/ml)

treatments were carried out post-fixation and prior to the blocking step in PBS

containing 5 mM MgCli, 4% Tween 20 for 15 min or 2 h respectively. Where indicated,

coverslips were incubated with 100 ng/ml Hoechst 33342 in PBS for 3 mins following

incubation with the secondary antibody and prior to mounting.

*


After paraformaldehyde fixation, coverslips were incubated with 50 mM NH4 CI for 15

min and then blocked using PBS containing 2% bovine serum albumin (BSA), 0.25%

gelatin, 0.2% glycine and 0.2% Triton X-100 for 1 h. The primary antibody was

appropriately diluted (2C11 1:200; anti-Sm 1:2000; anti-SC35 1:2000; H5 1:1000; anti-

p80/coilin, 1:500; 9H10, 1:2000) in PBS containing 1% BSA, 0.25% gelatin and 0.2%

Triton X-100 and incubated for 1 h. Cells were washed with 0.2% gelatin in PBS and

the fluorescent secondary antibody (1:200, Molecular Probes) applied for 20 min in the

same buffer as the primary antibody.

2C11-Cy3 was prepared by incubating 2C11 with N-hydroxysuccinimidyl-Cy3 ester

(Amersham Pharmacia Biotech) in 100 mM HEPES-NaOH, pH 8.0. The optimum

dye:antibody ratio was worked out experimentally and the labelling was checked each

time by immunofluorescence on fixed and Triton X-100 permeabilised cells. As a

control, a monoclonal antibody against the vesicular stomatitis virus glycoprotein

(VSV-G, antibody P5D4) was Cy3-labelled using the same conditions. This antibody

gives a diffuse background fluorescence on fixed and Triton X-100 permeabilised cells.

For co-localisation experiments using two monoclonal antibodies, an additional

blocking step with a 30-fold excess of unlabelled primary antibody was performed

following incubation with the Alexa-488 conjugated anti-mouse secondary antibody and

prior to application of 2C11-Cy3/P5D4-Cy3.

For microinjection, labelled antibodies were concentrated to between 1 and 1.8 mg/ml

in PBS prior to use. Cells were grown for 18 h on glass coverslips prior to cytoplasmic

microinjection. Cells were fixed with paraformaldehyde after a 2 h recovery period.

Samples were imaged with an upright Laser Scanning Microscope (Zeiss 510). The

confocal system and the microscope were controlled through the manufacturer-supplied

86


software (LSM 510 version 1.49.44) running on Windows NT 4.0 operating system

(Microsoft). The 488 and 543 nm lines of an Argon- and a Helium-Neon-ion laser,

respectively, were used for dual excitation. Images were collected using an oil-

immersion objective (plan-Apochromat, 63x/l .4 NA, phase 3). Z-sections were taken

with a thickness of 0.4 pm. Emission fluorescence from dual stained preparations were

separated with a combination of an FITC-type narrow band-pass filter block (505-530

nm) and a long-pass rhodamine-type block (> 560 nm). Images were processed batch-

wise in Adobe Photoshop v5.0 and the same adjustments were applied to all images

(gamma levels adjustments for presentation purposes). Where specified, images were

acquired using a cooled charge-coupled device (CCD) camera mounted on a Zeiss

Axiovert 135 microscope. Images were collected using a Zeiss oil-immersion

Plan/apochromat 63x 1.4 NA objective.

2.2.13 Electron microscopv analvsis

These experiments were carried out in collaboration with Claire Thomas and Steve

Gschmeissner.

Cryosections of HeLa cells and extruded liposomes (Duzgunes and Wilschut, 1993)

containing 90% PC plus 10% Ptdlns or 94% PC, 2% PtdIns(4 ,5 )P2 and 4% Ptdlns in 20

mM HEPES-KOH, pH 7.4, 0.1 mM DTT were labelled as previously described (Slot

and Geuze, 1985). 2C11 antibody was used at 1:10 dilution and followed by 10 nm

gold-conjugated rabbit anti-mouse IgM (1:100, British Biocell). Sections were

examined and photographed with a JEOL 1010 TEM.

2.2.14 [ P1- and f^^Sj-metabolic labelling of cells

Cells were seeded in 150 mm dishes and grown overnight to 80% confluency. HeLa

cells for [^^P]-labelling were incubated for 3 h with phosphate-free Krebs/Ringer (117.5

87


mM NaCl, 1.2 mM CaCl], 3.6 mM KCl, 0.8 mM MgS0 4 , 5 mM NaHCOg, 20 mM

HEPES-NaOH, pH 7.4, 10 mM glucose, 0.1% BSA) to deplete the intracellular

phosphate pool . Growth medium was exchanged for the labelling buffers, phosphate-

free Krebs/Ringer containing Phenol red, 1% Fetal Calf Serum, 100 pM NaxPj 1 mCi [y-

^^P]-orthophosphate (10 mCi/ml) or methionine/cysteine free Dulbecco’s modified

Eagle’s medium containing 10% normal growth medium and 1.4 mCi [^^S]

cysteine/[^^S] methionine (1.43 mCi/ml) Promix cell labelling mix. Cells were

incubated overnight at 37°C, 10% CO2 (Spector et a l, 1998).

2.2.15 Extraction of [^^Pi-labelled phosphoinositides

Intact nuclei with the nuclear membrane removed were prepared in the presence of the

non-ionic detergent Nonidet P-40 (NP40) based on the method of Popov and

collaborators (Popov et a l, 1998). Briefly, cells were scraped on ice in PBS and were

spun down for 3 min, 500 gav Nuclei were obtained by the addition of 0.5 ml 0.25%

NP40 buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgClz, 0.2 mM EDTA,

0.25% NP40, 10 mM NaF, 1 mM DTT, 0.1 mM PMSF, 2 pg/ml pepstatin A, 1:100

phosphatase inhibitor cocktail (Sigma)), a treatment that also removes the nuclear

envelope. Following an incubation of 2 min on ice, nuclei were pelleted by

centrifugation for 5 min, 500 gav, re-suspended in 0.5 ml 0.25% NP40 buffer and

immediately spun down. Intact cells or nuclei were re-suspended in 200 pi PBS and 840

pi CHCI3 . Phosphoinositides were extracted by the addition of 1200 pi CHCfiiMeOH

1:2, followed by 840 pi 2.4 N HCl. The mixture was stirred for 30 sec in between each

addition. Aqueous and organic phases were then separated by centrifugation for Imin,

500 gav. The organic phases were sampled, the aqueous phase re-extracted with 400 pi

CHCI3 and the two organic phases were pooled and washed three times with

MeOH:HCl (1 N) 1:1. Lipids were loaded on thin layer chromatography (TEC) plates

88


pre-run in 1.2% potassium oxalate in MeOHiHiO 2:3 (v/v) and washed in

CHClsiMeOH, 1:1. Pis were separated using CHCl3 :MeOH:H2 0 :NH4 OH, 90:90:20:7.

Labelled species were detected by autoradiography and compared to unlabelled PI

standards (10 pg) which were visualised by spraying TLC plates with phospholipid

detection reagent (Goswani and Frey, 1970) and heating at 110°C until the

characteristic blue dot appeared.

2.2.16 Immunoprécipitation

Nuclear extracts from [ ^P] and [^^S]-labelled cells were initially prepared in the

presence of detergent (0.25% NP40). Nuclei were isolated as above were re-suspended

in 1 ml NP40 buffer, passed 10 times through a 25g needle and incubated for 5 min at

25°C prior to centrifugation for 5 min at 13,000 gav to remove insoluble material.

Nuclear extracts were immunoprecipitated sequentially with IgM and 2C11-conjugated

Protein G beads. Immunoprecipitates were washed 3 times in 0.25% NP40 buffer and

twice with NP40 buffer containing 0.5% NP40. [^^P]-labelled phosphoinositides were

extracted with CHChMeOH and analysed on oxalate treated TLC plates as above. [ ^S]-

labelled proteins immunoprecipitated were solubilised in Laemmli sample buffer and

analysed by SDS-PAGE and autoradiography.

Immunoprécipitations for Western blotting and Coomassie Blue staining were carried

out on HeLa nuclear extracts prepared by C. Thomas from 10 litres of suspension HeLa

cells (HeLa S3, American Tissue Culture Catalogue) according to the method of

Dignam and coworkers (Dignam et a l, 1983). Briefly, HeLa cells were harvested by

centrifugation and washed in PBS, 4°C. Cells were lysed using a Dounce homogeniser

in 2 cell volumes of 10 mM HEPES-KOH pH 7.9, 10 mM KCl, 1.5 mM MgCb, 0.5

mM DTT, nuclei were collected by centrifugation and resuspended in 3 mis of 20 mM

89


HEPES-NaOH pH 7.9, 25% (v/v) glycerol, 0.42 M NaCl, 1.5 mM MgCE, 0.2 mM

EDTA, 0.5 mM PMSF, 0.5 mM DTT per 10 cells. Nuclei were broken using a Dounce

homogeniser and insoluble material removed by centrifugation. The supernatant was

dialysed extensively in 20 mM HEPES-KOH pH 7.9, 20% (v/v) glycerol, 0.1 M KCl,

0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT then cleared by high speed centrifugation

and stored at -80°C.

Extracts were incubated with 20 pi of either anti-IgM conjugated or 2C11-conjugated

protein G-Sepharose beads for 2 h at 4°C and beads were collected by centrifugation for

1 min at l,200g at 4°C. For competition experiments, 2C11 beads were pre-incubated

with 250 pM GroPIns or GroPIns(4 ,5 )P2 in PBS for 30 min at room temperature.

Immunoprecipitates were washed four times in 20 mM HEPES-KOH pH 7.9, 100 mM

KCl, 1.5 mM MgCE, 0.2 mM EDTA, 0.25% NP40 and then prepared for SDS-PAGE.

Proteins were either stained with Coomassie Blue or transferred to nitrocellulose and

analysed by Western blotting.

[^^P]-labelled RNAs associated with the control and 2C11 immunoprecipitates from

nuclear extracts prepared from f^P]-labelled HeLa cells using the Dignam method with

modifications (Abmayr et a l, 1988), were phenol/chloroform extracted following

proteinase K treatment (50 pg/ml in 0.5 % SDS, 10 mM Tris-HCl, pH 7.6, 5 mM EDTA

for 20 min, 37°C). Alternatively, immunoprecipitates from nuclear extracts prepared

from unlabelled HeLa cells using the NP40 method were treated with Proteinase K,

associated RNAs were phenol/chloroform extracted and 3’ end-labelled with [5'-

^^PJpCp (3000 Ci/mmole, Amersham Pharmacia Biotech) and T4-RNA ligase (New

England Biolabs) for 45 min at 37 °C (England and Uhlenbeck, 1978). Labelled RNAs

were separated on a 6 % acrylamide/7 M urea denaturing gel. snRNAs were identified

90

Chapter 2___________________________________________Materials and Methods

according to molecular weight and by comparison with parallel immunoprécipitations

using anti-snRNP antibodies (either human Sm anti-serum or monoclonal antibody Y12

(Lemer et a l, 1981)). [^^P]-labelled RNA markers were prepared from a pBR322 DNA

Msp I digest (New England Biolabs) by in vitro transcription (a kind gift from F.

Nicolas).

2.2.17 In vitro phosphoinositide kinase assavs

Kinase assays were carried out according to the method of Jenkins and collaboratorspfrfttAn

(Jenkins et a l, 1994) using liposomes c o n t a i n i n g a n d different Pis in a 4:1 molar

ratio as substrate.Immunoprecipitates were assayed for kinase activity towards 100 pM

phosphoinositide in the presence of 50 pM [y-^^P]-ATP (10 pCi/nmol). In appropriate

samples, 80 pM phosphatidic acid (PA) was present. Lipids were extracted by addition

of 600 pi CHCbiMeOHiHCl (IN), 200:100:1 followed by centrifugation for 1 min at

13,000 gav The organic phase was washed twice with MeOH:HCl (IN), 1:1. Lipids

were loaded onto oxalate treated TLC plates as described before and separated using

CHCl3 :MeOH:dH2 0 :NH4 OH (90:90:20:7). Labelled species were visualised by

autoradiography and compared to unlabelled standards (10 pg) as before. HPLC

analysis of deacylated PtdIns(4 ,5 )P2 was performed by F. Cooke as previously

described (Dove et a l , 1997) using purified tritiated deacylated PtdIns(4 ,5 )P2

(GroPIns(4 ,5 )P2) as an internal standard.

2.2.18 In vitro splicing assavs

Splicing assays were carried out in a final volume of 20 pi, containing 30% HeLa

nuclear extract, 0.8 U/ml RNasin (Promega), 0.4 mM ATP, 20 mM creatine phosphate,

3 mM MgCb, 0.6% polyvinyl alcohol and 3-4 ng RNA probe. Uniformly radiolabelled

RNAs were in vitro transcribed from linearised vectors containing the first two exons

91


and intron of P-globin (Krainer et a l, 1984) and exons 14, 15 and the separating intron

of 8 -crystallin (spl4-15; Pellizzoni et a l, 1998), using [a-^^P]-CTP (Amersham

Pharmacia Biotech), Sp6 RNA polymerases and the Riboprobe in vitro transcription

system (Promega). RNAs were gel purified and the specific activity calculated based on

the percentage of [ P] incorporated into the RNA and assuming that all nucleotides are

incorporated to the same extent. The average specific activity of the RNA probes in all

the experiments was 5x10" cpm/ng. Splicing assays were carried out in a final volume

of 20 pi, containing 30% HeLa nuclear extract, 0.8 U/ml RNasin, 0.4 mM ATP, 20 mM

creatine phosphate, 3 mM MgClz, 0.6% polyvinyl alcohol and 3-4 ng RNA probe. After

incubation for 3 h (B-globin) or 1 h (8 -crystallin) at 30°C, RNA was isolated by

phenol/chloroform extraction and ethanol precipitation and analysed by gel

electrophoresis on a 6 % acrylamide, 7 M urea denaturing gel.

2.2.19 Immunodepletion of nuclear extracts

For immunodepletion experiments, the splicing reaction mix was incubated for 1 h at

4°C with protein G&pharose beads alone or conjugated with anti-IgM, 2C11 or Y12

prior to the addition of the RNA probe. Beads were removed by centrifugation, washed

and associated proteins were analysed by SDS-PAGE and Western blotting using an

antibody raised against the hyperphosphorylated form of the large subunit of RNA

Polymerase II (H5) as a marker. Supernatants were used in the splicing reaction. RNAs

were analysed by electrophoresis as before. Quantitation of splicing was performed

using a Phoshorimager (Molecular Dynamics). The amount of splicing was calculated

as (free intron + spliced product + splicing intermediates)/(start + free intron + spliced

product + splicing intermediates) and was expressed as a percentage of splicing in the

IgM depleted control (100%) to enable different experiments to be compared.

92

Chapter 2___________________________________________Materials and Methods

2.2.20 Elution and add-back experiments

Immunoprécipitations were carried out in 19 pi splicing reaction containing 40%

nuclear extract for 90 min at 4°C. Immunoprecipitated material was eluted by

incubating beads for 15 min at 4°C with 5 pi elution buffer (14 mM HEPES-NaOH, pH

7.9, 40 mM KCl, 3 mM MgCE, 0.4 mM ATP, 20 mM creatine phosphate, 0.6%

polyvinyl alcohol) containing 300 pM Ptdlns, di-butyl Ptdlns(4 ,5 )P2 or GroPlns(4 ,5 )P2 .

The supernatant or 5 pi of the lipids alone were added to the depleted reaction mix to

give a final concentration of 30% nuclear extract. 3 ng d-crystallin RNA was used per

reaction and splicing reactions were carried out for 1 h at 30°C. The immunoprecipitates

post-elution and samples of the eluted material were analysed in parallel by SDS-PAGE

and Western blotting using antibody H5. RNAs from the splicing reactions were

isolated and analysed by denaturing acrylamide gel electrophoresis and the extent of

splicing was quantitated as before.

2.2.21 Ptdlns(4.5)P? phosphatase assays

Ptdlns(4 ,5 )P2 labelled with [ P] at the 5’ position was prepared using recombinant

Mss4p, the yeast Ptdlns(4)P-5 kinase, and liposomes containing 100 pM Ptdlns(4)P,

400 pM The kinase reaction was carried out in 25 mM HEPES-NaOH, pH 7.4, 150

mM NaCl, 1 mM DTT, 0,2 mM EDTA, 2 mM MgCL, 10 |xM [y-"P] ATP (3

mCi/nmol) for 30 min, 30°C. The reaction was stopped with 240 pi CHClsiMeOH (1:1,

v/v) and lipids extracted by the addition of 240 pi CHCI3 , 58.5 pi 2.4 N HCl. The

organic phase was washed once with 240 pi IN HCEMeOHiCHCE (47:48:3), dried

down and supplemented with cold Ptdlns(4 ,5 )P2 as a carrier. Lipids were re-suspended

in phosphatase assay buffer (20 mM HEPES-NaOH, pH 7.9, 100 mM KCl, 0.2 mM

EDTA, 0.5 mM DTT, 0.2% OG). Phosphatase assays were carried out for 15 min, 30°C

in phosphatase assay buffer containing approximately 100 pM Ptdlns(4 ,5 )P2 and 1 pg

93


of Inp52p-CD). 100 pi dHiO was added followed by 500 pi CHCI3 iMeOHidHzO

(50:50:0.6). 100 pi ImM CaClz was added prior to centrifugation for 5 min at 2 0 0 0 gav.

Radioactivity associated with the aqueous phase was determined by direct counting in a

Beckman scintillation counter after evaporation of the MeOH.

2.2.22 Phosphatase treatment of nuclear extracts

6 pi HeLa nuclear extract was incubated with 1 pg Inp52p-CD in the presence of 3 mM

MgClz for 20 min at 30°C. Phosphatase treated nuclear extracts were then used in

splicing reactions using d-crystallin mRNA as substrate.

2.2.23 Immunoprécipitation of splicing complexes

Splicing reactions were carried out as described in section 2.2.18 and reactions were

stopped by placing the samples on ice. 15 pi of 50% antibody conjugated Protein G

beads (2C11, anti-IgM or Y12 (Lemer et al, 1981)) were added and the samples were

incubated for 1 h at 4°C. Immunoprecipitates were washed three times in 50 mM Tris-

HCl pH 7.5, 150 mM NaCl, 0.5% NP40, 1.5 mM MgCL, 0.5 mM DTT prior to

Proteinase K treatment. RNAs were phenol/chloroform extracted, ethanol precipitated

in the presence of 10 pg glycogen as a carrier and analysed by 6 % acrylamide, 7 M

urea, denaturing gel electrophoresis and autoradiography.

94

Chapter 3: Calcium-dependent

oligomerisation of Syt I/II

95

Chapter 3________________________Calcium-dependent oligomerisation o f Svt ////

3.1 Introduction

Syt I and the highly homologous Syt II are synaptic vesicle proteins specifically

expressed in the nervous system. Genetic, electrophysiological and biochemical studies

have provided compelling evidence Syt I and by virtue of its similarity, Syt II function

as calcium sensors in the fast phase of neurotransmitter release. Syt IV is also expressed

in the nervous system. Syt IV differs from Syt I and II as it lacks a critical calcium

binding residue in the C2A that abolishes calcium-dependent phospholipid binding (von

Poser et al, 1997) and as such, may have a different function at the synapse. Moreover,

Syt IV is also expressed in non-neuronal tissues, suggesting a more general role for this

isoform.

Syt I, II and IV mRNAs have been shown to have individual but overlapping patterns of

expression within the mammalian brain (Geppert et a l, 1991; Berton et a l, 1997).

Biochemical and genetic evidence suggest that Syt I is able to oligomerise (Perin et a l ,

1991), probably to form dimers (Chapman et a l, 1996; Damer and Creutz, 1996), and is

likely to function as a multimeric complex in neurotransmitter release (Littleton et a l ,

1994). Syt I dimérisation is calcium-dependent (EC50 of 3-10 pM calcium) and is

mediated by the C2B domain (Chapman et a l, 1996; Sugita et al, 1996). The formation

of Syt dimers could be important for its interaction with effector molecules such as the

SNARE complex, PtdSer and phosphoinositides. The similarity between the calcium-

dependent binding properties of Syt I and II and the fact that Syt IV C2B, unlike the

C2A, has the amino acids required for the coordination of calcium suggest that

oligomerisation could occur between different isoforms on the surface of SSV. To

investigate this we have raised isoform-specific polyclonal antibodies against Syt I, II

and IV. These antibodies have been used, together with a population of highly purified

rat brain cortical SSV, to demonstrate for the first time that Syt IV is present on SSV

96

Chapter 3________________________ Calcium-dependent oligomerisation o f Svt ////

and that different Syt isoforms can be present on the same SSV where they have the

potential to interact in a calcium-dependent manner.

3.2 Results

3.2.1 Generation and characterisation of Svt isoform-specific antibodies

Polyclonal antibodies were raised against peptides from the N-terminal, intra-vesicular

domain of Syt I, II and IV. Sequence alignment and comparison of the fourteen Syt

isoforms identified (Figure 3.1), demonstrates that the regions of highest homology are

the two C2 domains, the major effector domains of Syt. In contrast, the N-terminal,

intra-vesicular region is highly variable between isoforms (Figure 3.1 B) and as such is

an ideal region against which to raise isoform specific antibodies (Schiavo et al, 1998).

Previous studies have shown that antibodies against the N-terminal portion of Syt I can

bind to the protein in stimulated hippocampal neurons without perturbing its function

(Matteoli et a l, 1992), suggesting that antibodies directed against this portion of other

isoforms will be equally inert.

Anti-sera generated were tested by Western blotting after affinity purification on the

corresponding immobilised-peptide column for anti-Syt I and II and following partial

purification of anti-Syt IV by ammonium sulphate precipitation and protein-A sepharose

affinity chromatography. As shown in Figure 3.2, each antibody recognised a single major

band in both cortical synaptic vesicles and a synaptic membrane fraction from cerebellum.

In the case of anti-Syt I and II antibodies, this reactivity was abolished by pre-incubation

with an excess of the respective generating peptide, while anti-Syt IV immunoreactivity was

reduced significantly, but not completely abolished. To confirm the specificity, pre-immune

and immune anti-Syt IV sera were therefore tested against the same cortical and cerebellar

97

0.05SytVIII ' '

SytB /K

--------------- S ytX Ill

------------- Srgl

— SytVlI

— SytXI

— SytIV

-S y tX

• SytVI

-S y tV

■ S ytlll

■SytlX

- S ytll

■ Sytl

BTM

S y t l VPHNATEPASPGE6KEDAFSKLKQKFMNELHKIPLPS y 1 1 1 B ^ g g 2 ^ ^ S S ^ S * ^ * ™ P L A P A A P A D N S T E S T G T G E S Q E C M r A K L K D K r r H E I N E I P L P S y t l X M FPE PPT PG SP--------------- A PE T PPD SSR IR Q G ------------------------------------------ AVPAl

phSl t I'Pi i.'AWpTLA!

lA IA IV A V L L W T C C rC V lA M A W A G LLLLTC C rC I .T IL L G SG L L V F SS C rC L

S y t V I I I M QAD RSM KM G H A LN PFSTSA PLD A TA G PSLIPD LITRIPH PRM TLFIÎLA AGVLLV SCLLCVI M

S y t I VS y tX I

S y t V I I

S y tVS y tV I

S y tXS y t l l l

S y t X I I IS r g l

MA PITTSRVEFDEIFT______________________pV G IFS A F G L V F T V S — LF|AW MM A E IT N IR PS F D V S PV A A ÎG A SV L W C V SV T V F V H ll7

M T R D P E A A S PG A PT R D ^L V SA IIT V S L S V T IV L C 36

MPGARDA— L - -CHQA IQLLA ELCA RG-------- A LEH D SCQD FIZHLRORA RPRLRO PD ISV iM SGVW GAGGP-RCOAALAVLASLCRARPPPLGLDVETCQSFELOPPEOS-PSAADSGTSV!M SFRKEDG VSSLCQKALBIITELCFA G-------------QVEWDKCSGIFPADRSGOGGGGTDISViMSGDZEDD LC RR A LILV SD LC A R IR — D A D TN D RCQEFN -ELRIRGZPRG PD ADISVi

LTLW TACGLALFGVSLFV LAVW IVCGV ALVAV FFFL LA V W S F C G L A L L W SL FV L SV IV T FC G IV LLG V SLFV

Figure 3.1 Phylogenetic analysis of the Syt family. A) This phylogenetic tree was obtained by aligning rat and mouse Syt orthologues using ClustalX vl .8 with default settings (scale-bar= 0.05 divergance units). Five distinct homology groups can be identified from this. B) The N-terminal domains of Syt were analysed within these groups, keeping the position of the transmembrane (TM) domain invariant. TM regions were identified using TMpredict <http://www.ch.embnet.org/> and are boxed. Syt B/K does not have a transmembrane region and as such is not included.Peptides used to generate polyclonal anti-Syt I, II and IV are highlighted. Amino acid numbers are indicated on the right. Accession numbers: Syt I, X52772; Syt II, M64488; Syt III, D285I2; Syt IV, UI4398; Syt V, AB026802; Syt VI, U20105; Syt VII, U20106; Syt VIII, AB026805; Syt IX, X84884; Syt X, U855I3; Syt XI, AF000423; Syt XIII,NM 030839; Srgl, U7I294.

http://www.ch.embnet.org/

Mr(xIO ^)

83 ►

62 ► 47 ►

p e p t i d e

a n t i - S y t I a n t i -S y t II

+ + + +

Mr(X1Q3) ^ ^

a n t i - S y t IV a n t i - S y t IV

p e p t i d e - i m m u n e p r e - im m u n e

Figure 3.2 Antibody characterisation. Affinity purified anti-Syt I and II and partially purified anti-Syt IV were incubated with 5 mg/m I of the generating peptide (+), or DMSO alone (-) and were used for Western blotting samples of purified rat brain cortical SSV (15 pg, CTX) and crude rat cerebellar SSV (50 pg, CBM). Anti-Syt IV antiserum were also compared to the pre-immune serum by Western blot using the same samples.

Chapter 3________________________ Calcium-dependent olisomerisation o f Svt I/II

synaptic vesicle membrane fractions and a single immunoreactive band was detected only

with the immune serum (Figure 3.2).

3.2.2 Preparation of Small Synaptic Vesicles TSSV)

Highly purified SSV prepared from rat brain cortices are an ideal model for the

characterisation of the protein composition of SSV and as an abundant source of native

synaptic vesicle-specific proteins for the study of protein-protein interactions. The

drawback of this system is the fact that the SSV are isolated from populations of

neurons and as such can only be used to draw conclusions on the average properties of

SSV and their constituents.

SSV were prepared from rat brain cortices using a method based on that of Huttner and

collaborators (Huttner et a l, 1983). A schematic of the different steps is shown in

Figure 3.3 A. The final step requires the purification of SSV using size-exclusion

chromatography. To check for the efficiency of our purification, samples from different

steps in the fractionation were analysed by Western blotting with synaptic vesicle

markers or were prepared for electron microscopy. Electron microscopic analysis of

CPGii shows that this fraction contains a homogeneous population of vesicular

structures with an average diameter of 39 ± 3 nm, which is consistent with them being

SSV (Figure 3.3 A). Analysis of Fill on the other hand reveals that this denser fraction

contains mainly larger membrane fragments and some vesicular structures with

irregular shapes and diameters that are on average a lot larger than SSV (Figure 3.3 A).

Western blotting with an antibody against the v-SNARE, VAMP-2, which is mainly

found on SSV shows that there is a marked enrichment of this marker in fractions

containing SSV (Figure 3.3 B). CPGn, the fraction from the size-exclusion

100

R a t B r a in

C o r te x

Crude Synaptic V esic le s LP2

▼ S u c r o s e G r a d ie n t f — \ 5 0 - 8 0 0 m M

FI "A

H o m o g e n i s a t i o n100 nm

aFill

N u c le a r P e l le t

PNS

S yn ap tosom es

C o n tr o l G l a s s P o r e C h r o m a t o g r a p h y

?

O s m o t i c l y s i s

C ru d e P la sm a m e m b ra n e LP1 CPG,

Crude Synaptic V esic le s LP2

B y25 I VAMP-2

Figure 3.3 Purification of rat brain cortical SSV. A schematic of the protocol is shown in (A). The final step involves a size-exclusion chromatography step. Fractions from the second elution peak, containing pure SSV (shaded area, CPGn) were pooled. Electron microscopy of these pooled fractions shows a homogeneous population of vesicles with an average diameter of 39±3 nm. Fraction Fill from the previous step (the sucrose density gradient) on the other hand contains mainly membrane fragments and larger vesicular structures. B) Samples (50 pg) of each of the purification steps were analysed by SDS-PAGE and Western blotting using antibodies against the synaptic vesicle markers VAMP-2 and Syt I. An enrichment of the two markers is seen in SSV-containing fractions and is particularly marked in fraction CPGn.

Chapter 3________________________ Calcium-dependent oligomerisation o f Svt I/II

chromatography step containing the SSV-like profiles, contains the most VAMP-2. The

same fractions were also Western blotted with a monoclonal antibody against Syt I

(M48; Matthew et a l, 1981). Again, a significant enrichment is observed in fractions

containing SSV (Figure 3.3 B).

3.2.3 Different Svt isoforms are present on the same synaptic vesicle

For any protein-protein interaction to be physiologically relevant, both proteins must be

found at the same location i.e. in the case of different Syt isoforms, on the same SSV.

While Syt I and II are known to be integral membrane proteins of the synaptic vesicle,

the sub-cellular distribution of Syt IV had not been analysed. To determine whether Syt

IV is found on SSV, samples were taken from individual fractions eluted from the

glycerol coated controlled-pore glass bead column (CPG), the last step in the

purification of SSV (Figure 3.3 A). These samples were analysed by SDS-PAGE and

Western blotting with antibodies against Syt I, II or IV. The distributions of Syt I and II

immunoreactivity overlap exactly, peaking in the same fraction, fraction 32 within the

CPGii peak (Figure 3.4) suggesting that these two isoforms are present on SSV with the

same size distribution and possibly on the same synaptic vesicle. Syt IV

immunoreactivity is also present within CPGn demonstrating that Syt IV is a protein of

SSV. The immunoreactivity is however slightly shifted compared to that of Syt I and II,

peaking in fraction 34 (Figure 3.4). These results suggest that different populations of

cortical SSVs exist, which differ slightly in their size and the isoform of Syt present on

the surface. Such populations could each contain a single Syt isoform or alternatively

could contain multiple Syt isoforms on their surface. This is not the first non-

electrophysiological demonstration of the heterogeneity of SSV, as a previous study

identified at least two different populations distinguished both physically and

102

C P G . C P G ,

15 -

Eco00CM

OoE

20 25 30 35 405 10 15 45fraction num ber

Mr(X103)

62 ► ^ a n t i - S y t I

62 a n t i - S y t II

62 a n t i - S y t IV

10 13 16 18 20 22 24 26 28 30 32 34 36 38

fraction num ber

Figure 3.4 Syt I and II co-localise in a SSV preparation from rat brain cortex.The elution profile of the glycerol-coated controlled pore glass beads column loaded with an impure fraction of rat cortical SSV (FI, see Figure 3.3) is shown in the upper panel. Proteins from fractions within the two absorbance peaks at 280 nm were analysed by SDS-PAGE and Western blotting using anti-Syt I, II and IV antibodies. The immunoreactivity for Syt I and Syt II co-localises and overlaps with the second peak ( C P G n ) , which contains pure SSV. Syt IV immunoreactivity also peaks in C P G n ,

but is slightly shifted compared to the signal for Syt I and II (peaking in fraction 34, compared with 32 for Syt I and II).


biochemically by the presence of the enzyme arginine aminopeptidase (Thoidis et al.,

1998).

To ascertain whether individual SSVs can contain more than one Syt isoform, intact

synaptic vesicles were immunoisolated in the absence of detergent using monoclonal

antibody M48 which recognises an epitope within the cytoplasmic domain of Syt I

(Matthew et a l, 1981). Such an immunoisolation strategy has been used successfully in

the past, for example in the isolation of glutamate containing SSV from brain

homogenates (Burger et a l, 1989). M48 immobilised on beads was incubated with the

purified CPGn fraction, then associated proteins were analysed by SDS-PAGE and

Western blotting with anti-Syt II or anti-Syt IV specific polyclonal antibodies and, as a

control, with antibodies against VAMP-2. Syt I-specific beads immunopurified SSV

containing the majority of the Syt II immunoreactivity (Figure 3.5 A). More than 65 %

of Syt II immunoreactivity was found in the pellet, as determined by quantitative

Western blotting and scanning analysis, suggesting that in the cortex, most of the Syt II

is found on Syt I containing vesicles. In contrast, less than half of the Syt IV is

associated with the Syt I positive SSV (< 45 %, Figure 3.5 A), indicating the presence

of this isoform in at least two populations of SSV, one of which lacks Syt I. The

converse experiments, immunoisolating Syt II or Syt IV containing vesicles and

assaying for the presence of the other two isoforms, could not be done as the polyclonal

antibodies against these isoforms recognise epitopes on the intralumenal N-termini of

the proteins which are inaccessible in the absence of detergent. Whether Syt IV

positive/Syt I negative SSVs contain Syt II or another Syt isoform remains to be

established.

104

Mr(x1Q3) j

62

62

16

anti-Syt I beads

emptybeads

mm

— ii—- — ►

mm m m

a n ti-S y t II

a n t i -S y t IV

an ti-V A M P 2

B

# 1 0 0 n m

o O bserved

— Expected

cucna 1c

1 10 20 30

Photo number

Figure 3.5 Syt I and II are present on the same SSV. A) Intact Syt I-containing vesicles were immunoisolated using immobilised anti-Syt 1 monoclonal antibody (anti-Syt 1 beads) or empty beads and analysed by SDS-PAGE and Western blotting using anti-Syt 11, anti-Syt IV or anti-VAMP 2 antibodies. The majority of Syt 11 immunoreactivity is associated with Syt 1-containing SSV compared to 45% of Syt IV immunoreactivity. This demonstrates that Syt 1 and 11 and Syt 1 and IV are present on the same SSV and suggests that more than one population of cortical SSV exist. T= total input, P= pellet, S- supernatant. B) Purified cortical SSV were labelled post-embedding with anti-Syt 1 monoclonal antibody and anti-Syt 11. A 5 nm gold conjugated anti-mouse secondary and a 10 nm gold conjugated anti-rabbit were used to detect the anti-Syt 1 and anti-Syt 11 respeetively. An example of a synaptic vesicle labelled with both 5 nm and 10 nm gold particles is boxed. The boxed area has been expanded (inset). C) The number of SSV were counted in 30 photographs of random fields and scored for the presence of 5 nm, 10 nm or both 5 and 10 nm gold particles. The percentage of observed and expected (based on the frequency of single labelled SSV) double-labelled SSV was plotted for each. Although the number of double-labelled vesicles is small, the number observed is significantly higher than the expected number (using a paired t-test, t=3.97 on 29 degrees of freedom; p=0.0004).


A third evidence that Syt I and II can exist on the same SSV comes from immuno-

electron microscopy studies. Purified SSVs taken from the CPGn peak were prepared

for electron microscopy. Ultra-thin cryosections were co-stained with M48, the

monoclonal antibody against Syt I and our polyclonal antibody against Syt II. A 10 nm

gold conjugated anti-rabbit and a 5 nm gold conjugated anti-mouse were used as

secondary antibodies (Figure 3.5 B). Control sections were incubated with the

secondary antibodies alone and had negligible amounts of gold particles associated (not

shown). Pictures were taken of random areas in the sections and in each photograph the

total number of SSVs were counted and the number of vesicles with either 5 nm, 10 nm

or both 5 and 10 nm gold within 5 nm of the surface of the SSV scored. A total of 30

photographs were analysed (Figure 3.5 C). Of the 3955 SSV counted, 368 were labelled

with 5 nm gold (i.e. Syt I), 59 were labelled with 10 nm gold (i.e. Syt II) and 27 were

labelled with both. Analysis using a paired t-test showed that the obtained number of

SSV containing both 5 and 10 nm gold (i.e. both Syt I and II) was significantly higher

than expected number, which was calculated from the observed number of single

labelled SSV (t=3.97 on 29 degrees of freedom; p=0.0004). We conclude that Syt I and

II are present on the same SSV.

3.2.4 Svnaptotagmins I and II hetero-oligomerise in a calcium-dependent manner

As different Syt isoforms can co-exist on the same SSV, we used a co-

immunoprecipitation approach to see whether different isoforms are able to interact.

Purified cortical SSVs (fraction CPGn) or crude cerebellar SSV (fraction LP2) were

solubilised using 4% OG and immunoprécipitations were carried out in 1.2% OG using

the anti-Syt I and II N-terminal antibodies. Western blotting of immunoprecipitates

showed that, in conditions where free calcium levels were uncontrolled, Syt II is co-

immunoprecipitated with anti-Syt I antibodies (Figure 3.6 A). Similarly, Syt I

106

Mr CTX CBM

(xIO®) P S

65 I S y tl

BMr

CTX CBM

(xio=) P S P S

65 S y tl

65

6 5

Syt II 65

Syt IV

anti-Syt I beads

S y tll

anti-Syt II beads

Mr(x10)65 ».

0 fjM 100 ^M [Ca2+]

Syt II

65

Syt IV

anti-Syt I beads

Figure 3.6 Co-immunoprecipitation of Syt I, II and IV Purified SSV from rat brain cortex (CPGn; CTX) and a crude vesicular fraction from rat cerebellum (LP2; CBM) were detergent solubilised prior to immunoprécipitation using either anti-Syt I (A) or anti-Syt II beads (B). The resulting pellets (P) and supernatants (S) were then probed with anti-Syt I, II or IV antibodies. Syt II co- immunoprecipitates with Syt I from both cortex and cerebellum, whereas only 5- 12% of Syt IV is co-immunoprecipitated from either fraction. C) The extent of the interaction between Syt I and Syt II in detergent-solubilised purified rat brain cortical SSV is increased in the presence of 100 pM free calcium. A basal level of interaction is seen even in the absence of free calcium (0 pM). The interaction between Syt I and IV is not reproducibly altered by changes in free calcium.


co-immunoprecipitates with anti-Syt II antibodies (Figure 3.6 B). Little Syt IV (5-10%)

is detected in the anti-Syt I immunoprecipitate (Figure 3.6 A).

We went on to determine whether this interaction, like the homo-oligomerisation of Syt

I, was dependent on the levels of free calcium. Immunoprécipitations from detergent-

solubilised cortical SSV were carried out using anti-Syt I in the presence of 1.5 mM

MgClz and 0 pM (EGTA) or 100 pM free calcium. The amounts of Syt II or Syt IV co-

immunoprecipitated were determined by SDS-PAGE and Western blotting using the

appropriate N-terminal antibodies (Figure 3.6 C). In the presence of calcium, the

proportion of Syt II present in the anti-Syt I immunoprecipitate increased while no

reproducible calcium-dependence was observed in the amount of Syt IV co-

immunoprecipitated and the levels of Syt IV recovered were low (between 5 and 12%

of the total).

