Proteome changes in wild and modern wheat leaves upondrought stress by two-dimensional electrophoresisand nanoLC-ESI–MS/MS

Hikmet Budak • Bala Ani Akpinar •

Turgay Unver • Mine Turktas

Received: 30 November 2012 / Accepted: 4 February 2013 / Published online: 27 February 2013

� Springer Science+Business Media Dordrecht 2013

Abstract To elucidate differentially expressed proteins

and to further understand post-translational modifications of

transcripts, full leaf proteome profiles of two wild emmer

(Triticum turgidum ssp. dicoccoides TR39477 and TTD22)

and one modern durum wheat (Triticum turgidum ssp. durum

cv. Kızıltan) genotypes were compared upon 9-day drought

stress using two-dimensional gel electrophoresis and nano-

scale liquid chromatographic electrospray ionization tandem

mass spectrometry methods. The three genotypes compared

exhibit distinctive physiological responses to drought as

previously shown by our group. Results demonstrated that

many of the proteins were common in both wild emmer and

modern wheat proteomes; of which, 75 were detected as

differentially expressed proteins. Several proteins identified

in all proteomes exhibited drought regulated patterns of

expression. A number of proteins were observed with higher

expression levels in response to drought in wild genotypes

compared to their modern relative. Eleven protein spots with

low peptide matches were identified as candidate unique

drought responsive proteins. Of the differentially expressed

proteins, four were selected and further analyzed by quan-

titative real-time PCR at the transcriptome level to compare

with the proteomic data. The present study provides protein

level differences in response to drought in modern and wild

genotypes of wheat that may account for the differences of

the overall responses of these genotypes to drought. Such

comparative proteomics analyses may aid in the better

understanding of complex drought response and may suggest

candidate genes for molecular breeding studies to improve

tolerance against drought stress and, thus, to enhance yields.

Keywords Drought stress � Modern wheat �Wild emmer � nanoLC-ESI–MS/MS � Proteomics � 2-DE

Background

With an ever-increasing world population and global

environmental changes bringing about deleterious effects

on yields, food security has emerged as a major concern

worldwide (Ingram 2011). In contrast to biotic stresses,

yield improvement in response to abiotic stresses, partic-

ularly to drought, has been considered challenging due to

the complex nature of molecular mechanisms governing

the stress responses. Strategies adopted to enhance yields

are generally dependent on geographical regions and

growing seasons, rather than being generic (Sinclair 2011).

A climatic increase of 1 �C has been implicated in

decreasing yields up to 10 %, while yields in wheat and

maize, major constituents of human consumption, have

already been marked with a declining trend in the last three

decades across the world, due to changing environmental

conditions (Lobell et al. 2011).

Plants are equipped with sophisticated and elaborate

mechanisms to cope with environmental stresses to which

they are constantly subjected to (Ahuja et al. 2010). Of

these, drought is of particular importance (Kantar et al.

2011a; Akpinar et al. 2012). The complex drought response

is initiated by a massive transcriptional reprogramming

upon the perception of water scarcity and is proceeded by

diverse anatomical and physiological alterations such as

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11103-013-0024-5) contains supplementarymaterial, which is available to authorized users.

H. Budak (&) � B. A. Akpinar � T. Unver � M. Turktas

Biological Sciences and Bioengineering Program,

Faculty of Engineering and Natural Sciences, SabancıUniversity, Tuzla, Istanbul 34956, Turkey

e-mail: budak@sabanciuniv.edu

123

Plant Mol Biol (2013) 83:89–103

DOI 10.1007/s11103-013-0024-5

stomatal closure and synthesis of compatible osmolytes

and antioxidants (Ergen and Budak 2009; Ergen et al.

2009; Ahuja et al. 2010). Domestication of crop species

and centuries of cultivation have improved production

yields at the expense of reducing the crop germplasm

diversity; in the process several genes associated with

stress responses have been eradicated. Consequently, gene

banks and landraces have recently gained prominence in

the identification of novel alleles for stress resistance

(Tanksley and McCouch 1997; Bhullar et al. 2009). From

this perspective, wild emmer wheat (Triticum turgidum ssp.

dicoccoides), one of the progenitors of modern cultivated

wheat (Chantret et al. 2005), provides a valuable source for

stress resistance genes and have been utilized in our pre-

vious studies for a better understanding of the drought

stress response in wheat (Ergen and Budak 2009; Ergen

et al. 2009; Kantar et al. 2011b; Lucas et al. 2011a, b).

Comparative transcriptomics approaches to highlight dif-

ferentially expressed genes have been applied successfully,

against both biotic and abiotic stresses (Ergen et al. 2007,

2009; Ergen and Budak 2009; Kantar et al. 2011b). How-

ever, identification of differentially expressed genes solely

is generally not adequate to unravel the underlying

molecular mechanisms of drought stress, since several

transcripts are known to undergo transcriptional, transla-

tional and post-translational modifications. Consequently,

comparative proteomics approach has recently emerged as

a powerful and promising tool to investigate stress

responses of plants (Caruso et al. 2009; Peng et al. 2009;

Zhang et al. 2010; Gao et al. 2011; Shin et al. 2011;

Abdalla and Rafudeen 2012).

A total of 200 wild emmer wheat genotypes originating

from Turkey were previously screened by our group for

drought tolerance, of which 26 genotypes were selected

and further examined. Among these 26 and the modern

durum wheat (Triticum turgidum ssp. durum), three geno-

types were further selected based on their contrasting

responses to prolonged and shock drought stress and uti-

lized for comparative analyses to identify the molecular

differences leading to the contrasting responses (Ergen and

Budak 2009; Ergen et al. 2009). Here, we provide a com-

plementary proteomics analysis to reveal molecular dif-

ferences at the protein level in wild and modern wheat

genotypes in response to prolonged drought stress. By

using a 2-DE approach combined with nanoLC-ESI–MS/

MS, a total of 66 differentially expressed proteins were

identified from the comparison of three wheat genotypes. A

functional classification of these proteins was performed to

reveal putative roles of identified proteins and the relation

of individual proteins to drought response. The present

study provides a source of unique and conserved proteomic

changes in modern durum and its wild relatives in response

to drought, suggesting several candidate genes for

molecular breeding studies for improving drought toler-

ance in wheat.

Materials and methods

Plant materials and stress treatment

Triticum turgidum ssp. dicocoides genotypes TR39477 and

TTD22, along with T. turgidum ssp. durum variety

Kızıltan were selected for this study based on the previous

findings from our group (Ergen and Budak 2009), where

TR39477, Kızıltan and TTD22, respectively, exhibited

mild to severe responses to slow drought application based

on physiological data. The contrasting responses of the

wild genotypes were also confirmed by a subsequent study

(Ergen et al. 2009). Drought stress treatment in this study

was performed as previously described for all genotypes in

three replicates (Ergen and Budak 2009). Briefly, seeds of

all three genotypes were surface sterilized in 1 % NaOCl

and pre-germinated on petri dishes. Germinated seedlings

of similar growth were transferred to pots that contain 3:2

clay:sand mixture supplemented with 200 ppm N,

2.5 ppm Fe, 100 ppm P, 20 ppm S and 2 ppm Zn. Plants

were grown under controlled conditions: 10–12 h photo-

period, 25 ± 3 �C temperature. Four weeks of normal

growth with stable irrigation and random positioning of

plants was followed by the application of drought stress by

withholding water for 9 days, while remaining control

plants were continuously irrigated. After 9-day-drought

treatment leaf samples were collected and stored at

-80 �C.