The amount of Syt II co-immunoprecipitated by anti-Syt I increased in parallel with the

concentration of free calcium (Figure 3.7). The proportion of Syt II co-

immunoprecipitated was calculated as a percentage of the maximum recovery and

plotted against free calcium (Figure 3.7, lower panel). The concentration of calcium

triggering the half-maximal effect (EC50) is 6 ± 4 pM and maximal association between

Syt I and II occurs at concentrations >100 pM Ca^ , when more than 45% of Syt II is

associated with the Syt I immunoprecipitate. Together, these results suggest that, at

calcium concentrations experienced by an SSV during exocytosis (Aimers, 1994), a

significant proportion of Syt II may be in a complex with Syt I on the surface of the

vesicle. To demonstrate that Syt I and II can interact on the surface of intact SSVs, a

cross-linking strategy was attempted (not shown). SSVs were treated with cross-linking

agents in the presence and absence of calcium prior to solubilisation with OG and

immunoprécipitation with anti-Syt I antibodies. However, a number of problems were

108

EGTA

[Ca2+] (^M)

1 10 100 1000

P S P S P S P S P S

a n t i - S y t II

100 -

goo£E3E

iEo

40

2029 8 7 6 5 4 3

- lo g [Ca2+] (M)

Figure 3.7 Syt I and II oligomerisation is calcium-dependent. Purified rat brain cortical SSV (CPGn) were detergent-solubilised and anti-Syt 1 immunoprécipitations were caiTied out in the presence of EGTA/calcium buffers with free calcium concentrations ranging from 1 pM to 1 mM.The amount of Syt II associated was analysed by quantitative Western blotting (upper panel). The fraction of Syt II associated with the pellet (P) was expressed as a percentage of the total Syt II. Both the sum of the supernatant (S) and pellet (P) and the total input (T) were used as denominators in the calculation. The two values were compared and both were used to determine the EC50 of the calcium-dependence of Syt I/Syt II co- immunoprecipitation. The variability between the two calculation methods is included in the error bars in the lower panel. To compare different experiments, data were normalised (n=5) and mean values were plotted as a function of calcium concentration (lower panel). The EC50 of the interaction T " is 6±4 pM with the maximal association (^ 45%) being reached at calcium concentrations > 100 pM Ca2+.


experienced, which hampered the success of this approach. For example, Syt I and II

were mainly insoluble after treatment with cross-linking agent. Moreover, cross-linking

treatment caused a loss of immunoreactivity which resulted in a lack of

immunoprécipitation of the solubilised Syt. After trying a number of different

conditions and cross-linking agents with different lengths and chemical reactivities, this

strategy was abandoned.

3.2.5 Full-length Svnaptotagmin forms fi-mercaptoethanol insensitive oligomers

In all experiments using native Syt, a high molecular weight band of approximately 200

kDa can be detected by Western blotting with anti-Syt I (both the N-terminal and M48)

and anti-Syt II antibodies. This high molecular weight band is also immunoprecipitated

by Syt I and II antibodies. The ratio between Syt and the 200 kDa band varied from

experiment to experiment, but the band was always present even when samples were

heated to 100°C in the presence of strong reducing conditions (100 mM DTT). The

existence of B-mercaptoethanol insensitive Syt dimers has been described previously

(Perin et a l, 1991) and was attributed to a region of the protein just downstream of the

transmembrane domain that is predicted to have a high potential of forming an

amphipathic a-helix. Similarly, clustering of Syt in proteoliposomes has been described

(Bai et a l, 2000) although this was attributed to a cysteine dependent mechanism

involving residues 1-96 and therefore could not be responsible for the observed

phenomenon, as the oligomers do not dissociate in the presence reducing agents. To

investigate whether the high molecular weight band is composed only of oligomeric Syt

or is a stable complex of Syt with another protein(s), the pattern of peptides generated

by limited proteolysis of Syt and the high molecular weight band were compared using

the Cleveland method (Cleveland et al, 1977). If only synaptotagmin is present, the

110

175 ►

Figure 3.8 Syt forms SDS and reducing agent-insenstive oligomers. A Syt Iand II immunoreactive band of approximately 200 kDa (p200) can be detected in purified SSV, the amount of which varies from preparation to preparation. To determine whether p200 is an SDS and reducing agent-insensitive oligomer of Syt (p65) or a complex of Syt and another protein(s), the pattern of peptides were compared following limited proteolysis of the two bands with the protease V8. p65 and p200 were purified by immunoprécipitation from a salt washed bovine brain detergent extract using antibody M48 and SDS-PAGE. Proteins were excised and run on a 8-12% gradient gel in the presence or absence of V8 protease. The two input proteins (marked by asterisks) and the proteolytic fragments generated were visualised by silver staining. The pattern of peptides is equivalent for both p65 and p200, with the exception of a low abundance 25 kDa peptide that is only generated from p65 (arrow). Additionally, when p65 alone is run in the gel, p200 is visible and vice-versa. This suggests that p200 is an oligomeric form of Syt and that a dynamic equilibrium exists between these two forms of Syt.

Chapter 3________________________ Calcium-dependent oli2omerisation o f Svt I/II

pattern of peptides present should be identical in both cases. However, if another

protein(s) is present, a change is expected in the pattern of peptides generated.

Syt and the 200 kDa protein were purified from salt washed bovine brain detergent

extracts by immunoprécipitation with anti-Syt I (M48). The proteins were resolved by

SDS-PAGE and visualised by staining with Coomassie Blue. The appropriate bands

were excised and digested in a second gel using the Staphylococcus aureus protease V8,

and peptides generated were visualised by silver staining. As shown in Figure 3.8, the

patterns of peptides generated are identical for both bands with the exception of a single

peptide of 25 kDa present in the p65 but not in the p200 digest. The low abundance and

lack of focussing of this band prevented further analysis. However, as this putative

additional peptide is present in p65, it does not support the hypothesis that p200 is an

SDS-resistant complex of Syt and a different protein(s). Additionally, in control lanes

where the untreated Syt and 200 kDa bands were loaded directly in the second gel, both

bands are present (asterisks) suggesting that the 200 kDa band is comprised only of Syt

and also that a dynamic equilibrium exists between these monomeric and oligomeric

forms. Samples of the two proteins were also analysed by MALDI peptide sequencing.

The tryptic peptides originating from both bands all matched those expected for Syt

based on a theoretical digest of the protein. Whether such Syt oligomers exist on the

surface of the SSV or whether this oligomerisation is triggered by the detergent

solubilisation and/or the oxidising conditions present in vitro is unclear.

3.2.6 Calcium-dependent hetero-oligomerisation is a propertv of the cvtoplasmic

domains

Immunoprécipitation experiments using native synaptotagmins obtained from rat brain

cortical SSV demonstrate that Syt I and II interact and that this is moreover potentiated

112

Chapter 3________________________Calcium-dependent oligomerisation o f Svt I/ll

by calcium concentrations in the range that trigger neurotransmitter release.

Additionally, Syt I and II are found on the same SSV suggesting that this

oligomerisation has the potential to be physiologically relevant. As the SSV detergent

extracts contain other SSV proteins, we cannot conclude from these experiments that

Syt I and II are interacting directly. To demonstrate this, recombinant cytoplasmic

domains of Syt I and II (residues 95-421, Syt Icyto and residues 103-422, Syt Ilcyto) were

cloned, expressed in E. coli, purified and used for immunoprécipitation experiments,

similar to those carried out using the native proteins. Due to a lack of an antibody

recognising the cytoplasmic domain of Syt II, the recombinant protein was engineered

to include an HA tag at the N-terminal end of the protein to allow immunoprécipitation

and detection by Western blotting using a suitable anti-HA antibody. The calcium-

dependent homo-oligomerisation of Syt I involves interactions between the two C2B

domains, and it is expected that the hetero-oligomerisation of Syt I and II will occur via

the same regions. An N-terminal tag should therefore minimise any steric hindrance

during the immunoprécipitation. The two recombinant proteins have a slightly different

mobility in SDS-PAGE (Figure 3.9 inset; lanes A and B) which facilitates their

identification in Coomassie Blue stained gels.

Syt Ilcyto and HA-Syt Ilcyto were combined in the presence of Ca^^/EGTA buffers added

to obtain the desired free calcium concentration. HA-Syt Ilcyto was recovered with

immobilised HA-specific antibodies and the immunoprecipitate was analysed for the

presence of Syt Icyto by Coomassie Blue or Western blotting with antibody M48. Syt

Icyto is only immunoprecipitated in the presence of HA-Syt Ilcyto (Figure 3.9, compare

lanes C and D). The amount of Syt Icyto recovered is dependent on the free calcium

concentration, with an EC50 of 5 ± 3 pM (n=4), a value very similar to the one observed

with the native proteins ( 6 ± 4 pM, section 3.2.4). The addition of magnesium,

113

Mr100 -

6 6 1>B S SS'

gou£

4 5 >80-

3 1 >

E 60-3EXI 40-

2 5 0

20

(/)

9 8 7 6 3 25 4

- lo g [Ca2+] (M)

Figure 3.9 Co-immunoprecipitation of recombinant Syt 1 and II cytoplasmic domains. Recombinant Syt I and HA-tagged Syt II cytoplasmic domains (Syt I y and HA-Syt Ilcyto) ^^ re mixed and incubated in the presence of different free calcium concentrations after which, HA-Syt Ilcyto immunoprecipitated with anti-HA antibodies. Syt Icyto associated with the beads was analysed by densi- tometric analysis of Coomassie stained gels or quantitative Western blotting using antibody M48. Data were expressed as a percentage of the maximal Syt Icyto present in the HA-Syt 11 ^ immunoprecipitate. The calcium concentration where the interaction is half maximal is 5±3 pM (n=4) in the absence of Mg2+ (solid circles) and 9±5 pM (n=3) in the presence of Mg + (empty circles). The presence of 0.5 mM Mg2+ decreases the calcium-independent interaction of Syt I and II. Inset, Coomassie stained gel. A) Syt Icyto, B) HA-Syt Ilcyto, C) Syt Icyto immunoprecipitated with HA beads in the presence of HA-Syt Ilcyto and 100 pM calcium, D) Syt Icyto immunoprecipitated with HAbeads in the absence of HA-Syt Ilgy . Asterisks indicate the positions of the antibody heavy and light chains.


previously reported to alter the homo-dimerisation of Syt I (Sugita et a l, 1996), only

slightly shifts the EC50 towards higher calcium concentrations (9 ± 5 pM; n=3), but

instead is efficient in reducing the amount of calcium-independent binding between Syt

Icyto and Syt Ilcyto (Figure 3.9, open circles). These results demonstrate that the

recombinant cytoplasmic domain of Syt I and II are sufficient for calcium-dependent

hetero-oligomerisation and furthermore that they can mimic the behaviour of the native

proteins. A previous report demonstrating the dimérisation of Syt I found that one

native protein was required for efficient and calcium-dependent formation of dimers

(Chapman et a l, 1996). The reason for this discrepancy was not immediately clear, but

it has recently been published that the difference is a consequence of a single amino

acid variation at position 374 (Gly 374-Âsp) within the C2B domain (Desai et al,

2000).

3.2.7 Analvsis of calcium-dependent hetero-oligomerisation bv FRET

The phenomenon of Fluorescence Resonance Energy Transfer (FRET) has been used

successfully to monitor protein-protein interactions both in vitro and in vivo (Bastiaens

and Jovin, 1998; Selvin, 2000). Energy transfer occurs between a donor and an acceptor

fluorophore if they are sufficiently close (within 10 nm). In the case that the two

fluorophores are on different molecules, energy transfer can only occur if the proteins

are interacting with the correct spatial orientation. The donor fluorophore is excited at a

wavelength that does not excite the acceptor. FRET can be detected as a decrease in the

emission spectrum of the donor and results in emission from the acceptor fluorophore.

To measure FRET between Syt Icyto and Ilcyto, the donor-acceptor pair chosen were the

fluorescent dyes Cy3 (donor) and Cy5 (acceptor)^Figure 3.10 A). These two

fluorophores have been successfully used for FRET in the past (Bastiaens et a l, 1996).

Recombinant Syt Icyto and Syt Ilcyto were labelled with one or other of the dyes, with

115

540 nm

B

ACy3Cy5

Ex Em Ex Em100 —

80 —

M 6 0 -

40 —

O 20 —

400 500 600 700 800

wavelength (nm)

Productive

Syt I-CY5 Ca^*-dependentHeterodimerisation

S y t II-CY3

\ / /F R E T

S y t I-CY5 S y t II-CY3

Non-productive

Syt I-CY5

S y t II-CY3AI C 2 B

XT

Ca'+dependentHeterodimerisation

S y t I-CY5 S y t II-CY3

Figure 3.10 FRET can be used to detect protein-protein interactions in vitro.A) The fluorescent dyes, Cy3 and Cy5 are an ideal donor/acceptor pair for FRET. An excitation wavelength of 540 nm, selectively excites Cy3. If FRET occurs between the Cy3 and Cy5 fluorophores, there is a decrease in Cy3 fluorescence and an increase in Cy5 emission (sensitised emission). Energy transfer depends on the distance between the two fluorophores. B,C) Cy3 and Cy5 could potentially modify any of the lysines along the length of Syt I and II cytoplasmic domains. If the two fluorophores on interacting Syt I and II molecules are in the same region of the proteins, energy transfer can occur (a productive interaction, B). However, if the two fluorophores are at opposite ends of the interacting proteins, energy transfer cannot occur and the interaction is effectively invisible (an unproductive interaction, C).


conditions being optimised to give a dye:protein ratio of between 0.5 and 1.2. The N-

succinimidyl derivatives of Cy3 and Cy5 were used for the labelling which specifically

modify lysine residues. As there are multiple lysines within the cytoplasmic domains of

Syt I and II, the labelling should result in a random modification of the C2A and C2B

domains. As a result, interactions will only be detected between a fraction of the

labelled proteins (Figure 3.10 B, C).

Initially the emission spectrum of Syt IIcyto-Cy3 alone (donor) was measured between

550 nm and 750 nm in the presence of EGTA (Figure 3.11 A, dotted line). An excess of

Syt Icyto-Cy5 was then added and the emission spectrum of the Cy3 recorded in EGTA

and then in the presence of increasing amounts of free calcium (Figure 3.11 A, solid

lines). A decrease in the emission peak of the Cy3 is observed. This decrease is a result

of energy transfer between the Cy3 and Cy5. Ideally, you expect to see an increase in

the acceptor fluorescence in parallel with the decrease in donor fluorescence. However

in our experiments we always detected a decrease in the acceptor emission spectrum.

This decrease could be attributed to shielding of the Cy5 fluorescence upon

oligomerisation. Syt Icyto-Cy5 is only slightly excited in the absence of Syt IIcyto-Cy3

and a similar calcium-dependent internal quenching of this fluorescence is also visible

with increasing calcium (Figure 3.11 B).

To exclude quenching effects due to the direct interaction of the added protein with the

donor dye Cy3, the same experiment was performed with Cy3-Syt Ilcyto alone (Figure

3.11 D) or by adding unlabelled Syt Icyto (Figure 3.11 C). In both these samples, the

addition of calcium caused a decrease in the fluorescence emission of Cy3-Syt Ilcyto,

although to a lesser extent than in the presence of the Cy5-Syt Icyto acceptor (Figure 3.11

A). The FRET efficiency ( E f ) of the oligomerisation was therefore calculated using the

117

ACy3-Syt IUyt</Cy5-Syt Uyto3 0 0 0 0 -

2 5 0 0 0

20000 -

3 1 5 0 0 0 - Js10000-1

5 0 0 0 -

5 5 0 6 0 0 6 5 0 7 0 0 7 5 0

BCyS-Syt Icyto

6 5 0 7 0 0

wavelength (nm)

c 3 5 0 0 0Cy3-Syt licyt</Syt 1^*

3 0 0 0 0

2 5 0 0 0

^ 20000 3

S 1 5 0 0 0UL

10000

5 0 0 0

6 0 05 5 0 6 5 0 7 0 0 7 5 0

D

5 5 0 6 0 0

wavelength (nm)

Figure 3.11 FRET measurement of the calcium-dependent oligomerisation ofSyt and Syt Ilcyto* Fluorescence emission following excitation at 540 nm of 0.1 pM Syt IIgy Q-Cy3 was monitored between 550 and 750 nm in the absence of calcium (dotted line). Measurements were repeated after the addition of 0.5 pM Syt Içyto-Cy3 (A), unlabelled Syt (C) or buffer alone (D) in the presence of increasing free calcium concentrations (continuous lines, from the top: ^1 nM (2 mM EGTA), 0.1 mM, 0.49 mM, 0.99 mM, 3.86 mM free calcium). The effects of calcium concentration on Cy5-Syt alone (B) and on Cy3-Syt alone (D) were determined in a similar way (from the top: ^1 nM (2 mM EGTA), 0.1 mM, 0.49 mM, 0.99 mM free calcium).


emission peak of the donor, where an efficient control for the FRET-independent

quenching of the fluorophore is available. The average Cy3 fluorescence quenching in

the range 560-590 nm was normalised for the maximum emission wavelength (X=570

nm) and the data was expressed as the FRET efficiency versus the calcium

concentration, where Ef = 1-Rp’, Rp’ being the ratio between the fluorescence measured

in the presence of FRET acceptor and in its absence (Bastiaens and Jovin, 1998; Figure

3.12).

In the presence of Cy5-Syt Icyto there is a significant decrease (Ep = 0.05) in emitted Cy3

fluorescence in even at free calcium concentrations < 1 nM (2 mM EGTA). This basal

interaction is consistent with the calcium-independent Syt I/Syt II association observed

in the immunoprécipitation experiments performed with both the native and

recombinant synaptotagmins (see Figure 3.7 and 3.9). FRET efficiency increases in

parallel with the concentration of free calcium, reaching a maximum between 250 pM

and 500 pM free calcium (Figure 3.12) with an EC50 of 140 ± 80 pM (n=5).

The EC50 of the interaction between the recombinant cytoplasmic domains of Syt I and

II, as determined by FRET, is an order of magnitude higher than that obtained by co-

immunoprecipitation of both the recombinant, cytoplasmic and the native, full length

proteins. One possible explanation for this is that there are a large number lysine

residues throughout the C2A and C2B domains and modification of these by Cy3 and

Cy5 might alter the binding properties of Syt, which could explain the shift towards

higher calcium concentrations. In fact, it has been demonstrated by mutational analysis

that two adjacent conserved lysines within the C2B domain of Syt I are required for

binding to Ins?4 , AP-2 and for calcium-dependent homo-oligomerisation (Chapman et

al, 1998). Another drawback is that FRET only occurs between donor and acceptor

119

0 .3-1

0.25-

0.2-u.

LU 0.15-

0.1 -

0.05-

0-

-zy-

i

I. ^ Cy3-Syt Ilcyto/ Cy5-Syt Icyto■ F = ' " F '

^ Cy3-Syt I Icyto/Syt IcytoI / /T

0.25 0.5 0.75 1

[Ca"+] (m M )

1.25 4.0

Figure 3.12 Efficiency of energy transfer between Cy3-Syt Ilcyto and CyS-Syt Icyto* The average Cy3 fluorescence between 560 and 590 nm was normalised for the maximum fluorescence intensity at 570 nm to allow different experiments to be compared. Data were expressed as FRET efficiency (Ep) versus calcium concentration. Ep= 1-Rp’ where Rp. is ratio of the Cy3 fluorescence in the presence and absence of the acceptor. The EC50 of the calcium-dependence of the Syt Icytc/Syt Ilcyto interaction is 140 ± 80 pM (n = 5).

Chapter 3________________________ Calcium-dependent oligomerisation ofSvt I/II

fluorophores that are sufficiently close and as a consequence, only a fraction of the Syt

interactions would be visible, either because there is no dye molecule or because the dye

molecules are on distant parts of the interacting proteins (Figure 3.10 C).

To try and overcome these limitations, recombinant proteins were generated where the

Syt I/II cytoplasmic domains were fused to ECFP and EYFP, two GFP variants that can

be used as a donor and acceptor pair for FRET (Overton and Blumer, 2000). N-terminal

fusion chimeras were designed to minimise steric hindrance from the bulky GFP

moieties. Unfortunately, these constructs were insoluble when expressed in bacteria. An

HA tag was introduced between the GFP and Syt as a spacer to try and promote correct

folding and these constructs were in fact more soluble. However, the recombinant

proteins bound poorly to GSH beads and what did bind could not be released by

thrombin cleavage. There were no obvious reasons for this lack of solubility.

Microsequencing of the constructs did not reveal any mutations or deletions, the GFP

moiety was able to fold correctly as all constructs in the bacterial extract were

fluorescent and Syt I could be detected at the correct molecular weight by Western

blotting with antibody M48. A possible explanation is that the fusion protein was

folding in such a way that the glutathione binding site of GST was shielded, thus

impairing its binding to the GSH beads. This approach was shelved and a new strategy

adopted, using FRET to detect interactions between ECFP/EYFP-Syt I/II in living cells.

3.2.8 Measuring Svt oligomerisation in PCI2 cells

Fluorescence Resonance Energy Transfer can be exploited for the measurement of

protein-protein interactions in living cells using the technique of Fluorescence Lifetime

Imaging Microscopy (FLIM; Bastiaens and Squire, 1999). To examine the interaction

between Syt I and II, constructs were made consisting of full-length Syt I and II fused to

121

457 nm

ECFPEYFPEm Ex Em

^ 1 0 0 -1

8 0 -

6 0 -

4 0 -

2 0 -

LL

400 500 600wavelength (nm)

B

Syt I

ssv

Ca^‘*^-dependentHeterodlmerisation

Syt I

Syt II

Figure 3.13 Protein-protein interactions can be detected in vivo using FRET. The two GFP variants, ECFP and EYFP have overlapping émission- absorption spectra and as such make an ideal donor-acceptor pair for FRET(A). Full-length Syt I and II fused to either ECFP or EYFP may be used to detect Syt oligomerisation in cells (B). Oligomerisation of Syt I and II in the presence of calcium would bring the two fluorophores close enough for energy transfer to occur. In this case, all interactions between the fusion proteins will be productive as all the molecules are modified at the same site, the intralumenal N-terminus.


the two GFP variants, ECFP and EYFP (Figure 3.13). Full length Syt I and II were

cloned from a rat brain cDNA library using primers based on the published sequences

and including Xho I and Hind III restriction sites so the sequences could be cloned into

the pECFP-Cl and pEYFP-Cl mammalian expression vectors. N-terminal, intra-

vesicular fusions were chosen to minimise any interference with the normal functions of

the protein, in particular the calcium-dependent oligomerisation mediated by the C2B

domain.

Rat pheochromocytoma (PC 12) cells were chosen as the model system. These cells

differentiate to a neuron-like phenotype on exposure to NGF and can also be transfected

using standard protocols. Syt I is present endogenously in catecholamine-containing

dense core secretory vesicles and acetylcholine-containing synaptic-like microvesicles

in the neurites of NGF-differentiated PC 12 cells. Preliminary experiments to determine

the presence of Syt I and Syt II in our PC 12 clone demonstrated that while Syt I is

constitutively expressed (Figure 3.14 A, E), Syt II cannot be detected in either

undifferentiated or NGF-differentiated cells (Figure 3.14 D, G).

To assess whether the recombinant proteins have the same distribution as endogenous

Syt I, undifferentiated PC 12 cells were transiently transfected with either the full-length

Syt I-EYFP or the Syt II-EYFP construct and left for 48 hours to allow expression of

the fusion proteins, in NGF-containing or normal growth medium, prior to fixation. In

both undifferentiated and NGF-differentiated cells, the ECFP/EYFP fluorescence

appears to be localised to punctate structures within the cell body (Figure 3.15 A-D).

Several bright, larger structures are sometimes visible in the cell body that are

reminiscent of lysosomes (Figure 3.15 A).

123

VAMP2 merge

merge

M r ,!.< ■ J ' J '(x103)

O' cT <r <r1751

83

62 ■Syt II

anti-Syt II

Figure 3.14 PC12 cells difTerentiate to a neuronal-like phenotype in the presence of NGF. Syt I immunostaining, co-localises with that of VAMP-2, a marker of secretory granules and synaptic-like microvesicles, in punctate structures both in the cell body and NGF-induced processes (A-C). PC 12 cells do not contain Syt II by immunofluorescence (D-F). Images are projections of a series of 0.4 pm confocal z-sections. Secondary antibodies used were Alexa 488 (green) or Texas Red (red) conjugated. G) To confirm the absence of Syt II, whole-cell extracts of PC 12 cells before and after NGF treatment (approximately 50 pg of each) were analysed by SDS-PAGE and Western blotting for the presence of Syt II. Samples of cortical (CTX) and cerebellar (CBM) crude synaptic vesicles (30 pg) were used as positive controls. Our clone of PC 12 cells does not contain detectable amounts of Syt II. The position of the high molecular weight SDS-resistant Syt oligomer is marked by the asterisk.

P C 1 2- N G F

EYFP-Syt I ECFP-Syt

P C 1 2 + N G F

ECFP-Syt 11/ EYFP-Syt IEYFP-Syt I

Figure 3.15 Recombinant Syt I and II are targeted to vesicular structures in PC12 cells. Undifferentiated (-NGF) or differentiated (+NGF) PCI2 cells, were transiently transfected with either ECFP-Syt II, EYFP-Syt I or both. Both ECFP-Syt II (A) and EYFP-Syt I (B) fluorescence localises to vesicular structures throughout the cell in undifferentiated PC 12 cells. Occasionally larger, intensely fluorescent structures were visible in the cell bodies (empty arrowheads; A) that are reminiscent of lysosomes. In the presence of NGF, fluorescence is associated with vesicular structures in the cell body and in neurite-like processes (filled arrowheads; C, D). Images A, B were acquired with a CCD camera-equipped Zeiss microscope. C, D are projections of a series of 0.4 pm confocal z-sections. Bars= 10 pM (A, B, D) or 5 pM (C).


Syt I-EYFP expressing cells were fixed following a 90 min incubation with

cycloheximide to inhibit protein synthesis and immunostained with either anti-Syt 1 or

anti-VAMP-2, as a marker of secretory granules and synaptic-like vesicles, using Texas

Red conjugated secondary antibodies. As expected, the majority of Syt 1-EYFP

fluorescence co-localised with anti-Syt 1 immunostaining (Figure 3.16 A-C), while a

substantial but incomplete co-localisation was observed with VAMP-2 (Figure 3.16 D-

F), as expected based on the wider distribution of this SNARE protein. In contrast, in

cells transfected with the pEYFP-Cl vector alone, the EYFP fluorescence distributes

diffusely throughout the cell, including in the nucleus and does not co-localise with

endogenous Syt 1 ( Figure 3.16 G-1).

Co-transfection studies were performed with ECFP-Syt 11 and EYFP-Syt 1 and the

NGF-differentiated transfected cells were used for FLIM. Immediately prior to imaging,

the NGF-containing growth medium was exchanged for a pre-warmed high NaVlow

buffer. Cells expressing adequate levels of ECFP and/or EYFP were chosen for imaging

(Figure 3.17, top panels) and an initial lifetime series were taken using an excitation

wavelength of 457 nm. The medium was then exchanged for pre-warmed low Na" /high

depolarisation medium to stimulate exocytosis. A second lifetime series was taken of

the same cells after buffer exchange. Lifetimes for the phase ( x p ) and modulation ( x m )

were calculated for each pixel in the image (Squire and Bastiaens, 1999) and averaged

to produce the lifetime maps shown in Figure 3.17, middle panels. The x? and Xm two-

dimensional histograms show that there was no shift in donor lifetimes following

depolarisation, in the presence or absence of acceptor (Figure 3.17, lower panels) i.e. no

FRET could be detected between ECFP-Syt 11 and EYFP-Syt 1.

126

EYFP-Syt m erge

EYFP-Syt I VAMP2 m erge

m erge

Figure 3.16 EYFP-Syt I distribution in NGF-differentiated PC12 cells. PC 12cells were transiently transfected with EYFP-Syt I or EYFP and differentiated with NGF for 48 h post-transfection. EYFP-Syt I fluorescence is present in the processes of NGF-differentiated PC 12 cells and co-localises with Syt 1 immunostaining (A- C) and the vesicular marker VAMP-2, although not completely (D-F) as expected considering the wider distribution of this vesicular SNARE protein. PC 12 cells transfected with EYFP alone were fluorescent throughout the cell bodies, processes and the nucleus (G). The fluorescence was diffuse compared to the more punctate fluorescence in the EYFP-Syt I transfected cells (A, D) and compared to endogenous Syt 1 (H ). In each case, a Texas Red-conjugated secondary antibody was used. Images are projections of a series of 0.4 pm confocal z-sections.

ECFP-Syt II B ECFP-Syt II EYFP-Syt I

l if e t im e s pre-KCI

Tp(ns)

Tp= 2.03+/- 0.25 Tm = 2.26+/- 0.20

l if e t im e s post-K C I

Tp (ns)

Tp = 2.05+/-0.24Tm = 2.26+/- 0.20

lif e t im e s pre-KCI lif e t im e s post-K C I

Tp(ns)

T p = 1.84+/-0.17 Tm= 2.21+/-0.15

Tp(ns)

T p = 1.85+/-0.16 Tm = 2.25+/-0.14

Figure 3.17 Fluorescence Lifetime Imaging Microscopy of transiently tranfected PC12 cells. NGF- differentiated PC 12 cells were transiently transfected with ECFP-Syt II (A) or ECFP-Syt II and EYFP-Syt I(B). Fluorescence images from the donor (ECFP-Syt 11) and acceptor (EYFP-Syt I) are shown in the top panels. Lifetime series were taken of expressing cells in high Na+/low K+ buffer. The buffer was exchanged for a calcium-containing low Na+/high K+ depolarisation buffer and a second lifetime series of the same cell was acquired. Average lifetimes (t, the average of Tp and T^) were calculated for every pixel in the image (middle panels). ECFP lifetimes are very heterogeneous, even in the absence of acceptor. There is no significant change in the lifetimes before and after depolarisation in either case, illustrated by the 2D histograms (lower panels) which show the donor lifetimes for both the phase (Xp) and the modulation (Tm).


However, we cannot conclude from this that Syt I and II do not interact in living cells as

there were a number of technical drawbacks encountered. Firstly, the low quantal yield

of ECFP combined with the comparatively low sensitivity of the microscope to ECFP

fluorescence meant that only cells greatly over-expressing Syt II-ECFP were suitable

for imaging and that long exposure times had to be used. This low sensitivity posed a

significant problem as the neurites, our region of interest, were very hard to visualise

above the background, even in conditions of high over-expression. Additionally, long

exposure times might not be suitable for detecting the rapid association and dissociation

of Syt molecules anticipated to occur during exocytosis and can cause phototoxicity in

cells. Secondly, the lifetimes of the ECFP in the absence of acceptor were very

heterogeneous and lower than expected (Figure 3.17). The reasons behind this

heterogeneity are not clear at the moment. Thirdly, the substitution of the low K^/high

Na^ buffer with the high KVIow Na^ depolarisation medium caused the cells to round

up within seconds. This was particularly evident with Transfast transfected compared to

micro injected cells. The change in shape between one frame and the next means that the

lifetimes cannot be correlated as the pixels do not correspond within the series.

FLIM experiments were also performed on microinjected NGF-differentiated PC12

cells co-expressing Syt I-ECFP and Syt I-EYFP. This was done both to demonstrate the

suitability of the technique in our system using the well-established homo

oligomerisation of Syt I as a positive control (Chapman et al, 1996; Sugita et al, 1996)

and to rule out any adverse effects from over-expressing Syt II as it does not appear to

be expressed endogenously in these cells. However, there was still the problem that the

ECFP lifetimes were very heterogeneous and lower than expected in the absence of

acceptor (not shown). Due to these methodological problems, no conclusions can be

drawn about the interactions of Syt I and II in NGF-differentiated PC 12 cells. Improved

129

Chapter S________________________Calcium-dependent olisomerisation o f Svt I/II

optics, more efficient lasers for ECFP excitation to allow shorter acquisition times and

more physiological stimulation conditions will provide more suitable experimental

conditions for testing our hypothesis in the future. Although we have not been able to

demonstrate an interaction between Syt I and II in living cells, we have demonstrated,

using two different techniques (immunoprécipitation and FRET) that Syt I and II

oligomerise in the presence of calcium. This interaction is direct and is a property of the

cytoplasmic recombinant proteins, although it appears to be facilitated by

immobilisation at the N-terminus (in the immunoprécipitation experiments), as would

occur in the SSV membrane. Furthermore, Syt I and II are present on the same SSV

suggesting that the calcium-dependent oligomerisation is a physiologically relevant

interaction for SSV exocytosis.

130

Chapter 4: Synaptotagmin

oligomerisation discussion

131

Synaptotagmin oligomerisation discussion

4.1 Introduction

Syt I and II are the favoured candidates for calcium sensor in neuroexocytosis based on

genetic, electrophysiological and biochemical data (Schiavo et a l , 1998).

Synaptotagmins are a large family of proteins, members of which differ in their

expression patterns and calcium-dependent binding properties. Syt IV and XI, for

example, lack one of the calcium binding aspartates in the C2A domain required for the

calcium-dependent binding to phospholipids (von Poser et al, 1997). Genetic evidence

from complementation of Syt mutant alleles in Drosophila points to Syt acting as a

multimer in neurotransmitter release (Littleton et al, 1994). Consistent with this, Syt I

is able to oligomerise via the C2B domain in the presence of calcium (Chapman et a l ,

1996; Sugita et al, 1996). The importance of the C2B is highlighted by the profound

deficit in synaptic transmission is Drosophila ADI mutants which lack the C2B of Syt I

(DiAntonio and Schwarz, 1994; Littleton et al, 2001).

If Syt multimers are the functional unit during neurotransmitter release, one could

envisage that the association of Syt isoforms with different calcium-dependent features,

for example binding to phospholipids, could create a variety of calcium sensors each

with a unique calcium sensitivity. This combinatorial hypothesis predicts that the

repertoire of synaptotagmins present on the SSV surface will determine, to some extent

at least, the probability of a single SSV exocytic event. Differential expression of Syt

isoforms could thus contribute to the heterogeneities in release probabilities observed at

different synapses, for different vesicles within a given nerve terminal and the

alterations in release probability that occur as a result of long term potentiation and

depression (Kasai, 1999; Thomson, 2000). The results presented in Chapters 3

demonstrate that not only can different synaptotagmin isoforms be found on the same

synaptic vesicle, they also have the potential to interact in a calcium-dependent manner.

132

Synaptotagmin olisomerisation discussion

The implications of these results and the related work of other laboratories will be

discussed in the context of the above hypotheses.

4.2 Different populations of SSV can be distinguished by their complement of Syt

isoforms

Different Syt isoforms have different patterns of expression in the brain. Syt I and II

have distinct but overlapping patterns of expression, with Syt I expressed mainly in

caudal and Syt II mainly in rostral areas of the brain (Geppert et al, 1991). In contrast,

Syt IV mRNA is present at high levels during brain development and subsequently at

low levels uniformly throughout the brain (Berton et al, 1997). We have demonstrated

that Syt I and II and Syt I and IV can be found on the same SSV by immunoisolating

intact SSV. Syt I and II containing SSV were also visualised by immuno-electron

microscopy. Two thirds of cortical Syt II is found on Syt I containing vesicles,

compared to around half the cortical Syt IV. This suggests that different populations of

Syt I-containing vesicles exist. The existence of biochemically distinct populations of

SSV has been described previously (Thoidis et a l, 1998). Both of these populations

contained Syt I and it would be interesting to determine whether these two populations

differ in their complement of other Syt isoforms.

Recent work by other groups using a similar immunoisolation approach has also

demonstrated that Syt I and IV are present on the same SSV in Drosophila (Littleton et

a l, 1999) and in PC 12 cells stimulated by KCl depolarisation or with forskolin

(Ferguson et al, 1999; Thomas et al, 1999b). Other groups however have reported that

Syt I and IV have distinct sub-cellular distributions by immunofluorescence in PCI2

cells and cultured hippocampal neurons (Ibata et a l , 2000; Berton et a l , 2000) and by

sub-cellular fractionation when Syt IV was not found in a synaptic vesicle enriched

133


fraction isolated from 6 day old rat brains (Berton et al, 2000). These discrepancies

could reflect differences in the systems used such as the ages of the animals, the PC 12

subclones or the differentiation state of the neuronal cultures used as well as differences

in the molecular tools used. A more systematic study of the localisation of Syt IV in

different systems, developmental stages and conditions is required before this issue can

be resolved.

4.3 Calcium-dependent hetero-oligomerisation of native and recombinant Syt I

and II

Syt I homo-oligomerises in the presence of calcium (Chapman et al, 1996; Sugita et al,

1996). In view of the co-localisation of Syt I and II on the same SSV, we investigated

whether these two isoforms are able to interact in the same way. Using

immunoprécipitation and FRET, we found that both native, full-length Syt I and II and

their recombinant cytoplasmic domains (Syt Icyto and Syt Ilcyto) are able to hetero-

oligomerise and in both cases this interaction is promoted calcium. The half-maximal

interaction between native Syt I and II (EC50) occurs at calcium concentrations ranging

between 2 and 10 pM. This value is compatible with the reported EC50 for Syt I

homodimerisation of between 3 and 10 pM (Chapman et al, 1996). The maximal

association between Syt I and II occurs at calcium concentrations >100 pM, when more

than 45% of cortical Syt II is associated with Syt I. An earlier study demonstrated that

native Syt I was able to bind to immobilised recombinant Syt II C2B although in that

case, half maximal binding was observed in the presence of 250 pM free calcium

(Sugita et al, 1996). The value was suggested by the authors as being artificially high

due to the high magnesium concentrations used (3.5 mM) although the calcium-

dependence was not investigated at lower levels of magnesium.

134


Although the interaction between Syt Icyto and Ilcyto was shown to be calcium-dependent

by immunoprécipitation and FRET, the EC50 values differed by more than an order of

magnitude. In the immunoprécipitation experiments, half maximal interaction occurred

at calcium concentrations of 9 ± 5 pM in the presence of physiological concentrations

of magnesium, which compares well to the EC50 of 6 ± 4 pM for the native proteins.

However, in FRET experiments, calcium concentrations of 140 ± 80 pM were required.

These discrepancies could reflect differences in the experimental procedures. In the case

of FRET, the cytoplasmic domains interact in solution at all times, whereas in the

immunoprécipitation, although the initial incubation is carried out with cytoplasmic Syt

I and II, Syt II is subsequently immobilised on beads via the anti-HA antibody, resulting

in an increase in its effective concentration. In support of this, the immobilisation of

recombinant tagged Syt isoforms at the N-terminus has, with the exception of Syt VII,

been shown to be required for oligomerisation (Fukuda and Mikoshiba, 2000b).

An observation that could be related to this, is the finding that Syt can form stable SDS-

and reducing agent-insensitive oligomers (Figure 3.8; Perin et al, 1991; Schiavo et al,

1996). The formation of calcium-independent oligomers has been attributed to a region

in the very N-terminus between residues 1-92 that clusters via the formation of non-

covalent bonds (Brose et a l , 1992; Bai et a l, 2000). The calcium-independent

interaction via regions N-terminal to the two C2 domains could thus act as a tether to

hold Syt molecules together on the surface of the SSV, facilitating the C2B-mediated

oligomerisation triggered by calcium influx. The N-terminal mediated clustering of Syt

could explain the relatively high levels of interaction observed in the absence of calcium

between the native versus the cytoplasmic domains of Syt I and II.

An alternative explanation for the observed differences in the calcium-dependence of

135


oligomerisation could, as mentioned in Chapter 3.2.7, be that the shift in calcium-

dependence is a consequence of the modifications with the Cy3 and Cy5. The dyes

covalently bind to free amino groups in lysine and arginine residues. Syt is rich in

lysines and in particular, two lysines within the C2B domain have been shown to be

essential for AP-2 and Ins? 4 binding and calcium-dependent oligomerisation (Fukuda et

al, 1995a; Chapman et al, 1998; Desai et al, 2000). Modification of these residues

may thus be expected to alter or even prevent calcium-dependent oligomerisation.

Similarly, modification of other lysines with bulky and hydrophobic fluorophores may

interfere sterically with the oligomerisation process.

Our finding that Syt Icyto and Syt Ilcyto hetero-oligomerise in the presence of calcium is

contrary to a previous report that Syt I homo-oligomerisation cannot occur between two

recombinant cytoplasmic domains but only between a recombinant and a native Syt I

(Chapman et al, 1996). This discrepancy has since been traced to a difference in the

sequences of the recombinant proteins used. Our clone of Syt I differs at three positions

from the clone used by Chapman and collaborators. These amino acid substitutions (Glu

188 for Asp, Gly 374 for Asp and He 393 for Met), generated by single nucleotide

changes, were initially ascribed to differences in the strain of rat used for the cloning

(Osborne et al, 1999). However, the Gly 374 for Asp substitution has been confirmed

independently and it is the presence of an aspartate at this position that prevents the

calcium-dependent oligomerisation of recombinant Syt la (Desai et al, 2000). Both Syt

la (Asp 374) and Syt Ib (Gly 374) have been identified in the same rat brain cDNA

library, although the origin of this difference is not clear as the genomic sequence of the

rat Syt I has not been reported (Desai et al, 2000). Whether Syt la and Ib differ in other

C2B-dependent interactions in vitro, for example with Pis (Schiavo et al, 1996) and

calcium channels (Leveque et al, 1994; Sheng et al, 1997; Kim and Catterall, 1997) or

136


in their distributions, regulation and function in vivo remains to be determined.

4.4 Calcium-dependent oligomerisation of Syt I and IV?

In contrast to the robust hetero-oligomerisation of native Syt I and II in the presence of

calcium, we were unable to detect any calcium-dependent interaction between native

Syt I and IV. Only minimal amounts of Syt IV are associated with Syt I (around 5%) in

low calcium and no significant and reproducible increase is detected at calcium

concentrations where the maximal Syt I/II interaction is observed (between 5 and 12%

of Syt IV associates with Syt I at calcium concentrations of 100 pM or more). However,

other groups have found that Syt I and IV do hetero-oligomerise in the presence of

calcium using a combination of native and recombinant proteins (Chapman et al, 1998;

Littleton et al, 1999; Thomas et al, 1999b). In our system, multiple Syt isoforms are

present in the SSV detergent extracts. As Syt IV levels are low in the cortex,

oligomerisation would occur preferentially between the more abundant isoforms, such

as Syt I and II and any calcium-dependent oligomerisation between Syt I and IV would

therefore be difficult to detect. The lack of calcium-dependent Syt I/IV oligomerisation

in our system does not therefore rule out the occurrence of such an interaction on the

surface of the SSV.

4.5 Calcium-dependent oligomerisation is required for exocytosis

Evidence has been accumulating that multiple Syt isoforms have the potential to

oligomerise and moreover that the formation of Syt oligomers is essential for its

function as calcium sensor in neurotransmitter release (Chapman et al, 1998; Osborne

et al, 1999; Littleton et al, 1999; Fukuda and Mikoshiba, 2000b; Littleton et al, 2000;

Littleton et a l , 2001). Insight into a possible link between calcium-dependent

oligomerisation and membrane fusion has come from the study of Syt mutants with

137


decreased abilities to oligomerise. Consistent with a critical role for calcium-dependent

oligomerisation in membrane fusion, oligomerisation competent Syt I cytoplasmic

domain inhibits exocytosis in permeabilised PCI2 cells while a non-oligomerising form

(K326,327A mutant) has no effect (Desai et al, 2000). However, this mutant Syt shows

deficiencies in other C2B effector functions, including AP-2 and InsP4 binding (Fukuda

et al, 1995a; Chapman et al, 1998), complicating the interpretation. In Drosophila

AD3 mutants, the change of a tyrosine to an asparagine in the C2B inhibits

neurotransmitter release at a post-docking step (DiAntonio and Schwarz, 1994; Littleton

et al, 2001). Recombinant Syt engineered with the AD3 mutation is impaired in its

ability to oligomerise in the presence of calcium although it can still bind calcium-

channels, AP-2 and InsP4 (Fukuda et al, 2000; Littleton et al, 2001) suggesting that it

is the oligomerisation itself that is required for fusion.

4.6 Hetero-oligomerisation alters calcium-dependent exocytosis

There is also evidence that alterations in the relative levels of Syt I and IV can influence

the probability of calcium-dependent exocytosis and that this is a consequence of

changes in the composition of Syt oligomers. Syt IV can not only hetero-oligomerise

with Syt I but also reduces the ability of Syt I to penetrate lipid bilayers (Littleton et a l ,

1999). Furthermore the up-regulation of Syt IV, but not Syt I, in Drosophila decreases

evoked neurotransmission suggesting that Syt I/IV hetero-oligomers are less efficient at

coupling Ca^ influx to secretion in vivo (Littleton et al, 1999). Altering the calcium-

dependent membrane binding properties of Syt oligomers may not be the only way of

altering the calcium-sensitivity of the release machinery, as it has been shown that Syt

IV, unlike Syt I and II, is unable to bind the BI isoform of the «1a subunit of P/Q-type

calcium channels (Charvin et a l , 1997). The trapping of Syt I in binding-incompetent

complexes could disrupt the Syt-calcium channel interaction and thereby greatly reduce

138

Synaptotagmin oIi2omerisation discussion

the efficiency of excitation-secretion coupling.

The study of the biogenesis of regulated secretory vesicles has provided further

evidence that Syt IV and/or Syt I/IV oligomers are able to negatively regulate calcium-

dependent secretion (Eaton et al, 2000). Secretory granules undergo a conversion from

an immature, constitutive to a mature, regulated exocytic state. While both immature

and mature secretory granules contain Syt I, the removal of Syt IV correlates with this

maturation process. In addition, over-expression of Syt IV reduces the stimulus-

responsiveness of maturing granules (Eaton et a l , 2000), suggesting that Syt IV acts as

a dominant negative for Syt I function.

Alterations in the ratios of Syt I and IV, and perhaps other isoforms, could also be

important for the modulation of synaptic efficacy underlying certain forms of learning

and memory. Syt IV mRNA is up-regulated in an activity-dependent manner in PC 12

cells and in the hippocampus (Vician et al, 1995). PKA is involved in the activation of

certain genes important in the development and maintenance of learning and memory

via phosphorylation of the cAMP responsive element binding protein (CREB). The

activity-dependent up-regulation of Syt IV appears to occur via a PKA dependent

pathway in PCI2 cells (Ferguson et al, 1999; Ibata et al, 2000) and a consensus cAMP

responsive element has been reported in the promoter of Syt IV (Ferguson et a l , 1999).

Furthermore, Syt IV knock-out mice are deficient in hippocampal-dependent learning

and memory (Ferguson et al, 2000).

4.7 Phosphoinositides, Syt oligomerisation and exocytosis

Calcium-dependent secretion from large dense core vesicles is preceded by an essential

ATP-dependent priming step, with at least part of this ATP being required for the

139


synthesis of PtdIns(4,5)P2 (Hay et al., 1995). While the C2A domain of Syt I is a

‘classic’ C2 domain in its ability to bind phospholipids in the presence of calcium (Perin

et al, 1990; Davletov and Siidhof, 1993), the C2B is somewhat unusual as it only

interacts poorly with phospholipids but binds phosphoinositides to a much greater

extent in a calcium-dependent manner (Schiavo et al, 1996). Syt binds PtdIns(4,5)Pz at

calcium concentrations required for neurotransmitter release and furthermore, inositol

polyphosphates, that act as competitive inhibitors of phosphoinositides, are able to

inhibit neurotransmitter release by binding to Syt C2B (Fukuda et al, 1995b; Mochida

et a l, 1997), both suggesting that an interaction between Syt and PtdIns(4,5)P2 is

important for the calcium-dependent exocytosis of SSV. Such an interaction has been

suggested to function in maintaining the SV and the pre-synaptic membranes in close

apposition prior to fusion (Schiavo et al, 1996).

The C2A domain of Syt is able to simultaneously bind SNARE complexes and

phospholipid bilayers in a calcium-dependent manner (Davis et al, 1999) and one could

envisage that, in an analogous way, the C2B domain could simultaneously oligomerise

and bind PtdIns(4,5)P2. However, unlike the C2A domain where different regions

mediate calcium-dependent binding to SNAREs and phospholipids (Sutton et al, 1999;

Chapman and Davis, 1998), a common region of the C2B is required for IPP binding

and oligomerisation (Fukuda et al, 1994; Chapman et al, 1998) indicating that these

interactions may in fact be mutually exclusive and function at different stages of the

exocytic process. In fact, IPPs not only act as competitors for Syt-PtdIns(4,5)P2 binding

(Schiavo et al, 1996) but also inhibit the oligomerisation of Syt II (Fukuda et al, 2000).

Thus the ability of IPPs to inhibit neurotransmitter release could result either from their

preventing Syt oligomerisation or PtdIns(4,5)P2 binding or both. Moreover, Syt binding

to calcium channels also requires the oligomerisation/IPP binding region (Chapman et

140

Synaptotagmin oli2omerisation discussion

al, 1998). Accordingly, IPPs are able to block the interaction between Syt and N-type

calcium channels (Tobi et al, 1998). Finally, peptides corresponding to the synaptic

protein interaction site (synprint) of N-type calcium channels, that inhibit

neurotransmitter release (Mochida et al, 1996; Rettig et al, 1997) also interfere with

Syt oligomerisation (Chapman et al, 1998). Studies investigating the ability of Syt to

oligomerise and/or bind calcium channels in the presence of PtdIns(4,5)P2-containing

liposomes and the relative affinities of these interactions at different calcium

concentrations may help shed light on the relevance of the Syt-PtdIns(4,5)P2 interaction

for neurotransmitter release, as will the use of Syt C2B mutants, such as the AD3

mutant, wdth selective defects in only one of the C2B-effector interactions.

Importantly, the site of PtdIns(4,5)P2 synthesis required for exocytosis remains to be

determined. While Ptdlns 4-kinase activity associates with the secretory vesicles

(Wiedemann et a l, 1996; Wiedemann et al, 1998), PtdIns(4)P 5-kinase activity

associates primarily with the synaptic plasma membrane (Wiedemann et al, 1998).

Although recent studies using the PH domain of PLCd fused to GFP suggest that a

plasma membrane pool of PtdIns(4,5)P2 is important for regulated exocytosis in

chromaffin cells (Holz et al, 2000), it is possible that the phosphorylation in trans of

PtdIns(4)P in the granule membrane by the plasma membrane-associated PtdIns(4)P 5-

kinase is the critical step. In this model, the compartmentalisation of the two kinases on

different membranes would ensure that PtdIns(4,5)P2 is only synthesised on vesicles in

close enough proximity to the plasma membrane. Furthermore, this would ensure that

the production of PtdIns(4,5)P2 is restricted to the region of the SSV membrane that will

fuse with the plasma membrane. The development of further tools to study the

localisation and dynamics of PtdIns(4,5)P2 in the nerve terminal will be invaluable in

determining the role of PtdIns(4,5)P2 in neurotransmitter release. In view of this, we

141


have developed a monoclonal antibody specific for PtdIns(4,5)P2 that is described in

detail in the Chapters 5-7.

4.8 A molecular model for the involvement of Syt oligomers in exocytosis

Synaptotagmin I and II interact with multiple protein and lipid targets, mainly via the

C2A and C2B domains, and these interactions are important for the sequential docking,

calcium-dependent fusion and endocytosis of synaptic vesicles. While alterations in the

calcium-dependence of C2A binding to phosholipid membranes affect the calcium-

dependence of exocytosis (Fernandez-Chacon et a l, 2001), C2B-mediated

oligomerisation appears to be essential for the ability of Syt to act as a calcium sensor

(Littleton et al, 2001).

How might Syt multimerisation contribute to the fusion event? Syt oligomers are able to

bind SNARE complexes, although the binding of Syt to SNARE complexes does not

require oligomerisation (Littleton et al, 2001). Syt is able to trigger the calcium-

dependent formation of SDS-resistant SNARE complex dimers in vitro, but this only

occurs with oligomerisation competent Syt (Littleton et al, 2001). This, together with

the observation that Syt-SNARE complexes have a 1:2 stoichiometry, suggests that in

the presence of calcium, Syt could trigger the nucléation of SNARE complexes and

promote their oligomerisation. The subsequent formation of rings of Syt-SNARE

oligomers could participate in the formation and/or expansion of a fusion pore. The

importance of SNARE complex oligomerisation for exocytosis is highlighted by studies

of complexins. Complexins bind to SNARE complexes via syntaxin and also promote

SNARE complex oligomerisation (Tokumaru et a l , 2001). Neurotransmission is

inhibited by peptides blocking the complexin-SNARE complex interaction and in

neurons lacking complexins (Tokumaru et al, 2001; Reim et al, 2001).

142

Synaptotagmin olisomerisation discussion

Despite recent advances in the molecular interactions involved in the different stages of

neurotransmitter release, there are a number of important questions to be resolved

before they can be integrated to give a global perspective of the sequence of events

leading to membrane fusion. For example, it is not known whether fusion proceeds

through a temporary lipidic hemifusion intermediate as is the case for viral fusion

(Stegmann, 2000) or via expansion of a proteolipid channel between the two

membranes, as appears to be the case for yeast vacuole fusion (Peters et al, 2001).

Studies to reconstitute fusion of liposomes with kinetics and calcium sensitivities

approaching those observed for regulated exocytosis should help address some of these

issues.

143

Chapter 5: Nuclear PtdIns(4,5)P2

localises to SFCs

144

Chapter 5_____________________________ Nuclear PtdIns(4,5)P'> localises to SFCs

5.1 Introduction

A number of different approaches have been taken to investigate the sub-cellular

distribution of PtdIns(4,5)P2 and other phosphoinositides. These include fluorescent

analogues, fluorescent Pl-binding proteins and specific antibodies.

5.1.1 fluorescent analogues

A number of groups have synthesised fluorescent phosphoinositides and inositol

polyphosphates either as cell-permeant caged compounds that can be introduced into

cells and released at the required time (Jiang et al, 1998; Li et al, 1998), or complexed

with polyamine carriers such as the aminoglycoside neomycin. Such analogues can be

introduced into cells without disrupting them and will reveal the localisation of

endogenous binding partners but may not reflect sites where PtdIns(4,5)P2 might be

synthesised. Fluorescent analogues have been used to visualise the localisation of

PtdIns(4,5)P2 to specific cytosolic and nuclear compartments in vivo (Ozaki et al,

2000). However, the used of these is somewhat limited as the fluorescent analogues

would also be the targets of intracellular phosphatases, kinases and other enzymes, so

the fluorescent signal detected would not necessarily correspond to the molecule

introduced.

5.1.2 fluorescent lipid-binding molecules

A number of polypeptides contain domains that bind to phosphoinositides both within

the context of the protein and when isolated. Chimeras of these domains with GFP has

allowed researchers to visualise the sub-cellular distribution and dynamics of the

endogenous lipids in fixed and living cells. Pleckstrin homology (PH) domains are

phosphoinositide binding membrane-targeting modules. Different PH domains bind

different Pis (Rameh et al, 1997a; Kavran et al, 1998) and these variations have been

145

Chapter 5_____________________________ Nuclear PtdIns('4,5)P7 localises to SFCs

exploited in the study of endogenous Pis. For example, GFP-PH fusion proteins have

been used to visualise receptor-induced changes in levels of PtdIns(4,5)P2 (Stauffer et

a l, 1998), PtdIns(3,4)P2 and PtdIns(3,4,5)P3 (Gray et al, 1999), the dynamics of

Ptdlns(4,5)P2 in membrane ruffles (Tall et al, 2000) and sites of PI 3-kinase activity in

vivo (Watton and Downward, 1999). Despite their advantages, there are several

drawbacks to using GFP-PH domains (Lemmon and Ferguson, 2000). Firstly, PH

domains only appear to recognise subpools of Ptdlns(4,5)P2. For example, the PLC3-PH

only localises to the plasma membrane even though Ptdlns(4,5)P2 has been found on

intra-cellular membranes using biochemical methods (Godi et al, 1999). This may

depend on Ptdlns(4,5)P2 being associated with a specific protein as appears to be the

case for the PH domain of oxysterol binding protein. This particular PH domain

recognises a determinant on Golgi membranes that appears to be a combination of

Ptdlns(4,5)P2 with an unidentified protein (Levine and Munro, 1998). Secondly, PH

domains also bind the soluble analogues of Pis often with the same affinity suggesting

that inositol polyphosphates could compete for binding to the PH domain and thereby

alter its localisation. Thirdly, GFP-PH fusion proteins are typically expressed in cells

for 24-48 hours. This prolonged expression of a domain capable of sequestering Pis is

likely to alter the cellular physiology bearing in mind the range of functions Pis are

involved in. Additionally, PI binding domains may alter the distribution of endogenous

Pis. For example, the PI binding region of MARCKS is able to segregate Ptdlns(4,5)P2

into domains in artificial liposomes (Denisov et a l, 1998) and furthermore,

overexpressing MARCKS increases the size of Ptdlns(4,5)P2-containing membrane

microdomains (Laux et al, 2000).

Fluorescently-labelled neomycin offers a further alternative. Neomycin is an

aminoglycoside antibiotic that binds to multiple Pis including Ptdlns(4,5)P2 (Gabev et

a l, 1989; Arbuzova et al, 2000). Despite its broader specificity, neomycin has an

146

Chapter 5_____________________________ Nuclear PtdIns(4.5)P-> localises to SFCs

advantage over PH domains as it is not displaced from the surface of Ptdlns(4,5)?2-

containing liposomes by physiological concentrations of InsPg, conditions which result

in the release of significant amounts of GFP-PH domains.

5.1.3 specific antibodies

An antibody that recognises PtdIns(4)P and PtdIns(4,5)P2 has previously been described

(Fukami et al, 1988) and used to localise the lipids sub-cellularly (Boronenkov et al,

1998; Laux et a l, 2000). A similar strategy has been used for the localisation of

PtdIns(3,4)P2 (Yokogawa et al, 2000). Our interest in the involvement of PtdIns(4,5)P2

in neuro secretion led us to produce and characterise monoclonal antibodies specific for

PtdIns(4,5)P2 (Thomas et al, 1999a). Two of the antibodies generated recognised

PtdIns(4,5)P2 in preference to other phosphoinositides both by dot-blot analysis and

TLC overlay. When tested by indirect immunofluorescence using standard

paraformaldehyde fixation and Triton X-100 permeabilisation protocols, both antibodies

were found to stain interphase nuclei of HeLa and NIH-3T3 cells (Thomas et al,

1999a). We have used one of these antibodies, antibody 2C11, to characterise this

nuclear PtdIns(4,5)P2 and to investigate its function in the regulation of nuclear

processes, in particular pre-mRNA splicing.

5.2 Results

5.2.1 Characterisation of antibodies against PtdlnsM.S^P?

Monoclonal antibodies against PtdIns(4,5)P2 were developed and tested for their

specificity towards phosphoinositides, including PtdIns(4,5)P2 (Thomas et al, 1999a).

Antibody 2C11, recognises PtdIns(4,5)P2 and to a lesser extent PtdIns(4)P and

PtdIns(3,4,5)P3 by dot-blot and PtdIns(4,5)P2 only by TLC overlay. In view of the

intense nuclear staining observed using both antibodies tested (Thomas et al, 1999a),

147

Chapter 5_____________________________ Nuclear PtdInsf4.5)P-> localises to SFCs

the cross-reactivity of antibody 2C11 to DNA and RNA was tested by dot-blot. 2C11

only recognises PtdIns(4,5)P2 in this assay (Figure 5.1).

The ability of 2C11 to recognise PtdIns(4,5)P2 inserted in a lipid bilayer was tested

using a liposome-binding assay. In this assay, 2C11, or as a control anti-mouse IgG,

was immobilised on protein G beads and incubated with liposomes containing 1%

PtdIns(4,5)P2 or Ptdlns in a background of PtdCho. A small amount of tritiated PtdCho

was incorporated in the liposomes to act as a tracer. Following the incubation, the beads

were spun down, washed and the amount of radioactivity associated with the

immobilised 2C11 or control antibodies was measured by scintillation counting. 2C11

specifically pulls-down PtdIns(4,5)P2-containing liposomes (Figure 5.2 A). The ability

of 2C11 to recognise PtdIns(4,5)P2 in the context of a bilayer was confirmed by

immuno-electron microscopy. PtdCho liposomes containing PtdIns(4,5)P2 or Ptdlns

were pelleted, and treated for cryo-electron microscopy. Sections were incubated with

2C11 post-embedding, followed by a gold conjugated anti-mouse secondary antibody.

Gold was specifically associated with liposomes containing PtdIns(4,5)P2 (Figure 5.2 B)

but not Ptdlns (Figure 5.2 C). Random fields of view were photographed and the total

number of liposomes and the number decorated with one or more gold particles were

scored. 34% of PtdIns(4,5)P2-containing liposomes (n = 170) were labelled with one or

more gold particles compared to 0% of Ptdlns-containing liposomes (n = 96).

Altogether, these results demonstrate that 2C11 is able to recognise PtdIns(4,5)P2 both

in and out of the context of a lipid bilayer.

5.2.2 2C11 recognises PtdInst4.5IP? in the nucleus of different cell-tvpes

Detergent permeabilisation of cells following fixation reveals an intense staining of the

nucleus with antibody 2C11 and an independent anti-PtdIns(4,5)P2 antibody, 10F8

148

(•) # ) # # #

G G G G G

G G G G G

Ptdlns(4,5)P2

DNA

total RNA

concentration

Figure 5.1 2C11 is specific for PtdIns(4,5)P2 in a dot-blot assay. Serial dilutions of PtdIns(4,5)P2 (12.5- 200 ng), DNA and total PC 12 cell RNA (300 ng-1 gg) were spotted on membranes and probed with monoclonal antibody 2C11. 2C11 recognises PtdIns(4,5)P2 but does not cross-react with other phosphoinositides (Thomas et al, 1999), DNA or PC 12 total cellular RNA.

40□ PC/Rd Ins

■ PC/Ptdlns(4,5)P2o 30-

TJ 2 0 -

Figure 5.2 2C11 is able to recognise PtdIns(4,5)P2 inserted in a lipid bilayer.A) Liposomes containing 1% Ptdlns (empty bars) or PtdIns(4,5)P2 (filled bars) and radioactive PC were incubated with immobilised 2C11 or anti-IgQ . Radioactivity associated with beads was measured and expressed as a percentage of the total radioactivity. Error bars represent the standard deviation based on three experiments. B,C) Cryosections of extruded liposomes containing PtdIns(4,5)P2 (B) and Ptdlns (C) were probed with 2C11 followed by gold-conjugated secondary antibodies. 34% of PtdIns(4,5)P2-containing liposomes (n=170) were labelled with one or more gold particles compared to 0% (n=96) of Ptdlns- containing liposomes. Bars= 50 nm.

Chapter 5_____________________________ Nuclear PtdIns(4,5)P-> localises to SFCs

(Thomas et al, 1999a). This staining has a speckled distribution that extends through

the nucleoplasm but excludes the nucleolus and does not appear to contact the nuclear

envelope. This pattern is observed in a number of different cell-types from different

species, including HeLa (human epithelial), NIH-3T3 (rat fibroblast), Vero (monkey

kidney fibroblast; Figure 5.3 A-C) and PC12 (rat neurosecretory; Figure 5.5 B). Co

localisation studies using 2C11 and Lamin B, a component of the nuclear lamina, a

meshwork of intermediate filaments underlying the inner nuclear membrane, highlight

the absence of PtdIns(4,5)P2 associated with the nuclear membrane (Figure 5.3 D-F).

To confirm that the nuclear antigen recognised by 2C11 is PtdIns(4,5)P2, the antibody

was pre-incubated with liposomes containing different phosphoinositides and then used

for immunofluorescence. All known PI species were tested (Figure 5.4 A-I), but only

PtdIns(4,5)P2 (Figure 5.4 H) and to a lesser extent PtdIns(3,4,5)P3 (Figure 5.4 I) were

able to compete staining. The partial competition using PtdIns(3,4,5)P3 is consistent

with the small cross-reactivity by dot-blot (Thomas et a l, 1999a) but could also be

ascribed to a slight contamination of the commercial PtdIns(3,4,5)P3 sample with

PtdIns(4,5)P2. Competition experiments were also performed with the soluble

deacylated derivatives of Ptdlns and PtdIns(4,5)P2 (GroPIns and GroPIns(4,5)P2

respectively). As shown in Figure 5.4 J, only GroPIns(4,5)P2 is able to completely

abolish the nuclear staining.

2C11 recognises the phosphorylated inositol headgroup, as InsP3 is also able to compete

the nuclear staining (Figure 5.4 K). Although isoforms of phospholipase C have been

localised to the nucleus, we believe that 2C11 is recognising nuclear PtdIns(4,5)P2 not

InsP3 , as pre-incubating cells with the fungal metabolite neomycin abolishes nuclear

staining (Figure 5.4 L). Neomycin binds with relatively high affinity to

150

NIH-3T3«itlv

HeLa

2C11amin B m erge

Figure 5.3 2C11 labels the nuclei of detergent-permeabilised cells. 2C11immunostaining following detergent-permeabilisation reveals an intense non- homogeneous nuclear staining which could be seen in a number of cell-lines from different species including N1H-3T3 (rat fibroblast; A), Vero (monkey kidney fibroblast; B) and HeLa (human epithelial; C) cells. Panel C inset shows a merged phase and fluorescent image illustrating the nuclear localisation. This is also highlighted by double-labelling of HeLa cells using anti-lamin followed by a secondary Alexa-488 conjugated secondary antibody (D) and Cy3-labelled 2C11 (E). The merged image (F) highlights the fact that nuclear PtdIns(4,5)P2 is not associated with the nuclear envelope. Images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

co n tro tl B + P td ln s | C

+P td ln s(4)P |E

+Ptdlns(3)P

.$ + P td ln s ( 5 ) P |F +Ptdlns(3,4)P,

+ P td ln s (3 ,5 )P , |H

f a ?

+ G ro P ln s (4 ,5 )P . |K

+Ptdlns(4,5)P +Ptdlns 3,4,5)P

flnsPi +neomycin

Figure 5.4 2C11 is recognising nuclear PtdIns(4,5)P2. 2C11 was pre-incubated with liposomes containing different FIs prior to immunofluorescence on detergent- permeabilised NIH-3T3 cells. PtdIns(4,5)?2-containing liposomes can compete the nuclear staining (H) whereas other FIs have little effect (A-G, I). Fre-incubating 2C11 with the soluble headgroup of FtdIns(4,5)F2 (GroFIns(4,5)F2) (J) or with InsF] (K) also abolishes nuclear staining. Although InsFg is present in the nucleus and can compete the staining, we believe 2C11 is recognising nuclear FtdIns(4,5)F2 as pre-incubating cells with neomycin prior to 2C11 also abolishes nuclear staining (L). Images were acquired with a CCD camera-equipped Zeiss microscope. Bars = 10 pm.

Chapter 5_____________________________ Nuclear PtdIns('4.5)Py localises to SFCs

phosphoinositides including PtdIns(4,5)P2. Importantly, InsPg is unable to displace

neomycin pre-bound to PtdIns(4,5)P2 in liposomes (Arbuzova et al, 2000).

Additionally, nuclear staining is absent following methanol fixation (C. Thomas,

personal communication), a treatment expected to remove lipids from the membrane

and proteolipid complexes. Altogether, these results suggest that the nuclear antigen

recognised by 2C11 is PtdIns(4,5)P2.

As a further proof, we tried to use a recombinant PtdIns(4,5)P2-speciflc 5-phosphatase

catalytic domain from the Sacchromyces cerevisiae phosphatase Inp52p (Stolz et al,

1998) on fixed and permeabilised cells to attenuate nuclear staining. Although we were

unable to see any change in the levels of nuclear staining (not shown), we have no

positive control that PtdIns(4,5)P2 is dephosphorylated by the enzyme in these

conditions, so no conclusions can be drawn from this approach.

5.2.3 Bimodal distribution of PtdInsf4.5)P? in PC 12 cells

PtdIns(4,5)P2 synthesis is required for the regulated exocytosis of secretory granules in

PC 12 cells (Hay et al, 1995). It is not clear however whether this PtdIns(4,5)P2 is

generated on the plasma membrane or on the secretory granules themselves. 2C11 was

used to investigate the distribution of PtdIns(4,5)P2 in PCI2 cells differentiated with

NGF. As mentioned before, in the presence of detergent, there is nuclear but no

peripheral staining (Figure 5.5 B). To visualise peripheral PtdIns(4,5)P2, detergent-free

conditions had to be used. Following optimisation of the staining protocol to minimise

the high levels of background fluorescence associated with PC 12 cells, particularly in

the absence of detergent, staining was observed at the tips of NGF-induced neurites

(Figure 5.5 D). This is consistent with other reports of PtdIns(4,5)P2 localisation in

PC 12 cells (Martin, 1997a; Holz et al, 2000). The staining appears to be punctate and

153

+ TX100

-TX100

Figure 5.5 2C11 immunostaining varies depending on the permeabilisation protocol used. 2C11 stains the nuclei of detergent-permeabilised NGF- differentiated PCI 2 cells (A, B). In the absence of detergent, the nuclear staining is not seen but there is punctate staining at the tips of the neurites (C,D). Images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

Chapter 5_____________________________ Nuclear Ptdlns (4.5)P7 localises to SFCs

to resemble that of the secretory granule and synaptic-like microvesicle marker VAMP-

2 (see Figures 3.14 and 3.16) which is more consistent with the unpublished findings of

Martin and collaborators (Martin, 1997a). Further work, including electron microscopy,

is required to confirm if Ptdlns(4,5)?2 is present on the membranes of secretory

granules, the plasma membrane, or both.

5.2.4 Localisation of peripheral PtdInst4.5)P? in fibroblasts

Peripheral PtdIns(4,5)P2 has also been detected on the plasma membrane of cells using

the PH domain of PLC31 fused to GFP (Stauffer et a l, 1998; Tall et al, 2000). In

fibroblasts, PtdIns(4,5)P2 was shown to concentrate in dynamic regions of the plasma

membrane enriched in F-actin (Tall et al, 2000). We introduced 2C11 labelled with the

fluorescent dye Cy3, into Vero cells by microinjection. As a control, a non-specific

monoclonal antibody against vesicular stomatitis virus glycoprotein (VSV-G, antibody

P5D4) labelled with Cy3 was microinjected in parallel. Both modified antibodies were

tested prior to use on detergent-permeabilised HeLa or Vero cells. Under these

conditions, the 2C11-Cy3 antibody labels nuclei with a pattern undistinguishable from

unlabelled 2C11 and both the labelled and unlabelled P5D4 give only a diffuse

background signal (not shown).

Cells were microinjected with P5D4-Cy3 or 2C11-Cy3, left to recover for 2 h and then

fixed with paraformaldehyde prior to confocal microscopy. As expected, P5D4-Cy3

injected cells have a homogeneous cytoplasmic fluorescence (Figure 5.6 A). However,

cells injected with 2C11-Cy3 have, in addition to a similar background of diffuse

fluorescence, significantly brighter puncta within the cytoplasm (Figure 5.6 B).

Interestingly, staining of the plasma membrane was not detectable, suggesting that 2C11

is recognising a pool of intra-cellular PtdIns(4,5)P2 distinct from that recognised by

155

P h a s e P 5 D 4 -C y 3

2 C 1 1 -C y 3

Figure 5.6 2C11 can be used to visualise peripheral PtdIns(4,5)P2 in fibroblast-like cells. Vero cells were micro injected in the cytoplasm with either Cy3-labelled control antibody (anti-VSVG, clone P5D4; A) or with Cy3-labelled 2C11. Cy3-P5D4 labelled cells have a diffuse cytoplasmic fluorescence. In contrast, Cy3-2C11 fluorescence is asociated with discrete, punctate structures within the cytoplasm. No plasma membrane staining is apparent. Fluorescent images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

Chapter 5_____________________________ Nuclear PtdIns(4.5)P7 localises to SFCs

PLC3-PH. Although the presence of PtdIns(4,5)P2 on intra-cellular vesicular structures

has not been demonstrated directly, increased levels of PtdIns(4,5)P2 have been linked

to the formation of actin tails on cholesterol-enriched vesicles from the plasma

membrane and TGN. Over-expressed PtdIns(4)P 5-kinase localises to the tips of these

actin tails suggesting that PtdIns(4,5)P2 is synthesised on these vesicles (Rozelle et al.,

2000).

To determine whether these structures co-localise at all with the TGN, normal rat

kidney (NRK) cells stably transfected with a TGN38-GFP fusion protein (Girotti and

Banting, 1996) were microinjected with either 2C11-Cy3 or P5D4-Cy3. TGN38 is an

integral membrane protein which cycles between the TGN and the cell surface and at

steady-state localises to the TGN (Girotti and Banting, 1996). Cells microinjected with

P5D4-Cy3 have a diffuse cytoplasmic fluorescence as was observed in Vero cells

(Figure 5.7 C). In contrast, a number of fluorescent structures are visible in the

cytoplasm of 2C11-Cy3 injected cells, mostly occupying a region of the cell

surrounding the TGN (Figure 5.7 E-H). The TGN38-GFP and 2C11-Cy3 signals do not

co-localise although in a number of instances they appear to be in close apposition but

not interconnected. This is particularly evident in the inset of Figure 5.7 H, where the

area corresponding to the TGN has been expanded.

The perinuclear distribution of these 2C11-positive structures is reminiscent of early

endosomes (Stenmark et al, 1996). Similar microinjections were therefore performed

using NRK cells stably transfected with a 2xFYVE-GFP construct that specifically

binds PtdIns(3)P on early endosomes (Gillooly et al, 2000). As expected, 2xFYVE-

GFP fluorescence is associated with punctate structures concentrated around the nucleus

(Figure 5.8 B, F). There is no co-localisation between the GFP-positive and 2C11-Cy3-

157

P h a s e T G N 3 8 -G F P P 5D 4-C y3 m e rg e

P h a s e T G N 3 8 -G F P 2 C 1 1 -C y 3 m e rg e

Figure 5.7 TGN38 and 2C11 do not co-localise in NRK cells. NRK cells stably transfected with TGN38-GFP (B, F) were microinjected in the cytoplasm with Cy3-labelled P5D4 (C) or 2C11-Cy3 (G). While Cy3 fluorescence is diffusely distributed throughout the cytoplasm of control injected cells (C), 2C11-Cy3 labels punctate structures within the cytoplasm (G) that are concentrated in an area containing TGN38-GFP. Although there is no co-localisation, the two signals sometimes appear to be in contact (H). The lack of co-localisation is emphasised in the inset (H) where the area within the white rectangle has been enlarged. Fluorescent images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

P h a s e 2X FY V E-G FP P 5 D 4 -C y 3 m e rg e

P h a s e 2X FY V E-G FP 2 C 1 1 -C y 3 m e r g e

Figure 5.8 2C11-positive structures are not early endosomes. NRK cells stably transfected with 2xFYVE-GFP (B, F) were microinjected in the cytoplasm with P5D4-Cy3 (C) or 2C11-Cy3 (G). Cy3 fluorescence is diffusely distributed throughout the cytoplasm of control injected cells and does not co-localise with 2xFYVE-GFP (B-D). 2C11-Cy3 labels punctate structures within the cytoplasm that are concentrated in the area of 2xFYVE-GFP positive structures, but there is no co-localisation between the two signals (F-H). Fluorescent images are projections of a series of 0.4 pM confocal z-sections. Bars = 10 pM


positive structures (Figure 5.8 H). The 2C11-Cy3 positive structures occupy a region

closer to the base of the cell where it contacts the substrate, while the 2xFYVE-GFP

signal occupies an area towards the top of the cell. Further co-localisation studies, for

example using influenza virus hemagglutinin as a marker of TGN-derived secretory

vesicles (Rozelle et al., 2000), will shed light on the identity and composition of these

2C11-Cy3 positive structures.

5.2.5 PtdInst4.5)P? localises to electron dense structures in the nuclei of interphase cells

Although the presence of PtdIns(4,5)P2 within the nucleus has been previously reported

(Divecha et al, 1993; Mazzotti et al, 1995; Boronenkov et al, 1998), the distinctive

nuclear distribution we observed by light microscopy has not been described, with the

exception of the work by Boronenkov and collaborators which was published not long

after our initial observations (Boronenkov et al, 1998). The authors reported a non-

homogeneous staining of PtdIns(4,5)P2 within the nucleus but did not provide any

information concerning its role(s). We were therefore interested in further characterising

this detergent-resistant pool of PtdIns(4,5)P2.

The pattern observed by immunofluorescence with 2C11 in the presence of detergent

strikingly resembles the distribution of a number of factors involved in pre-mRNA

processing and in particular splicing (Matera, 1999). Splicing factors are concentrated in

nuclear structures named Interchromatin Granule Clusters (IGCs) and/or Perichromatin

Fibrils (PFs). These structures were defined by electron microscopy and cannot be

distinguished using light microscopy, when they are referred to collectively as Splicing

Factor Compartments (SFCs; Misteli, 2000a). We therefore investigated the localisation

of nuclear PtdIns(4,5)P2 by immuno-electron microscopy. Cryo-sections of HeLa cells

were labelled post-embedding with 2C11 followed by a gold conjugated secondary

160

Chapter 5_____________________________ Nuclear PtdInsf4.5)P? localises to SFCs

antibody. A large number of gold particles localise to intra-nuclear, electron-dense

structures with an average diameter of 0.4 pm (Figure 5.9 A). These structures appear to

be comprised of smaller particles and as such resemble IGCs (Spector et al, 1991).