Protein isolation

Sample preparation was performed according to Proteome

Factory’s 2DE sample preparation protocol. Briefly,

300 mg of leaf sample was ground in liquid nitrogen and

mixed with six volumes of sample preparation buffer (9 M

urea, 2 % ampholytes and 70 mM DTT). 1 volume of glass

beads was added and vortexed eight times for 1 min. After

incubation for 20 min at room temperature and centrifu-

gation for 45 min at 13,0009g, the supernatant was col-

lected and stored at -80 �C.

2-Dimensional gel electrophoresis (2-DE)

120 lg of protein was applied to vertical rod gels (9 M

urea, 4 % acrylamide, 0.3 % PDA, 5 % glycerol, 0.06 %

TEMED and 2 % carrier ampholytes (pH 2–11), 0.02 %

APS) for IEF (isoelectric focusing) at 8820 Vh in the first

dimension. After focusing, the IEF gels were incubated

in equilibration buffer, containing 125 mM trisphosphate

90 Plant Mol Biol (2013) 83:89–103

123

(pH 6.8), 40 % glycerol, 65 mM DTT, and 3 % SDS for

10 min and subsequently frozen at -80 �C. The second

dimension SDS-PAGE gels (20 cm 9 30 cm 9 0.1 cm)

were prepared, containing 375 mM Tris–HCl buffer (pH

8.8), 12 % acrylamide, 0.2 % bisacrylamide, 0.1 % SDS

and 0.03 % TEMED. After thawing, the equilibrated IEF

gels were immediately applied to SDS-PAGE gels. Elec-

trophoresis was performed at 140 V for 5 h and 15 min.

After 2DE separation, the gels were stained with FireSilver

(Proteome Factory, PS-2001).

Image analysis

The 2DE gels used for comparison analysis were digitized

at a resolution of 150 dpi using a PowerLook 2100XL

scanner with transparency adapter. Two-dimensional

image analysis was performed using the Proteomweaver

software (Definiens AG, Munich, Germany) to identify

differentially regulated proteins on 2DE gels.

In-gel digestion

Protein spots were selected (under a clean bench), 29

washed (50 mM ammonium bicarbonate), dyed and

digested by 20 ll trypsin (Promega, Mannheim, Germany)

over night at 37 �C.

Protein identification

The nanoLC-ESI–MS/MS system consisted of an Agilent

1100 nanoLC system (Agilent, Boeblingen, Germany),

PicoTip emitter (New Objective, Woburn, USA) and an

Esquire 3000 plus ion trap MS (Bruker, Bremen, Ger-

many). In-gel digested protein spots were used for the

analysis. After trapping and desalting the peptides on an

enrichment column (Zorbax SB C18, 0.3 9 5 mm, Agi-

lent) using 1 % acetonitrile/0.5 % formic acid solution for

5 min, peptides were separated on a Zorbax 300 SB C18,

75 lm 9 150 mm column (Agilent) using an acetonitrile/

0.1 % formic acid gradient from 5 to 40 % acetonitril for

40 min. MS spectra were automatically taken by Esquire

3000 plus according to manufacturer’s instrument settings

for nanoLC-ESI–MS/MS analyses. Ion charge in search

parameters for ions from ESI–MS/MS data acquisition

were set to ‘‘1?, 2? or 3?’’ according to the instrument’s

and method’s common charge state distribution.

Database search and functional classification

MASCOT search engine (Matrix Science) was used for

MS/MS data analysis and NCBI (National Center for

Biotechnology Information, Bethesda, USA) was set as the

target protein sequence database. Functional classification

was performed with the Clusters of Orthologous Groups of

proteins (COG) tool of NCBI (http://www.ncbi.nlm.nih.

gov/COG/).

Quantitative real-time PCR (RT-qPCR) analysis

To design primers, four protein sequences, ribulose-1,

5-biphosphate carboxylase/oxygenease large subunit (RuBi-

sCO), manganese superoxide dismutase (MnSOD), glutathione

transferase (GST), and ferredoxin-NADP(H) oxidoreductase

(FNR), obtained from nanoLC-ESI–MS/MS analysis were

searched against non-redundant protein databases of Triti-

cum aestivum due to limited availability of T. dicoccoides

and T. durum sequences in the corresponding databases.

The coding DNA sequences (CDS) of the best hits of the

selected four proteins were retrieved. RT-qPCR primers

were designed with Primer3 using the following criteria:

optimum product size is 50–150 bp, accepted up to

200–250 bp; GC content is 30–80 %; runs of identical

nucleotides are not allowed; more than two G’s or C’s are

avoided as the last 5 bases of the 30 end. Further analysis of

the primers was performed with IDT DNA OligoAnalyzer

(www.idtdna.com/analyzer/applications/oligoanalyzer) to

select primer pairs with the least potential of hairpin and

dimer formation. The primers used for RT-qPCR were the

following: GST Forward: TCGTGTACGAGTGCCTCA

TC; GST Reverse: GGTGTAGGGGAAGTGGTTGA; FNR

Forward: ACTTCGACGTTCCACTGCTC; FNR Reverse:

TGGGAGATGCTCAAGAAGGA; MnSOD Forward: CAG

AGGGTGCTGCTTTACAA; MnSOD Reverse: TCCAGAT

GTTGGTCAGGTAGTC; Rubisco Forward: TGGCAGCA

TTCCGAGTAAG; Rubisco Reverse: GCAACAGGCTCG

ATGTGATA.

Total RNA was isolated from 200 mg frozen leaf sam-

ples using Trizol reagent (Invitrogen) according to manu-

facturer’s instructions with minor modifications (Budak

et al. 2006; Kantar et al. 2010). The quality and quantity of

isolated leaf RNAs were measured using a Nanodrop ND-

100 spectrophotometer (Nanodrop Technologies, Wil-

mington, DE, USA). The integrity of the isolated RNA was

assessed by running on 2 % agarose gel. DNase treatment

was performed in 10 ll reaction mixture containing 19

reaction buffer with MgCl2, 1 lg of total RNA, and 1 U of

RNase-free DNase I (Fermentas) (Ergen et al. 2007). The

reaction mixture was incubated at 37 �C for 30 min and

terminated by the addition of 1 ll of 25 mM EDTA fol-

lowed by incubation at 65 �C for 10 min. DNase-treated

samples were purified by ethanol precipitation and dis-

solved in 20 ll RNase-free water (Kantar et al. 2010).

Purified RNA samples were stored at -80 �C.

Total cDNAs were synthesized from 200 ng RNA using

Transcriptor First Strand cDNA Synthesis kit from Roche

Applied Science (Cat no: 04379012001) according to

Plant Mol Biol (2013) 83:89–103 91

123

manufacturer’s instructions. RT-qPCR was performed as

follows: 1 ll of synthesized cDNA was amplified with 300

nM of specific primers in a total of 20 ll volume using

FastStart Universal SYBR Green Master (Rox) from Roche

Applied Sciences (Cat No: 04913850001) with ICycler

Multicolor Real-time PCR Detection Systems (Bio-Rad

Laboratories). The quantification was performed using 18S

rRNA (GenBank ID: AF147501, forward: GTGACGGGTG

ACGGAGAATT and reverse: GACACTAATGCGCCCG

GTAT) as a reference gene and three independent RT-

qPCR results were averaged. Specified RT-qPCR thermal

setup was adjusted as follows: heated to 95 �C for 15 min,

followed by 40 cycles of 95 �C for 10 s, 54.5 �C for 30 s,

72 �C for 30 s followed by 72 �C for 20 min. The melting

curves were generated using the following program: PCR

products were denatured at 95 �C and cooled to 55 �C. The

fluorescence signals were collected continuously from 55

to 95 �C as the temperature increased at 0.5 �C per second

for 80 cycles with a dwell time of 00:10.

Results

Plant growth response to drought

To investigate the responses of modern durum and wild

emmer wheat to drought stress, plants were subjected to

9-day water deficit. In drought treated plants leaves were

desiccated, wilted and faded, while control plants showed

normal growth and sustained turgescence. Species

responded to drought stress at varying degrees, in accor-

dance with our previous results (Ergen and Budak 2009).

Based on the physiological data, Triticum dicoccoides

genotype TTD22 was severely affected from drought,

whereas genotype TR39477 was observed as the most

tolerant genotype. Triticum durum variety Kızıltan exhib-

ited an intermediate response upon 9-day drought stress.

2-DE maps

To assess proteome level responses of wheat under drought

stress, leaf proteins were analyzed by 2-DE. We detected

500 protein spots on 2-DE maps for each leaf proteome.

Representative 2-DE maps from drought-stressed and

control TR39477 plants are shown in Fig. 1. Comparing

2-DE maps of drought stressed and control samples, 30

protein spots were identified to be differentially expressed.

Moreover, comparison of the 2-DE maps from stressed

samples from three varieties revealed additional 36 dif-

ferentially expressed proteins. Some of these differentially

expressed spots are indicated in Fig. 2.

Protein identification

In total, 75 differentially expressed protein spots were

detected, of which 66 could be recovered from the gel.

Peptide sequences, including respective isoforms and sub-

units, were successfully identified by nanoLC-ESI–MS/

MS. Elimination was performed based on a probability

threshold of greater than 40 (Supplementary Table 1).

Thirty-six differentially expressed protein spots were

identified from the comparison of drought stressed

T. durum and T. dicocoides maps (Table 1). Twenty-two

out of 36 proteins were found at higher levels in at least

one wild emmer genotype compared to durum wheat under

drought stress. Eighteen of these 36 proteins were induced

in both wild genotypes more than the modern variety.

Alternately, 11 differentially expressed proteins (out of

total 36) were found to be more abundant in drought

stressed maps of T. durum than that of any T. dicoccoides

10 kDa

MW 150 kDa

IP3 IP11 Fig. 1 2-DE gel of drought-

stressed (right) and control (left)

TR39477 leaf proteins.

Isoelectric point (IP) and

molecular weight (MW) were

shown on the gel

92 Plant Mol Biol (2013) 83:89–103

123

genotypes used. Three proteins (spots 10, 12 and 39)

exhibited higher expression levels in the tolerant genotype,

TR39477, but lower expression levels in sensitive geno-

type, TTD22, in comparison to durum wheat (Table 1).

Differentially regulated proteins identified by species-spe-

cific comparisons are given in detail in Supplementary

Table 1.

Among 66, the remaining 30 protein spots were found

by comparing drought stressed samples of three genotypes

to their controls. Out of 30 proteins, 14 exhibited down-

regulation, whereas 8 showed upregulation in response to

drought in each genotype where the detection of regulation

was possible. One of the proteins (spot 45) was found to be

upregulated in wild emmer wheat, but downregulated in

durum wheat. Conversely, 2 proteins (spots 49 and 59)

appeared to be upregulated in durum wheat, but down-

regulated in wild emmer genotypes. One protein exhibited

higher expression only in the tolerant T. dicoccoides

genotype, TR39477, upon drought stress (Table 2). These

differentially regulated 30 proteins identified by treatment-

specific comparisons are given in detail in Supplementary

Table 1.

Functional classification of drought-responsive proteins

A total of 66 protein spots were identified by nanoLC-ESI–

MS/MS, of which 4 spots did not give statistically signif-

icant protein matches. Of the remaining 62 protein spots,

46 could be assigned to known proteins, whereas 16 gave

hits to hypothetical/unknown proteins and their isoforms.

Protein spots corresponding to known proteins were clas-

sified into eight functional classes which are clustered into

5 broad categories (Fig. 3, Supplementary Table 1). Some

proteins were identified from multiple spots. Eleven of

these proteins were detected more than once even in the

same gel with different pI and/or MW. Proteins detected

multiple times with the same pI and MW include (1,3;1,4)

beta glucanase (spots 62, 70), polyamine oxidase (spots 31,

32, 45), cell wall beta glucosidase (spots 17, 18), triose-

phosphate isomerase (spots 10, 41) and Os03g0786100

(spots 48, 56) (Supplementary Table 1).

Among the functionally annotated proteins, carbohy-

drate transport and metabolism related proteins formed the

largest group, with 17 members. Other major protein

groups identified were energy production and conversion

(13) and amino acid transport and metabolism (6), which

are followed by minor groups of posttranslational modifi-

cation, protein turnover, chaperones (3), translation, ribo-

somal structure and biogenesis (3), inorganic ion transport

and metabolism (2), transcription (1) and general function

(1).

We identified 11 proteins with low peptide match scores

to known protein sequences implying possible unique

protein candidates for drought response mechanism in

plants (Table 3). Two of these proteins (spots 38 and 40)

showed a higher expression level in wild species under

drought conditions. Overall, 4 of these proteins (spots 38,

70, 71, 73) were detected to be upregulated under drought

stress. Moreover, four spots did not match to any known

proteins (Tables 1, 2), of which two spots (spot 4 and 63)

had increased expression upon drought stress in both wild

and modern wheats.

Expression level analysis of selected protein encoding

genes

Quantification of mRNA levels of four selected proteins,

RuBisCO, MnSOD, GST and FNR was performed by RT-

qPCR. For some cultivars and stress conditions, level of

transcript change was in accordance with the change in

protein level. Interestingly, for RuBisCO, RT-qPCR

revealed a marked decrease in transcript levels in all three

genotypes upon drought stress as shown in Fig. 4a

(1,076.1, 12.1 and 41.8 fold in Kızıltan, TR39477 and

Fig. 2 Drought responsive protein spots excised from 2D gels. Left

Comparison between total leaf proteins of wild genotypes TR39477

and TTD22 treated with water deficit shows the spots 3 and 5. Middle

Spots 10 and 15 were detected by comparing drought treated

TR39477 and Kızıltan. Right Spot 68 was found in gel maps of

drought treated Kızıltan and control Kızıltan leaf proteins

Plant Mol Biol (2013) 83:89–103 93

123

TTD22, respectively. At the proteome level, however, all

genotypes exhibited elevated levels of RuBisCO in

response to drought (spots 64 and 66), with the highest

level observed in drought-tolerant wild genotype,

TR39477, whereas the lowest level observed in modern

durum wheat Kızıltan (spots 26, 28, 34 and 38). For

MnSOD (spot 72), all genotypes exhibited increased pro-

tein levels in response to drought stress, with the highest

upregulation observed in durum wheat, Kızıltan. A 1.7 and

26.7 fold increase in transcript levels in drought stressed

TR39477 and TTD22 genotypes, respectively, was in

accordance with the increased protein levels; whereas a

statistically significant increase could not be observed in

drought treated modern genotype, Kızıltan (Fig. 4b).