Gold particles are also found in the nucleoplasm associated with more diffusely

distributed electron dense material. Consistent with the immunofluorescence results, no

gold particles are found in the immediate vicinity of the nuclear envelope.

Although there is no nucleolar staining by immunofluorescence, gold particles are

found within the nucleolus by electron microscopy (Figure 5.9 B). The particles appear

to be associated with fibrillar centres and the dense fibrillar component (Carmo-Fonseca

et al., 2000) although they do not overlap completely with either compartment. The

difference in nucleolar staining by the two methods could reflect a difference in the

accessibility of the antibody. With the electron microscopy, antibody staining is carried

out post-sectioning so the accessibility is much greater. Similar distributions of gold

particles were observed using HeLa cells detergent-permeabilised after fixation

indicating that detergent does not cause a redistribution of nuclear PtdIns(4,5)P2 (not

shown).

IGCs are thought to be sites of storage of splicing factors and/or of assembly of

spliceosomes as they do not contain sites of active transcription (Fakan, 1994). As a

result, IGCs are resistant to nuclease treatment (Spector et al, 1991). PFs on the other

hand, contain nascent transcripts, are sensitive to treatment with RNase but not DNase

(Spector et al, 1991) and are thought to represent sites of active splicing. Nuclease

treatment differentially affects the localisation of SFC associated factors. For example,

while DNase treatment does not affect the localisation of either the Sm proteins, snRNP

components or the non-snRNP splicing factor SC35, RNase treatment abolishes Sm

161

B

#

N u

Figure 5.9 PtdIns(4,5)P2 is localised in electron-dense structures in HeLa nuclei. Cryosections of unpermeabilised HeLa cells were incubated with 2C11 followed by a 10 nm gold-conjugated secondary antibody. Gold particles are associated with electron-dense areas within the nucleus (A), that resemble IGCs (white arrow) and areas of the fibrillar centres (white arrowhead) and dense granular components (black arrowhead) of the nucleolus. N = nucleus, Nu = nucleolus. Bars = 200 nm.

+ D N a s e + R N a s e

Figure 5.10 The localisation of nuclear PtdIns(4,5)P2 is dependent on intact RNA. 2C11 staining is unaffected by DNase pre-treatment (A). However, pretreating cells with RNase abolishes nuclear staining (B), even though 2C11 does not cross-react with RNA by dot-blot (Figure 5.1). Images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

Chapter 5_____________________________ Nuclear PtdIns(4.5)Pj localises to SFCs

staining but not SC35 staining (Spector et al, 1991). Treatment of HeLa cells with

RNase A, but not DNase I, prior to immunofluorescence with 2C11, abolishes nuclear

staining (Figure 5.10). As 2C11 does not recognise DNA or RNA by dot-blot (Figure

5.1 A), this demonstrates that localisation of PtdIns(4,5)P2 within the SFC, like that of

Sm proteins, requires intact RNA.

5.2.6 2C11 co-localises with splicing factors in interphase cells

Immunofluorescence co-localisation experiments were performed using antibodies

against a variety of different nuclear markers to confirm that nuclear PtdIns(4,5)P2 does

indeed localise to the SFC. In detergent-permeabilised HeLa cells, 2C11

immunostaining overlaps exactly with that of the essential splicing factor SC35 a

marker of the SFC (Figure 5.11 A-C). Sm proteins like SC35 also localise to SFCs, but

in addition display a wider localisation also being dispersed throughout the nucleoplasm

and in Cajal bodies (Sleeman and Lamond, 1999). As expected, there is a partial co

localisation between 2C11 and Sm proteins within SFCs but not in the nucleoplasm or

in Cajal bodies. This was demonstrated using anti-serum from patients suffering from

Systemic Lupus Erythematosus, an autoimmune disease where auto-antibodies

recognising Sm proteins are generated (Figure 5.11 D-F), and monoclonal antibody

Y12, which also recognises Sm proteins, primarily B/B’ (Lerner et al, 1981)(not

shown). Co-localisations with p80-coilin, a marker of Cajal bodies, confirm that

PtdIns(4,5)P2 is not present in these structures at steady state (Figure 5.11 J-L).

A sub-population of the largest sub-unit of RNA Polymerase II has previously been

described to co-localise with SC35 in the SFC. This fraction is hyperphosphorylated at

Ser 2 of the heptad repeat YSPTSPS in the carboxy terminal domain (CTD). Using the

monoclonal antibody H5, that specifically recognises this phospho-epitope (designated

163

Figure 5.11 PtdIns(4,5)P2 co-localises with markers of the Splicing Factor

Compartment (SFC). Detergent-permeabilised HeLa cells were co-stained with Cy3-

labelled 2C11 (B, E, H, K, N) and antibodies against the essential splicing factor, SC35

(A), Sm proteins (D), RNA Pol IIo (H5, G), p80-coilin (J) and hnRNP A1 (M). The

yellow pseudo-colour merge highlights the extent of co-localisation (C, F, I, L, O).

2C11 and SC35 co-localise within the SFC. Both Sm proteins and RNA Pol IIo have a

wider distribution and as a result only partially co-localise with 2C11. There is no co

localisation between 2C11 and the Cajal body marker, coilin or hnRNP Al. Images are

projections of a series of 0.4 pm confocal z-sections. Bars =10 pm.

SC-35

D

merge

F

merge

• '.Mmerge ■ v /

coilin merge

hnRNP Al merge

Chapter 5_____________________________ Nuclear PtdInsf4.5)Pj localises to SFCs

RNA Pol IIo), we find that a portion of RNA Pol IIo co-localises with PtdIns(4,5)P2

immunoreactivity (Figure 5.11 G-I). However, under our experimental conditions, we

do not see the obvious speckled pattern that was previously described for RNA Pol IIo

(Bregman et a l, 1994; Mortillaro et al, 1996; Albert et a l, 1999). This could be

ascribed to differences in the antibodies used and in the fixation and permeabilisation

protocols (Mortillaro et al, 1996; Albert et a l, 1999). Bregman and collaborators

(Bregman et al, 1994) did use antibody H5, but pre-extracted cells with Triton X-100

prior to fixation and utilised a high concentration of antibody. In order to reproduce

their staining pattern, this treatment was attempted on HeLa cells, and the reported

speckled pattern of RNA Pol IIo was observed. However, their experimental conditions

severely disrupted the normal cellular architecture and caused a massive re-distribution

of PtdIns(4,5)P2 (not shown). hnRNP Al, an abundant nuclear protein involved in the

packaging and export of mRNA (Krecic and Swanson, 1999) has a diffuse nuclear

staining pattern and does not co-localise with 2C11 (Figure 5.11 M-0).

Co-localisation experiments were carried out using the same markers on interphase

populations of Vero cells, paraformaldehyde fixed and Triton X-100 permeabilised as

before, to determine whether this characteristic distribution is common to other cell-

types. The results were essentially the same as those obtained using HeLa cells, with

2C11 staining co-localising exactly with SC35, partially with Sm proteins and RNA Pol

IIo but not with p80-coilin in Cajal bodies (not shown).

5.2.7 Mitotic re-distribution of detergent-resistant PtdInsf4.5)P9

The distribution of detergent-resistant PtdIns(4,5)P2, as revealed by 2C11 staining,

changes dramatically during mitosis. During prophase, nuclear PtdIns(4,5)P2 is

excluded from the area occupied by the condensing chromosomes (Figure 5.12 A-C).

166

H o e c h s t 2 C 1 1 m e r g e

Figure 5.12 Cell-cycle dependent changes in the localisation of detergent- resistant PtdIns(4,5)P2. Synchronised NIH-3T3 cells were fixed at different stages of mitosis and the distributions of DNA and PtdIns(4,5)P2 were visualised using Hoechst 33342 (blue, A, D, G, J, M) and 2C11 (red, B, E, H, K, N) respectively. The lack of co-localisation between PtdIns(4,5)P2 and DNA at all stages is particularly evident in the pseudo-coloured merged images (C, F, I, L, O). Images were acquired using a CCD camera-equipped Zeiss microscope.Bars -- 10 pm.

Chapter 5_____________________________ Nuclear PtdInsf4,5)P7 localises to SFCs

On nuclear membrane disassembly in metaphase, PtdIns(4,5)P2 shifts to the cytoplasm

where it has a more diffuse distribution but is still absent from areas containing the

genetic material (Figure 5.12 D-F). During anaphase, bright PtdIns(4,5)P2-positive foci

begin to reappear (Figure 5.12 G-I). These increase in number during telophase and

remain peripheral even at very late stages of mitosis when the daughter nuclei are

reforming and cytokinesis is nearly complete (Figure 5.12 M-0). Immuno-electron

microscopy of HeLa cells in late telophase reveals that these PtdIns(4,5)P2-containing

structures appear to be very similar morphologically to the IGC-like structures observed

in interphase nuclei (compare Figure 5.13 with Figure 5.9 A). Both structures are

electron-dense, lack any apparent bilayer structure and are not connected with the

plasma membrane or nuclear envelope respectively. This distinctive distribution in late

telophase has been observed by immunofluorescence in all cell-lines tested.

5.2.8 2C11 co-localises with SC35 and RNA Pol IIo in mitosis

The dynamic changes in PtdIns(4,5)P2 localisation during mitosis, like the localisation

of PtdIns(4,5)P2 in interphase, are very similar to the changes observed for the splicing

factor SC35 (Spector et al, 1991; Ferreira et al, 1994). In telophase SC35 also becomes

concentrated in peripheral structures, morphologically similar to those observed in

interphase by electron microscopy. These structures were suggested to be the mitotic

equivalent of IGCs, based on their morphology and the fact that they contain SC35, and

were named Mitotic Interchromatin Granules (MIGs; Ferreira et al, 1994).

Co-localisations were performed on synchronised HeLa cells in late telophase to

confirm that PtdIns(4,5)P2 is present in MIGs. The 2C11 staining pattern co-localises

with that of SC35 (Figure 5.14 A-C), as it does in interphase nuclei (Figure 5.11 A-C).

RNA Pol IIo has also been localised to MIGs (Warren et al, 1992) and correspondingly

168

Figure 5.13 PtdIns(4,5)P2 is localised in electron dense structures in late telophase. Cryosections of HeLa cells in late telophase were labelled with 2C11 followed by a 10 nm gold-conjugated secondary antibody. Gold particles are found associated with peripheral electron-dense structures (arrowheads). The dotted line outlines the plasma membrane (PM). Bar = 200 nm.

SC -35 m erge

merge

m erge

Figure 5.14 PtdIns(4,5)P2 co-localises with SC35 and RNA Pol IIo in late telophase.Synchronised HeLa cells were fixed and co-localisations were carried out using 2C11- Cy3 (B, E, H) and antibodies against SC35 (A), RNA Pol IIo (H5, D) and Sm proteins (G). Co-localisation is shown by yellow in the pseudo-colour merges (C, F, I). PtdIns(4,5)P2 co-localises with SC35 and RNA Pol IIo but not Sm proteins. Images are projections of a series of 0.4 pm confocal z-sections. Bars = 10 pm.

Chapter 5_____________________________ Nuclear PtdInsf4,5)Py localises to SFCs

there is an almost perfect co-localisation between H5 and 2C11 (Figure 5.14 D-F). At

this point in the cell-cycle it has been suggested on the basis of BrdU incorporation

studies, that transcription has re-commenced in the reforming daughter nuclei.

However, there is incorporation of BrdU in MIGs (Ferreira et al, 1994), therefore this

sub-population of RNA Pol II must be transcriptionally inactive. Sm proteins reenter the

nucleus earlier than SC35, synchronous with the onset of transcription (Ferreira et al,

1994). Similarly, the majority of the Sm staining is found back in the nucleus even

when the majority of detergent-resistant Ptdlns(4,5)?2 is still present within MIGs

(Figure 5.14 G-I).

To look at the timing of the disappearance of PtdIns(4,5)P2-containing MIGs and the

reappearance of nuclear PtdIns(4,5)P2, we carried out co-localisations with hnRNP Al,

one of the later hnRNPs to be imported into the nucleus after mitosis, a process

requiring active transcription by RNA Pol II (Pinol-Roma and Dreyfuss, 1991) and

Lamin B l, that appears to play an early role in the process of nuclear envelope re

assembly in anaphase/telophase (Moir et al, 2000). Detergent-resistant PtdIns(4,5)P2

staining remains peripheral and associated with MIGs even when hnRNP Al has

reentered the daughter nuclei (Figure 5.15 A-C) and Lamin Bl has begun to enclose

them (Figure 5.15 D-F). The reappearance of PtdIns(4,5)P2 in the nucleus therefore

appears to be one of the latest events following cell division. How this happens remains

to be resolved for PtdIns(4,5)P2, as well as for other MIG components. Although MIGs

can occasionally be observed in close proximity to the nuclear envelope, we are never

able to find MIGs within the nucleus, or a stage where both the peripheral and nuclear

PtdIns(4,5)P2 pools are absent. It is hoped that in the future, real-time imaging of the

PtdIns(4,5)P2-labelled MIGs in GFP-Lamin expressing cells might provide a clearer

171

hnRNP A1 m erge

lamm B 2C11 m erge

Figure 5.15 Nuclear re-entry of PtdIns(4,5)P2 is one of the latest events at the end of mitosis. Synchronised HeLa cells were fixed and co-localisations were carried out using 2C11-Cy3 (B, E) and antibodies against hnRNP Al (A) and lamin B (D). Colocalisation is shown by yellow in the pseudo-eolour merges (C, F). PtdIns(4,5)P2 is still peripheral when hnRNP Al, one of the later hnRNPs to be re-imported, has reentered the nucleus and when the nuclear envelope has at least partially reformed. Images are projections of a series of 0.4 pm confoeal z-sections. Bars = 10 pm.


answer of when and how Ptdlns(4,5)?2 and other MIG components such as SC35 and

RNA Pol IIo get back into the nucleus at the end of mitosis.

5.2.9 Transcription-independent association of PtdInst4.51P? with splicing factors

The observation that PtdIns(4,5)P2 is found in transcriptionally silent, splicing factor-

containing structures during mitosis suggests that PtdIns(4,5)P2 associates with splicing

factors in a transcription-independent manner. Treating cells with transcription

inhibitors such as the fungal metabolite a-amanitin that binds irreversibly to RNA Pol

II, or the nucleotide analogue DRB that indirectly and reversibly blocks transcription by

inhibiting casein kinase II (Zandomeni et al, 1986), causes a rounding up of several

SFC antigens including Sm proteins, SC35 (Huang and Spector, 1996), RNA Pol IIo

(Bregman et al, 1995) and nuclear PtdIns(4)P 5-kinases (Boronenkov et al, 1998) into

larger, unconnected foci. We monitored the change in distribution of nuclear

PtdIns(4,5)P2 in drug-treated unsynchronised HeLa cells. Treatment with both a-

amanitin and DRB cause a redistribution of interphase PtdIns(4,5)P2 staining in parallel

with that of Sm proteins (Figure 5.16 D-I). The DRB-induced redistribution of both

antigens was reversible following washout of the drug (Figure 5.16 J-L). Significantly,

the overall level of 2C11 staining does not differ significantly between treated and

untreated cells for both drugs, suggesting that the balance of phosphoinositide

metabolism within the nucleus does not correlate with transcriptional activity.

173

an ti-S m 2C11 m e rg e

Figure 5.16 The association of nuclear PtdIns(4,5)P2 with SFCs is independent of transcription HeLa cells were stained with anti-Sm (green) and 2C11 (red) antibodies prior to (A-C) and following treatment with the transcription inhibitors a-amanitin (D-F) and DRB (G-I). Both drugs cause a rounding up of 2C11 staining into discrete foci in parallel with Sm proteins. The DRB induced re-distribution is reversible following wash-out of the drug (J-L). Images are projections of a series of 0.4 pm confoeal z-sections. Bars = 10 pm.

Chapter 6: Nuclear PtdIns(4f5)P2 and

pre-mRNA splicing

175

Chapter 6___________________________ Nuclear PtdIns(4.5)P7 andpre-mRNA splicing

6.1 Introduction

In Chapter 5, I described the identification of a pool of detergent-resistant nuclear

PtdIns(4,5)P2, using a novel antibody raised against PtdIns(4,5)P2, that co-localises with

a number of proteins involved in pre-mRNA splicing within SFCs. The association with

SFCs is independent of active transcription by RNA Pol IIo in both drug-treated

interphase cells and in mitotic cells. Interestingly, both the localisation and

transcription-dependent redistribution of nuclear PtdIns(4,5)P2 resembles that described

for nuclear PIP kinases (Boronenkov et al, 1998).

Although co-localisation by immunofluorescence is suggestive of an association

between two antigens, it cannot alone be used as a proof of this association. The

detergent-resistance and stability of this nuclear PtdIns(4,5)P2 suggests that this pool

might be amenable to study using conventional biochemical approaches. In this chapter,

an immunoprécipitation strategy is used to demonstrate the association of PtdIns(4,5)P2

with proteins and RNAs involved in pre-mRNA processing.

6.2 Results

6.2.1 PtdInsI4.5IP? is present in the nucleus and can be immunoprecipitated bv 2C11

To confirm that PtdIns(4,5)P2 is present in the nucleus of the cell lines tested by

immunofluorescence, HeLa, NIH-3T3 and PC 12 cells were labelled overnight with

[^^P]-orthophosphate, conditions which result in the incorporation of radioactivity into

phospholipids and also into RNA, DNA and phospho-proteins. Phospholipids were

chloroform/methanol extracted from both whole cells and nuclei isolated using the non

ionic detergent NP40 (Popov et a l, 1998), and phosphoinositide species were separated

by TLC (Jenkins et a l, 1994) and visualised by autoradiography. Results were

normalised by loading phosphoinositide samples extracted from equivalent numbers of

176

Chapter 6___________________________ Nuclear PtdIns(4.5)P-> and pre-mRNA splicing

cells. PtdIns(4,5)P2 is present in the nuclei of all three cell-lines as expected from the

immunofluorescence, although in differing amounts (Figure 6.1 A). The detergent NP40

used to isolate the nuclei strips the nuclear membrane. As a result, the PtdIns(4,5)P2

detected is unlikely to be derived from the nuclear envelope or other contaminating

membranes such as the endoplasmic reticulum or perinuclear endosomes. The purity of

the nuclei obtained using the NP40 method was checked using an antibody against

protein disulphide isomerase, PDI, as a marker of the endoplasmic reticulum. No

significant contamination was found (Figure 6.1 B).

PtdIns(4,5)P2 can be extracted from isolated nuclei using detergent-containing buffer or

detergent-free protocols such as the method established by Dignam and collaborators

(Dignam et a l, 1983, not shown). To determine whether antibody 2C11 can

immunoprecipitate PtdIns(4,5)P2 from complex samples, nuclear extracts were prepared

from [^^P]-labelled adherent HeLa cells using the NP40 method (Popov et a l, 1998) and

incubated with either 2C11 or control anti-IgM antibodies immobilised on Protein G

beads. Phospholipids associated with the imm unoprecipitates were

chloroform/methanol extracted and analysed by TLC and autoradiography. A

radioactive band migrating at the same level as an unlabelled PtdIns(4,5)P2 standard is

present only in the 2C11 immunoprecipitate (Figure 6.1 C). In the TLC system used,

PtdIns(4,5)P2 cannot be distinguished from the other bis-phosphorylated isomers. To

confirm its identity as PtdIns(4,5)P2, the radioactive spot was scraped from the TLC

plate, deacylated and analysed by HPLC (Dove et al, 1997). In this system, the [^^P]-

labelled headgroup co-migrates with tritiated, deacylated PtdIns(4,5)P2 used as a

standard. Altogether, these results demonstrate that PtdIns(4,5)P2 is present in the

nucleus of different cell types and can be immunoprecipitated using antibody 2C11.

177

Figure 6.1 PtdIns(4,5)P2 is found within the nuclei of different cell-types. A ) H eLa,

NIH-3T3 and PC 12 cells were labelled overnight with [^^P] orthophosphate.

Phospholipids were extracted from whole cells or isolated nuclei stripped of the nuclear

envelope and analysed by TLC and autoradiography. Isolated nuclei contain PtdlnsPz.

The solvent system used does not allow different PtdlnsP/PtdlnsPz isomers to be

distinguished, nor the separation of Ptdlns and other phospholipids that migrate close to cell

the front. B) nuclei prepared using NP40 as in (A) were analysed by SDS-PAGE andT

Western blotting for the presence of PDI, a marker of the ER. Parallel samples were

Coomassie stained. Nuclei (Nuc) contain negligible amounts of PDI compared to the

post nuclear supernatant (PNS). C) 2C11, but not control anti-IgCr antibodies, is able to

immunoprecipitate PtdIns(4,5)P2 from nuclear extracts of [^^P]-labelled cells. Thet

identity was confirmed as PtdIns(4,5)P2 by déacylation and HPLC analysis of the [^^P]-

labelled band.

y y y f '

Ptdlns

PtdInsP

PtdInsP

PtdInsPg

origin .4 ':T O T A L C E LL (1 h e x p o s u r e )

N U C L E I (4 h e x p o s u r e )

B Mr(X1Q3) P N S W a s h N u c P N S W a s h N u c185 ►

83 ►

68 ►

45 ►

32 ►

25 ►

C o o m a ss ieB lue

antl-PDI

IgG 2011

Chapter 6___________________________ Nuclear Ptdlnst'4.5)P7 and pre-mRNA splicing

6.2.2 Nuclear proteins co-immunoprecipitate with PtdlnsM.S^P?

The fact that nuclear Ptdlns(4,5)?2 co-localises with a number of proteins involved in

pre-mRNA splicing by immunofluorescence, suggests a possible interaction with at

least some of these. To determine whether PtdIns(4,5)P2 does interact with nuclear

proteins, immunoprécipitations were carried out using NP40 nuclear extracts prepared

from HeLa cells grown overnight in the presence of [ ^S] cysteine/methionine, which

becomes incorporated into newly synthesised proteins. Proteins associated with 2C11

and control anti-IgM immunoprecipitates were analysed by SDS-PAGE and

autoradiography. A large number of bands are immunoprecipitated with the 2C11 but

not the anti-IgM-conjugated beads (Figure 6.2 A). Pre-incubation of 2C11 with

PtdIns(4,5)P2-containing liposomes or GroPIns(4,5)P2 abolishes nuclear staining

(Figure 5.4), and similarly, pre-incubation of 2C11 conjugated beads with

GroPIns(4,5)P2 prevents the immunoprécipitation of the majority of the bands. In

contrast, GroPIns that does not affect nuclear staining has little effect on the protein

recovery (Figure 6.2 A).

Immunoprécipitations were also carried out using nuclear extract prepared from

unlabelled suspension HeLa cells according to the method of Dignam and collaborators

(Dignam et a l, 1983), a method widely used to prepare splicing and transcription

competent nuclear extracts. In this case, proteins recovered were visualised by

Coomassie Blue staining (Figure 6.2 B). Again, pre-incubation of the 2C11 beads with

an excess of GroPIns(4,5)P2 prevents immunoprécipitation of the majority of the

proteins, whilst GroPIns treatment is relatively ineffective.

180

B

GroPInsGroPlnsP(4,5)P2

Mr(xl03)

175 ►

65 ►

32 ►

GroPIns . GroPlnsP(4,5)Pg -

M r(x1Q3)175 ►

65 ►

32 ►

16 ►

# * # #

Figure 6.2 2C11 co-immunoprecipitates several proteins from HeLanuclear extracts. HeLa nuclear extracts were prepared from P^S] labelled (A) or unlabelled (B) HeLa cells. Immunoprécipitations were carried out using 2C11 or anti-IgM antibodies. Proteins were analysed by SDS-PAGE and autoradiography (A) or Coomassie Blue staining (B). Pre-incubating 2C11 beads with GroPIns(4,5)P2 prevents immunoprécipitation of the majority of the bands. Asterisks in B mark the antibody heavy and light chains.

Chapter 6___________________________Nuclear PtdIns(4.5)P7 and pre-mRNA splicins

6.2.3 Proteins involved in pre-mRNA splicing co-immunoprecipitate with PtdlnsM.S)??

To identify some of the proteins associated with the PtdIns(4,5)P2 immunoprecipitates,

2C11 and anti-IgM immunoprecipitates were analysed by SDS-PAGE and Western

blotting with the antibodies used for the immunofluorescence screen. The

unphosphorylated and hyperphosphorylated forms of the largest subunit of RNA Pol II

(RNA Pol Ila and RNA Pol IIo) can be distinguished using specific antibodies and by

the difference in their mobility in SDS-PAGE. RNA Pol Ila migrates at 220 kDa, whilst

the subpopulation of RNA Pol IIo recognised by antibody H5 has an apparent molecular

mass of 240 kDa. Western blots of the anti-IgM and 2C11 immunoprecipitates were

probed sequentially with antibodies H5 (anti-RNA Pol IIo) and 8WG16 (anti-RNA Pol

Ila). Consistent with the partial co-localisation by immunofluorescence (Figure 5.11 G-

I), a fraction of RNA Pol IIo (around 20% depending on the experiment) specifically

associates with 2C11 immunoprecipitates (Figure 6.3, top panels; arrow). RNA Pol Ila

does not localise to SFCs (Bregman et a l, 1995) and likewise is not associated with

2C11 immunoprecipitates (Figure 6.3, top panels; asterisk) demonstrating that

PtdIns(4,5)P2 interacts specifically with RNA Pol IIo.

A pool of Sm proteins co-localise with 2C11 within the SFC (Figure 5.11 D-F) and

similarly a fraction of Sm proteins associate specifically with the 2C11

immunoprecipitate (Figure 6.3, middle panels). The incomplete co-immunoprecipitation

of Sm proteins and RNA Pol IIo is expected as there is not a complete co

localisation between PtdIns(4,5)P2 and either antigen by immunofluorescence.

Furthermore, the anti-Sm antibodies recognise a family of nuclear proteins and

PtdIns(4,5)P2 might only associate with a sub-set of these. Finally, there could be an

incomplete recovery of PtdIns(4,5)P2 from the nuclear extract by antibody 2C11.

182

(X 103)

1851

B

s # f

V P - P + s P - P + SP - P + P - P +

* RNA Pol II

25 ►Sm proteins

32 hnRNP A1

- N P 4 0 + N P 4 0

Figure 6.3 RNA Pol IIo and Sm proteins associate with nuclear PtdIns(4,5)P2. A) Nuclear extracts were prepared from unlabelled HeLa cells using the Dignam method (Dignam et a i , 1983). Proteins associated with anti-IgM and 2C11 immunoprecipitates were analysed by SDS-PAGE and Western blotting using antibodies against RNA Pol Ila, RNA Pol IIo, Sm proteins and hnRNP A I. RNA Pol IIo (arrow) and a sub-set of Sm proteins (empty arrow) are found in the 2CII but not in the control IgM immunoprecipitates (P+), while the majority of RNA Pol Ila (asterisk) and hnRNP AI remains in the supernatants (S). Antibody-conjugated beads alone were loaded in lanes P-. One half of the start material was loaded. B) Sequential immunoprécipitations with anti-IgM and 2CII were carried out using nuclear extracts prepared from unlabelled cells using the NP40 method. Again RNA Pol IIo and Sm proteins are immunoprecipitated by 2CII but not anti-IgM antibodies, while the majority of RNA Pol Ila and hnRNP AI remain in the supernatant (post IP). One tenth of the supernatant post-IP was loaded.

Chapter 6___________________________ Nuclear PtdIns^4.5)P7 and pre-mRNA splicins

Unfortunately, although there is a near-perfect co-localisation between 2C11 and SC35

by immunofluorescence (Figure 5.11 A-C), the presence of SC35 in the

immunoprecipitates could not be demonstrated as the anti-SC35 antibody did not work

in Western blot in our hands.

The preferential co-immunoprecipitation of RNA Pol IIo rather than RNA Pol Ila

highlights the specificity of the 2C11 immunoprécipitation. This specificity was further

demonstrated by Western blot using an antibody against hnRNP Al (9H10). Only

background levels of hnRNP Al associate with 2C11 beads (Figure 6.3, bottom panels)

consistent with the lack of co-localisation by immunofluorescence (Figure 5.11 M-0).

In all cases, similar results were obtained using HeLa nuclear extracts prepared from

suspension cells using the Dignam method (Dignam et a l, 1983; Figure 6.3 A) and

nuclear extracts prepared from adherent cells using the NP40 method (Popov et al,

1998; Figure 6.3 B).

Three of the major Coomassie stained bands co-immunoprecipitated by antibody 2C11,

with apparent sizes of approximately 45 kDa, 100 kDa and 140 kDa, were sequenced by

MALDI mass spectrometry. The 140 kDa band was identified as SAP 155, a splicing

factor that specifically associates with the U2 snRNP and localises to SFCs (Wang et

a l, 1998; Schmidt-Zachmann et a l, 1998). The 100 kDa and 45 kDa bands were

identified as actinin-4 and B-actin respectively, in two separate experiments. Actinin-4

is a novel actinin isoform that can localise to the nucleus or the cytoplasm. The presence

of actinin-4 within the cytoplasm has been linked to the metastatic potential of tumour

cells (Honda et a l, 1998). a-actinin is a Ptdlns(4,5 )P2 -binding cytoskeletal protein

(Fukami et a l, 1994). Sequence alignment demonstrates that the a-actinin 1

PtdIns(4,5)P2-binding site is present in actinin-4, with the exception of a conserved

184

Chapter 6___________________________ Nuclear PtdInsf4.5)P? and pre-mRNA splicing

Ile^V al substitution (Figure 6.4). Therefore it is likely that actinin-4 also binds

PtdIns(4,5)P2. A number of studies have localised B-actin within the nucleus although

this is still disputed by some (Rando et al, 2000). The B-actin and actinin-4 associated

with the immunoprecipitates is unlikely to be due to contamination with cytoplasmic

protein as nuclei isolated using the NP40 method are only minimally contaminated with

cytoplasmic proteins as shown previously (Figure 6.1 B).

Figure 6.4 Sequence alignment of human a-actinin 1 and 4

4a c t in in 1 lO P ISV E E T SA K E G L L L W C O R K tB ISB B B B B SH B B B SD G L G FC A T .T H R H R PE L T D Y G

actinin 4 lOPISVEETSAKEGLLLWCORKtBBSBjBBBSBBSpGLAFNALIHRHRPELIEYD

The full-length sequences of human a-actinin 1 and 4 (Accession numbers XM_007459 and XM 009148 respectively) were aligned using the ClustalX v.1.8 multiple sequence alignment program. Residues 136-194 (a-actinin 1) and 155-213 (a-actinin 4) are shown. The PtdIns(4,5)P2-binding site of a-actinin 1 (Fukami et a l, 1996) and the corresponding sequence in a-actinin 4 are highlighted. The two sequences are identical with the exception of a single conservative amino acid substitution, Ile^Val, indicated by the arrow.

6.2.4 PtdIns(4.5)P? associates with a 140 kDa protein in HeLa nuclear extracts

Western blotting with antibodies against PtdIns(4,5)P2 has been used successfully in the

past to identify a-actinin and vinculin (Fukami et al, 1994) and histone HI (Yu et al,

1998) as PtdIns(4,5)P2-binding proteins. The fact that PtdIns(4,5)P2 is still associated

with proteins after SDS-treatment indicates the strength and stability of these

interactions. A similar strategy using our antibody 2C11 was employed to identify

PtdIns(4,5)P2-binding proteins in the HeLa nuclear extracts. No reproducible 2C11

immunoreactive bands were present in nuclear extracts prepared according to the NP40

or the Dignam method (not shown). The absence of 2C11 signal at a molecular weight

185

Chapter 6___________________________Nuclear PtdlnsM.S)?? and pre-mRNA splicing

similar to that of Histone HI could be ascribed to a lack of this protein in our extracts,

although this has not been confirmed by Western blotting. A faint band of around 45

kDa (not corresponding to B-actin as determined by sequential Western blotting with

2C11 and anti-B actin) was present in some experiments but could not be competed by

pre-incubation of the antibody with GroPIns(4,5)?2 (not shown). Similarly, no bands

were observed in the nuclear extracts by Far Western blotting using [^^P]-labelled

PtdIns(4,5)P2 as a probe (not shown). However, when proteins immunoprecipitated

from HeLa nuclear extracts are analysed by SDS-PAGE and Western blotting with

2C11 or by Far Western with [^^P]-PtdIns(4,5)P2, a major band . with an apparent

molecular mass of ~140 kDa is apparent in both cases (Figure 6.5 A). The 45 kDa band

is also visible although it is much less intense, demonstrating that this high molecular

weight protein is greatly enriched in the 2C11 immunoprecipitates. The finding that this

140 kDa protein can bind exogenous PtdIns(4,5)P2 demonstrates that 2C11 is not cross

reacting with a nuclear protein and suggests that this protein binds PtdIns(4,5)P2. Two

other PtdIns(4,5)P2-binding bands are visible in the [^^P]-PtdIns(4,5)P2 overlay, but not

in the 2C11 Western blot. However, as the 140 kDa band is the major PtdIns(4,5)P2-

binding protein in the immunoprecipitates, it was chosen for peptide sequencing.

To obtain sufficient material for sequencing and identification of the protein, large-scale

2C11 immunoprécipitations were carried out using HeLa nuclear extract prepared from

adherent HeLa cells using the NP40 method. One tenth of the anti-IgM and 2C11

immunoprecipitates were analysed by SDS-PAGE and Western blotting with antibody

2C11, while the remainder of the proteins were separated by SDS-PAGE and stained

with Coomassie Blue (Figure 6.5 B). The Coomassie band corresponding to the 2C11-

positive band was identified by overlapping the two digitally in Adobe Photoshop v5.0.

Its position is highlighted by the arrow in Figure 6.5 B. The band was excised and

186

83 ►

32 ►

32p-Ptdlns(4,5)P2overlay

NE

175^

83 ►

65 ►

48 ►

32 ►-

25 ►

16^

WesternBlot

BMr

(x103)

IgM 2C11

175

83 ►

WesternBlot

IgM 2C11

CoomassieBlue

Figure 6.5 PtdIns(4,5)P2 binds a 140 kDa protein in HeLa nuclear extracts.A) Proteins immunoprecipitated by 2C11 from NP40 HeLa nuclear extracts were separated by SDS-PAGE and transferred to nitrocellulose. Far Western overlay using liposomes containing PtdIns(4,5)P2 p2P]-labelled at the 5’ position demonstrates that PtdIns(4,5)P2 binds to 3 bands of 120-180 kDa. The major 140 kDa band is also visible by Western blotting with 2C11 in the absence of exogenous Ptdlns(4,5)P2. B) A large-scale immunoprécipitation with 2C11 was carried out and used as a source of the 140 kDa band for protein sequencing. Nine tenths of the material was analysed by SDS-PAGE and stained with Coomassie Blue. One tenth of the material was run in parallel on the same gel and used for Western blotting with 2C11. The Coomassie-stained band corresponding to the 2C11 immunoreactivity was excised (arrow) and used for sequencing by MALDI mass spectrometry (Dr.Totty, Protein Analysis Laboratory, ICRF ). tr\irvdircCvHs aAtibx) 1 ^

Chapter 6___________________________ Nuclear PtdIns(4.5)P'> and pre-mRNA splicins

prepared for MALDI fingerprinting by Dr. N. Totty in the ICRF protein sequencing

facility, who is currently working to identify the protein(s) present. The identification of

this protein and verification of its being a PtdIns(4,5)P2-binding protein will hopefully

provide valuable insights into the role of PtdIns(4,5)P2 within the nucleus.

6.2.5 Association of a type I PtdInst4)P-5 kinase activitv with nuclear PtdIns(4.5)P?

Several enzymes involved in phosphoinositide metabolism, including Ptdlns 4-kinases

and PtdIns(4)P 5-kinases, have been identified within the nucleus (Payrastre et al,

1992). Recently, Boronenkov and coworkers demonstrated by immunofluorescence that

isoforms of both PIPKI and PIPKII are present within the SFC where they co-localise

with nuclear PtdIns(4,5)P2 (Boronenkov et al, 1998). We used in vitro kinase assays to

test the anti-IgM and 2C11 immunoprecipitates for any associated kinase activity

towards exogenous phosphoinositide substrates. Immunoprecipitates from HeLa NP40

and Dignam nuclear extracts were incubated with liposomes containing different Pis

and PtdEtan, in a 1:4 molar ratio, in the presence of [y-^^P]-ATP. Reactions were

stopped by the addition of chloroform and Pis were extracted and analysed by TLC and

autoradiography. A significant amount of [ ^P] is incorporated only when PtdIns(4)P-

containing liposomes are used as substrate and the radiolabelled band migrates parallel

to an unlabelled PtdIns(4,5)P2 standard (Figure 6.6 A). This suggests that a Type I

PtdIns(4)P 5-kinase activity is co-immunoprecipitated by 2C11. These kinases are

stimulated in the presence of phosphatidic acid (PA; Jenkins et a l, 1994) and as shown

in Figure 6.6 B, the incorporation of [ P] was increased in the presence of 80 pM PA.

These results suggest that the immunoprecipitated kinase is a Type I PtdIns(4)P-5

kinase and that the radiolabelled band is PtdIns(4,5)P2. To confirm that the labelled PI

species was PtdIns(4,5)P2, the radioactive spot was scraped from the TLC plate,

deacylated and the soluble glycero-derivative analysed by HPLC as described in

188

A< Ptdlns

< PtdInsP

<1 PtdlnsP2

< PtdInsP;

origin

% % K % K % \ % % %

Ptdlns P tdlns(3)P Ptdlns(4)P Ptdlns(5)P Ptdlns(4,5)P2

B

2000

3 H -G ro P ln s (4 ,5 )P 23 2p

IE 1000CLÜ

140

80

O■O3

"0

fraction number

Figure 6.6 PtdIns(4)P 5-kinase activity associates with nuclear PtdIns(4,5)P2.Anti-IgM and 2C11 immunoprecipitates from HeLa nuclear extracts prepared using the Dignam method (Dignam et al, 1983) were incubated with liposomes containing different Pis y-[ ^P] ATP (A). A significant amount of radioactivity is incorporated into a band migrating at the same level as an unlabelled Ptdlns(4,5)P2 standard. The incorporation of P^P] is increased by the presence of 80 pM PA suggesting the activity is a type 1 Ptdlns(4)P 5-kinase (B). HPLC analysis of the deacylated P^P]-labelled species confirmed its identity as Ptdlns(4,5)P2 (C).

Chapter 6________________________ Nuclear PtdIns(4.5)P7 and pre-mRNA splicing

Chapter 6.2.1. The elution profile of the [^^P]-labelled species exactly overlapped with

that of the [^H]-labelled GroPIns(4,5)?2 standard (Figure 6.6 C).

6.2.6 2C11 co-immunoprecipitates snRNAs

Small nuclear RNAs (snRNAs) play important catalytic and structural roles within the

spliceosome and can be co-immunoprecipitated with Sm proteins (Lemer et al, 1981).

To determine whether snRNAs could be co-immunoprecipitated with PtdIns(4,5)P2,

HeLa cells were grown in phosphate-free medium for 2 hours before overnight labelling

with [ ^P] orthophosphate, conditions that maximise the incorporation of [ ^P] into

RNAs (Spector et a l, 1998). Nuclear extracts were prepared using a modified Dignam

method (Abmayr et a l, 1988) and immunoprécipitations were carried out using anti-

IgM and 2C11 coupled beads as before. Additional immunoprécipitations were

performed using the monoclonal antibody Y12 that recognises Sm proteins (mainly

B/B') as a positive control. Proteins associated with the immunoprecipitates were

removed by Proteinase K digestion and RNAs were phenol/chloroform extracted,

ethanol precipitated and analysed by denaturing electrophoresis and autoradiography.

Ul, U2, U4, U5 and U6 snRNAs, identified according to their molecular mass (Figure

6.7 A) and by comparison with the Y12 immunoprecipitates, associate with

immobilised 2C11 but not anti-IgM antibodies (Figure 6.7 B). The immunoprécipitation

of snRNAs can be competed, although not 100%, by pre-incubating the 2C11 beads

with GroPIns(4,5)P2 but not GroPIns, conditions that inhibit the immunoprécipitation of

nuclear proteins (Figure 6.2). 2C11 immunoprecipitates contain proportionally more

U2-U6 snRNAs, while Y12 mainly immunoprecipitates Ul and U2 snRNAs. This

finding correlates well with the more nucleoplasmic distribution described for Ul

190

M a m m a l s s n R N A (nucleotides)

U1

U2

U4

U5

U6

1 6 4

1 8 7

1 4 5

1 1 6

1 0 6

B

bases

190^

160 147 ►

123 ►

90 ►

76

+ - GroPIns

\

+ GroPlns(4,5)P2_ GroPIns + GroPlns(4.5)P2

rm i » < U2

< Ul

< U4

< U5 o U6

tRNA

bases

< U2

160 ►

< U4

< U5

90 ►

tRNA

Figure 6.7 Nuclear PtdIns(4,5)P2 associates with snRNAs. A) U1-U6 snRNAs are core structural and catalytic components of the spliceosome and can be identified according to their size. B) Nuclear extracts were prepared using a modified Dignam method (Abmayr et ai, 1988) from HeLa cells metabolically labelled overnight with [32p] orthophosphate. P^P]-labelled RNAs were extracted from one tenth of the input nuclear extract (total) or from anti-IgM, 2C11 and anti-Sm (Y12, positive control) immunoprecipitates and analysed on a 6% acrylamide, denaturing gel. 2C11 co- immunoprecipitates U1-U6 snRNAs and this is inhibited by pre-incubation with GroPIns(4,5)P2 but not GroPIns. C) snRNAs co-immunoprecipitated from unlabelled NP40 HeLa nuclear extracts were visualised by 3’-end labelling using [5’- P] pCp. 2C11 co-imunoprecipitates snRNAs but not tRNAs and again this is competed by pre-incubation with GroPIns(4,5)P2 but not GroPIns. The top panel (snRNAs) is a 3 times longer exposure than the bottom panel (tRNAs).

Chapter 6___________________________ Nuclear PtdIns(4.5)P-> and pre~mRNA splicing

snRNA and Sm proteins compared to U2-U6 snRNAs which have a more pronounced

speckled distribution (Matera and Ward, 1993).

The association of snRNAs with 2C11 immunoprecipitates was also demonstrated using

the technique of 3’end-labelling to [^^P]-label the RNAs post-immunoprecipitation

(England and Uhlenbeck, 1978). In this technique, [5’- ^P] pCp is used as a donor and is

incorporated by T4 RNA ligase into RNAs with a 3’ terminal free hydroxyl group.

While both snRNAs and tRNAs act as good acceptors (Bruce and Uhlenbeck, 1978),

there is no incorporation at the m^G cap structure of mRNAs (England and Uhlenbeck,

1978). It is important to remember that 3’ end-labelling does not label all RNAs with

equal efficiency and cannot therefore be used to get information on the relative

abundance of different RNA species.

In these experiments, nuclear extracts were prepared using the NP40 method from

adherent HeLa cells and anti-Sm antibodies (human anti-sera as opposed to antibody

Y12) were used as a positive control for the immunoprécipitation. snRNAs were again

immunoprecipitated with 2C11 but not anti-IgM (Figure 6.7 C), although only U2, U4

and U5 are visible. In addition, there are a number of other phosphorylated bands

visible in the 2C11 immunoprecipitates around the molecular weight of the snRNAs.

The identity of these bands is not known but they are unlikely to be non-specific as

tRNAs, that are efficiently labelled by [5’-^^P] pCp, are not immunoprecipitated by

2C11 (Figure 6.7 C).

It is possible that the NP40 method favours the extraction of RNA species that are also

associated with PtdIns(4,5)P2 which are not extracted using the Dignam method. As

these RNAs do not immunoprecipitate with anti-Sm antibodies, they are unlikely to be

192

Chapter 6___________________________ Nuclear Ptdlnst'4.5)P7 and pre-mRNA splicim

other (less abundant) snRNA species that have been identified in HeLa nuclear extracts

(Yu et a l, 1996; Montzka and Steitz, 1988). Small nucleolar RNAs (snoRNAs) are

related RNAs found in the nucleolus, of which there are thought to be up to 200

different species (Filipowicz, 2000). snoRNAs are involved in the pseudouridinylation

and 2’-0-ribose méthylation of rRNA and are somewhat less abundant than the U1-U6

snRNAs. The association of snoRNAs with nuclear PtdIns(4,5)P2 is possible bearing in

mind the localisation of PtdIns(4,5)P2 to the nucleolus of HeLa cells observed by

immuno-electron microscopy (Figure 5.9).

6.2.7 The in vitro splicing assav

Detergent-resistant nuclear PtdIns(4,5)P2 not only co-localises with splicing factors

within SFCs, but also interacts with both proteins and RNAs involved in splicing. These

findings point to an involvement, either direct or indirect, of PtdIns(4,5)P2 in the

splicing of pre-mRNAs. To investigate this, we have used a well characterised in vitro

splicing assay (Krainer et a l, 1984). This assay uses splicing-competent nuclear extract

prepared from suspension HeLa cells according to the method of Dignam (Dignam et

a l, 1983) and as a substrate, uniformly radiolabelled in vitro transcribed RNA probes

consisting of a two exons and an intron. Incubation of the RNA with the nuclear extract

in the presence of ATP and creatine phosphate results in splicing of the substrate. The

start RNA, the final spliced product and the splicing intermediates can be resolved by

denaturing acrylamide gel electrophoresis and used to monitor and quantify the extent

of splicing.

The in vitro system has a number of advantages in that factors within the nuclear extract

can be easily manipulated and the readout of the experiment is simple. There are

however a number of limitations, including the fact that this assay focusses only on the

193

Chapter 6___________________________ Nuclear PtdIns(4.5)P:> and pre-mRNA splicins

splicing reaction while recent genetic and biochemical studies emphasise the tight

coupling of transcription, 5’ capping, splicing, polyadenylation and cleavage (Bentley,

1999; Hirose and Manley, 2000). It must therefore be remembered that splicing does not

occur as an isolated process but is influenced by, and in turn influences, other pre-

mRNA processing steps.

6.2.8 Immunodepletion of PtdIns(4.51P? and associated factors inhibits splicing

To demonstrate that PtdIns(4,5)P2 and the associated factors are involved in the splicing

of intron-containing RNAs, splicing competent HeLa nuclear extracts were

immunodepleted with 2C11 or anti-IgM coupled beads. The depleted nuclear extracts

were then used in splicing reactions using an in vitro transcribed, uniformly

radiolabelled B-globin RNA as a probe (Figure 6.8 A) and RNA Pol IIo as a marker to

follow the immunoprécipitation (Figure 6.8 B). Splicing reactions were incubated for 3

hours at 30 °C, after which time RNAs were extracted using chloro form/ methano 1,

ethanol precipitated and analysed in a 6% acrylamide/7 M urea denaturing gel. The 13-

globin splicing intermediates are short-lived and only one can be resolved in this system

(see scheme to right of Figure 6.8 A) which simplifies the analysis greatly.

Splicing is dramatically inhibited when nuclear extracts were immunodepleted with

2C11 but not control beads (Figure 6.8 A, C), most obvious as a decrease in the

formation of the products of the splicing reaction. Importantly, the 2C11 dependent

inhibition of splicing can be blocked by pre-incubating the antibody with

GroPIns(4,5)P2 (Figure 6.8 A, D), a treatment that abolishes nuclear staining by

immunofluorescence (Figure 5.4) and prevents the co-immunoprecipitation of proteins

and snRNAs with PtdIns(4,5)P2 (Figures 6.2 and 6.7). Pre-treatment of the 2C11 with

GroPIns on the other hand has little effect (Figure 6.8 A, D). Furthermore, the amount

194

+ GroPlns(4,5)P2 + - GroPIns

4 9 9 ►

^ 100

80

60

0) 40

E ~ 20

mock IgM 2C11

D

100

80

B+ + + Nuclear Extract

+ GroPlnsPg

60

<D 40

:9 20

RNA Pol IIo

IgM 2C11 2C11

GroPInsGroPlns(4,5)Pg

Figure 6.8 Immunodepleting nuclear extracts with 2C11 inhibits the splicing of B-globin RNA. A) In vitro splicing reaction using a 6-globin RNA probe. Splicing is inhibited by pre-incubation of nuclear extract with 2C11 beads. This effect is blocked by pre-treatment of the antibody with GroPIns(4,5)P2 but not GroPIns. A schematic of the start, intermediates and product of the splicing reaction is shown on the right. B) The beads used in the immunodepletion experiment presented in (A) and an equivalent amount of untreated 2C11 beads were analysed by Western blotting using anti-RNA Pol IIo (H5). C) Splicing efficiency was quantified and expressed as the percentage of processed RNA in the samples versus the total, taking samples treated with Protein G beads alone (not shown) as 100%. Bars represent the standard error of six experiments. D) The inhibition of splicing seen on treatment of the nuclear extract with immobilised 2C11 is partially rescued by pre-treatment of 2C11 beads with GroPIns(4,5)P2 but not GroPIns. Results are expressed as in C). Bars represent the standard error of four experiments.

Chapter 6___________________________ Nuclear PtdIns('4.5)P7 and pre-mRNA splicing

of RNA Pol IIo immunoprecipitated with 2C11 parallels the degree of inhibition of

splicing (Figure 6.8 B). Pre-treating the 2C11 beads with GroPIns(4,5)P2 does not

completely inhibit the co-immunoprecipitation of RNA Pol IIo nor does it completely

prevent the inhibition of splicing (Figure 6.8 B, D). This only partial protection can be

ascribed to the fact that although the pre-incubation is carried out in an excess of soluble

headgroup, this is removed prior to the addition of nuclear extract, effectively diluting

the competitor. In contrast, in the immunofluorescence competition experiments,

GroPIns(4,5)P2 is present at all times and the competition appears to be complete.

The immunodepletion experiments described above were repeated using 3-crystallin

RNA as a probe. Again, immunodepletion of PtdIns(4,5)P2 and associated factors by

2C11 coupled beads inhibits splicing (Figure 6.9). Pre-incubating the 2C11 beads with

GroPIns(4,5)P2 prevented the inhibition of splicing, whilst GroPIns had little effect. In

these experiments, antibody Y12 was used as a positive control and demonstrates that

immunodepletion with 2C11 is just as effective as immunodepleting with an antibody

against a component of the spliceosome. Altogether, these results suggest that the

nuclear PtdIns(4,5)P2 recognised by 2C11 associates with the active fraction of splicing

factors responsible for the majority of the pre-mRNA splicing activity of the nuclear

extracts.

196

1 1 4 1 1 5 1

□Zl

/GroPInsGroPlns{4,5)P2

QZ-OI]*

Figure 6.9 Immunodepleting nuclear extracts with 2C11 inhibits splicing of -crystallin RNA. 2C11-depleted HeLa nuclear extracts are impaired in their ability to support the splicing of 5-crystallin RNA and pre-incubation of 2C11 with GroPIns(4,5)?2 but not GroPIns prevents this. The extent of inhibition is similar to that seen when nuclear extracts are immunodepleted with an antibody against spliceosomal proteins, the Sm proteins (Y12). A schematic of the start, intermediates and products of the splicing reactions is shown to the left of the panel. The asterisk corresponds to the debranched intron.

Chapter 6___________________________ Nuclear PtdIns(4.5)P7 and pre-mRNA splicing

6.2.9 Re-addition of PtdIns(^4.51P? and associated factors restores splicing

To determine whether the depletion of PtdIns(4,5)P2 itself or PtdIns(4,5)P2 and the

associated factors is responsible for the inhibition of splicing, a series of add-back

experiments were carried out. The addition of Ptdlns, PtdIns(4,5)P2 or GroPIns(4,5)P2

(300 pM) to the 2C11-depleted nuclear extract is unable to restore splicing (Figure 6.10

A, C). However, the material co-immunoprecipitated by 2C11 can be eluted by

incubating 2C11 immunoprecipitates with an excess of PtdIns(4,5)P2 or GroPIns(4,5)P2

but not Ptdlns (300 pM of each). If this eluted material is added back to the depleted

nuclear extracts, the splicing activity is partially restored (Figure 6.10 A, C). The

efficiency of the elution can be followed by Western blotting the beads and the eluates

using anti-RNA Pol IIo (H5) as a marker (Figure 6.10 B). The only partial recovery in

splicing activity is expected as only a fraction of the immunoprecipitated material is

eluted in the conditions used: an average of 26% of H5 is eluted in the presence of

PtdIns(4,5)P2 and GroPIns(4,5)P2 compared to the buffer alone control (n = 4) as

determined by quantitative Western blotting. These results demonstrate that the

inhibition of splicing does not result from the depletion of PtdIns(4,5)P2 alone but from

the depletion of PtdIns(4,5)P2 and the factors associated with it.

Although PtdIns(4,5)P2 and the interacting factors are required for the efficient splicing

of intron containing RNAs, they are not sufficient, d-crystallin RNA was incubated with

the eluted material in the presence of ATP and creatine phosphate. There is no splicing

of the 3-crystallin RNA under these conditions (Figure 6.11), suggesting that there are

additional factors in HeLa cell nuclear extracts that are required for the efficient splicing

of mRNA but are not associated with nuclear PtdIns(4,5)P2.

198

2C11 Elution + Re-addition

QI]—[32]

I.H115I

QI]

B g,

LipidRe-addition

Ptdlns(4,5)P2G roPlns(4,5)P2

.'1' A- gÿp p s p s p s p s

RNA Pol IIo

PtdlnsPtdlns(4,5)P2

+ G roPlns(4,5)P2

2C11 Elution + Re-addition

LipidRe-addition

Figure 6.10 PtdIns(4,5)P2 and associated factors are necessary for splicing. A)HeLa nuclear extracts were immunodpeleted with anti-IgM or 2C11 prior to using them in splicing reactions with ^-crystallin RNA. A schematic of the start, intermediates and products of the splicing reactions is shown to the left of the panel. The asterisk corresponds to the debranched intron. Immunoprecipitated material can be eluted from 2C11 beads by incubation with an excess (250 pM) of (di-C4) Ptdlns(4,5)?2 or GroPIns(4,5)P2 which can be followed by Western blotting using anti-RNA Pol llo (B; p=pellet, s=supematant). Re-addition of these eluates to the depleted nuclear extracts partially restores the splicing activity. Re-addition of the control eluates or 250 pM of the lipids alone has no effect. C) The extent of splicing was quantified in each case as the amount of intermediates and products versus the total RNA and expressed as a percentage of the IgM control (100%). The average of two experiments is shown. Bars represent the difference between the two.

114115 I

E]

IgM2C11 Elution

CHE]CL.

DH-CE]

PtdlnsPtdlns(4,5)P2GroPlns(4,5)P2

Figure 6.11 PtdIns(4,5)P2 and associated factors are not sufficient for the splicing of intron-containing RNAs.Material eluted from 2C11 immunoprecipitates as in Figure6.3 was incubated with ^-crystallin RNA under splicing conditions. No splicing is seen in any of the conditions demonstrating that although PtdIns(4,5)P2 and associated factors are necessary for the splicing of intron-containing RNAs, they are not sufficient. A schematic of the start, intermediates and products of the splicing reactions is shown to the left of the panel.

Chapter 6___________________________ Nuclear PtdInsf4.5)P? and pre-mRNA splicing

6.2.10 Exogenous PtdlnsM.SlP? does not effect splicing in vitro

If PtdIns(4,5)P2 itself plays a direct role in splicing, either catalytically or in the

assembly of the spliceosome, altering the levels of PtdIns(4,5)P2 within the nuclear

extract should alter the efficiency of the splicing reaction. Levels of PtdIns(4,5)P2 in the

HeLa nuclear extract were increased by the addition of exogenous GroPIns(4,5)P2, C4-

PtdIns(4,5)P2 or, as a control, GroPIns to the splicing reactions. These treatments had no

effect on the efficiency of splicing of 3-crystallin RNA, even after the addition of 300

pM GroPIns(4,5)P2 or C4-PtdIns(4,5)P2 (Figure 6.12 A).

2C11 staining by immunofluorescence can be competed by InsPg although a number of

evidences, as discussed in Chapter 5, convince us that 2C11 is recognising nuclear

PtdIns(4,5)P2 not InsPg. The ability of InsPg and inositol polyphosphates to affect the

splicing reaction was therefore also investigated. Cellular InsPa concentrations are

estimated to reach up to 10 pM in stimulated cells (although possibly higher in

specialised cell-types such as Purkinje cells; Khodakhah and Ogden, 1993; Luzzi et al,

1998). The addition of 17 pM InsPa, does not inhibit the splicing reaction (Figure 6.12

B) suggesting that InsPa is unlikely to affect splicing in vivo. Similarly, InsP4 has little

effect on the extent of splicing, even at concentrations up to 300 pM (Figure 6.12 C, D).

However, the higher phosphorylated analogue InsPô inhibits splicing by as much as

80% at concentrations >100 pM (Figure 6.12 C, D). Total cellular InsPô has been

estimated to be 10 pM, although the free concentration could be significantly lower as

much of it may be bound to proteins and monovalent/divalent cations (Hanakahi et al.,

2000). This inhibition is therefore highly unlikely to be physiologically relevant. At

these concentrations, InsPe could be chelating metal ions required for splicing, for

example Mg^’*'. Additionally, InsPe has been shown to be an inhibitor of serine/threonine

2 0 1

f f î f l

QT]

G r o P In sG r o P ln s (4 ,5 )P gC 4 - P td ln s ( 4 ,5 ) P ;

0K

lnsP„(/;M)

114115 !

o100

o c 6 003 O03 4 0

InsPe ( /M)

Figure 6.12 Exogenous PtdIns(4,5)P2 or IPPs do not affect splicing efficiency. A)250 pM GroPIns, GroPIns(4,5)P2 or (di-C4) PtdIns(4,5)P2, were added to splicing reactions using 5-crystallin RNA. There is no decrease or increase in the splicing efficiency in any condition. B) Soluble inositol polyphosphates (IPPs) are implicated in various nuclear processes. 17 pM InsPg does not affect the efficiency of splicing of 5-crystallin RNA (physiological levels are -10 pM). C,D) The higher phosphorylated IPPs, lnsP4

and InsPé were added to splicing reactions using B-globin RNA. The splicing efficiency was quantitated and expressed as the amount of splicing product versus the total RNA and expressed as a percentage of the control (100%). InsPé inhibits splicing, but only at high, non-physiological concentrations. The average of two experiments is shown in (D). Bars represent the difference between the two experiments. Schematics of the start, intermediates and products of the splicing reaction are shown to the left of panels A-C.

Chapter 6___________________________ Nuclear Ptdlns(4.5)P? and pre-mRNA splicins

phosphatases at concentrations greater than 10 pM (Larsson et a l, 1997) and it is

known that in vitro splicing is blocked in the presence of serine/threonine phosphatase

inhibitors (Mermoud et a l, 1994). Phosphatase inhibitors do not prevent the formation

of the spliceosome but block the subsequent catalytic steps, possibly by preventing the

dephosphorylation of SR proteins and other splicing factors and as a consequence,

blocking the dynamic rearrangements within the spliceosome that are necessary for its

function (Misteli, 1999).

6.2.11 Inositol phosphatase treatment of nuclear extracts

To try and ascertain whether decreased levels of PtdIns(4,5)P2 can alter the efficiency of

splicing, nuclear extracts were pre-treated with the recombinant catalytic domain of the

Sacchromyces cerevisiae inositol 5-phosphatase Inp52p (Stolz et a l, 1998)(Inp52p-

CD). The activity of the phosphatase towards PtdIns(4,5)P2 was tested on PtdIns(4,5)P2-

containing liposomes. [^^P]-labelled PtdIns(4,5)P2 at the D-5 position was synthesised

in vitro using recombinant GST-Mss4p immobilised on GSH beads. Mss4p is the yeast

PtdIns(4)P-5 kinase and phosphorylates PtdIns(4)P on the D-5 position, producing

PtdIns(4,5)P2. Following incubation with the phosphatases, liberated [ ^P] (aqueous

phase) was separated from the lipids (organic phase) by chloroform/methanol extraction

and radioactivity in the aqueous phase was measured by scintillation counting. Inp52p-

CD is able to liberate the 5-phosphate of PtdIns(4,5)P2 (Figure 6.13 A).

HeLa nuclear extracts were incubated for 20 min at 30°C in the presence of 1 pg

Inp52p-CD and 1.5 mM MgCL. These nuclear extracts were then assayed for splicing

activity using 3-crystallin as the RNA probe. Under these conditions, there is no

difference in the splicing efficiency of mock-treated and phosphatase-treated nuclear

extracts (Figure 6.13 B). Although the phosphatases are active towards PtdIns(4,5)P2 in

203

3(Ô

COO

Û.

I(0Q)n

B

‘=HTm

Qu—im

IgM 2C11

I l 4 l l 5 l

+ I n p 5 2 p - C D

m]

+ Inp52p-CD

Figure 6.13 Inositol phosphatase treatment of nuclear extracts. A) Recombinant Mss4p PtdIns(4)P 5-kinase was used to synthesise PtdIns(4,5)P2 [32P]-labelled at the D-5 position. Liposomes containing the [32P]-PtdIns(4,5)P2 were used to test the activity of the recombinant PtdIns(4,5)P2 5-phosphatase catalytic domain Inp52p (Inp52p-CD). Liposomes were incubated with 1 pg of the enzyme or buffer alone. Aqueous and organic phases were separated and the amount of liberated [32P] present in the aqueous phase was measured by scintillation counting. Inp52p-CD is able to remove the 5-phosphate from Ptdlns(4,5)P2. B) HeLa nuclear extracts were incubated with 1 pg Inp52p-CD in the presence of Mg2+ prior to using the nuclear extract in a splicing reaction with &cry stall in as a probe. Phosphatase-treated nuclear extract is able to support splicing to the same extent as untreated extracts, although there is no positive control to check that the enzymes can dephosphorylate PtdIns(4,5)P2 in the nuclear extract. Phosphatase-treated nuclear extracts were also immunodepleted with 2C11 prior to splicing, which should prevent the inhibition of splicing, as happens when 2C11 is pre-incubated with GroPIns(4,5)P2. However, there is no difference in the amount of splicing following IgM or 2C11 immunodepletion in the absence of phosphatase, indicating that the pre-incubation itself is sufficient to prevent the 2C11- dependent inhibition of splicing. A schematic of the start, intermediates and products of the splicing reactions is shown to the left of the panel.

Chapter 6___________________________ Nuclear PtdIns(4.5)P7 and pre-mRNA splicins

liposomes, there is no control in these experiments to show that the PtdIns(4,5)P2 in the

nuclear extract has been dephosphorylated. Even if the PtdIns(4,5)P2 in the extract was

accessible to the phosphatases, PtdIns(4)P-5 kinases are found in the nucleus

(Boronenkov et al., 1998) and a PtdIns(4)P-5 kinase activity is associated with nuclear

PtdIns(4,5)P2 (Figure 6.6). It is conceivable that the action of the phosphatases to

dephosphorylate PtdIns(4,5)P2 could lead to a compensatory up-regulation of the kinase

activity to keep the levels of PtdIns(4,5)P2 constant.

The same phosphatases were also used to try and demonstrate that decreased levels of

PtdIns(4,5)P2 in the nuclear extracts can reduce the 2C11 immunoprécipitation and

therefore prevent the inhibition of splicing. Nuclear extracts were incubated with 1 pg

Inp52p-CD in the presence of 1.5 mM MgCb for 20 min at 30°C. These nuclear

extracts were then used for immunodepletion with IgM or 2C11-depleted beads as

above. Phosphatase treating extracts prior to immunodepletion with 2C11 did not result

in increased splicing compared to depleted samples incubated with MgCh alone (Figure

6.13 B). In fact, there was no inhibition of splicing in the 2C11-depleted samples

compared to the IgM-depleted controls even in the absence of phosphatase. Under these

conditions, the amount of RNA Pol IIo immunoprecipitated was reduced or even absent

(not shown). This suggests that the pre-incubation itself, even in the absence of the

enzymes, is enough to prevent the immunodepletion of PtdIns(4,5)P2 and associated

factors. It is not clear whether this is a consequence of decreased PtdIns(4,5)P2 levels

within the nuclear extract or of a change in the molecular interactions, leading to a

disassembly of the PtdIns(4,5)P2-containing complex.

205

Chapter 6___________________________ Nuclear PtdInsf4.5)P7 and pre-mRNA splicim

6.2.12 PtdlnsM.SlP? associates with active spliceosomes

PtdIns(4,5)P2 associates with protein and RNA components of the pre-mRNA splicing

machinery and these complexes account for the majority of the splicing activity of HeLa

nuclear extracts. To assess whether PtdIns(4,5)P2 is also associated with active splicing

complexes, in vitro splicing reactions were carried out using [^^P]-labelled 3-crystallin

intron-containing RNA constructs. Splicing reactions were carried out for 1 h at 30°C

and reactions were stopped by placing samples on ice. 2C11, anti-IgM (negative

control) and Y12 (positive control) antibodies immobilised on Protein G beads were

added and samples were incubated for a further hour at 4 °C. Immunoprecipitates were

washed extensively prior to incubation with Proteinase K. Associated RNAs were then

extracted and analysed in an acrylamide, denaturing gel. 2C11 immunoprecipitates the

start RNA, splicing intermediates and products to a similar extent as Y12 (Figure 6.14

A). Pre-incubating 2C11 beads with GroPIns(4,5)P2, but not GroPIns, prevents the

immunoprécipitation of splicing complexes.

When the splicing assay was performed in the absence of ATP, a condition that does not

support splicing, the levels of RNA immunoprecipitated were actually less than those

immunoprecipitated with the control anti-IgM and Y12 beads (Figure 6.14 B). The non

specific association of high amounts of RNA with antibody coated beads, something

that has been observed in the past (Lallena et al., 1998). To summarise, these results

suggest that PtdIns(4,5)P2 associates with the spliceosome at all stages of the splicing

reaction.

206

A A A# S # # N # ^

m ]—£H] *

I14I15 I

133

m

+ A T P

- . GroPIns+ - GroPlns(4,5)P2

- A T P

Figure 6.14 2CI1 co-immunoprecipitates pre formed splicing complexes. Invitro splicing reactions were carried out for 1 h at 30°C, in the presence or absence of ATP, using uniformly [32P]-labelled 6-crystallin RNA as a probe, prior to immunoprécipitation with anti-IgM, 2C11 or anti-Sm protein (Y12).2C11 is able to immunoprecipitate the start, intermediates and products of the splicing reaction to a similar extent as antibody Y12. The immunoprécipitation is competed by pre-incubation of the 2C11 with GroPIns(4,5)P2 but not GroPIns. In the absence of ATP, there is no splicing and only background levels of RNA are immunoprecipitated. The input RNA alone (half) and splicing reactions prior to immunoprécipitation are loaded in the start and untreated lanes respectively. A schematic of the start, intermediates and products of the splicing reactions is shown on the left. The asterisk corresponds to the debranched intron.

Chapter 7: Nuclear PtdIns(4,5)P2

discussion

208

Chapter 7_______________________________________ Nuclear PtdIns^4.5)P? discussion

7,1 Introduction

PtdIns(4,5)P2 plays an important role in an ever increasing number of cellular processes

occurring at different locations within the cell. As these processes are regulated

independently, it follows that multiple compartmentalised pools of intra-cellular

PtdIns(4,5)P2 must exist. It is therefore important to develop tools for the identification

and study of different cellular pools of PtdIns(4,5)P2. To this end, we have developed

and characterised a novel monoclonal antibody, 2C11, against PtdIns(4,5)P2. Antibody

2C11 is able to recognise PtdIns(4,5)P2 both within and out of the context of a lipid

bilayer. In the absence of detergent, 2C11 labels discrete cytoplasmic structures,

implying the presence of PtdIns(4,5)P2 on intra-cellular membrane bound organelles.

These preliminary results demonstrate that 2C11 can be used to follow a pool of

PtdIns(4,5)P2 distinct from the plasma membrane and Golgi-associated PtdIns(4,5)P2

recognised by different GFP-PH domains (Stauffer et a l, 1998; Levine and Munro,

1998; Holz et a l, 2000; Tall et a l, 2000).

In the presence of detergent, peripheral staining disappears and instead an intense,

heterogeneous staining of the nucleus, excluding the nucleolus is visible. Intra-nuclear

PtdIns(4,5)P2 has been observed previously by immunofluorescence and electron

microscopy using other anti-PtdIns(4,5)?2 antibodies (Mazzotti et a l, 1995;

Boronenkov et a l, 1998). However, while the role of PtdIns(4,5)P2 in cytoplasmic

processes has been studied extensively, few functions have been attributed to nuclear

PtdIns(4,5)P2. We have used antibody 2C11 to characterise this detergent-resistant pool

of nuclear PtdIns(4,5)P2 and to investigate an involvement of PtdIns(4,5)P2 in pre-

mRNA processing.

209

Chapter 7_______________________________________ Nuclear PtdIns(4.5)P'> discussion

7.2 Nuclear PtdIns(4,5)P2 associates with SFCs

Within the mammalian nucleus, different families of pre-mRNA splicing factors

localise to morphologically distinct domains. Non-snRNP splicing factors such as

members of the SR family of proteins localise predominantly to SFCs while snRNP

splicing factors are present within SFCs, Cajal bodies and in a diffuse nucleoplasmic

pool (Sleeman and Lamond, 1999; Misteli, 2000a). Detergent-insoluble nuclear

PtdIns(4,5)P2, localises predominantly to SFCs under steady state conditions as

demonstrated by confocal and immuno-electron microscopy, where it co-localises with

SC35, Sm proteins and a sub-pool of RNA Pol IIo (Chapter 5; Osborne et a l, 2001).

The association of PtdIns(4,5)P2 with SFCs depends on intact RNA as has been reported

for Sm proteins but not SC35 (Spector et a l, 1991). Thus although the distribution of

PtdIns(4,5)P2 follows more closely that of SC35 both in interphase and mitosis, it is

associated with SFCs via interactions that have more in common with Sm proteins.

This nucleoplasmic PtdIns(4,5)P2 is however not the only pool of intra-nuclear

PtdIns(4,5)P2. We also detected a pool of nucleolar PtdIns(4,5)P2 associated with the

fibrillar centres and the dense fibrillar component using immuno-electron microscopy.

Previous studies also localised PtdIns(4,5)P2 to the nucleolus and also to

chromatin/interchromatin borders using this technique (Mazzotti et a l, 1995). The

discrepancy between the localisations by immunofluorescence and immuno-electron

microscopy can be attributed to a difference in the accessibility of nucleolar

PtdIns(4,5)P2 to the antibody.

The presence of PtdIns(4,5)P2 within the SFC suggests a possible association with

splicing factors and an involvement in pre-mRNA processing. Similarly the presence of

PtdIns(4,5)P2 within the nucleolus could imply a role in the processing of rRNA.

210

Chapter 7_______________________________________ Nuclear PtdIns(4,5)P7 discussion

Alternatively, the nucleolar PtdIns(4,5)P2, like nucleoplasmic PtdIns(4,5)P2, could be

associated with splicing factors as it has recently been shown that snRNPs interact with

the nucleolus in a phosphorylation-dependent manner (Sleeman et a l, 1998).

Interestingly another PI, PtdIns(3)P, has also been localised to the nucleolus by electron

microscopy using a recombinant FYVE domain (Gillooly et al., 2000), where it has a

similar distribution to the one we observe for nucleolar PtdIns(4,5)P2. These findings

suggest that different phosphoinositides are likely to play important roles in the

nucleolus.

7.3 A novel tripartite proteolipid-nucleic acid complex within the nucleus

Nuclear PtdIns(4,5)P2 associates with a number of factors involved in pre-mRNA

processing (Chapter 6; Osborne et al, 2001). PtdIns(4,5)P2 is present in nuclear extracts

prepared using both detergent and detergent-free protocols and can be

immunoprecipitated using antibody 2C11. Under the same conditions, a variety of

nuclear proteins and a sub-set of nuclear RNAs, the snRNAs, are co-

immunoprecipitated. Analysis of PtdIns(4,5)P2-associated proteins identified a number

of proteins that are localised in SFCs including Sm proteins, RNA Pol IIo but not RNA

Pol Ila, SAP 155, a component of the U2 snRNP, and a type I PtdIns(4)P 5-kinase. In

addition, a number of other factors implicated in pre-mRNA processing have been

localised to the SFC including 3’ processing factors and proteins with putative structural

functions such as Protein 4.1 and NuMa (Zeng et al, 1994a; Lallena and Correas, 1997;

Mintz et a l, 1999), and it is possible that at least some of these may also associate with

nuclear PtdIns(4,5)P2.

These results suggest that a significant pool of nuclear PtdIns(4,5)P2 is present within

tripartite protein-lipid-RNA complexes, which could help explain its resistance to

211

Chapter 7_______________________________________ Nuclear PtdInsf4.5)P7 discussion

detergent extraction. Ptdlns(4,5)?2 can also exist in proteolipid complexes within the

cytoplasm, for example bound to cytoskeletal proteins. The resistance of these

interactions to SDS and denaturing electrophoresis has been used in the past for the

identification of PtdIns(4,5)P2-binding proteins (Fukami et a l, 1994). Using a similar

strategy, we have identified a putative PtdIns(4,5)P2-binding protein of 140 kDa (pi40).

It is hoped that the identification of p i40 will provide valuable insights into how

PtdIns(4,5)P2 might function within the SFC.

It is important to note that the large number of proteins immunoprecipitated by 2C11

does not reflect an unspecific immunoprécipitation, as suggested by the lack of co-

immunoprecipitation of the abundant nuclear protein hnRNP A1 that is not present in

IGCs (Mintz et a l, 1999). Rather, this appears to be a consequence of the large and

complex nature of PtdIns(4,5)P2-containing complexes. The spliceosome itself is a 3

MDa multi-subunit complex comprising over 80 proteins while purified IGCs were

found to contain around 150 proteins (Mintz et al, 1999). Considering the localisation

of PtdIns(4,5)P2 in SFCs and its association with a number of IGC associated proteins,

it will be of interest in the future to not only further identify the proteins co-

immunoprecipitated with PtdIns(4,5)P2, but also to determine whether purified IGCs

contain PtdIns(4,5)P2.

7.4 Nuclear PtdIns(4,5)P2 and pre-mRNA splicing

Although the majority of splicing in vivo is thought to occur co-transcriptionally,

splicing can be reconstituted in vitro using intron-containing RNAs and HeLa nuclear

extracts (Krainer et a l, 1984). We found that immuno-depleting PtdIns(4,5)P2 and

associated factors from splicing competent nuclear extracts prior to RNA addition,

inhibits the splicing of both 8-crystallin and B-globin RNA probes by as much as 95%,

212

Chapter 7_______________________________________ Nuclear PtdIns(4.5)P7 discussion

demonstrating that nuclear PtdIns(4,5)P2 associates with the active fraction of splicing

factors in these nuclear extracts. While PtdIns(4,5)P2 alone does not appear to play a

direct role in pre-mRNA splicing, adding-back the immunodepleted material restores

splicing, demonstrating that PtdIns(4,5)P2 and associated factors are necessary for this

process. They are not however sufficient as the immunodepleted material alone is

unable to support splicing of intron-containing RNAs. Although we have only

investigated a possible involvement of PtdIns(4,5)P2 in splicing, it is conceivable that,

in view of the tight coupling of capping, splicing and 3’ end processing in vivo,

immunodepleting PtdIns(4,5)P2-containing complexes will have similar results in the

equivalent in vitro assays.

7.5 Possible functions for nuclear PtdIns(4,5)P2

Although we have been unable to demonstrate a direct involvement of PtdIns(4,5)P2 in

the splicing reaction in vitro, there are at least two different but not mutually exclusive,

ways in which Ptdlns(4,5)?2 could be important in regulating pre-mRNA processing in

vivo. Firstly, Ptdlns(4,5)?2 could be functioning as a substrate for nuclear

phospholipases or PI 3-kinases and secondly, PtdIns(4,5)P2, via interactions with

nuclear actin binding proteins, could have a structural function analogous to its role in

stabilising the cytoskeleton and strengthening plasma membrane-cytoskeletal

interactions.

7.5.1 PtdInsf4.51P? as a substrate for nuclear phospholipase C and PI 3-kinase

In the cytoplasm certain pools of PtdIns(4,5)P2 serve as precursors for enzymes such as

phospholipases and PI 3-kinases and isoforms of both these enzymes have been

identified in the nucleus. Phospholipases generate both DAG which is involved in the

regulation of certain isoforms of PKC and InsPg that can in turn acts as a substrate for

213


inositol polyphosphate kinases, that generate InsP4 , InsPg and InsPô. Recently, roles for

inositol polyphosphates have been described in the control of transcription, RNA export

and DNA repair (York et al, 1999; Odom et a l, 2000; Hanakahi et al, 2000; Saiardi et

a l, 2000; Feng et a l, 2001). PtdIns(4,5)P2 associated with the transcriptosome could

serve to deliver a pool of PtdIns(4,5)P2 to sites of transcription where the generation of

IPPs could influence the steps leading to mRNA export. Interestingly, DNA-PK that

binds InsPô and requires InsPe for its function in DNA repair by non-homologous end

joining (Hanakahi et a l, 2000), can phosphorylate the CTD of RNA Pol II in vitro

(Peterson et a l, 1995) suggesting a possible cross-talk between inositol signalling

pathways.