Similarly, glutathione transferase (spot 71) exhibited 1.4

and 15.4 fold increases in mRNA levels in drought stressed

Kızıltan and TTD22 genotypes, respectively, in accordance

with the protein levels. However, the transcript and protein

levels of genotype TR39477 showed a contrasting pattern

of regulation upon drought stress. Glutathione transferase

Table 1 Proteins that show cultivar-specific differential expression patterns

Spot no Annotation Functional category TR/

Kn

TTD/

Kn

TR/

TTD

3 atp1 Energy metabolism 1.29 1.14 1.13

4 No significant result – 1.32 3.55 0.37

5 Nuclear localization sequence binding protein (ISS) Information storage and processing 0.99 0.65 1.54

6 Peroxisomal (S)-2-hydroxy-acid oxidase Energy metabolism 2.26 1.42 1.59

7 Os03g0786100 Unknown/hypothetical 5.04 4.21 1.20

8 Elongation factor 1-alpha Information storage and processing 1.02 NA NA

9 Elongation factor 1-alpha Information storage and processing 0.36 NA NA

10 Triosephosphate isomerase, cytosolic Carbohydrate metabolism 1.23 0.67 1.84

11 Putative aconitate hydratase, cytoplasmic Carbohydrate metabolism NA NA 1.66

12 Glycine decarboxylase P subunit Amino acid metabolism 3.60 0.70 5.15

13 Hypothetical protein SORBIDRAFT_01g039390 Unknown/hypothetical 0.22 0.38 0.57

14 Methionine synthase Amino acid metabolism 0.30 0.17 1.81

15 ATP synthase CF1 alpha subunit Energy metabolism 2.60 1.15 2.27

16 Beta-D-glucan exohydrolase Carbohydrate metabolism 0.44 0.58 0.76

17 Cell wall beta-glucosidase Carbohydrate metabolism 0.55 0.64 0.85

18 Cell wall beta-glucosidase Carbohydrate metabolism 0.27 0.23 1.19

19 Hypothetical protein Unknown/hypothetical 3.84 2.10 1.83

20 Catalase-1 Cellular processes 3.08 2.88 1.07

21 UTP-glucose-1-phosphate uridylyltransferase Cellular processes 0.66 NA NA

22 Putative chloroplast inner envelope protein Information storage and processing NA NA 1.29

23 Putative cytochrome c oxidase subunit II PS17 Energy metabolism 0.20 0.41 0.50

24 Unknown [Zea mays] Unknown/hypothetical 3.60 2.17 1.65

25 Os04g0623800 Unknown/hypothetical 0.90 0.93 0.97

26 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism 8.64 6.22 1.39

27 Carbonic anhydrase Cellular processes 5.29 2.39 2.21

28 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism 5.16 3.22 1.60

29 Hypothetical protein Unknown/hypothetical 0.09 0.24 0.40

31 Polyamine oxidase Amino acid metabolism 1.67 2.06 0.81

32 Polyamine oxidase Amino acid metabolism 1.79 2.85 0.63

33 Serine hydroxymethyltransferase Amino acid metabolism NA NA 1.22

34 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism 2.91 2.80 1.04

37 No significant result – 3.37 2.31 1.46

38 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism 2.13 1.93 1.10

39 No significant result – 1.22 1.00 1.23

40 Ribulosebisphosphate carboxylase Carbohydrate metabolism 2.17 2.33 0.93

41 Triosephosphate isomerase, cytosolic Carbohydrate metabolism 3.81 2.73 1.40

Comparisons are given as expression ratios of drought-stressed genotype pairs as assessed from spot values

94 Plant Mol Biol (2013) 83:89–103

123

Table 2 Proteins that show differential expression patterns in response to drought

Spot no Annotation Category TR/TR c TTD/TTD c Kn/Kn c

42 Hypothetical protein OsI_16800 Unknown/hypothetical 0.27 NA NA

43 Hypothetical protein SORBIDRAFT_09g029170 Unknown/hypothetical 0.41 NA 0.29

45 Polyamine oxidase Amino acid metabolism 4.65 4.58 0.87

46 Os02g0101500 Unknown/hypothetical 0.73 0.81 NA

47 Hypothetical protein SORBIDRAFT_01g005960 Unknown/hypothetical 0.69 0.66 0.20

48 Os03g0786100 Unknown/hypothetical 0.50 0.56 0.16

49 Ferredoxin-NADP(H) oxidoreductase Energy metabolism 0.35 0.25 1.28

50 Ferredoxin-NADP(H) oxidoreductase Energy metabolism 0.48 0.23 0.24

51 Putative inorganic pyrophosphatase Energy metabolism NA NA NA

52 Hypothetical protein OsI_16800 Unknown/hypothetical 0.27 NA NA

53 Hypothetical protein LOC100383416 Unknown/hypothetical 0.87 0.40 0.66

54 Dihydrolipoamide dehydrogenase precursor Energy metabolism 0.82 0.62 0.29

56 Os03g0786100 Unknown/hypothetical 0.50 0.56 0.16

58 Putative cytochrome c oxidase subunit II PS17 Energy metabolism NA NA NA

59 Peroxisomal (S)-2-hydroxy-acid oxidase Energy metabolism 0.68 0.43 1.20

60 Ferredoxin-NADP(H) oxidoreductase Energy metabolism 0.58 0.24 0.75

61 Glyoxysomal malate dehydrogenase Energy metabolism 0.57 0.63 0.28

62 (1,3;1,4) Beta glucanase Carbohydrate metabolism NA 1.85 2.58

63 No significant result – 2.83 9.56 3.09

64 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism NA 16.44 NA

65 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism NA NA NA

66 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Carbohydrate metabolism 2.02 5.00 1.64

67 Hypothetical protein SORBIDRAFT_06g023840 Unknown/hypothetical 0.27 NA NA

68 Hypothetical protein SORBIDRAFT_10g022570 Unknown/hypothetical 1.06 0.69 0.68

69 Xyloglucan endotransglycosylase (XET) Carbohydrate metabolism NA NA NA

70 (1,3;1,4) Beta glucanase Carbohydrate metabolism NA 1.85 2.58

71 Glutathione transferase Cellular processes 1.71 3.74 3.11

72 Manganese superoxide dismutase Cellular processes 1.55 1.86 2.63

73 Cold regulated protein Other NA 5.87 NA

74 Putative cytochrome c oxidase subunit II PS17 Energy metabolism NA NA 0.20

TR and TRc: Drought-stressed and control TR39477, respectively, TTD and TTDc: Drought-stressed and control TTD22, respectively, Kn and

Knc: Drought-stressed and control Kızıltan, respectively. Ratios are deduced from spot values

Fig. 3 Functional classification

of the proteins identified in this

study. Functional categories are

given explicitly, while ‘cellular

processes’ and ‘information

processing’ categories are

further divided into 2 functional

groups (see Supplementary

Table 1). Numbers denote the

number of annotated members

in each functional group

Plant Mol Biol (2013) 83:89–103 95

123

Table 3 Proteins that show differential expression patterns in response to drought, but show low-peptide match scores to known protein

sequences

Spot no Annotation Function TR/TR c TTD/TTD c Kn/Kn c

13 Hypothetical protein SORBIDRAFT_01g039390 Unknown/hypothetical 0.22 0.38 0.57

23 Putative cytochrome c oxidase subunit II PS17 Oxidative phosphorylation 0.20 0.41 0.50

38 Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit Photosynthesis 2.13 1.93 1.10