Nuclear PI 3-kinases have been implicated in cellular differentiation via the generation

of PtdIns(3,4,5)P3 (Lu et a l, 1998; Neri et a l, 1994). In addition, PI 3-kinase regulatory

proteins, PtdIns(3,4,5)P] binding proteins and PTEN, a PI 3-phosphatase, are also found

within the nucleus (Tanaka et al, 1999; Ye et al, 2000; Gimm et a l, 2000; Lachyankar

et a l, 2000). The GTPase PIKE activates nuclear PI 3-kinase during NGF

differentiation of PC 12 cells and interestingly this is antagonised by Protein 4.1

suggesting that an interplay exists between cytoskeletal proteins and nuclear inositide

signalling pathways (Ye et al, 2000). Although the functions of nuclear PtdIns(3,4,5)P3

are not known, possible targets include Akt/PKB, PDKl and PKC^ (Rameh and

Cantley, 1999). In fact, recent work has demonstrated that the NGF-induced production

of nuclear PtdIns(3,4,5)P3 is required for the nuclear translocation of PKCÇ in PCI2

cells (Neri et a l, 1999).

A role as a substrate for phospholipases and lipid kinases does not exclude a function

for PtdIns(4,5)P2 as an intact molecule prior to its being targeted by these enzymes. For

214

Chapter 7_______________________________________ Nuclear PtdIns{4,5)Po discussion

example, Ptdlns(4,5)?2 associated with chromatin and the chromatin-interchromatin

boundaries could act first as intact molecule interacting with histones and chromatin

remodelling complexes to influence template availability (Yu et a l, 1998; Zhao et al,

1998) and subsequently as a substrate for DAG/InsPs production thereby altering the

transcription of specific genes and their export from the nucleus (York et al, 1999;

Odom et al, 2000; Saiardi et a l, 2000; Feng et al, 2001).

7.5.2 PtdInsf4.51P? and the regulation of nuclear structural proteins

Peripheral PtdIns(4,5)P2 has a well-characterised role in the organisation of the actin

cytoskeleton, in general acting to promote actin polymerisation and interactions

between the cytoskeleton and the plasma membrane (Sechi and Wehland, 2000).

Although it is unlikely that a filamentous network equivalent in nature and function to

the cytoskeleton exists within the nucleus (Pederson, 2000), actin and numerous actin

regulatory proteins have been detected within the nucleus (Rando et a l, 2000). A recent

study has convincingly demonstrated that nuclear actin associates with a specific

mRNA, the Balbiani ring mRNA in Chironomus tetans (Percipalle et a l, 2001). Actin

becomes coupled co-transcriptionally and remains associated with the free

ribonucleoprotein particles in the nucleoplasm and in the cytoplasm. It is not known

whether this actin is monomeric or polymeric, but it is tempting to speculate that

PtdIns(4,5)P2 may influence the association of actin with the mRNA.

Two of the nuclear actin binding proteins are of particular interest for their potential

association with the splicing apparatus. Protein 4.1, a protein involved in linking

spectrin and the actin cytoskeleton at the plasma membrane, and NuMa, a protein with

similarities to myosins and intermediate filaments, both localise to SFCs (Lallena and

Correas, 1997; Zeng et a l, 1994a). Interestingly, Protein 4.1 and NuMa associate with

215


pre-formed splicing complexes and furthermore, depletion of Protein 4.1 and associated

factors inhibits splicing in vitro although the protein itself does not play a direct role in

splicing (Lallena et ai, 1998). Protein 4.1 is of particular interest as it contains an ERM

domain which is potentially able to bind PtdIns(4,5)P2 (Sechi and Wehland, 2000).

Little is known of the mechanisms underlying the characteristic speckled appearance of

SFCs. Recent studies using the splicing factor SF2/ASF fused to GFP have

demonstrated that while SFCs themselves are relatively immobile within the nucleus,

SF2/ASF is highly dynamic (Misteli et a l, 1997; Phair and Misteli, 2000; Kruhlak et

al, 2000). Using the techniques of fluorescence recovery after photobleaching (FRAP)

and fluorescence loss in photobleaching (FLIP), SF2/ASF was shown to be moving

rapidly in an energy-independent, random fashion. However the movement was slower

than expected for simple diffusion and at any one time, around 10% of the protein was

found to be immobile (Phair and Misteli, 2000; Kruhlak et a l, 2000). Based on these

studies, the reduced speed was suggested to reflect transient interactions between

SF2/ASF and multiple low-affinity binding sites (Phair and Misteli, 2000; Kruhlak et

a l , 2000). It is tempting to speculate that these sites could be comprised of localised

accumulations of structural elements stabilised by PtdIns(4,5)P2. As the above results

are all based on over-expression studies, it is important to note that the apparent

mobility of SF2/ASF may be artificially high due to the saturation of these putative

binding sites.

The majority of splicing is thought to occur co-transcriptionally, and consistent with

this, accumulations of splicing factors coincide with sites of transcription (Neugebauer

and Roth, 1997). Moreover, splicing factors have been observed to re-distribute from

SFCs to sites of active transcription (Misteli et a l, 1997). The association of

216


PtdIns(4,5)P2 with active spliceosomes suggests that it too may be localised at sites of

transcription in addition to SFCs. In this case, focal accumulations of cytoskeletal

proteins, regulated by PtdIns(4,5)P2, could serve to concentrate essential factors and/or

to co-ordinate interactions between the transcriptosome and the RNA transcript, thereby

controlling both the speed and efficiency of pre-mRNA processing. Such a role has

been suggested for PtdIns(4,5)P2 in the regulation of the SWI/SNF-like BAF chromatin

remodelling complex (Zhao et a l, 1998). PtdIns(4,5)P2 is sufficient for targeting this 2

MDa multi-subunit complex to chromatin and the ‘nuclear matrix’, likely via

interactions with B-actin and actin-related proteins which are intrinsic components of

this complex. In this case, these proteins do not just have a structural role but are also

essential for the ATPase activity of Brgl (Zhao et a l, 1998). Another chromatin-

remodelling complex, yeast RSC, contains actin-like subunits (Cairns et a l, 1998)

suggesting that this and the related SWI/SNF-B complex in humans (Xue et a l, 2000)

could also be regulated by nuclear PtdIns(4,5)P2. These findings, together with our

observation that B-actin and actinin-4 associate with nuclear PtdIns(4,5)P2, highlights

possible similarities between the chromatin remodelling and pre-mRNA processing

machineries and suggests an underlying general mechanism whereby PtdIns(4,5)P2

could fimction as a direct modulator of various nuclear multi-subunit protein complexes

by coupling them to actin treadmilling. The balance between monomeric and polymeric

forms of actin appears to act as a regulator of several nuclear functions, as recently

demonstrated for serum response factor-dependent gene transcription (Sotiropoulos et

al, 1999).

7.6 PtdIns(4,5)P2 and splicing factor localisation during mitosis

Possible insights into the role of Ptdlns(4,5)?2 in interphase can be inferred from

observations on the dynamics of detergent-resistant PtdIns(4,5)P2 during mitosis. We

217

Chapter 7_______________________________________ Nuclear PtdIns('4.5)P7 discussion

have demonstrated that, in late telophase, the majority of this PtdIns(4,5)P2 is present

within discrete peripheral structures identified as mitotic interchromatin granules

(MIGs) based on the presence of SC35 and their morphology by electron microscopy

(Spector et a l, 1991; Ferreira et a l, 1994). MIGs remain peripheral even when

transcription has recommenced within the daughter nuclei and although they contain the

majority of RNA Pol IIo, MIGs themselves are transcriptionally silent (Ferreira et al,

1994). Interesting parallels can be drawn between the mitotic trafficking of pre-mRNA

and pre-rRNA processing factors. During mitosis, nucleolar components involved in the

processing but not the transcription of rRNA, are localised in the perichromosomal

region and in discrete peripheral structures termed nucleolar derived foci (NDF). NDF

also contain partially processed rRNA and as such are thought to be aggregates of

assembled but inactive processing complexes (Dundr et a l, 2000). The fact that MIGs

contain elements of the pre-mRNA processing machinery suggests that they too could

be comprised of partial pre-mRNA processing complexes. Possible functions for MIG-

associated PtdIns(4,5)P2 include a role in the storage and compartmentalisation of

splicing factors and/or in the trafficking of MIGs.

Most studies concerning the distribution of pre-mRNA processing factors focus on their

localisation and functions in interphase and, as a consequence, little is known about the

trafficking of splicing factors during mitosis and their partitioning between daughter

cells. There are two possible scenarios whereby MIG components could re-enter the

nucleus. Firstly, the PtdIns(4,5)P2-containing MIGs could move through gaps in an

incompletely formed nuclear envelope. Our co-localisation studies show that MIGs

remain peripheral even after the nuclear membrane has at least partially reformed.

Alternatively, they could be disassembled into individual components or smaller

complexes prior to being imported into the nucleus, as appears to be the case for NDFs

218


based on time-lapse studies using different nucleolar antigens fused to GFP (Dundr et

a l, 2000). Further work, including time-lapse microscopy is needed to determine

whether PtdIns(4,5)P2 is re-imported or degraded in the cytoplasm and subsequently re

synthesised within the nucleus. Re-synthesis is possible bearing in mind the repertoire

of enzymes involved in phosphoinositide metabolism that are found in the nucleus.

Immunoprécipitation of PtdIns(4,5)P2-containing MIGs and analysis of their

components will provide insights into the composition and organisation of these

structures, while the comparison of PtdIns(4,5)P2-containing MIGs and IGCs could

provide information essential for understanding the dynamic changes in composition of

these domains during the cell-cycle. In addition, the analysis of the movement of

PtdIns(4,5)P2 and other MIG components in living mitotic cells by time-lapse

fluorescence microscopy and comparison with the timing of nuclear envelope

reassembly could generate valuable insights into the mechanisms of transport and re

uptake of these structures.

7.7 Concluding remarks and future perspectives

It is becoming increasingly apparent that multiple compartmentalised signalling

pathways involving phosphoinositides exist within the nucleus of eukaryotic cells

(Irvine, 2000) and that nuclear Pis can influence vital cellular processes such as cell-

cycle progression, survival and differentiation by regulating the localisation and/or

activation of target proteins. As in the cytoplasm, nuclear Ptdlns(4,5)?2 appears to play

a central role in these processes (Figure 7.1).

We have used a novel antibody to confirm the presence of PtdIns(4,5)P2 within SFCs

and the nucleolus (Mazzotti et a l, 1995; Boronenkov et a l, 1998) and have extended

219

Transcriptional regulation

Chromatin remodelling < [2222]

pre-mRNA processing Rdlns(4,5)P2

nuclear targeting

Ptdlns(3,4,5)P3 i = > differentiation

^ . ,^ ^ survival

^ DAG [ = = > PKC activation

A c \D nuclear e n v e lo p e differentiationin s ( l ,4 ,& ) K 3 breakdow n . .breakdow n . .

C actin b in d in g p r o t e in s ) transcription

^ fl %regulation of cytoskeletalcomponents Intranuclear Ca^+ transcription

homeostasis IPPS

/ \DNA repair pre-mRNA export

Figure 7.1 PtdIns(4,5)P2 is an important regulator of nuclear physiology. Nuclear PtdIns(4,5)P2, like cytoplasmic PtdIns(4,5)P2 influences the localisation and/or activity of target proteins and as a result influences transcription, chromatin remodelling and pre-mRNA processing. Nuclear PtdIns(4,5)P2 can also be phosphorylated in situ by PI 3-kinases (PI3K) generating PtdIns(3,4,5)P3, which is important in turn for differentiation and cell survival. DAG, produced by nuclear phospholipase C (PLC), is required for the activation of PKC, while InsPg is involved in transcriptional regulation and possibly in nuclear Ca^+homeostasis. In addition, InsPg can be phosphorylated further by inositol polyphosphate (IPP) kinases, products of which are implicated in the control of DNA repair and pre-mRNA processing/export.

Chapter 7_______________________________________ Nuclear PtdIns(4.5)P? discussion

these findings by demonstrating that nuclear PtdIns(4,5)P2 is part of a novel proteolipid-

nucleic acid complex that accounts for the majority of splicing activity in HeLa nuclear

extracts. PtdIns(4,5)P2 may well turn out to be involved in other pre-mRNA processing

steps bearing in mind the intimate coupling of splicing with transcription, capping and

3’ end processing in vivo (Bentley, 1999; Hirose and Manley, 2000; Proudfoot, 2000).

Important areas to be addressed in the future include the biochemical purification and

characterisation of the polypeptide composition of the PtdIns(4,5)P2-containing

complexes in interphase and mitosis using a large-scale proteomics approach (Pandey

and Mann, 2000). Related to this is the identification of PtdIns(4,5)P2-binding protein(s)

within these complexes, such as the -140 kDa protein we are currently characterising

(Chapter 6). In addition to these biochemical approaches, altering nuclear PtdIns(4,5)P2

dynamics in living cells could provide valuable insights into its role in nuclear

physiology. One way this could be done is by over-expressing isolated PtdIns(4,5)P2-

binding domains with a nuclear localisation sequence, which would be expected to have

a dominant-negative effect on PtdIns(4,5)P2 function by competing for binding to

endogenous proteins. Alternatively, nuclear PtdIns(4,5)P2 levels could be altered by the

over-expression and nuclear targeting of enzymes such as PtdIns(4,5)P2-specific

phosphatases and PtdIns(4)P 5-kinase. The effect of such manipulations on the

appearance of SFCs and on splicing and other pre-mRNA processing steps could then

be followed. These approaches, combined with studies on the dynamics of

PtdIns(4,5)P2-containing structures in mitosis will help uncover the molecular

mechanisms responsible for the assembly of PtdIns(4,5)P2-containing nuclear

complexes and provide insights into the structural organisation of pre-mRNA

processing within the nucleus.

221

Chapter 8: References

2 2 2

Chapter 8_____________________________________________________________References

References

Abmayr, S. M., Workman, J. L. and Roeder, R. G. (1988). The pseudorabies immediate

early protein stimulates in vitro transcription by facilitating TFIID: promoter

interactions. Genes Dev 2, 542-553.

Achiriloaie, M., Barylko, B. and Albanesi, J. P. (1999). Essential role of the dynamin

pleckstrin homology domain in receptor- mediated endocytosis. Mol Cell Biol 19,

1410-1415.

Albert, A., Lavoie, S. and Vincent, M. (1999). A hyperphosphorylated form of RNA

polymerase II is the major interphase antigen of the phosphoprotein antibody

MPM-2 and interacts with the peptidyl-prolyl isomerase Pinl. J Cell Sci 112, 2493-

2500.

Aimers, W. (1994). Synapses. How fast can you get? Nature 367, 682-683.

Ann, K., Kowalchyk, J. A., Loyet, K. M. and Martin, T. F. (1997). Novel Ca^"^-binding

protein (CAPS) related to UNC-31 required for Ca2‘*‘-activated exocytosis. J Biol

Chem 272, 19637-19640.

Arbuzova, A., Martushova, K., Rangyas-Mihalyne, G., Morris, A. J., Ozaki, S.,

Prestwich, G. D. and McLaughlin, S. (2000). Fluorescently labeled neomycin as a

probe of phosphatidylinositol-4,5- bisphosphate in membranes. Biochim Biophys

Acta 1464, 35-48.

Ameson, L. S., Kunz, J., Anderson, R. A. and Traub, L. M. (1999). Coupled inositide

phosphorylation and phospholipase D activation initiates clathrin-coat assembly on

lysosomes. J Biol Chem 274, 17794-17805.

Ashery, U., Koch, H., Scheuss, V., Brose, N. and Rettig, J. (1999). A presynaptic role

for the ADP ribosylation factor (ARF)-specific GDP/GTP exchange factor msec7-

1. Proc Natl Acad Sci US A96, 1094-1099.

Audhya, A., Foti, M. and Emr, S. D. (2000). Distinct roles for the yeast

phosphatidylinositol 4-kinases, stt4p and piklp, in secretion, cell growth, and

organelle membrane dynamics. Mol Biol Cell 11, 2673-2689.

Babity, J. M., Armstrong, J. N., Plumier, J. C., Currie, R. W. and Robertson, H. A.

(1997). A novel seizure-induced synaptotagmin gene identified by differential

display. Proc Natl Acad Sci USA 94, 2638-2641.

Bai, J. H., Earles, C. A., Lewis, J. L. and Chapman, E. R. (2000). Membrane-embedded

synaptotagmin penetrates cis or trans target membranes and clusters via a novel

mechanism. J Biol Chem 275, 25427-25435.

223


Bajjalieh, S. M. (1999). Synaptic vesicle docking and fusion. Curr Opin Neurobiol 9,

321-328.

Barylko, B., Gerber, S. H., Binns, D. D., Grichine, N., Khvotchev, M., Sudhof, T. C.

and Albanesi, J. P. (2001). A novel family of phosphatidylinositol 4-kinases

conserved from yeast to humans. J Biol Chem 276, 7705-7708.

Bastiaens, P. I., Majoul, I. V., Verveer, P. J., Soling, H. D. and Jovin, T. M. (1996).

Imaging the intracellular trafficking and state of the AB5 quaternary structure of

cholera toxin. EMBO J 15, 4246-4253.

Bastiaens, P. I. H. and Jovin, T. M. (1998). Fluorescence resonance energy transfer

microscopy. In Cell biology. A laboratory handbook, (ed. J. E. Celis), pp. 136-146.

San Diego: Academic Press.

Bastiaens, P. I. H. and Squire, A. (1999). Fluorescence lifetime imaging microscopy:

spatial resolution of biochemical processes in the cell. Trends in Cell Biology 9, 48-

52.

Bazenet, C. E., Ruano, A. R., Brockman, J. L. and Anderson, R. A. (1990). The human

erythrocyte contains two forms of phosphatidylinositol-4- phosphate 5-kinase

which are differentially active toward membranes. J Biol Chem 265, 18012-18022.

Bentley, D. (1999). Coupling RNA polymerase II transcription with pre-mRNA

processing. Curr Opin Cell Biol 11, 347-351.

Berridge, M. J. (1993). Inositol trisphosphate and calcium signalling. Nature 361, 315-

325.

Berton, F., Comet, V., Iborra, C., Garrido, J., Dargent, B., Fukuda, M., Seagar, M. and

Marqueze, B. (2000). Synaptotagmin I and IV define distinct populations of

neuronal transport vesicles. Eur JNeurosci 12, 1294-1302.

Berton, F., Iborra, C., Boudier, J. A., Seagar, M. J. and Marqueze, B. (1997).

Developmental regulation of synaptotagmin I, II, III, and IV mRNAs in the rat

CNS. J Neurosci 17, 1206-1216.

Berwin, B., Floor, E. and Martin, T. F. J. (1998). CAPS (mammalian unc-31) protein

localizes to membranes involved in dense-core vesicle exocytosis. Neuron 21, 137-

145.

Biederer, T. and Sudhof, T. C. (2000). Mints as Adaptors. Direct Binding to Neurexins

and Recmitment of Muncl8. J Biol Chem 275, 39803-39806.

Borgatti, P., Mazzoni, M., Carini, C., Neri, L. M., Marchisio, M., Bertolaso, L., Previati,

M., Zauli, G. and Capitani, S. (1996). Changes of nuclear protein kinase C activity

224


and isotype composition in PC 12 cell proliferation and differentiation. Exp Cell Res

224, 72-78.

Boronenkov, I. V., Loijens, J. C., Umeda, M. and Anderson, R. A. (1998).

Phosphoinositide signaling pathways in nuclei are associated with nuclear speckles

containing pre-mRNA processing factors. Mol Biol Cell 9, 3547-3560.

Botelho, R. J., Teruel, M., Dierckman, R., Anderson, R., Wells, A., York, J. D., Meyer,

T. and Grinstein, S. (2000). Localized Biphasic Changes in Phosphatidylinositol-

4,5-Bisphosphate at Sites of Phagocytosis. J Ce// Biol 151, 1353-1368.

Bourquin, J. P., Stagljar, I., Meier, P., Moosmann, P., Silke, J., Baechi, T., Georgiev, O.

and Schaffner, W. (1997). A serine/arginine-rich nuclear matrix cyclophilin

interacts with the C- terminal domain of RNA polymerase II. Nucleic Acids Res 25,

2055-2061.

Bregman, D. B., Du, L., Li, Y., Ribisi, S. and Warren, S. L. (1994). Cytostellin

distributes to nuclear regions enriched with splicing factors. J Cell Sci 107, 387-

396.

Bregman, D. B., Du, L., van der Zee, S. and Warren, S. L. (1995). Transcription-

dependent redistribution of the large subunit of RNA polymerase II to discrete

nuclear domains. J Ce// Biol 129, 287-298.

Brodin, L., Low, P. and Shupliakov, O. (2000). Sequential steps in clathrin-mediated

synaptic vesicle endocytosis. Curr Opin Neurobiol 10, 312-320.

Brose, N., Petrenko, A. G., Sudhof, T. C. and Jahn, R. (1992). Synaptotagmin: a

calcium sensor on the synaptic vesicle surface. Science 256, 1021-1025.

Bruce, A. G. and Uhlenbeck, O. C. (1978). Reactions at the termini of tRNA with T4

RNA ligase. Nucleic Acids Res 5, 3665-3677.

Bruck, C., Portetelle, D., Glineur, C. and Bollen, A. (1982). One-step purification of

mouse monoclonal antibodies from ascitic fluid by DEAE Affl-Gel blue

chromatography. J Immunol Methods 53, 313-319.

Bunney, T. D., Watkins, P. A., Beven, A. P., Shaw, P. J., Hernandez, L. E.,

Lomonossoff, G. P., Shanks, M., Peart, J. and Drobak, B. K. (2000). Association of

phosphatidylinositol 3-kinase with nuclear transcription sites in higher plants. Plant

Cell 12, 1679-1688.

Burger, P. M., Mehl, E., Cameron, P. L., Maycox, P. R., Baumert, M., Lottspeich, P.,

De Camilli, P. and Jahn, R. (1989). Synaptic vesicles immunoisolated from rat

cerebral cortex contain high levels of glutamate. Neuron 3, 715-720.

225


Burgoyne, R. D. and Weiss, J. L. (2001). The neuronal calcium sensor family of Ca2+-

binding proteins. Biochem J353, 1-12.

Butz, S., Okamoto, M. and Sudhof, T. C. (1998). A tripartite protein complex with the

potential to couple synaptic vesicle exocytosis to cell-adhesion in brain. Cell 94,

773-782.

Cairns, B. R., Erdjument-Bromage, H., Tempst, P., Winston, F. and Komberg, R. D.

(1998). Two actin-related proteins are shared functional components of the

chromatin-remodeling complexes RSC and SWI/SNF. Mol Cell 2, 639-651.

Calado, A. and Carmo-Fonseca, M. (2000). Localization of poly(A) binding protein 2

(PABP2) in nuclear speckles is independent of import into the nucleus and requires

binding to poly (A) RNA. J Cell Science 113, 2309-2318.

Carmo-Fonseca, M., Mendes-Soares, L. and Campos, I. (2000). To be or not to be in the

nucleolus. Nat Cell Biol 2, E l07-112.

Carmo-Fonseca, M., Pepperkok, R., Carvalho, M. T. and Lamond, A. I. (1992).

Transcription-dependent colocalization of the Ul, U2, U4/U6, and U5 snRNPs in

coiled bodies. J Ce// Biol 117, 1-14.

Ceccaldi, P. E., Grohovaz, F., Benfenati, F., Chieregatti, E., Greengard, P. and Valtorta,

F. (1995). Dephosphorylated synapsin I anchors synaptic vesicles to actin

cytoskeleton: an analysis by videomicroscopy. J Ce// Biol 128, 905-912.

Chapman, E. R., An, S., Edwardson, J. M. and Jahn, R. (1996). A novel function for the

second C2 domain of synaptotagmin. Ca^'*"-triggered dimerization. J Biol Chem

271, 5844-5849.

Chapman, E. R. and Davis, A. F. (1998). Direct interaction of a Ca2“*‘-binding loop of

synaptotagmin with lipid bilayers. JBiol Chem 273, 13995-14001.

Chapman, E. R., Desai, R. C., Davis, A. F. and Tomehl, C. K. (1998). Delineation of

the oligomerization, AP-2 binding, and synprint binding region of the C2B domain

of synaptotagmin. J Biol Chem 273, 32966-32972.

Chapman, E. R., Hanson, P. I., An, S. and Jahn, R. (1995). Ca2+ regulates the

interaction between synaptotagmin and syntaxin \ . JBiol Chem 270, 23667-23671.

Charvin, N., Leveque, C., Walker, D., Berton, F., Raymond, C., Kataoka, M.,

Shojikasai, Y., Takahashi, M., Dewaard, M. and Seagar, M. J. (1997). Direct

interaction of the calcium sensor protein synaptotagmin-I with a cytoplasmic

domain of the alpha(l)a subunit of the P/Q-type calcium-channel. EMBO J 16,

4591-4596.

226

Chapter 8_______ References

Chen, Y. A., Scales, S., Patel, S. M., Doung, Y. and Scheller, R. H. (1999). SNARE

Complex Formation Is Triggered by Ca2+ and

Drives Membrane Fusion. Cell 97,165-174.

Cho, E. J., Rodriguez, C. R., Takagi, T. and Buratowski, S. (1998). Allosteric

interactions between capping enzyme subunits and the RNA polymerase II

carboxy-terminal domain. Genes Dev 12, 3482-3487.

Chung, S. H., Song, W. J., Kim, K., Bednarski, J. J., Chen, J., Prestwich, G. D. and

Holz, R. W. (1998). The C2 domains of Rabphilin3A specifically bind

phosphatidylinositol 4,5-bisphosphate containing vesicles in a Ca2+-dependent

manner. In vitro characteristics and possible significance. J Biol Chem 273, 10240-

10248.

Ciruela, A., Hinchliffe, K. A., Divecha, N. and Irvine, R. F. (2000). Nuclear targeting of

the beta isoform of Type II phosphatidylinositol phosphate kinase

(phosphatidylinositol 5-phosphate 4-kinase) by its alpha-helix 7. Biochem J346,

587-591.

Cleveland, D. W., Fischer, S. G., Kirschner, M. W. and Laemmli, U. K. (1977). Peptide

mapping by limited proteolysis in sodium dodecyl sulfate and analysis by gel

electrophoresis. J Biol Chem 252, 1102-1106.

Cockcroft, S. (2001). Phosphatidylinositol transfer proteins couple lipid transport to

phosphoinositide synthesis. Seminars in Cell and Developmental Biology 12, 183-

191.

Compton, D. A. and Cleveland, D. W. (1994). NuMA, a nuclear protein involved in

mitosis and nuclear reformation. Curr Opin Cell Biol 6, 343-346.

Conaway, J. W., Shilatifard, A., Dvir, A. and Conaway, R. C. (2000). Control of

elongation by RNA polymerase II. Trends Biochem Sci 25, 375-380.

Cooke, F. T., Dove, S. K., McEwen, R. K., Painter, G., Holmes, A. B., Hall, M. N.,

Michell, R. H. and Parker, P. J. (1998). The stress-activated phosphatidylinositol 3-

phosphate 5-kinase Fab Ip is essential for vacuole function in S. cerevisiae. Curr

BiolS, I219-I222.

Corvera, S. and Czech, M. P. (1998). Direct targets of phosphoinositide 3-kinase

products in membrane traffic and signal transduction. Trends Cell Biol 8, 442-446.

Corvera, S., D'Arrigo, A. and Stenmark, H. (1999). Phosphoinositides in membrane

traffic. Curr Opin Cell Biol 11, 460-465.

Cramer, P., Bushnell, D. A., Fu, J., Gnatt, A. L., Maier-Davis, B., Thompson, N. E.,

Burgess, R. R., Edwards, A. M., David, P. R. and Kornberg, R. D. (2000).

227

Chapter 8_____________________________________________________________ References

Architecture of RNA polymerase II and implications for the transcription

mechanism. Science 288, 640-649.

Cremona, O. and De Camilli, P. (2001). Phosphoinositides in membrane traffic at the

synapse. J. Cell Sci. 114, 1041-1052.

Cremona, O., DiPaolo, G., Wenk, M. R., Luthi, A., Kim, W. T., Takei, K., Daniell, L.,

Nemoto, Y., Shears, S. B., Flavell, R. A. et al. (1999). Essential role of

phosphoinositide metabolism in synaptic vesicle recycling. Cell 99, 179-188.

Cunningham, E., Thomas, G. M., Ball, A., Hiles, I. and Cockcroft, S. (1995).

Phosphatidylinositol transfer protein dictates the rate of inositol trisphosphate

production by promoting the synthesis of P1P2. Curr Biol 5, 775-783.

D'Souza-Schorey, C., Li, G., Colombo, M. 1. and Stahl, P. D. (1995). A regulatory role

for ARF6 in receptor-mediated endocytosis. Science 267, 1175-1178.

Damer, C. K. and Creutz, C. E. (1996). Calcium-dependent self-association of

synaptotagmin 1. JNeurochem 67, 1661-1668.

Davis, A. P., Bai, J. H., Fasshauer, D., Wolowick, M. J., Lewis, J. L. and Chapman, E.

R. (1999). Kinetics of synaptotagmin responses to Ca2+ and assembly with the core

SNARE complex onto membranes. Neuron 24, 363-376.

Davletov, B. A. and Sudhof, T. C. (1993). A single C2 domain from synaptotagmin 1 is

sufficient for high affinity Ca2+/phospholipid binding. J Biol Chem 268, 26386-

26390.

De Career, G., Lallena, M. J. and Correas, 1. (1995). Protein 4.1 is a component of the

nuclear matrix of mammalian cells. Biochem J 312, 871-877.

de Heuvel, E., Bell, A. W., Ramjaun, A. R., Wong, K., Sossin, W. S. and McPherson, P.

S. (1997). Identification of the major synaptojanin-binding proteins in brain. J Biol

Chem 272, 8710-8716.

De Vries, K. J., Heinrichs, A. A., Cunningham, E., Brunink, P., Westerman, J.,

Somerharju, P. J., Cockcroft, S., Wirtz, K. W. and Snoek, G. T. (1995). An isoform

of the phosphatidylinositol-transfer protein transfers sphingomyelin and is

associated vdth the Golgi system. Biochem J 643-649.

De Vries, K. J., Westerman, J., Bastiaens, P. 1., Jovin, T. M., Wirtz, K. W. and Snoek,

G. T. (1996). Fluorescently labeled phosphatidylinositol transfer protein isoforms

(alpha and beta), microinjected into fetal bovine heart endothelial cells, are targeted

to distinct intracellular sites. Exp Cell Res 227, 33-39.

Denisov, G., Wanaski, S., Luan, P., Glaser, M. and McLaughlin, S. (1998). Binding of

basic peptides to membranes produces lateral domains enriched in the acidic lipids

228


phosphatidylserine and phosphatidylinositol 4,5-bisphosphate - an electrostatic

model and experimental results. Biophys J l ^ , 731-744.

Desai, R. C., Vyas, B., Earles, C. A., Littleton, J. T., Kowalchyck, J. A., Martin, T. F.

and Chapman, E. R. (2000). The C2B domain of synaptotagmin is a Ca(2+)-sensing

module essential for exocytosis. J Cell Biol 150, 1125-1136.

Desrivieres, S., Cooke, F. T., Parker, P. J. and Hall, M. N. (1998). MSS4, a

phosphatidylinositol-4-phosphate 5-kinase required for organization of the actin

cytoskeleton in Saccharomyces cerevisiae. J Biol Chem 273, 15787-15793.

DiAntonio, A., Parfitt, K. D. and Schwarz, T. L. (1993). Synaptic transmission persists

in synaptotagmin mutants of Drosophila. Cell 73, 1281-1290.

DiAntonio, A. and Schwarz, T. L. (1994). The effect on synaptic physiology of

synaptotagmin mutations in Drosophila. Neuron 12, 909-920.

Dignam, J. D., Lebovitz, R. M. and Roeder, R. G. (1983). Accurate transcription

initiation by RNA polymerase II in a soluble extract from isolated mammalian

nuclei. Nucleic Acids Res 11, 1475-1489.

Divecha, N., Banfic, H. and Irvine, R. F. (1991). The polyphosphoinositide cycle exists

in the nuclei of Swiss 3T3 cells under the control of a receptor (for IGF-I) in the

plasma membrane, and stimulation of the cycle increases nuclear diacylglycerol

and apparently induces translocation of protein kinase C to the nucleus. EMBO J

10, 3207-3214.

Divecha, N., Banfic, H. and Irvine, R. F. (1993). Inositides and the nucleus and

inositides in the nucleus. Cell 74, 405-407.

Domin, J., Pages, F., Volinia, S., Rittenhouse, S. E., Zvelebil, M. J., Stein, R. C. and

Waterfield, M. D. (1997). Cloning of a human phosphoinositide 3-kinase with a C2

domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem J

326, 139-147.

Domin, J. and Waterfield, M. D. (1997). Using structure to define the function of

phosphoinositide 3-kinase family members. FEBS Lett 410, 91-95.

Dove, S. K., Cooke, F. T., Douglas, M. R., Sayers, L. G., Parker, P. J. and Michell, R.

H. (1997). Osmotic-stress activates phosphatidylinositol-3,5-bisphosphate

synthesis. Ahfwre 390, 187-192.

Dowler, S., R, A. C., D, G. C., Deak, M., Kular, G., Downes, C. P. and D, R. A. (2000).

Identification of pleckstrin-homology-domain-containing proteins with novel

phosphoinositide-binding specificities. Biochem J 351, 19-31.

229


Du, L. and Warren, S. L. (1997). A Functional Interaction between the Carboxy-

Terminal Domain of RNA Polymerase II and Pre-mRNA Splicing. Jornal o f Cell

Biology 136, 5-18.

Dunaevsky, A. and Connor, E. A. (2000). F-actin is concentrated in nonrelease domains

at frog neuromuscular junctions. J Neurosci 20, 6007-6012.

Dundr, M., Misteli, T. and Olson, M. O. J. (2000). The Dynamics of Postmitotic

Reassembly of the Nucleolus. J Ce// Biol 150, 433-466.

Duzgunes, N. and Wilschut, J. (1993). Fusion assays monitoring intermixing of aqueous

contents. Methods Enzymol 220, 3-14.

Eaton, B. A., Haugwitz, M., Lau, D. and Moore, H. P. H. (2000). Biogenesis of

regulated exocytotic carriers in neuroendocrine cells. J Neurosci 20, 7334-7344.

Eberhard, D. A., Cooper, C. L., Low, M. G. and Holz, R. W. (1990). Evidence that the

inositol phospholipids are necessary for exocytosis. Loss of inositol phospholipids

and inhibition of secretion in permeabilized cells caused by a bacterial

phospholipase C and removal of ATP. Biochem J 268, 15-25.

el Far, O., Charvin, N., Leveque, C., Martin-Moutot, N., Takahashi, M. and Seagar, M.

J. (1995). Interaction of a synaptobrevin (VAMP)-syntaxin complex with

presynaptic calcium channels. FEBS Lett 361, 101-105.

Elhamdani, A., Martin, T. F., Kowalchyk, J. A. and Artalejo, C. R. (1999). Ca(2+)-

dependent activator protein for secretion is critical for the fusion of dense-core

vesicles with the membrane in calf adrenal chromaffin cells. J Neurosci 19, 7375-

7383.

England, T. E. and Uhlenbeck, O. C. (1978). 3'-terminal labelling of RNA with T4

RNA ligase. Nature 275, 560-561.

Faenza, I., Matteucci, A., Manzoli, L., Billi, A. M., Aluigi, M., Peruzzi, D., Vitale, M.,

Castorina, S., Suh, P. G. and Cocco, L. (2000). A role for nuclear PLC betal in cell

cycle control. J Biol Chem .

Fakan, S. (1994). Perichromatin fibrils are in situ forms of nascent transcripts. Trends in

Cell Biology 4, 86-90.

Feng, Y., Wente, S. R. and Majerus, P. W. (2001). Overexpression of the inositol

phosphatase SopB in human 293 cells stimulates cellular chloride influx and

inhibits nuclear mRNA export. Proc Natl Acad Sci USA9S, 875-879.

Fensome, A., Cunningham, E., Prosser, S., Tan, S. K., Swigart, P., Thomas, G., Hsuan,

J. and Cockcroft, S. (1996). ARE and PITP restore GTP gamma S-stimulated

230


protein secretion from cytosol-depleted HL60 cells by promoting PIP2 synthesis.

Curr Biol 6, 730-738.

Fergestad, T. and Broadie, K. (2001). Interaction of Stoned and Synaptotagmin in

Synaptic Vesicle Endocytosis. J Neurosci 21, 1218-1227.

Ferguson, G. D., Anagnostaras, S. G., Silva, A. J. and Herschman, H. R. (2000).

Deficits in memory and motor performance in synaptotagmin IV mutant mice. Proc

Natl Acad Sci U SA 97, 5598-5603.

Ferguson, G. D., Thomas, D. M., Elferink, L. A. and Herschman, H. R. (1999).

Synthesis degradation, and subcellular localization of synaptotagmin IV, a neuronal

immediate early gene product. J Neurochem 72, 1821-1831.

Fernandez-Chacon, R., Konigstorfer, A., Gerber, S. H., Garcia, J., Matos, M. F.,

Stevens, C. F., Brose, N., Rizo, J., Rosenmund, C. and Sudhof, T. C. (2001).

Synaptotagmin I functions as a calcium regulator of release probability. Nature

410, 41-49.

Ferreira, J. A., Carmo-Fonseca, M. and Lamond, A. I. (1994). Differential interaction of

splicing snRNPs with coiled bodies and interchromatin granules during mitosis and

assembly of daughter cell nuclei. J Cell Biol 126, 11-23.

Fesce, R., Grohovaz, F., Valtorta, F. and Meldolesi, J. (1994). Neurotransmitter release:

fusion or 'kiss-and-run'. Trends Cell Biology 4, 1-4.

Filipowicz, W. (2000). Imprinted expression of small nucleolar RNAs in brain: time for

RNomics. Proc Natl Acad Sci U SA 97, 14035-14037.

Ford, M. G., Pearse, B. M., Higgins, M. K., Vallis, Y., Owen, D. J., Gibson, A.,

Hopkins, C. R., Evans, P. R. and McMahon, H. T. (2001). Simultaneous Binding of

PtdIns(4,5)P2 and Clathrin by API 80 in the Nucléation of Clathrin Lattices on

Membranes. Science 291,1051-1055.

Freeh, M., Andjelkovic, M., Ingley, E., Reddy, K. K., Falck, J. R. and Hemmings, B. A.

(1997). High-affmity binding of inositol phosphates and phosphoinositides to the

pleckstrin homology domain of rac protein-kinase-b and their influence on kinase-

activity. J Biol Chem 272, 8474-8481.

Fricker, M., Hollinshead, M., White, N. and Vaux, D. (1997). Interphase nuclei of many

mammalian cell types contain deep, dynamic, tubular membrane-bound

invaginations of the nuclear envelope. J Ce// Biol 136, 531-544.

Fruman, D. A., Meyers, R. E. and Cantley, L. C. (1998). Phosphoinositide kinases.

Annu Rev Biochem 67, 481-507.

231


Fukami, K., Endo, T., Imamura, M. and Takenawa, T. (1994). alpha-Actinin and

vinculin are PIP2-binding proteins involved in signaling by tyrosine kinase. J Biol

Chem 269, 1518-1522.

Fukami, K., Matsuoka, K., Nakanishi, O., Yamakavâ, A., Kawai, S, and Takenawa, T.

(1988). Antibody to phosphatidylinositol 4,5-bisphosphate inhibits oncogene-

induced mitogenesis. Proc Natl Acad Sci U SA 85, 9057-9061.

Fukami, K., Sawada, N., Endo, T. and Takenawa, T. (1996). Identification of a

phosphatidylinositol 4,5-bisphosphate-binding site in chicken skeletal muscle

alpha-actinin. JBiol Chem 271, 2646-2650.

Fukuda, M., Aruga, J., Niinobe, M., Aimoto, S. and Mikoshiba, K. (1994). Inositol-

1,3,4,5-tetrakisphosphate binding to C2B domain of IP4BP/synaptotagmin II. J Biol

Chem 269, 29206-29211.

Fukuda, M., Kabayama, H. and Mikoshiba, K. (2000). Drosophila AD3 mutation of

synaptotagmin impairs calcium-dependent self-oligomerization activity. FEBS Lett

482, 269-272.

Fukuda, M., Kojima, T., Aruga, J., Niinobe, M. and Mikoshiba, K. (1995a). Functional

diversity of C2 domains of synaptotagmin family. Mutational analysis of inositol

high polyphosphate binding domain. J Biol Chem 270, 26523-26527.

Fukuda, M. and Mikoshiba, K. (2000a). Calcium-dependent and -independent hetero

oligomerization in the synaptotagmin family. J Biochem 128, 637-645.

Fukuda, M. and Mikoshiba, K. (2000b). Distinct self-oligomerization activities of

synaptotagmin family. Unique calcium-dependent oligomerization properties of

synaptotagmin VII. JBiol Chem 275, 28180-28185.

Fukuda, M., Moreira, J. E., Lewis, F. M., Sugimori, M., Niinobe, M., Mikoshiba, K.

and Elinas, R. (1995b). Role of the C2B domain of synaptotagmin in vesicular

release and recycling as determined by specific antibody injection into the squid

giant synapse preterminal. Proc Natl Acad Sci USA 92, 10708-10712.

Fykse, E. M., Li, C. and Sudhof, T. C. (1995). Phosphorylation of rabphilin-3A by

Ca2+/calmodulin- and cAMP-dependent protein kinases in vitro. J Neurosci 15,

2385-2395.

Gabev, E., Kasianowicz, J., Abbott, T. and McLaughlin, S. (1989). Binding of

neomycin to phosphatidylinositol 4,5-bisphosphate (PIP2). Biochim Biophys Acta

979, 105-112.

Gad, H., Ringstad, N., Low, P., Kjaerulff, O., Gustafsson, J., Wenk, M., Di Paolo, G.,

Nemoto, Y., Crun, J., Ellisman, M. H. et al (2000). Fission and uncoating of

232


synaptic clathrin-coated vesicles are perturbed by disruption of interactions with the

SH3 domain of endophilin. Neuron 27, 301-312.

Gaidarov, I., Chen, Q., Falck, J. R., Reddy, K. K. and Keen, J. H. (1996). A functional

phosphatidylinositol 3,4,5-trisphosphate/phosphoinositide binding domain in the

clathrin adaptor AP-2 alpha subunit. Implications for the endocytic pathway. J Biol

Chem 271, 20922-20929.

Gaidarov, I. and Keen, J. H. (1999). Phosphoinositide-AP-2 interactions required for

targeting to plasma membrane clathrin-coated pits. J Cell Biol 146, 755-764.

Gaidarov, I., Smith, M. E., Domin, J. and Keen, J. H. (2001). The class II

phosphoinositide 3-kinase C2alpha is activated by clathrin and regulates clathrin-

mediated membrane trafficking. Mol Cell 7, 443-449.

Gall, J. G., Bellini, M., Wu, Z. and Murphy, C. (1999). Assembly of the nuclear

transcription and processing machinery: Cajal bodies (coiled bodies) and

transcriptosomes. Mol Biol Cell 10, 4385-4402.

Gama-Carvalho, M., Krauss, R. D., Chiang, L., Valcarcel, J., Green, M. R. and Carmo-

Fonseca, M. (1997). Targeting of U2AF65 to sites of active splicing in the nucleus.

J Cell Biol 137, 975-987.

Garcia-Bustos, J. F., Marini, F., Stevenson, I., Frei, C. and Hall, M. N. (1994). PIKl, an

essential phosphatidylinositol 4-kinase associated with the yeast nucleus. EMBO J

13, 2352-2361.

Geppert, M., Archer, B. T. and Sudhof, T. C. (1991). Synaptotagmin II. A novel

differentially distributed form of synaptotagmin. J Biol Chem 266, 13548-13552.

Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F. and

Sudhof, T. C. (1994). Synaptotagmin I: a major Ca "*" sensor for transmitter release

at a central synapse. Cell 79, 717-727.

Gerona, R. R. L., Larsen, E. C., Kowalchyk, J. A. and Martin, T. F. J. (2000). The C

terminus of SNAP25 is essential for calcium-dependent binding of synaptotagmin

to SNARE complexes. J Biol Chem 275, 6328-6336.

Gillooly, D. J., Morrow, I. C., Lindsay, M., Gould, R., Bryant, N. J., Gaullier, J. M.,

Parton, R. G. and Stenmark, H. (2000). Localization of phosphatidylinositol 3-

phosphate in yeast and mammalian cells. EMBO J 19, 4577-4588.

Gimm, O., Perren, A., Weng, L. P., Marsh, D. J., Yeh, J. J., Ziebold, U., Gil, E., Hinze,

R., Delbridge, L., Lees, J. A. et al. (2000). Differential nuclear and cytoplasmic

expression of PTEN in normal thyroid tissue, and benign and malignant epithelial

thyroid tumors. Am J Pathol 156, 1693-1700.233


Girotti, M. and Banting, G. (1996). TGN38-green fluorescent protein hybrid proteins

expressed in stably transfected eukaryotic cells provide a tool for the real-time, in

vivo study of membrane traffic pathways and suggest a possible role for ratTGN38.

J Cell Sci 1^9, 2915-2926.

Godi, A., Fertile, P., Meyers, R., Marra, P., Di Tullio, G., lurisci, C., Luini, A., Corda,

D. and De Matteis, M. A. (1999). ARF mediates recruitment of PtdIns-4-OH

kinase-beta and stimulates synthesis of PtdIns(4,5)P2 on the Golgi complex. Nat

Cell Biol Cim-1%1.

Goswani, S. K. and Frey, C. F. (1970). Spray detection of bile acids on thin-layer

chromatograms. J C/zrowarogr 47, 126-127.

Gray, A., VanderKaay, J. and Downes, C. P. (1999). The pleckstrin homology domains

of protein kinase B and GRPl (general receptor for phosphoinositides-1 ) are

sensitive and selective probes for the cellular detection of phosphatidylinositol 3,4-

bisphosphate and/or phosphatidylinositol 3,4,5-trisphosphate in vivo. Biochem J

344, 929-936.

Gross, S. D., Hoffman, D. P., Fisette, P. L., Baas, P. and Anderson, R. A. (1995). A

phosphatidylinositol 4,5-bisphosphate-sensitive casein kinase I alpha associates

with synaptic vesicles and phosphorylates a subset of vesicle proteins. J Cell Biol

130,711-724.

Guan, K. L. and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli:

an improved thrombin cleavage and purification procedure of fusion proteins with

glutathione S-transferase. Anal Biochem 192, 262-267.

Hama, H., Schnieders, E. A., Thomer, J., Takemoto, J. Y. and DeWald, D. B. (1999).

Direct involvement of phosphatidylinositol 4-phosphate in secretion in the yeast

Saccharomyces cerevisiae. J Biol Chem 274, 34294-34300.

Hanakahi, L. A., BartletJones, M., Chappell, C., Pappin, D. and West, S. C. (2000).

Binding of inositol phosphate to DNA-PK and stimulation of double-strand break

repair. Cell 102, 721-729.

Hanson, P. I., Roth, R., Morisaki, H., Jahn, R. and Heuser, J. E. (1997). Structure and

conformational changes in NSF and its membrane receptor complexes visualized

by quick-freeze/deep-etch electron microscopy. Cell 90, 523-535.

Hara, K., Yonezawa, K., Sakaue, H., Ando, A., Kotani, K., Kitamura, T., Kitamura, Y.,

Ueda, H., Stephens, L., Jackson, T. R. et al (1994). 1-Phosphatidylinositol 3-kinase

activity is required for insulin- stimulated glucose transport but not for RAS

activation in CHO cells. Proc Natl Acad Sci U S A 9 \ , 7415-7419.

234

Herreros, J., Lalli, G. and Schiavo, G. (2000). C-terminal half of tetanus toxin

fragment C is sufficient for neuronal binding and interaction with a putative

protein receptor. Biochem. J. 347, 199-204.


Harlow, E. and Lane, D. (1988). Antibodies. A laboratory manual. Cold Spring Harbor,

NY : Cold Spring Harbor Laboratory.

Harris, T. W., Hartwieg, E., Horvitz, H. R. and Jorgensen, E. M. (2000). Mutations in

synaptojanin disrupt synaptic vesicle recycling. J Ce// Biol 150, 589-599.

Haucke, V., Wenk, M. R., Chapman, E. R., Farsad, K. and De Camilli, P. (2000). Dual

interaction of synaptotagmin with mu2- and alpha-adaptin facilitates clathrin-

coated pit nucléation. EMBO J 19, 6011-6019.

Hay, J. C., Fisette, P. L., Jenkins, G. H., Fukami, K., Takenawa, T., Anderson, R. A.

and Martin, T. F. (1995). ATP-dependent inositide phosphorylation required for

Ca(2+)-activated secretion. Nature 374, 173-177.

Hay, J. C. and Martin, T. F. (1992). Resolution of regulated secretion into sequential

MgATP-dependent and calcium-dependent stages mediated by distinct cytosolic

proteins. J Ce// Biol 119, 139-151.

Hay, J. C. and Martin, T. F. (1993). Phosphatidylinositol transfer protein required for

ATP-dependent priming of Ca(2+)-activated secretion. Nature 366, 572-575.

Heidelberger, R., Heinemann, C., Neher, E. and Matthews, G. (1994). Calcium

dependence of the rate of exocytosis in a synaptic terminal. Nature 371, 513-515.

Hendricks, K. B., Qing Wang, B., Schnieders, E. A. and Thomer, J. (1999). Yeast

homologue of neuronal frequenin is a regulator of phosphatidylinositol-4-OH

kinase. Nat Cell Biolog 1, 234-241.

Hinchliffe, K. (2000). Intracellular signalling: Is PIP2 a messenger too? Curr Biol 10,

RI04-R105.

Hinchliffe, K. A., Irvine, R. F. and Divecha, N. (1996). Aggregation-dependent,

integrin-mediated increases in cytoskeletally associated PtdInsP2 (4,5) levels in

human platelets are controlled by translocation of Ptdlns 4-P 5-kinase C to the

cytoskeleton. EMBO J 15, 6516-6524.

Hirose, Y. and Manley, J. L. (1998). RNA polymerase II is an essential mRNA

polyadenylation factor. Nature 395, 93-96.

Hirose, Y. and Manley, J. L. (2000). RNA polymerase II and the integration of nuclear

events. Genes Dev 14, 1415-1429.

Hirose, Y., Tacke, R. and Manley, J. L. (1999). Phosphorylated RNA polymerase II

stimulates pre-mRNA splicing. Genes Dev 13, 1234-1239.

Ho, C. K. and Shuman, S. (1999). Distinct roles for CTD Ser-2 and Ser-5

phosphorylation in the recmitment and allosteric activation of mammalian mRNA

capping enzyme. Mol Cell 3, 405-411.

235


Holz, R. W., Hlubek, M. D., Sorensen, S. D., Fisher, S. K., Balia, T., Ozaki, S.,

Prestwich, G. D., Stuenkel, E. L. and Bittner, M. A. (2000). A pleckstrin homology

domain specific for phosphatidylinositol 4, 5- bisphosphate (PtdIns-4,5-P2) and

fused to green fluorescent protein identifies plasma membrane PtdIns-4,5-P2 as

being important in exocytosis. JBiol Chem 275, 17878-17885.

Homma, K., Terui, S., Minemura, M., Qadota, H., Anraku, Y., Kanaho, Y. and Ohya,

Y. (1998). Phosphatidylinositol-4-phosphate 5-kinase localized on the plasma

membrane is essential for yeast cell morphogenesis. J Biol Chem 213, 15779-

15786.

Honda, A., Nogami, M., Yokozeki, T., Yamazaki, M., Nakamura, H., Watanabe, H.,

Kawamoto, K., Nakayama, K., Morris, A. J., Frohman, M. A. et al. (1999).

Phosphatidylinositol 4-phosphate 5-kinase alpha is a downstream effector of the

small G protein ARF6 in membrane ruffle formation. Cell 99, 521-532.

Honda, K., Yamada, T., Endo, R., Ino, Y., Gotoh, M., Tsuda, H., Yamada, Y., Chiba, H.

and Hirohashi, S. (1998). Actinin-4, a novel actin-bundling protein associated with

cell motility and cancer invasion. J Cell Biol 140, 1383-1393.

Hoover, K. B. and Bryant, P. J. (2000). The genetics of the protein 4.1 family:

organizers of the membrane and cytoskeleton. Curr Opin Cell Biol 12, 229-234.

Huang, S., Deerinck, T. J., Ellisman, M. H. and Spector, D. L. (1994). In vivo analysis

of the stability and transport of nuclear poly(A)+ RNA. J Ce// Biol 126, 877-899.

Huang, S. and Spector, D. L. (1992). Ul and U2 small nuclear RNAs are present in

nuclear speckles. Proc Natl Acad Sci USA 89, 305-308.

Huang, S. and Spector, D. L. (1996). Dynamic organization of pre-mRNA splicing

factors. J Ce// Biochem 62, 191-197.

Huttner, W. B., Schiebler, W., Greengard, P. and De Camilli, P. (1983). Synapsin I

(protein I), a nerve terminal-specific phosphoprotein. III. Its association with

synaptic vesicles studied in a highly purified synaptic vesicle preparation. J Cell

Biol 96, 1374-1388.

Ibata, K., Fukuda, M., Hamada, T., Kabayama, H. and Mikoshiba, K. (2000).

Synaptotagmin IV is present at the Golgi and distal parts of neurites. J Neurochem

74,518-526.

Ibata, K., Fukuda, M. and Mikoshiba, K. (1998). Inositol-1,3,4,5-tetrakisphosphate

binding activities of neuronal and nonneuronal synaptotagmins. J Biol Chem 273,

12267-12273.

236


Imoto, M., Morii, T., Deguchi, A. and Umezawa, K. (1994). Involvement of

phosphatidylinositol synthesis in the regulation of S phase induction. Exp Cell Res

215, 228-233.

Irvine, R. (2000). Nuclear Lipid Signalling. Science's stke <www.stke.org/> , 1-12.

Ishihara, H., Shibasaki, Y., Kizuki, N., Katagiri, H., Yazaki, Y., Asano, T. and Oka, Y.

(1996). Cloning of cDNAs encoding two isoforms of 68-kDa type I

phosphatidylinositol-4-phosphate 5-kinase. JBiol Chem 271, 23611-23614.

Ishihara, H., Shibasaki, Y., Kizuki, N., Wada, T., Yazaki, Y., Asano, T. and Oka, Y.

(1998). Type I phosphatidylinositol-4-phosphate 5-kinases. Cloning of the third

isoform and deletion/substitution analysis of members of this novel lipid kinase

family. JBiol Chem 273, 8741-8748.

Itoh, T., Koshiba, S., Kigawa, T., Kikuchi, A., Yokoyama, S. and Takenawa, T. (2001).

Role of the ENTH Domain in Phosphatidylinositol-4,5-Bisphosphate Binding and

Endocytosis. Science 291, 1047-1051.

Jefferson, A. B. and Majerus, P. W. (1995). Properties of type II inositol polyphosphate

5-phosphatase. JBiol Chem 270, 9370-9377.

Jenkins, G. H., Fisette, P. L. and Anderson, R. A. (1994). Type I phosphatidylinositol 4-

phosphate 5-kinase isoforms are specifically stimulated by phosphatidic acid. J Biol

Chem 269, 11547-11554.

Jiang, T., Sweeney, G., Rudolf, M. T., Klip, A., Traynor-Kaplan, A. and Tsien, R. Y.

(1998). Membrane-permeant Esters of Phosphatidylinositol 3,4,5-Trisphosphate. J

Biol Chem 273, 11017-11024.

Jimenez-Garcia, L. F. and Spector, D. L. (1993). In vivo evidence that transcription and

splicing are coordinated by a recruiting mechanism. Cell 73, 47-59.

Jones, D. H., Morris, J. B., Morgan, C. P., Kondo, H., Irvine, R. F. and Cockcroft, S.

(2000). Type I phosphatidylinositol 4-phosphate 5-kinase directly interacts with

ADP-ribosylation factor 1 and is responsible for phosphatidylinositol 4,5-

bisphosphate synthesis in the golgi compartment. J Biol Chem 275, 13962-13966.

Jones, S. M., Alb, J. G., Phillips, S. E., Bankaitis, V. A. and Howell, K. E. (1998). A

phosphatidylinositol 3-kinase and phosphatidylinositol transfer protein act

synergistically in formation of constitutive transport vesicles from the trans-Golgi

network. JBiol Chem 273, 10349-10354.

Jorgensen, E. M., Hartwieg, E., Schuske, K., Nonet, M. L., Jin, Y. and Horvitz, H. R.

(1995). Defective recycling of synaptic vesicles in synaptotagmin mutants of

Caenorhabditis elegans. Nature 378, 196-199.

237

http://www.stke.org/


Jost, M., Simpson, F., Kavran, J. M,, Lemmon, M. A. and Schmid, S. L. (1998).

Phosphatidylinositol-4,5-bisphosphate is required for endocytic coated vesicle

formation. Curr Biol 1399-1402.

Kasai, H. (1999). Comparative biology of calcium-dependent exocytosis: implications

of kinetic diversity for secretory function. Trends in Neurosci 22, 88-93.

Katan, M. and Williams, R. L. (1997). Phosphoinositide-specific phospholipase C:

structural basis for catalysis and regulatory interactions. Semin Cell Dev Biol 8,

287-296.

Kavran, J. M., Klein, D. E., Lee, A., Falasca, M., Isakoff, S. J., Skolnik, E. Y. and

Lemmon, M. A. (1998). Specificity and promiscuity in phosphoinositide binding by

pleckstrin homology domains. JBiol Chem 273, 30497-30508.

Kee, Y. and Scheller, R. H. (1996). Localization of synaptotagmin-binding domains on

syntaxin. J Neurosci 16,1975-1981.

Khodakhah, K. and Ogden, D. (1993). Functional heterogeneity of calcium release by

inositol trisphosphate in single Purkinje neurones, cultured cerebellar astrocytes,

and peripheral tissues. Proc Natl Acad Sci U SA 90, 4976-4980.

Khvotchev, M. and Sudhof, T. C. (1998). Newly synthesized phosphatidylinositol

phosphates are required for synaptic norepinephrine but not glutamate or gamma-

aminobutyric-acid (gaba) release. J Biol Chem 273, 21451-21454.

Kim, E., Du, L., Bregman, D. B. and Warren, S. L. (1997). Splicing factors associate

with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J Cell

Biol 136, 19-28.

Kim, K. and Catterall, W. A. (1997). Ca^^-dependent and Ca^"*"-independent

interactions of the isoforms of the alpha(la) subunit of brain Ca^" channels with

presynaptic SNARE proteins, Proc Natl Acad Sci U SA94, 14782-14786.

Klein, D. E., Lee, A., Frank, D. W., Marks, M. S. and Lemmon, M. A. (1998). The

pleckstrin homology domains of dynamin isoforms require oligomerization for high

affinity phosphoinositide binding. J Biol Chem 273, 27725-27733.

Kobrinsky, E., Mirshahi, T., Zhang, H., Jin, T. and Logothetis, D. E. (2000). Receptor-

mediated hydrolysis of plasma membrane messenger PIP2 leads to K+-current

desensitization. Nat Cell Biol 2, 507-514.

Komamitsky, P., Cho, E. J. and Buratowski, S. (2000). Different phosphorylated forms

of RNA polymerase II and associated mRNA processing factors during

transcription. Genes Dev 14, 2452-2460.

238


Krainer, A. R., Maniatis, T., Ruskin, B. and Green, M. R. (1984). Normal and mutant

human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell

36, 993-1005.

Krecic, A. M. and Swanson, M. S. (1999). hnRNP complexes: composition, structure,

and function. Curr Opin Cell Biol 11, 363-371.

Kruhlak, M. J., Lever, M. A., Fischle, W., Verdin, E., Bazett-Jones, D. P. and Hendzel,

M. J. (2000). Reduced Mobility of the Alternate Splicing Factor (ASF) through the

Nucleoplasm and Steady State Speckle Compartments. J Ce// Biol 150, 41-52.

Rubier, E. and Riezman, H. (1993). Actin and fimbrin are required for the

internalization step of endocytosis in yeast. EMBO J 12, 2855-2862.

Kular, G., Loubtchenkov, M., Swigart, P., Whatmore, J., Ball, A., Cockcroft, S. and

Wetzker, R. (1997). Co-operation of phosphatidylinositol transfer protein with

phosphoinositide 3-kinase gamma in the formylmethionyl- leucylphenylalanine-

dependent production of phosphatidylinositol 3,4,5- trisphosphate in human

neutrophils. Biochem J 325, 299-301.

Kwon, O. J., Gainer, H., Wray, S. and Chin, H. (1996). Identification of a novel protein

containing two C2 domains selectively expressed in the rat brain and kidney. FEBS

Lett 31%, 135-139.

Lachyankar, M. B., Sultana, N., Schonhoff, C. M., Mitra, P., Poluha, W., Lambert, S.,

Quesenberry, P. J., Litofsky, N. S., Recht, L. D., Nabi, R. et al (2000). A role for

nuclear PTEN in neuronal differentiation. J Neurosci 20, 1404-1413.

Lallena, M. J. and Correas, I. (1997). Transcription-dependent redistribution of nuclear

protein 4.1 to SC35- enriched nuclear domains. J Cell Sci 110, 239-247.

Lallena, M. J., Martinez, C., Valcarcel, J. and Correas, I. (1998). Functional association

of nuclear protein 4.1 with pre-mRNA splicing factors. J Ce// Sci 111, 1963-1971.

Lamond, A. I. and Earnshaw, W. C. (1998). Structure and function in the nucleus.

Science 280, 547-553.

Larsson, O., Barker, C. J., Sj-oholm, A., Carlqvist, H., Michell, R. H., Bertorello, A.,

Nilsson, T., Honkanen, R. E., Mayr, G. W., Zwiller, J. et al (1997). Inhibition of

phosphatases and increased Ca2+ channel activity by inositol hexakisphosphate.

Science 278, 471-474.

Laux, T., Fukami, K., Thelen, M., Golub, T., Frey, D. and Caroni, P. (2000). GAP43,

MARCKS, and CAP23 modulate PI(4,5)P(2) at plasmalemmal rafts, and regulate

cell cortex actin dynamics through a common mechanism. J Cell Biol 149, 1455-

1472.

239


Lee, A., Frank, D. W., Marks, M. S. and Lemmon, M. A. (1999). Dominant-negative

inhibition of receptor-mediated endocytosis by a dynamin-1 mutant with a

defective pleckstrin homology domain. Curr Biol 9, 261-264.

Lemmon, M. A. and Ferguson, K. M. (2000). Signal-dependent membrane targeting by

pleckstrin homology (PH) domains. Biochem J 1-18.

Lemmon, M. A., Ferguson, K. M., O'Brien, R., Sigler, P. B. and Schlessinger, J. (1995).

Specific and high-affmity binding of inositol phosphates to an isolated pleckstrin

homology domain. Proc Natl Acad Sci US A 9 2 , 10472-10476.

Lemer, E. A., Lemer, M. R., Janeway, C. A., Jr. and Steitz, J. A. (1981). Monoclonal

antibodies to nucleic acid-containing cellular constituents: probes for molecular

biology and autoimmune disease. Proc Natl Acad Sci U S A I S , 2737-2741.

Lev, S., Hernandez, J., Martinez, R., Chen, A., Plowman, G. and Schlessinger, J.

(1999). Identification of a novel family of targets of PYK2 related to Drosophila

retinal degeneration B (rdgB) protein. Mol Cell Biol 19, 2278-2288.

Leveque, C., el Far, O., Martin-Moutot, N., Sato, K., Kato, R., Takahashi, M. and

Seagar, M. J. (1994). Purification of the N-type calcium channel associated with

syntaxin and synaptotagmin. A complex implicated in synaptic vesicle exocytosis.

JBiol Chem 269, 6306-6312.

Levine, T. P. and Munro, S. (1998). The pleckstrin homology domain of oxysterol-

binding protein recognises a determinant specific to Golgi membranes. Curr Biol 8,

729-739.

Li, C., Ullrich, B., Zhang, J. Z., Anderson, R. G., Brose, N. and Sudhof, T. C. (1995).

Ca(2+)-dependent and -independent activities of neural and non-neural

synaptotagmins. Nature 375, 594-599.

Li, W., Llopis, J., Whitney, M., Zlokamik, G. and Tsien, R. Y. (1998). Cell-permeant

caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression.

Nature 392, 936-941.

Lin, H. C., Barylko, B., Achiriloaie, M. and Albanesi, J. P. (1997). Phosphatidylinositol

(4,5)-bisphosphate-dependent activation of dynamin-i and dynamin-II lacking the

proline/arginine-rich domains. JBiol Chem 272, 25999-26004.

Lin, R. C. and Scheller, R. H. (1997). Structural organization of the synaptic exocytosis

core complex. Neuron 19, 1087-1094.

Littleton, J. T., Bai, J. H., Vyas, B., Desai, R., Baltus, A. E., M B., G., Carlson, S. D.,

Ganetzky, B. and Chapman, E. R. (2001). synaptotagmin Mutants Reveal Essential

240


Functions for the C2B domain in Ca^'*'-Triggered Fusion and Recycling of

Synaptic Vesicles In Vivo. J Neurosci 21, 1421-1433.

Littleton, J. T., Chapman, E. R., Kreber, R., Garment, M. B., Carlson, S. D. and

Ganetzky, B. (1998). Temperature-sensitive paralytic mutations demonstrate that

synaptic exocytosis requires SNARE complex assembly and disassembly. Neuron

21,401-413.

Littleton, J. T., Serano, T. L., Rubin, G. M., Ganetzky, B. and Chapman, E. R. (1999).

Synaptic function modulated by changes in the ratio of synaptotagmin I and IV.

Nature 400, 757-760.

Littleton, J. T., Stem, M., Perin, M. and Bellen, H. J. (1994). Calcium dependence of

neurotransmitter release and rate of spontaneous vesicle fusions are altered in

Drosophila synaptotagmin mutants. Proc Natl Acad Sci U SA 91, 10888-10892.

Littleton, J. T., Stem, M., Schulze, K., Perin, M. and Bellen, H. J. (1993). Mutational

analysis of Drosophila synaptotagmin demonstrates its essential role in Ca(2+)-

activated neurotransmitter release. Cell 74, 1125-1134.

Littleton, J. T., Vyas, B., Bai, J. H., Ganetzky, B. and Chapman, E. R. (2000). The C2B-

domain of synaptotagmin is required for calcium-triggered exocytosis and SNARE

clustering. Mol Biol Cell 11, 278A-278A.

Liu, N., Fukami, K., Yu, H. and Takena^va, T. (1996). A new phospholipase C delta 4 is

induced at S-phase of the cell cycle and appears in the nucleus. J Biol Chem 271,

355-360.

Llinas, R., Gruner, J. A., Sugimori, M., McGuinness, T. L. and Greengard, P. (1991).

Regulation by synapsin I and Ca(2+)-calmodulin-dependent protein kinase II of the

transmitter release in squid giant synapse. J Physiol 436, 257-282.

Llinas, R., Sugimori, M., Lang, E. J., Morita, M., Fukuda, M., Niinobe, M. and

Mikoshiba, K. (1994). The inositol high-poly phosphate series blocks synaptic

transmission by preventing vesicular fusion: a squid giant synapse study. Proc Natl

Acad Sci USA 91, 12990-12993.

Llinas, R., Sugimori, M. and Silver, R. B. (1992). Microdomains of high calcium

concentration in a presynaptic terminal. Science 256, 677-679.

Loijens, J. C. and Anderson, R. A. (1996). Type I phosphatidylinositol-4-phosphate 5-

kinases are distinct members of this novel lipid kinase family. J Biol Chem 271,

32937-32943.

Loyet, K. M., Kowalchyk, J. A., Chaudhary, A., Chen, J., Prestwich, G. D. and Martin,

T. F. J. (1998). Specific binding of phosphatidylinositol 4,5-bisphosphate to241


calcium- dependent activator protein for secretion (CAPS), a potential

phosphoinositide effector protein for regulated exocytosis. J Biol Chem 273, 8337-

8343.

Lu, P. J., Hsu, A. L., Wang, D. S., Yan, H. Y., Yin, H. L. and Chen, C. S. (1998).

Phosphoinositide 3-kinase in rat liver nuclei. Biochemistry 37, 5738-5745.

Luzzi, V., Sims, C. E., Soughayer, J. S. and Allbritton, N. L. (1998). The physiologic

concentration of inositol 1,4,5-trisphosphate in the oocytes of Xenopus laevis. J

Biol Chem 273, 28657-28662.

Maraldi, N. M., Marmiroli, S., Cocco, L., Capitani, S., Bamabei, O. and Manzoli, F. A.

(1997). Nuclear lipid-dependent signal transduction in human osteosarcoma cells.

Adv Enzyme Regul 37, 351-375.

Maraldi, N. M., Zini, N., Ognibene, A., Martelli, A. M., Barbieri, M., Mazzotti, G. and

Manzoli, F. A. (1995). Immunocytochemical detection of the intranuclear

variations of phosphatidylinositol 4,5-bisphosphate amount associated with changes

of activity and amount of phospholipase C beta 1 in cells exposed to mitogenic or

differentiating agonists. Biol Cell 83, 201-210.

Maraldi, N. M., Zini, N., Santi, S. and Manzoli, F. A. (1999). Topology of inositol lipid

signal transduction in the nucleus. J Cell Physiol 181, 203-217.

Maraldi, N. M., Zini, N., Santi, S., Riccio, M., Falconi, M., Capitani, S. and Manzoli, F.

A. (2000). Nuclear domains involved in inositol lipid signal transduction. Adv

Enzyme Regul 40, 219-253.

Marchisio, M., Bertagnolo, V., Colamussi, M. L., Capitani, S. and Neri, L. M. (1998).

Phosphatidylinositol 3-kinase in HL-60 nuclei is bound to the nuclear matrix and

increases during granulocytic differentiation. Biochem Biophys Res Commun 253,

346-351.

Marks, B., Stowell, M. H. B., Vallis, Y., Mills, I. G., Gibson, A., Hopkins, C. R. and

McMahon, H. T. (2001). GTPase activity of dynamin and resulting conformation

change are essential for endocytosis. Nature 410, 231-235.

Martelli, A. M., Sang, N., Borgatti, P., Capitani, S. and Neri, L. M. (1999). Multiple

biological responses activated by nuclear protein kinase C. J Cell Biochem 74, 499-

521.

Martin, T. F. (1997a). Phosphoinositides as spatial regulators of membrane traffic. Curr

Opin Neurobiol 7, 331-338.

Martin, T. F. J. (1997b). Stages of regulated exocytosis. Trends Cell Biol 7, 271-276.

242


Martin, T. F. J. (1998). Phosphoinositide lipids as signaling molecules. Common

themes for signal-transduction, cytoskeletal regulation, and membrane trafficking.

Annu Rev Cell Dev Biol 14, 231-264.

Martin-Moutot, N., Charvin, N., Leveque, C., Sato, K., Nishiki, T., Kozaki, S.,

Takahashi, M. and Seagar, M. (1996). Interaction of SNARE complexes with P/Q-

type calcium channels in rat cerebellar synaptosomes. JBiol Chem 271, 6567-6570.

Martinez, I., Chakrabarti, S., Hellevik, T., Morehead, J., Fowler, K. and Andrews, N.

W. (2000). Synaptotagmin VII regulates Ca(2+)-dependent exocytosis of

lysosomes in fibroblasts. J Cell Biol 148, 1141-1149.

Matera, A. G. (1999). Nuclear bodies: multifaceted subdomains of the interchromatin

space. Trends Cell Biol 9, 302-309.

Matera, A. G. and Ward, D. C. (1993). Nucleoplasmic organization of small nuclear

ribonucleoproteins in cultured human cells. J Ce// Biol 121, 715-727.

Matteoli, M., Takei, K., Perin, M. S., Sudhof, T. C. and De Camilli, P. (1992). Exo-

endocytotic recycling of synaptic vesicles in developing processes of cultured

hippocampal neurons. J Ce//5 /o /117, 849-861.

Matthew, W. D., Tsavaler, L. and Reichardt, L. F. (1981). Identification of a synaptic

vesicle-specific membrane protein with a wide distribution in neuronal and

neurosecretory tissue. J Ce// Biol 91, 257-269.

Matthews, G. (1996). Neurotransmitter release. Annu Rev Neurosci 19, 219-233.

Maximov, A., Sudhof, T. C. and Bezprozvanny, I. (1999). Association of neuronal

calcium channels with modular adaptor proteins. J Biol Chem 274, 24453-24456.

Mayer, A., Scheglmann, D., Dove, S., Glatz, A., Wickner, W. and Haas, A. (2000).

Phosphatidylinositol 4,5-bisphosphate regulates two steps of homotypic vacuole

fusion. Mol Biol Cell 11, 807-817.

Mazzotti, G., Zini, N., Rizzi, E., Rizzoli, R., Galanzi, A., Ognibene, A., Santi, S.,

Matteucci, A., Martelli, A. M. and Maraldi, N. M. (1995). Immunocytochemical

detection of phosphatidylinositol 4,5-bisphosphate localization sites within the

nucleus. J Histochem Cytochem 43, 181-191.

McCracken, S., Fong, N., Rosonina, E., Yankulov, K., Brothers, G., Siderovski, D.,

Hessel, A., Foster, S., Shuman, S. and Bentley, D. L. (1997a). 5'-Capping enzymes

are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal

domain of RNA polymerase II. Genes Dev 11, 3306-3318.

McCracken, S., Fong, N., Yankulov, K., Ballantyne, S., Pan, G., Greenblatt, J.,

Patterson, S. D., Wickens, M. and Bentley, D. L. (1997b). The C-terminal domain

243

Chapter 8_____________________________________________________________Re ferences

of RNA polymerase II couples mRNA processing to transcription. Nature 385, 357-

361.

McNew, J. A., Parlati, F., Fukuda, R., Johnston, R. J., Paz, K., Paumet, F., Sollner, T.

H. and Rothman, J. E. (2000). Compartmental specificity of cellular membrane

fusion encoded in SNARE proteins. Nature 407, 153-159.

McPherson, P. S., Garcia, E. P., Slepnev, V. I., David, C., Zhang, X., Grabs, D., Sossin,

W. S., Bauerfeind, R., Nemoto, Y. and De Camilli, P. (1996). A presynaptic

inositol-5-phosphatase. Nature 379, 353-357.

Meier, R., Alessi, D. R., Cron, P., Andjelkovic, M. and Hemmings, B. A. (1997).

Mitogenic activation, phosphorylation, and nuclear translocation of protein kinase

Bbeta. J Biol Chem 272, 30491-30497.

Melcak, I., Cermanova, S., Jirsova, K., Kobema, K., Malinsky, J. and Raska, I. (2000).

Nuclear pre-mRNA compartmentalization: trafficking of released transcripts to

splicing factor reservoirs. Mol Biol Cell 11, 497-510.

Melcak, I., Melcakova, S., Kopsky, V., Vecerova, J. and Raska, I. (2001).

Prespliceosomal Assembly on Microinjected Precursor mRNA Takes Place in

Nuclear Speckles. Mol Biol Cell 12, 393-406.

Mellor, H. and Parker, P. J. (1998). The extended protein kinase C superfamily.

Biochem J332, 281-292.

Mermoud, J. E., Cohen, P. T. and Lamond, A. I. (1994). Regulation of mammalian

spliceosome assembly by a protein phosphorylation mechanism. EMBO J 13, 5679-

5688.

Metjian, A., Roll, R. L., Ma, A. D. and Abrams, C. S. (1999). Agonists cause nuclear

translocation of phosphatidylinositol 3-kinase gamma. A gbetagamma-dependent

pathway that requires the pllOgamma amino terminus. J Biol Chem 274, 27943-

27947.

Mintz, P. J., Patterson, S. D., Neuwald, A. F., Spahr, C. S. and Spector, D. L. (1999).

Purification and biochemical characterization of interchromatin granule clusters.

EMBO J IS, 4308-4320.

Misteli, T. (1999). RNA splicing: What has phosphorylation got to do with it? Curr Biol

9, R198-200.

Misteli, T. (2000a). Cell biology of transcription and pre-mRNA splicing: nuclear

architecture meets nuclear function. J Ce// Sci 113, 1841-1849.

Misteli, T. (2000b). Different site, different splice. Nat Cell Biol 2, E98-E100.

244


Misteli, T., Caceres, J. F., Clement, J. Q., Krainer, A. R., Wilkinson, M. P. and Specter,

D. L. (1998). Serine phosphorylation of SR proteins is required for their

recruitment to sites of transcription in Vwo.J Cell Biol 1 4 3 , 297-307.

Misteli, T., Caceres, J. F. and Spector, D. L. (1997). The dynamics of a pre-mRNA

splicing factor in living cells. Nature 3 8 7 , 523-527.

Misteli, T. and Spector, D. L. (1999). RNA polymerase II targets pre-mRNA splicing

factors to transcription sites in vivo. Mol Cell 3, 697-705.

Miyawaki, A., Llopis, J., Heim, R., McCaffery, J. M., Adams, J. A., Ikura, M. and

Tsien, R. Y. (1997). Fluorescent indicators for Ca2+ based on green fluorescent

proteins and calmodulin. Nature 3 8 8 , 882-887.

Mizutani, A., Fukuda, M., Niinobe, M. and Mikoshiba, K. (1997). Regulation of AP-2-

synaptotagmin interaction by inositol high polyphosphates. Biochem Biophys Res

Commun 2 4 0 , 128-131.