40 Ribulosebisphosphate carboxylase Photosynthesis 2.17 2.33 0.93

43 Hypothetical protein SORBIDRAFT_09g029170 Unknown/hypothetical 0.41 NA 0.29

54 Dihydrolipoamide dehydrogenase precursor Photorespiration 0.82 0.62 0.29

69 Xyloglucan endotransglycosylase (XET) Cytoskeleton related NA NA NA

70 (1,3;1,4) beta glucanase Cytoskeleton related NA 1.85 2.58

71 Glutathione transferase ROS 1.71 3.74 3.11

73 Cold regulated protein Other NA 5.87 NA

74 Putative cytochrome c oxidase subunit II PS17 Oxidative phosphorylation NA NA 0.20

4 No significant result – 1.41 4.40 1.19

37 No significant result – 0.76 0.73 0.33

39 No significant result – 0.95 1.04 1.05

63 No significant result – 2.83 9.56 3.09

Fig. 4 RT-qPCR of selected

proteins with species and/or

treatment-specific expression.

a RuBisCO, b manganese

superoxide dismutase,

c glutathione transferase,

d ferredoxin-

NADP(H) oxidoreductase,

mRNA expression levels in

Kızıltan, TR39477 and TTD22

control and stress samples. kn c:

Kızıltan control, kn s: Kızıltan

stress, tr c: TR39477 control, tr

s: TR39477 stress, ttd c: TTD22

control, ttd s: TTD22 stress

96 Plant Mol Biol (2013) 83:89–103

123

appears to be downregulated at the transcriptome level (1.2

fold decrease in mRNA levels), but upregulated at the

proteome level in response to drought (Fig. 4c). In the case

of ferredoxin-NADP(H) oxidoreductase, protein levels

were generally observed to be lower in drought stressed

plants for all genotypes (spots 49, 50 and 60) with one

exceptional upregulation in Kızıltan variety in response to

drought (spot 49). In contrast, as shown in Fig. 4d, tran-

script levels were upregulated by 6 and 3.6 fold in wild

genotypes, TR39477 and TTD22, respectively, and down-

regulated in Kızıltan variety by onefold in line with the

protein levels for spots 50 and 60.

Discussion

Elucidation of transcriptional changes in response to abi-

otic stress conditions provides clues into how plants cope

with adverse conditions. Additionally, protein-level alter-

ations enhance our understanding of stress responses, as it

is well-known that proteins undergo translational and

post-translational modifications such as glycosylation,

phosphorylation, and methylation. As a result of these

modifications it is highly possible to observe isoforms of

proteins with different molecular weight and/or protein

charge (Caruso et al. 2008, 2009).

Stress responses in plants are often intermingled as one

stress factor can trigger other stresses. For instance,

drought can be accompanied by osmotic and oxidative

stresses (Chinnusamy et al. 2004). Thus, it is not surprising

that several proteins from different pathways are also

involved in the drought response process. In this study, of

all 66 proteins identified, most proteins exhibited the

highest expression level in the drought-tolerant wild

emmer wheat genotype, TR39477, and their lowest

expression was observed in the modern genotype, Kızıltan.

In general, protein levels tend to decrease in response to

drought stress. Therefore, landraces and wild relatives

present a valuable gene pool that is may be lost in the

modern cultivars due to breeding (Tanksley and McCouch

1997), as also evident in this study.

Carbohydrate transport and metabolism

The proteins identified were classified into functional cat-

egories. Differentially expressed proteins that are involved

in the transport and metabolism of carbohydrates formed

the largest group in our study. Inhibitory effects of envi-

ronmental stresses on photosynthetic machinery of plants

are well established; among these stresses drought is of

particular importance (Nogues and Baker 2000; Flexas and

Medrano 2002). Although RuBisCO, a central enzyme in

the photosynthetic machinery, would be expected to be

downregulated due to the inhibition of photosynthesis in

response to drought stress, previous studies showed con-

tradictory results. Some researchers reported its upregula-

tion (Caruso et al. 2008; Moller et al. 2011; Ge et al. 2012),

whereas others found downregulation (Gao et al. 2011) or

even both (Guo et al. 2012) in response to abiotic stresses

such as drought and salinity. In this study, treatment-spe-

cific and species-specific comparisons of 2DE maps

revealed 8 differentially expressed protein spots identified

as the large subunit of ribulose-1.5-bisphosphate carbox-

ylase/oxygenase (RuBisCO) with differing MW and pI

(spots 26, 28, 34, 38, 40, 64, 65 and 66). Being the most

abundant proteins in leaf tissue, RuBisCO subunits have

been reported to be susceptible to fragmentation under

drought stress, possibly leading to isoforms of slightly

different MW/pI (Salekdeh et al. 2002; Ge et al. 2012).

Contrasting patterns of regulation of RuBisCO reported in

different studies were attributed to different sample prep-

aration conditions which may lead to fragmentation of

RuBisCO. RuBisCO fragmentation was also interpreted as

a protein turnover in response to stress (Demirevska et al.

2009; Moller et al. 2011). All RuBisCO large subunit

isoforms detected in this study exhibited upregulation in

response to drought stress and were found at higher levels

in the drought tolerant wild genotype, TR39477. However,

upregulation was also prominent in the sensitive wild

genotype, TTD22. In response to drought, closure of sto-

mata to reduce water loss simultaneously leads to reduction

in CO2 assimilation. At low CO2 to O2 ratios RuBisCO, the

key enzyme of the Calvin cycle, switches to its oxygenase

activity a process known as photorespiration (Nogues and

Baker 2000; Wingler et al. 2000). As a result, an upregu-

lation in RuBisCO levels may also indicate an increase in

the photorespiration rate which may be the case for the

drought sensitive genotype, TTD22. Although this energy-

depleting process is generally considered as damaging to

plants, photorespiration may prevent overreduction and,

thus, photoinhibition of photosystem II, thereby protecting

the photosynthetic electron transport chain (Wingler et al.

2000). In contrast to protein levels, mRNA levels of Ru-

BisCO were downregulated in drought stressed plants in all

three genotypes. It could be argued that under normal

conditions, plant cells harbor high levels of RuBisCO

transcripts and upon stress, these transcripts are quickly

translated into proteins, leading to low levels of transcripts

but high levels of proteins. In addition, it is also possible

that upon perception of stress signalling, RuBisCO tran-

scripts are rapidly degraded for recycling, whereas degra-

dation of existing RuBisCO proteins proceeds more slowly.

The detection of several isoforms of RuBisCO in our study,

suggestive of fragmentation, may be representative of such

an ongoing degradation process.

Plant Mol Biol (2013) 83:89–103 97

123

Another carbohydrate metabolism-related protein, tri-

osephosphate isomerase, identified from two protein spots

(spots 10 and 41), was found to be abundant in the drought

stressed tolerant genotype, TR39477. Triosephosphate

isomerase is an enzyme of the glycolysis pathway, where it

catalyzes isomerisation of dihydroxyacetone phosphate

and D-glyceraldehyde-3-P. Additionally, triosephosphate

isomerase has previously been reported to be upregulated

in a number of studies in crops including wheat, under

abiotic stress conditions (Riccardi et al. 1998; Cui et al.

2005; Yan et al. 2005; Caruso et al. 2008; Gao et al. 2011;

Moller et al. 2011). Our results, in line with previous

reports, may suggest a better utilization of carbohydrates in

drought stress by the drought-tolerant wild genotype,

TR39477.