Mochida, S., Fukuda, M., Niinobe, M., Kobayashi, H. and Mikoshiba, K. (1997). Roles

of synaptotagmin C2 domains in neurotransmitter secretion and inositol high-

polyphosphate binding at mammalian cholinergic synapses. Neuroscience 77, 937-

943.

Mochida, S., Sheng, Z. H., Baker, C., Kobayashi, H. and Catterall, W. A. (1996).

Inhibition of neurotransmission by peptides containing the synaptic protein

interaction site of N-type C a 2 + channels. Neuron 1 7 , 7 8 1 - 7 8 8 .

Mohamed, A. J., Vargas, L., Nore, B. F., Backesjo, C. M., Christensson, B. and Smith,

C. I. (2000). Nucleocytoplasmic shuttling of Bruton's tyrosine kinase. J Biol Chem

2 7 5 , 40614-40619.

Moir, R. D., Yoon, M., Khuon, S. and Goldman, R. D. (2000). Nuclear Lamins A and

Bl: Different Pathways of Assembly During Nuclear Envelope Reformation in

Living CqWs.J Cell Biol 1 5 1 , 1155- 1168.

Montzka, K. A. and Steitz, J. A. (1988). Additional low-abundance human small

nuclear ribonucleoproteins: U ll, U12, etc. Proc Natl Acad Sci U S A 8 5 , 8885-

8889.

Mortillaro, M. J., Blencowe, B. J., Wei, X., Nakayasu, H., Du, L., Warren, S. L., Sharp,

P. A. and Berezney, R. (1996). A hyperphosphorylated form of the large subunit of

RNA polymerase 11 is associated with splicing complexes and the nuclear matrix.

Proc Natl Acad Sci U SA 93, 8253-8257.

Myer, V. E. and Young, R. A. (1998). RNA polymerase 11 holoenzymes and

subcomplexes. J Biol Chem 2 7 3 , 27757-27760.

245


Nakielny, S. and Drey fuss, G. (1999). Transport of proteins and RNAs in and out of the

nucleus. Cell 99, 677-690.

Nalefski, E. A. and Falke, J. J. (1996). The C2 domain calcium-binding motif: structural

and functional diversity. Protein Sci 5, 2375-2390.

Neri, L. M., Martelli, A. M., Borgatti, P., Colamussi, M. L., Marchisio, M. and

Capitani, S. (1999). Increase in nuclear phosphatidylinositol 3-kinase activity and

phosphatidylinositol (3,4,5) trisphosphate synthesis precede PKC-zeta translocation

to the nucleus of NGF-treated PC12 cells. FASEB J 13, 2299-2310.

Neri, L. M., Milani, D., Bertolaso, L., Stroscio, M., Bertagnolo, V. and Capitani, S.

(1994). Nuclear translocation of phosphatidylinositol 3-kinase in rat

pheochromocytoma PC 12 cells after treatment with nerve growth factor. Cell Mol

Biol (Noisy-le-grand) 40, 619-626.

Neugebauer, K. M. and Roth, M. B. (1997). Distribution of pre-mRNA splicing factors

at sites of RNA polymerase II transcription. Genes Dev 11, 1148-1159.

Newman, A. (1998). RNA splicing. Curr Biol 8, R903-905.

Nichols, B. J., Ungermann, C., Pelham, H. R., Wickner, W. T. and Haas, A. (1997).

Homotypic vacuolar fusion mediated by t- and v-SNAREs. Nature 387, 199-202.

Niggli, V., Andreoli, C., Roy, C. and Mangeat, P. (1995). Identification of a

phosphatidylinositol-4,5-bisphosphate-binding domain in the N-terminal region of

ezrin. FEBS Lett 316, 172-176.

Niman, H. L., Houghten, R. A., Walker, L. E., Reisfeld, R. A., Wilson, I. A., Hogle, J.

M. and Lemer, R. A. (1983). Generation of protein-reactive antibodies by short

peptides is an event of high frequency: implications for the structural basis of

immune recognition. Proc Natl Acad Sci USA 80, 4949-4953.

Nonet, M. L., Grundahl, K., Meyer, B. J. and Rand, J. B. (1993). Synaptic function is

impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73,

1291-1305.

O'Keefe, R. T., Mayeda, A., Sadowski, C. L., Krainer, A. R. and Spector, D. L. (1994).

Disruption of pre-mRNA splicing in vivo results in reorganization of splicing

factors. J Ce// Biol 124, 249-260.

Odom, A. R., Stahlberg, A., Wente, S. R. and York, J. D. (2000). A role for nuclear

inositol 1,4,5-trisphosphate kinase in transcriptional control. Science 287, 2026-

2029.

Odorizzi, G., Babst, M. and Emr, S. D. (2000). Phosphoinositide signaling and the

regulation of membrane trafficking in yeast. Trends Biochem Sci 25, 229-235.

246


Ohara-Imaizumi, M., Fukuda, M., Niinobe, M., Misonou, H., Ikeda, K., Murakami, T.,

Kawasaki, M., Mikoshiba, K. and Kumakura, K. (1997). Distinct roles of C2A and

C2B domains of synaptotagmin in the regulation of exocytosis in adrenal

chromaffin cells. Proc Natl Acad Sci USA 94, 287-291.

Ohashi, M., Jan de Vries, K., Frank, R., Snoek, G., Bankaitis, V., Wirtz, K. and Huttner,

W. B. (1995). A role for phosphatidylinositol transfer protein in secretory vesicle

formation. Nature 377, 544-547.

Okamoto, M. and Sudhof, T. C. (1997). Mints, munc 18-interacting proteins in synaptic

vesicle exocytosis. J Biol Chem 272, 31459-31464.

Olafsson, P., Soares, H. D., Herzog, K. H., Wang, T., Morgan, J. I. and Lu, B. (1997).

The Ca "*" binding-protein, frequenin is a nervous system-specific protein in mouse

preferentially localized in neurites. Mol Brain Res 44, 73-82.

Olafsson, P., Wang, T. and Lu, B. (1995). Molecular cloning and functional

characterization of the Xenopus Ca(2+)- binding protein frequenin. Proc Natl Acad

Sci U SA 92, 8001-8005.

Osborne, S. L., Herreros, J., Bastiaens, P. I. H. and Schiavo, 0 . (1999). Calcium-

dependent oligomerization of synaptotagmins I and II - Synaptotagmins I and II are

localized on the same synaptic vesicle and heterodimerize in the presence of

calcium. J Biol Chem 274, 59-66.

Osborne, S. L., Thomas, C. L., Gschmeissner, S. and Schiavo, G. (2001). Nuclear

PtdIns(4,5)P2 assembles in a mitotically-regulated particle involved in pre-mRNA

splicing. J Cell Sci In press.

Overton, M. C. and Blumer, K. J. (2000). G-protein-coupled receptors function as

oligomers in vivo. Curr Biol 10, 341-344.

Ozaki, S., DeWald, D. B., Shope, J. C., Chen, J. and Prestwich, G. D. (2000).

Intracellular delivery of phosphoinositides and inositol phosphates using polyamine

carriers. Proc Natl Acad Sci U S A97, 11286-11291.

Pandey, A. and Mann, M. (2000). Proteomics to study genes and genomes. Nature 405,

837-846.

Patturajan, M., Schulte, R. J., Sefton, B. M., Berezney, R., Vincent, M., Bensaude, O.,

Warren, S. L. and Corden, J. L. (1998a). GrowTh-related changes in

phosphorylation of yeast RNA polymerase II. J Biol Chem 273, 4689-4694.

Patturajan, M., Wei, X., Berezney, R. and Corden, J. L. (1998b). A nuclear matrix

protein interacts with the phosphorylated C-terminal domain of RNA polymerase

II. Mol Cell Biol 18, 2406-2415.247


Paul, K. S., Bogan, A. A. and Waters, M. G. (1998). Phosphatidylinositol transfer

protein (PITPalpha) stimulates in vitro intra-Golgi transport. FEES Lett 431, 91-96.

Payrastre, B., Nievers, M., Boonstra, J., Breton, M., Verkleij, A. J. and Van Bergen en

Henegouwen, P. M. (1992). A differential location of phosphoinositide kinases,

diacylglycerol kinase, and phospholipase C in the nuclear matrix. J Biol Chem 267,

5078-5084.

Pederson, T. (2000). Half a century of "The nuclear matrix". Mol Biol Cell 11, 799-805.

Pellizzoni, L., Kataoka, N., Charroux, B. and Dreyfuss, G. (1998). A novel function for

SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing.

Ce//95, 615-624.

Percipalle, P., Zhao, J., Pope, B., Weeds, A., Lindberg, U. and Daneholt, B. (2001).

Actin Bound to the Heterogeneous Nuclear Ribonucleoprotein hrp36 Is Associated

with Balbiani Ring mRNA from the Gene to Polysomes. J Cell Biol 153, 229-235.

Perin, M. S., Brose, N., Jahn, R. and Sudhof, T. C. (1991). Domain structure of

synaptotagmin (p65). J Biol Chem 266, 623-629.

Perin, M. S., Fried, V. A., Mignery, G. A., Jahn, R. and Sudhof, T. C. (1990).

Phospholipid binding by a synaptic vesicle protein homologous to the regulatory

region of protein kinase C. Nature 345, 260-263.

Peters, C., Bayer, M. J., Buhler, S., Andersen, J. S., Mann, M. and Mayer, A. (2001).

Trans-complex formation by proteolipid channels in the terminal phase of

membrane fusion. Nature 409, 581-588.

Peterson, S. R., Jesch, S. A., Chamberlin, T. N., Dvir, A., Rabindran, S. K., Wu, C. and

Dynan, W. S. (1995). Stimulation of the DNA-dependent protein kinase by RNA

polymerase II transcriptional activator proteins. JBiol Chem 270, 1449-1454.

Phair, R. D. and Misteli, T. (2000). High mobility of proteins in the mammalian cell

nucleus. Nature 404, 604-609.

Phillips, A. M., Smith, M., Ramaswami, M. and Kelly, L. E. (2000). The products of the

Drosophila stoned locus interact with synaptic vesicles via synaptotagmin. J

Neurosci 20, 8254-8261.

Pinol-Roma, S. and Dreyfuss, G. (1991). Transcription-dependent and transcription-

independent nuclear transport of hnRNP proteins. Science 253, 312-314.

Pongs, O., Lindemeier, J., Zhu, X. R., Theil, T., Engelkamp, D., Krah-Jentgens, I.,

Lambrecht, H. G., Koch, K. W., Schwemer, J., Rivosecchi, R. et al. (1993).

Frequenin—a novel calcium-binding protein that modulates synaptic efficacy in the

Drosophila nervous system. Neuron 11, 15-28.

248


Popov, S., Rexach, M., Ratner, L., Blobel, B. and Bukrinsky, M. (1998). Viral Protein R

Regulates Docking of the HIV-1 Preintegration Complex to the Nuclear Pore

Complex. J Biol Chem 273, 13347-13352.

Proudfoot, N. (2000). Connecting transcription to messenger RNA processing. Trends

Biochem Sci 25, 290-293.

Qualmann, B., Kessels, M. M. and Kelly, R. B. (2000). Molecular Links between

Endocytosis and the Actin Cytoskeleton. J Cell Biol 150, FI 11-FI 16.

Rameh, L. E., Arvidsson, A., Carraway, K. L., 3rd, Couvillon, A. D., Rathbun, G,,

Crompton, A., VanRenterghem, B., Czech, M. P., Ravichandran, K. S., BurakoE,

S. J. et al. (1997a). A comparative analysis of the phosphoinositide binding

specificity of pleckstrin homology domains. JBiol Chem 272, 22059-22066.

Rameh, L. E. and Cantley, L. C. (1999). The role of phosphoinositide 3-kinase lipil

products in cell function. J Biol Chem 274, 8347-8350.

Rameh, L. E., Tolias, K. F., Duckworth, B. C. and Cantley, L. C. (1997b), A nev

pathway for synthesis of phosphatidylinositol-4,5-bisphosphate. Nature 390, 192-

196.

Rando, O. J., Zhao, I. and Crabtree, G. R. (2000). Searching for a function for nuclea*

actin. Trends Cell Biol 10, 92-97.

Rao, V. D., Misra, S., Boronenkov, I. V., Anderson, R. A. and Hurley, J. H. (1998)

Structure of type Ilbeta phosphatidylinositol phosphate kinase: a protein kinase foil

flattened for interfacial phosphorylation. Cell 94, 829-839.

Rancher, D., Stauffer, T., Chen, W., Shen, K., Guo, S., York, J. D., Sheetz, M. P.ani

Meyer, T. (2000). Phosphatidylinositol 4,5-bisphosphate functions as a seconl

messenger that regulates cytoskeleton-plasma membrane adhesion. Cell 100, 21

228.

Reim, K., Mansour, M., Varoqueaux, F., McMahon, H. T., Sudhof, T. C., Brose, N.anc

Rosenmund, C. (2001). Complexins regulate a late step in Ca2+-depenien

neurotransmitter release. Cell 104, 71-81.

Rettig, J., Heinemann, C., Ashery, U., Sheng, Z. H., Yokoyama, C. T., Catterall, W. A

and Neher, E. (1997). Alteration of Ca^" dependence of neurotransmitter rehas(

by disruption of Ca "*” channel/syntaxin interaction. J Neurosci 17, 6647-6656.

Rettig, J., Sheng, Z. H., Kim, D. K., Hodson, C. D., Snutch, T. P. and Catterall, W A

(1996). Isoform-specific interaction of the alpha (lA) subunits of brain Ci^^

249


channels with the presynaptic proteins syntaxin and SNAP-25. Proc Natl Acad Sci

USA 93, 7363-7368.

Ringstad, N., Nemoto, Y. and De Camilli, P. (1997). The SH3p4/Sh3p8/SH3pl3 protein

family: binding partners for synaptojanin and dynamin via a Grb2-like Src

homology 3 domain. Proc Natl Acad Sci USA 94, 8569-8574.

Robitaille, R., Adler, E. M. and Charlton, M. P. (1990). Strategic location of calcium

channels at transmitter release sites of frog neuromuscular synapses. Neuron 5,

773-779.

Rothman, J. E. (1994). Mechanisms of intracellular protein transport. Nature 372, 55-

63.

Rozelle, A. L., Machesky, L. M., Yamamoto, M., Driessens, M. H. E., Insall, R. H.,

Roth, M. G., LubyPhelps, K., Marriott, G., Hall, A. and Yin, H. L. (2000).

Phosphatidylinositol 4,5-bisphosphate induces actin-based movement of raft-

enriched vesicles through WASP-Arp2/3. Curr Biol 10, 311-320.

Rubbini, S., Cocco, L., Manzoli, L., Lutterman, J., Billi, A. M., Matteucci, A, and

Wirtz, K. W. (1997). Phosphoinositide signalling in nuclei of Friend cells: DMSO-

induced differentiation reduces the association of phosphatidylinositol- transfer

protein with the nucleus. Biochem Biophys Res Commun 230, 302-305.

Saiardi, A., Caffrey, J. J., Snyder, S. H. and Shears, S. B. (2000). Inositol polyphosphate

multikinase (ArgRIII) determines nuclear mRNA export in Saccharomyces

cerevisiae. FEBS Lett 468, 28-32.

Sakisaka, T., Itoh, T., Miura, K. and Takenawa, T. (1997). Phosphatidylinositol 4,5-

bisphosphate phosphatase regulates the rearrangement of actin filaments. Mol Cell

B W 17, 3841-3849.

Salim, K., Bottomley, M. J., Querfurth, E., Zvelebil, M. J., Gout, 1., Scaife, R.,

Margolis, R. L., Gigg, R., Smith, C. 1., Driscoll, P. C. et a l (1996). Distinct

specificity in the recognition of phosphoinositides by the pleckstrin homology

domains of dynamin and Bruton's tyrosine kinase. EMBO J 15, 6241-6250.

Schiavo, G. and Bisson, R. (1989). Oxygen influences the subunit structure of

cytochrome c oxidase in the slime mold Dictyostelium discoideum. J Biol Chem

264, 7129-7134.

Schiavo, G., Gu, Q.-M., Prestwich, G. D., Sollner, T. H. and Rothman, J. E. (1996).

Calcium-dependent switching of the specificity of phosphoinositide binding to

synaptotagmin. Proc Natl Acad Sci U SA 93, 13327-13332.

250


Schiavo, G., Herreros, J., Iglesias, T., Lalli, G., Osborne, S. L. and Thomas, C. L.

(1999). Molecular analysis of regulated secretion. In Molecular Mechanisms o f

Transcellular Signalling, (ed. J. P. Thiery), pp. 221-235: IQS Press.

Schiavo, G., Osborne, S. L. and Sgouros, J. G. (1998). Synaptotagmins - more isoforms

than functions. Biochem Biophys Res Commun 248, 1-8.

Schiavo, G., Stenbeck, G., Sollner, T. H. and Rothman, J. E. (1997). Binding of the

synaptic vesicle protein, synaptotagmin to the plasma membrane t-SNARE, SNAP-

25 can explain docked vesicles at neurotoxin treated synapses. Proc Natl Acad Sci

USA94, 997-1001.

Schivell, A. E., Batchelor, R. H. and Bajjalieh, S. M. (1996). Isoform-specific, calcium-

regulated interaction of the synaptic vesicle proteins SV2 and synaptotagmin. J Biol

Chem 271, 27770-27775.

Schluter, O. M., Schnell, E., Verhage, M., Tzonopoulos, T., Nicoll, R. A., Janz, R.,

Malenka, R. C., Geppert, M. and Sudhof, T. C. (1999). Rabphilin knock-out mice

reveal that rabphilin is not required for rab3 function in regulating neurotransmitter

release. J Neurosci 19, 5834-5846.

Schmidt-Zachmann, M. S., Knecht, S. and Kramer, A. (1998). Molecular

characterization of a novel, widespread nuclear protein that colocalizes with

spliceosome components. Mol Biol Cell 9, 143-160.

Schroeder, S. C., Schwer, B., Shuman, S. and Bentley, D. (2000). Dynamic association

of capping enzymes with transcribing RNA polymerase 11. Genes Dev 14, 2435-

2440.

Sechi, A. S. and Wehland, J. (2000). The actin cytoskeleton and plasma membrane

connection: Ptdlns(4,5)P(2) influences cytoskeletal protein activity at the plasma

membrane. J 5 ' c z 113, 3685-3695.

Selvin, P. R. (2000). The renaissance of fluorescence resonance energy transfer. Nat

Struct Biol 7, 730-734.

Sheng, Z. H., Yokoyama, C. T. and Catterall, W. A. (1997). Interaction of the synprint

site of N-type Ca2+ channels with the C2B domain of synaptotagmin 1. Proc Natl

Acad Sci USA 94, 5405-5410.

Shibasaki, Y., Ishihara, H., Kizuki, N., Asano, T., Oka, Y. and Yazaki, Y. (1997).

Massive actin polymerization induced by phosphatidylinositol-4- phosphate 5-

kinase in vivo. J Biol Chem 272, 7578-7581.

Shuman, S. (1995). Capping enzyme in eukaryotic mRNA synthesis. Prog Nucleic Acid

Res Mol Biol 50, 101-129.

251


Sleeman, J., Lyon, C. E., Platani, M., Kreivi, J. P. and Lamond, A. I. (1998). Dynamic

interactions between splicing snRNPs, coiled bodies and nucleoli revealed using

snRNP protein fusions to the green fluorescent protein. Exp Cell Res 243, 290-304.

Sleeman, J. E. and Lamond, A. I. (1999). Nuclear organization of pre-mRNA splicing

factors. Curr Opin Cell Biol 11, 372-377.

Slot, J. W. and Geuze, H. J. (1985). A new method of preparing gold probes for

multiple-labeling cytochemistry. EurJ Cell Biol 38, 87-93.

Snaar, S. P., Vincent, M. and Dirks, R. W. (1999). RNA polymerase II localizes at sites

of human cytomegalovirus immediate- early RNA synthesis and processing. J

Histochem Cytochem 47, 245-254.

Sollner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H. and Rothman, J. E.

(1993). A protein assembly-disassembly pathway in vitro that may correspond to

sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75, 409-

418.

Sotiropoulos, A., Gineitis, D., Copeland, J. and Treisman, R. (1999). Signal-regulated

activation of serum response factor is mediated by changes in actin dynamics. Cell

98, 159-169.

Spector, D. L. (1990). Higher order nuclear organization; three-dimensional distribution

of small nuclear ribonucleoprotein particles. Proc Natl Acad Sci U S AS7, 147-151.

Spector, D. L., Fu, X. D. and Maniatis, T. (1991). Associations between distinct pre-

mRNA splicing components and the cell nucleus. EMBO J 10, 3467-3481.

Spector, D. L., Goldman, R. D. and Leinwand, L. A. (1998). Metabolic Labelling and

Protein Modification. In Cells: A Laboratory Manual, vol. 1 (ed. 24.21-33.14: Cold

Spring Harbor Laboratory Press.

Squire, A. and Bastiaens, P. I. (1999). Three dimensional image restoration in

fluorescence lifetime imaging microscopy. JMicrosc 193, 36-49.

Stanley, E. F. (1997). The calcium-channel and the organization of the presynaptic

transmitter release face. Trends Neurosci 20, 404-409.

Stauffer, T. P., Ahn, S. and Meyer, T. (1998). Receptor-induced transient reduction in

plasma membrane PtdIns(4,5)P2 concentration monitored in living cells. Curr Biol

8, 343-346.

Stegmann, T. (2000). Membrane fusion mechanisms: The influenza hemagglutinin

paradigm and its implications for intracellular fusion. Traffic 1, 598-604.

252


Stenmark, H., Aasland, R., Toh, B. H. and D'Arrigo, A. (1996). Endosomal localization

of the autoantigen EEAl is mediated by a zinc- binding FYVE finger. J Biol Chem

271, 24048-24054.

Stephens, L. R., Hughes, K. T. and Irvine, R. F. (1991). Pathway of

phosphatidylinositol(3,4,5)-trisphosphate synthesis in activated neutrophils. Nature

351, 33-39.

Stimson, D. T., Estes, P. S., Rao, S., Krishnan, K. S., Kelly, L. E. and Ramaswami, M.

(2001). Drosophila Stoned Proteins Regulate the Rate and Fidelity of Synaptic

Vesicle Internalization. J Neurosci 21, 3034-3044.

Stolz, L. E., Huynh, C. V., Thorner, J. and York, J. D. (1998). Identification and

characterization of an essential family of inositol polyphosphate 5-phosphatases

(INP51, INP52 and INP53 gene products) in the yeast Saccharomyces cerevisiae.

Genetics 148, 1715-1729.

Sudhof, T. C. and Rizo, J. (1996). Synaptotagmins: C2-domain proteins that regulate

membrane traffic. Neuron 17, 379-388.

Sugita, S., Hata, Y. and Südhof, T. C. (1996). Distinct Ca(2+)-dependent properties of

the first and second C2-domains of synaptotagmin I. J Biol Chem 271, 1262-1265.

Sutton, R. B., Davletov, B. A., Berghuis, A. M., Südhof, T. C. and Sprang, S. R. (1995).

Structure of the first C2 domain of synaptotagmin I: a novel Ca^'^/phospholipid-

binding fold. Cell 80, 929-938.

Sutton, R. B., Ernst, J. A. and Brunger, A. T. (1999). Crystal structure of the cytosolic

C2A-C2B domains of synaptotagmin III: Implications for Ca+2-independent

SNARE complex interaction. J Cell Biol 147, 589-598.

Sutton, R. B., Fasshauer, D., Jahn, R. and Brunger, A. T. (1998). Crystal-structure of a

SNARE complex involved in synaptic exocytosis at 2.4 angstrom resolution.

Nature 395, 347-353.

Tahara, M., Coorssen, J. R., Timmers, K., Blank, P. S., Whalley, T., Scheller, R. and

Zimmerberg, J. (1998). Calcium can disrupt the snare protein complex on sea-

urchin egg secretory vesicles without irreversibly blocking fusion. J Biol Chem

273, 33667-33673.

Tall, E. G., Spector, I., Pentyala, S. N., Bitter, I. and Rebecchi, M. J. (2000). Dynamics

of phosphatidylinositol 4,5-bisphosphate in actin-rich structures. Curr Biol 10, 743-

746.

Tanaka, K., Horiguchi, K., Yoshida, T., Takeda, M., Fujisawa, H., Takeuchi, K.,

Umeda, M., Kato, S., Ihara, S., Nagata, S. et al. (1999). Evidence that a253

Tolias, K. F. and Carpenter, C. L. (2000). Enzymes involved in the synthesis of

PtdIns(4,5)P2 and their regulation: Ptdlns kinases and PtdlnsP kinases. In Biology

o f Phosphoinositides, (ed. S. Cockcroft). Oxford University Press.


phosphatidylinositol 3,4,5-trisphosphate-binding protein can function in nucleus. J

Biol Chem 274, 3919-3922.

Tandon, A., Bannykh, S., Kowalchyk, J. A., Banerjee, A., Martin, T. F. J. and Balch,

W. E. (1998). Differential regulation of exocytosis by calcium and CAPS in

semiintact synaptosomes. Neuron 21, 147-154.

Tanner, S., Stagljar, I., Georgiev, O., Schaffiier, W. and Bourquin, J. P. (1997). A novel

SR-related protein specifically interacts with the carboxy- terminal domain (CTD)

of RNA polymerase II through a conserved interaction domain. Biol Chem 378,

565-571.

Thoidis, G., Chen, P., Pushkin, A. V., Vallega, G., Leeman, S. E., Fine, R. E. and

Kandror, K. V. (1998). 2 distinct populations of synaptic-like vesicles from rat-

brain. Proc Natl Acad Sci U SA95, 183-188.

Thomas, C. L., Steel, J., Prestwich, G. D. and Schiavo, G. (1999a). Generation of

phosphatidylinositol-specific antibodies and their characterization. Biochem Soc

Trans 27, 648-652.

Thomas, D. M., Ferguson, G. D., Herschman, H. R. and Elferink, L. A. (1999b).

Functional and biochemical analysis of the C2 domains of synaptotagmin IV. Mol

Biol Cell 10, 2285-2295.

Thomas, G. M., Cunningham, E., Fensome, A., Ball, A., Totty, N. F., Truong, O.,

Hsuan, J. J. and Cockcroft, S. (1993). An essential role for phosphatidylinositol

transfer protein in phospholipase C-mediated inositol lipid signaling. Cell 74, 919-

928.

Thomson, A. M. (2000). Facilitation, augmentation and potentiation at central synapses.

Trends Neurosci 23, 305-312.

Tobi, D., Wiser, O., Trus, M. and Atlas, D. (1998). N-type voltage-sensitive calcium

channel interacts with syntaxin, synaptotagmin and SNAP-25 in a multiprotein

complex. Recept Channel 6, 89-98.

Tokumaru, H., Umayahara, K., Pellegrini, L. L., Ishizuka, T., Saisu, H., Betz, H.,

Augustine, G. J. and Abe, T. (2001). SNARE complex oligomerization by

synaphin/complexin is essential for synaptic vesicle exocytosis. Cell 104, 421-432.

Tolias, K. F., Hartwig, J. H., Ishihara, H., Shibasaki, Y., Cantley, L. C. and Carpenter,

C. L. (2000). Type ialpha phosphatidylinositol-4-phosphate 5-kinase mediates rac-

dependent actin assembly. Curr Biol 10, 153-156.

Tolias, K. F., Rameh, L. E., Ishihara, H., Shibasaki, Y., Chen, J., Prestwich, G. D.,

Cantley, L. C. and Carpenter, C. L. (1998). Type I phosphatidylinositol-4-

254


phosphate 5-kinases synthesize the novel lipids phosphatidylinositol 3,5-

bisphosphate and phosphatidylinositol 5- phosphate. J Biol Chem 273, 18040-

18046.

Ubach, J., Garcia, J., Nittler, M. P., Sudhof, T. C. and Rizo, J. (1999). Structure of the

Janus-faced C2B domain of rabphilin. Nat Cell Biol 1, 106-112.

Ungermann, C., Sato, K. and Wickner, W. (1998). Defining the functions of trans-

SNARE pairs. Nature 396, 543-548.

Vallis, Y., Wigge, P., Marks, B., Evans, P. R. and McMahon, H. T. (1999). Importance

of the pleckstrin homology domain of dynamin in clathrin- mediated endocytosis.

Curr Biol 9, 257-260.

Vann, L. R., Wooding, F. B., Irvine, R. F. and Divecha, N. (1997). Metabolism and

possible compartmentalization of inositol lipids in isolated rat-liver nuclei. Biochem

J327, 569-576.

Vician, L., Lim, I. K., Ferguson, G., Tocco, G., Baudry, M. and Herschman, H. R.

(1995). Synaptotagmin IV is an immediate early gene induced by depolarization in

PC 12 cells and in brain. Proc Natl Acad Sci USA 92, 2164-2168.

Vincent, M., Lauriault, P., Dubois, M. F., Lavoie, S., Bensaude, O. and Chabot, B.

(1996). The nuclear matrix protein p255 is a highly phosphorylated form of RNA

polymerase II largest subunit which associates with spliceosomes. Nucleic Acids

Res 24,4649-4652.

von Poser, C., Ichtchenko, K., Shao, X., Rizo, J. and Sudhof, T. C. (1997). The

evolutionary pressure to inactivate. A subclass of synaptotagmins with an amino

acid substitution that abolishes Ca2+ binding. JBiol Chem 272, 14314-14319.

von Poser, C., Zhang, J. Z., Mineo, C., Ding, W., Ying, Y. S., Sudhof, T. C. and

Anderson, R. G. W. (2000). Synaptotagmin regulation of coated pit assembly. J

Biol Chem 275, 30916-30924.

Walch-Solimena, C. and Novick, P. (1999). The yeast phosphatidylinositol-4-OH

kinase pikl regulates secretion at the Golgi. Nat Cell Biol 1, 523-525.

Wang, C., Chua, K., Seghezzi, W., Lees, E., Gozani, O. and Reed, R. (1998).

Phosphorylation of spliceosomal protein SAP 155 coupled with splicing catalysis.

Genes Dev 12, 1409-1414.

Warren, S. L., Landolfi, A. S., Curtis, C. and Morrow, J. S. (1992). Cytostellin: a novel,

highly conserved protein that undergoes continuous redistribution during the cell

cyclQ. J Cell Sci 103, 381-388.

255


Watton, S. J. and Downward, J. (1999). Akt/PKB localisation and 3' phosphoinositide

generation at sites of epithelial cell-matrix and cell-cell interaction. Curr Biol 9,

433-436.

Way, G., O'Luanaigh, N. and Cockcroft, S. (2000). Activation of exocytosis by cross-

linking of the IgE receptor is dependent on ADP-ribosylation factor 1-regulated

phospholipase D in RBL- 2H3 mast cells: evidence that the mechanism of

activation is via regulation of phosphatidylinositol 4,5-bisphosphate synthesis.

Biochem J346, 63-70.

Weber, T., Zemelman, B. V., McNew, J. A., Westermann, B., Gmachl, M. J., Parlati, F.,

Sollner, T. H. and Rothman, J. E. (1998). SNAREpins: minimal machinery for

membrane fusion. Cell 92, 759-772.

Weisz, O. A., Gibson, G. A., Leung, S. M., Roder, J. and Jeromin, A. (2000).

Overexpression of Frequenin, a Modulator of Phosphatidylinositol 4- Kinase,

Inhibits Biosynthetic Delivery of an Apical Protein in Polarized Madin-Darby

Canine Kidney Cells. J Biol Chem 275, 24341-24347.

Wiedemann, C., Schafer, T. and Burger, M. M. (1996). Chromaffin granule-associated

phosphatidylinositol 4-kinase activity is required for stimulated secretion. EMBO J

15, 2094-2101.

Wiedemann, C., Schafer, T., Burger, M. M. and Sihra, T. S. (1998). An essential role

for a small synaptic vesicle-associated phosphatidylinositol 4-kinase in

neurotransmitter release. J Neurosci 18, 5594-5602.

Witke, W., Podtelejnikov, A. V., Dinardo, A., Sutherland, J. D., Gumiak, C. B., Dotti,

C. and Mann, M. (1998). In mouse-brain profllin-I and profilin-II associate with

regulators of the endocytic pathway and actin assembly. EMBO J 11, 967-976.

Wong, K., Meyers dd, R. and Cantley, L. C. (1997). Subcellular locations of

phosphatidylinositol 4-kinase isoforms. J Biol Chem 272, 13236-13241.

Woscholski, R., Finan, P. M., Radley, E., Totty, N. F., Sterling, A. E., Hsuan, J. J.,

Waterfield, M. D. and Parker, P. J. (1997). Synaptojanin is the major constitutively

active phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase in rodent brain. J

Biol Chem 272, 9625-9628.

Xue, Y., Canman, J. C., Lee, C. S., Nie, Z., Yang, D., Moreno, G. T., Young, M. K.,

Salmon, E. D. and Wang, W. (2000). The human SWI/SNF-B chromatin-

remodeling complex is related to yeast rsc and localizes at kinetochores of mitotic

chromosomes. Proc Natl Acad Sci U SA 97, 13015-13020.

256


Yamaga, M., Fujii, M., Kamata, H., Hirata, H. and Yagisawa, H. (1999). Phospholipase

C-deltal contains a functional nuclear export signal sequence. J Biol Chem 274,

28537-28541.

Yamamotoa, M., Hilgemanna, D. H., Fenga, S., Bitob, H., Ishiharac, H., Shibasakic, Y.

and Yina , H. L. (2001). Phosphatidylinositol 4,5-Bisphosphate Induces Actin

Stress-fiber Formation and

Inhibits Membrane Ruffling in CVl Cells. J Cell Biol 152, 895-910.

Ye, K., Hurt, K. J., Wu, F. Y., Fang, M., Luo, H. R., Hong, J. J., Blackshaw, S., Ferris,

C. D. and Snyder, S. H. (2000). Pike. A nuclear gtpase that enhances PISkinase

activity and is regulated by protein 4.IN. Cell 103, 919-930.

Yokogawa, T., Nagata, S., Nishio, Y., Tsutsumi, T., Ihara, S., Shirai, R., Morita, K.,

Umeda, M., Shirai, Y., Saitoh, N. et al. (2000). Evidence that 3'-phosphorylated

polyphosphoinositides are generated at the nuclear surface: use of immunostaining

technique with monoclonal antibodies specific for PI 3,4-P-2. FEBS Lett 473, 222-

226.

York, J. and Majerus, P. (1994). Nuclear phosphatidylinositols decrease during S-phase

of the cell cycle in HeLa cells. J Biol Chem 269, 7847-7850.

York, J. D., Odom, A. R., Murphy, R., Ives, E. B. and Wente, S. R. (1999). A

phospholipase C-dependent inositol polyphosphate kinase pathway required for

efficient messenger RNA export. Science 285, 96-100.

Yu, H., Fukami, K., Watanabe, Y., Ozaki, C. and Takenawa, T. (1998).

Phosphatidylinositol 4,5-bisphosphate reverses the inhibition of RNA transcription

caused by histone HI. Eur J Biochem 251, 281-287.

Yu, Y. T., Tam, W. Y., Yario, T. A. and Steitz, J. A. (1996). More Sm snRNAs from

vertebrate cells. Exp Cell Res 229, 276-281.

Yuryev, A., Patturajan, M., Litingtung, Y., Joshi, R. V., Gentile, C., Gebara, M. and

Corden, J. L. (1996). The C-terminal domain of the largest subunit of RNA

polymerase II interacts with a novel set of serine/arginine-rich proteins. Proc Natl

Acad Sci U SA 93, 6975-6980.

Zandomeni, R., Zandomeni, M. C., Shugar, D. and Weinmann, R. (1986). Casein kinase

type II is involved in the inhibition by 5,6-dichloro-l- beta-D-

ribofuranosylbenzimidazole of specific RNA polymerase II transcription. J Biol

Chem 261,3414-3419.

257


Zeng, C., He, D., Berget, S. M. and Brinkley, B. R. (1994a). Nuclear-mitotic apparatus

protein: a structural protein interface between the nucleoskeleton and RNA

splicing. Proc Natl Acad Sci U SA 91, 1505-1509.

Zeng, C., He, D. and Brinkley, B. R. (1994b). Localization of NuMA protein isoforms

in the nuclear matrix of mammalian cells. Cell Motil Cytoskeleton 29, 167-176.

Zhang, J. Z., Davletov, B. A., Südhof, T. C. and Anderson, R. G. (1994).

Synaptotagmin I is a high affinity receptor for clathrin AP-2: implications for

membrane recycling. Cell 78, 751-760.

Zhang, Q., Calafat, J., Janssen, H. and Greenberg, S. (1999). ARF6 is required for

growth factor- and rac-mediated membrane ruffling in macrophages at a stage distal

to rac membrane targeting. Mol Cell Biol 19, 8158-8168.

Zhang, X., Loijens, J. C., Boronenkov, I. V., Parker, G. J., Norris, F. A., Chen, J.,

Thum, O., Prestwich, G. D., Majerus, P. W. and Anderson, R. A. (1997).

Phosphatidylinositol-4-phosphate 5-kinase isozymes catalyze the synthesis of 3-

phosphate-containing phosphatidylinositol signaling molecules. J Biol Chem 272,

17756-17761.

Zhang, X. and Majerus, P. W. (1998). Phosphatidylinositol signalling reactions. Semin

Cell Dev Biol 9, 153-160.

Zhao, K., Wang, W., Rando, O. J., Xue, Y., Swiderek, K., Kuo, A. and Crabtree, G. R.

(1998). Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF

complex to chromatin after T lymphocyte receptor signaling. Cell 95, 625-636.

Zheng, J., Cahill, S. M., Lemmon, M. A., Fushman, D., Schlessinger, J. and Cowbum,

D. (1996). Identification of the binding site for acidic phospholipids on the pH

domain of dynamin: implications for stimulation of GTPase activity. J Mol Biol

255, 14-21.

Zini, N., Martelli, A. M., Cocco, L., Manzoli, F. A. and Maraldi, N. M. (1993).

Phosphoinositidase C isoforms are specifically localized in the nuclear matrix and

cytoskeleton of Swiss 3T3 cells. Exp Cell Res 208, 257-269.

Zini, N., Ognibene, A., Bavelloni, A., Santi, S., Sabatelli, P., Baldini, N., Scotlandi, K.,

Serra, M. and Maraldi, N. M. (1996). Cytoplasmic and nuclear localization sites of

phosphatidylinositol 3- kinase in human osteosarcoma sensitive and multidrug-

resistant Saos-2 cells. Histochem Cell Biol 106, 457-464.

Zucker, R. S. (1999). Calcium- and activity-dependent synaptic plasticity. Curr Opin

Neurobiol 9, 305-313.

258

Date post:	22-Feb-2023
Category:	Documents
Upload:	khangminh22
View:	0 times
Download:	0 times

Phosphatidylinositol (4,5) bisphosphate - UCL Discovery

Documents