Among the carbohydrate metabolism related proteins

identified in this study, four were cell wall-related

enzymes: Cell wall beta-glucosidase (spots 17 and 18),

(1–3, 1–4) beta glucanase (spots 62 and 70), xyloglucan

endotransglycosylase (XET, spot 69) and beta-D-glucan

exohydrolase (spot 16). Beta glucanases are hydrolases of

beta glucans, major components of cell walls of plant cells

and are implicated in several processes such as endosperm

development and vegetative growth (Yun et al. 1993;

Hrmova and Fincher 2001; Nishizawa et al. 2003). Beta

glucanases were reported to be upregulated under certain

circumstances such as osmotic stress, pathogen infection

and darkness (Nishizawa et al. 2003; Mohammadi et al.

2007). This supports our data, where the upregulation of

(1–3, 1–4) beta glucanases were in synergy with the

drought tolerance of the respective genotype. Interestingly,

another cell wall-related enzyme, cell wall beta-glucosi-

dase (spots 17 and 18) and beta-D-glucan exohydrolase

(spot 16) exhibited highest levels in the modern wheat

variety Kızıltan. The breakdown of cell wall components

has been implicated to reduce water potential of the cells to

respond to the decreased water potential gradient due to

water scarcity (Mohammadi et al. 2007), and also to pro-

vide energy via the supply of resources when ATP demand

of the cell is high due to an impairment of the photosyn-

thetic machinery (Mohapatra et al. 2010). Thus, it can be

argued that ATP demand is higher in the drought-sensitive

genotypes. The decrease in photosynthetic ability of sen-

sitive varieties under drought stress conditions may force

the cells to switch to alternative sources of sugars.

Energy production and conversion

The second largest group of proteins differentially

expressed under drought stress conditions is composed of

proteins involving energy production and conversion pro-

cesses. Enhanced abundance of ATP-synthesis related

proteins under stress conditions, such as salinity and

drought, has previously been shown by several studies

(Parker et al. 2006; Wang et al. 2008; Gao et al. 2011; Guo

et al. 2012), although contrasting findings have also been

reported (Caruso et al. 2008, 2009; Kausar et al. 2012). An

increase of the level of such proteins, such as ATP syn-

thases, has been implicated to play an indirect role on ion

homeostasis under salt stress, where elevated ATP levels

drive H?-ATPases to generate a proton gradient which, in

turn, drive Na?/H? antiporters to translocate excessive

Na? and Cl- ions into the vacuole or tonoplast (Gao et al.

2011). Although the role of ion transporters in drought

stress response is not fully understood, their involvement in

drought stress is well-established (Ergen and Budak 2009).

Conversely, decreased ATP production via downregulation

of ATP synthase CF1 subunit and atp1 is attributed to

decreased photosynthetic rates in stressed plants (Caruso

et al. 2008, 2009). In this study, ATP synthase CF1 subunit

(spot 15) was found to be expressed at the highest level in

drought-tolerant wild genotype, TR39477, whereas its

expression was very low in modern variety Kızıltan under

drought stress conditions. This response may reflect the

greater ability of the wild relatives to generate ATP under

stress conditions. Similarly, atp1 (spot 3) expression was

observed as the highest in drought tolerant genotype,

TR39477, and the lowest in Kızıltan. Encoded by the

mtDNA, atp1 (also known as, F1-ATP synthase subunit a)

is also closely related to the ATP production (Bergman

et al. 2000), implying that wild genotypes may retain

higher ATP level compared to modern genotype Kızıltan,

under drought stress. However, treatment-specific com-

parisons revealed, the levels of both proteins generally tend

to decrease in response to drought in all three genotypes.

Another protein, aconitate hydratase (spot 11), is an inte-

gral member of the tricarboxylic acid cycle (TCA cycle)

and, thus, closely related to the energy status of a cell. In

this study, aconitate hydratase levels were revealed to be

higher in the resistant wild genotype, TR39477, compared

to the sensitive genotype, TTD22. Aconitate hydratase is

reported to be susceptible to oxidative damage (Navarre

et al. 2000) which is in line with the presented data with

respect to aconitase hydratase (spot 11) and the antioxidant,

catalase-1 (spot 20). A putative cytochrome c oxidase

subunit II PS17, involved in oxidative phosphorylation,

was detected from three spots (spots 23, 58 and 74).

Interestingly, these spots appeared to be downregulated in

response to drought and the drought-stressed wild geno-

type, TR39477, exhibited the lowest levels of the protein.

Considering the function of cytochrome c oxidase as the

terminal enzyme of the respiratory chain of mitochondria,

and previous reports of its induction by high salinity and

pathogen infection (Yan et al. 2005; Shin et al. 2011), the

decrease in the abundance of spots 23 and 74 remains to be

elucidated.

98 Plant Mol Biol (2013) 83:89–103

123

Treatment specific comparisons of three wheat geno-

types yielded three protein spots (49, 50 and 60) with same

or different MW and/or pI revealed to be ferredoxin-

NADP(H) oxidoreductase (FNR) isoforms. FNRs are

involved in the photosynthetic machinery where electrons

are transferred from ferredoxins or flavodoxins to NADPH

and are also implicated in protection against ROS (Caruso

et al. 2008). In fact, isoforms of FNRs are assigned to a

number of functions with differing catalytic properties

(Moolna and Bowsher 2010). In this study, putative iso-

forms of FNRs appear to be downregulated in response to

drought, with an exceptional upregulation in the modern

variety, Kızıltan, for protein spot 49. An upregulation was

also reported previously in another T. durum variety in

response to salinity stress (Caruso et al. 2008) and also in

rice seedlings in response to cold stress (Cui et al. 2005). In

striking contrast, transcript levels of FNR was found to be

decreased in the modern wheat, Kızıltan, but increased in

both wild genotypes, TR39477 and TTD22. Taken toge-

ther, these results indicate the complex interplay between

the transcriptional and translational regulatory machineries

having profound effects on stress tolerance. Contrasting

mRNA and protein levels of FNR will require further

investigation on the exact mechanisms to have a better

understanding on the stress responses at a molecular level.

Stomatal closure under drought stress conditions pro-

motes photorespiration leading to an increase in the

abundance of glycolate in chloroplasts. In peroxisomes,

glycolate is oxidized by glycolate oxidase (also known as

(S)-2-hydroxy-acid oxidase) and H2O2 is generated in the

process (Miller et al. 2010). In our study, two differentially

expressed protein spots (6 and 59) were identified as per-

oxisomal (S)-2-hydroxy-acid oxidase. The expression pat-

terns of protein spots showed a downregulation in wild

genotypes TR39477 and TTD22, but an upregulation in

modern variety, Kızıltan, (spot 59), suggesting a greater

susceptibility of modern variety to detrimental effects of

drought stress. Species-specific comparison (spot 6)

revealed the highest level of expression in the drought-

tolerant wild genotype TR39477, which may be attribut-

able to additional roles of H2O2 as signal transducers of

transcription factor modulators (Neill et al. 2002; Petrov

and Van Breusegem 2012). In addition, catalase-1 (spot 20)

was also found to be most abundant in TR39477, consistent

with its role of detoxification of H2O2 (Huang et al. 2009).

Amino acid transport and metabolism

In this study, 6 protein spots corresponding to methionine

synthase (spot 14), serine hydroxymethyltransferase (spot

33), glycine decarboxylase P subunit (spot 12) and poly-

amine oxidase (spots 31, 32 and 45) related to the trans-

port and metabolism of amino acids were found to be

differentially regulated in response to drought in both wild

and modern wheat genotypes. Methionine synthase cata-

lyzes the transfer of a methyl group from 5-methyltetra-

hydrofolate to homocysteine to produce methionine which

is further converted into S-adenosylmethionine (SAM) by

S-adenosylmethionine synthetase in a network of reactions

collectively known as the activated methyl cycle (Narita

et al. 2004). Generation and re-generation of SAM is of

particular importance as SAM is the universal donor in the

transmethylation of nucleic acids, proteins, lipids and other

metabolites such as compatible solutes glycine betaine and

polyamines (Narita et al. 2004; Ravanel et al. 2004).

Accordingly, methionine synthase was demonstrated to be

involved in the early stress response to salinity in barley

(Narita et al. 2004). Conversely, methionine synthase was

also reported to be downregulated in flooding stress in

wheat, interpreted to limit growth under stress conditions

(Kong et al. 2010). In this study, abundance of methionine

synthase was significantly higher in the modern T. durum

variety Kızıltan compared to both wild relatives. Among

the wild relatives, abundance of this protein in tolerant

TR39477 was almost as twice the abundance as in sus-

ceptible TTD22. Molecular details of the trade-off between

stress responses and growth processes may reveal the

expression level differences in these genotypes.

The role of polyamines in stress responses has been

extensively studied in a number of recent studies (Yoda

et al. 2006; Groppa and Benavides 2008; Gill and Tuteja

2010). Despite a number of studies reporting accumulation

of polyamines under stress condition, polyamine levels are

regulated differentially depending on the polyamine itself,

organism and type and duration of the stress condition (Liu

et al. 2007; Gill and Tuteja 2010). Polyamine levels are

considered to be tightly regulated by degradation via

polyamine oxidases, which produces H2O2 in the process.

In this study, drought stress was shown to induce the

expression of polyamine oxidases in wild genotypes,

TR39477 and TTD22. In contrast, polyamine oxidase

levels were found to decrease in the modern variety,

Kızıltan. Species-specific comparisons also revealed the

highest protein level in both wild genotypes. Although

differential regulation of polyamine oxidases may result

from genotype differences as suggested by Liu et al.

(2007), contrasting results for the wild and modern geno-

types may also imply an ancient line of defense against

abiotic stresses that was lost during rounds of domestica-

tion and breeding in the modern cultivar.

Cellular processes

Under the generalized cellular processes category, two

functional groups of differentially expressed proteins were

detected in this study: (1) Posttranslational modification,

Plant Mol Biol (2013) 83:89–103 99

123

protein turnover, chaperones-related group consisting of

UTP-glucose-1-phosphate uridylyltransferase (spot 21) and

glutathione transferase (spot 71), and, (2) Inorganic ion

transport and metabolism-related group consisting of car-

bonic anhydrase (spot 27), catalase-1 (spot 20) and

MnSOD (spot 72). Protective roles of glutathione trans-

ferase, catalase-1 and manganese superoxide dismutase

against oxidative stress have been well established (Kantar

et al. 2011a). Drought stress is well-known to exacerbate

the generation of ROS, thereby creating an oxidative stress

(Cruz de Carvalho 2008; Akpinar et al. 2012). Conse-

quently, several studies reported upregulation of ROS

scavengers in response to drought stress to protect the cell

from extensive oxidative damage (Cruz de Carvalho 2008;

Ge et al. 2012; Kausar et al. 2012). In this study, two

antioxidant proteins, glutathione transferase (spot 71) and

MnSOD (spot 72) were found to be upregulated in drought

stressed plants, with a more profound upregulation

observed in sensitive genotypes. In this study, GST and

MnSOD protein level changes were in agreement with the

transcript levels, where increased transcription was

observed in sensitive genotypes (TTD22 and Kızıltan) for

GST and in wild genotypes (TR39477 and TTD22) for

MnSOD. For both proteins drought-sensitive wild genotype

TTD22 exhibited the most prominent fold increases at the

mRNA level. In addition to detoxification via the tripeptide

glutathione, GST isoforms may also act as glutathione

peroxidases and thus are considered as an integral part of

oxidative stress responses (Galle et al. 2009). Similarly,

superoxide dismutases aid in alleviating the oxidative

stress via conversion of superoxide ion to hydrogen per-

oxide (Zhang et al. 2008). It can be speculated that resistant

genotypes may cope with drought stress through alternate

ROS scavengers, in addition to GST and MnSOD. Con-

sistently, another ROS scavenger, catalase-1 (spot 20) was

observed to be present at higher level in wild cultivars,

particularly resistant TR39477, under drought stress con-

ditions. Lower level of upregulation of MnSOD, together

with higher level of catalase, in resistant TR39477, in

comparison to sensitive cultivars, may account for avoid-

ance of hydrogen peroxide accumulation in the resistant

genotype, since it is an important signal molecule in sto-

matal closure in guard cells (Huang et al. 2009). In addition

to ROS-scavenging, GST has recently been assigned a

novel role through post-translational modification, partic-

ularly S-glutathionylation, of other proteins in humans

(Townsend et al. 2009). S-glutathionylation by GST is also

evident in plants (Sappl et al. 2004; Dixon et al. 2010).

Thus, expression trends of GST in different wheat geno-

types may also be associated with roles of GST other than

ROS detoxification.

Another ion transport and metabolism related protein,

carbonic anhydrase (spot 27), was found to be present at

the highest level in drought-tolerant wild genotype

TR39477 and lowest levels in modern variety Kızıltan

under drought stress conditions. Carbonic anhydrase cata-

lyzes the reversible conversion of carbon dioxide (CO2)

and water (H2O) to bicarbonate (HCO3-) and protons

(H?), thereby facilitating CO2 diffusion in chloroplasts and

enhancing CO2 availability to RuBisCO (Caruso et al.

2008; Fan et al. 2011). Consistent with the previous reports

on the upregulation of carbonic anhydrase in response to

drought and salinity stresses (Caruso et al. 2008, 2009),

highest levels of this protein observed in the drought-tol-

erant genotype TR39477 may contribute to molecular

mechanisms that govern utilization of available resources

for better survival under stress conditions.

Information storage and processing

In this functional group of proteins, two proteins, namely

elongation factor 1-alpha (isomers, spots 8 and 9) and a

putative chloroplast inner envelope protein (spot 22) were

related to translational machinery, whereas one protein,

namely nuclear localization sequence binding protein (ISS,

spot 5) was related to transcriptional machinery of the cell.

Given that membrane constituents including lipids and

proteins are primarily damaged by drought stress, chloro-

plast envelope was previously found to harbor several

proteins with scavenging and antioxidant capacities (Ferro

et al. 2003). In this study, a higher abundance of a putative

chloroplast envelope protein, which may be involved in the

defense against oxidative stress, was observed in drought-

tolerant TR39477 in comparison with drought-sensitive

TTD22 in drought stressed conditions, proposing a mech-

anism for the differential drought resistance between cul-

tivars. Additionally, our data confirms that gene expression

and protein synthesis is central to response against drought

stress.

Unknown/hypothetical proteins

We detected 16 differentially expressed unknown/hypo-

thetical proteins in our analysis. Treatment-specific com-

parisons of these hypothetical proteins suggested a general

trend for downregulation in response to drought stress. The

expression of all three identified isoforms of Os03g0786

100 Oryza sativa ssp. japonica hypothetical protein (spots

7, 48 and 56) decreased upon drought treatment, whereas

the abundance of the protein remained remarkably high in

the drought-tolerant genotype, TR39477. This hypothetical

protein may contribute to the drought tolerance of the wild

genotype, TR39477. Interestingly, protein spots 19 and 24

exhibited the highest level in drought-tolerant genotype,

TR39477, and the lowest level in the modern durum,

Kızıltan, whereas protein spots 13, 25 and 29 exhibited an

100 Plant Mol Biol (2013) 83:89–103

123

entirely contrasting pattern. Hypothetical proteins from

protein spots 13, 25 and 29 were found to be the most

abundant in the modern durum, Kızıltan, and the least

abundant in the drought-tolerant genotype, TR39477.

According to this result, it can be suggested that hypo-

thetical proteins might have a negative regulatory role on

drought stress. Supporting this argument, many genes/

proteins have been identified with negative effects upon

different stresses (Lee et al. 2001; Chinnusamy et al. 2007;

Qin et al. 2008). In light of these findings, one can spec-

ulate that these hypothetical proteins might have an

important role in drought defense which are yet-to-be

elucidated.

We found 11 proteins with very low match to known

protein sequences (Table 3, Supplementary Table 1). In

addition to these, we detected four spots which showed no

significant hit to any known proteins (Tables 1, 2). These

results may indicate the existence of unique, unknown

proteins in wheat governing drought stress response. Since

four of the low match proteins and two undefined proteins

were upregulated under drought stress, these proteins are

worthy of special attention and further characterization.

Previously, Ergen and Budak (2009) described differ-

ential expression of a number of genes under drought

among different wheat varieties. Additionally, proteomics

approaches offer a precious opportunity to look deeper into

plant response to stress. Here we report the assessment of

proteomic responses of modern durum and wild emmer

wheat species upon drought stress. In this study, we

showed that T. turgidum ssp. durum variety Kızıltan and

T. turgidum ssp. dicocoides genotypes TR39477 and

TTD22 differed from each other in their protein expression

patterns suggesting that the drought tolerance of Triticum

turgidum ssp. dicoccoides genotype, TR39477, may rely on

differential expression of several proteins. In a recent work

by our group (Lucas et al. 2011a), a drought-inducible

integral membrane protein, TMPIT1, is identified to be

expressed in wild emmer wheat but not in durum wheat

under prolonged drought conditions. In accordance with

this study, the proteins found to be upregulated only in wild

species may be candidates for major roles in drought

resistance. Interestingly, our results demonstrate that some

proteins are present and expressed in both modern and wild

emmer wheat species, some of which showed higher

expression patterns in wild wheat genotypes compared to

the modern relative (Table 1). Additionally, some proteins

with low or no peptide match scores identified in this study

can form a basis for elucidating putative response pathways

that are unique to wheat species (Table 3). The differences

in proteome level may provide an insight into the high

tolerance of T. dicoccoides genotype TR39477 to drought

than its modern relative, T. durum variety Kızıltan. It can

also be argued that modern durum wheat might have

different protein modifications and regulations that were

possibly lost during years of domestication which eventu-

ally caused susceptibility to drought. These findings pro-

vide an insight into wheat drought stress mechanisms, and

further molecular analyses may help to solve the domes-

tication-stress response enigma of wheat species.

Acknowledgments Authors acknowledge TUBITAK for the

financial support. We would like to thank to Dr. Megan Bowman for

reviewing the manuscript.

Conflict of interest The authors declare that they have no conflict

of interest.

References

Abdalla KO, Rafudeen MS (2012) Analysis of the nuclear proteome

of the resurrection plant Xerophyta viscosa in response to

dehydration stress using iTRAQ with 2DLC and tandem mass

spectrometry. J Proteomics 75(8):2361–2374. doi:10.1016/j.jprot.

2012.02.006

Ahuja I, de Vos RC, Bones AM, Hall RD (2010) Plant molecular

stress responses face climate change. Trends Plant Sci 15(12):

664–674. doi:10.1016/j.tplants.2010.08.002

Akpinar BA, Avsar B, Lucas SJ, Budak H (2012) Plant abiotic stress

signaling. Plant Signal Behav 7(11):1450–1455. doi:10.4161/psb.

21894

Bergman P, Edqvist J, Farbos I, Glimelius K (2000) Male-sterile

tobacco displays abnormal mitochondrial atp1 transcript accu-

mulation and reduced floral ATP/ADP ratio. Plant Mol Biol

42(3):531–544

Bhullar NK, Street K, Mackay M, Yahiaoui N, Keller B (2009)

Unlocking wheat genetic resources for the molecular identifica-

tion of previously undescribed functional alleles at the Pm3

resistance locus. Proc Natl Acad Sci USA 106(23):9519–9524.

doi:10.1073/pnas.0904152106

Budak H, Kasap Z, Shearman RC, Dweikat I, Sezerman U, Mahmood

A (2006) Molecular characterization of cDNA encoding resis-

tance gene-like sequences in Buchloe dactyloides. Mol Biotech-

nol 34(3):293–301. doi:10.1385/MB:34:3:293

Caruso G, Cavaliere C, Guarino C, Gubbiotti R, Foglia P, Lagana A

(2008) Identification of changes in Triticum durum L. leaf

proteome in response to salt stress by two-dimensional electro-

phoresis and MALDI-TOF mass spectrometry. Anal Bioanal

Chem 391(1):381–390. doi:10.1007/s00216-008-2008-x

Caruso G, Cavaliere C, Foglia P, Gubbiotti R, Samperi R, Lagana A

(2009) Analysis of drought responsive proteins in wheat

(Triticum durum) by 2D-PAGE and MALDI-TOF mass spec-

trometry. Plant Sci 177(6):570–576. doi:10.1016/j.plantsci.

2009.08.007

Chantret N, Salse J, Sabot F, Rahman S, Bellec A, Laubin B, Dubois I,

Dossat C, Sourdille P, Joudrier P, Gautier MF, Cattolico L, Beckert

M, Aubourg S, Weissenbach J, Caboche M, Bernard M, Leroy P,

Chalhoub B (2005) Molecular basis of evolutionary events that

shaped the hardness locus in diploid and polyploid wheat species

(Triticum and Aegilops). Plant Cell 17(4):1033–1045. doi:10.1105/

tpc.104.029181

Chinnusamy V, Schumaker K, Zhu JK (2004) Molecular genetic

perspectives on cross-talk and specificity in abiotic stress

signalling in plants. J Exp Bot 55(395):225–236. doi:10.1093/

jxb/erh005

Plant Mol Biol (2013) 83:89–103 101

123

Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene

expression in plants. Trends Plant Sci 12:444–451. doi:10.1016/

j.tplants.2007.07.002

Cruz de Carvalho MH (2008) Drought stress and reactive oxygen

species: production, scavenging and signaling. Plant Signal

Behav 3(3):156–165

Cui S, Huang F, Wang J, Ma X, Cheng Y, Liu J (2005) A proteomic

analysis of cold stress responses in rice seedlings. Proteomics

5(12):3162–3172. doi:10.1002/pmic.200401148

Demirevska K, Zasheva D, Dimitrov R, Simova-Stoilova L, Stame-

nova M, Feller U (2009) Drought stress effects on Rubisco in

wheat: changes in the Rubisco large subunit. Acta Physiol Plant

31:1129–1138. doi:10.1007/s11738-009-0331-2

Dixon DP, Skipsey M, Edwards R (2010) Roles for glutathione

transferases in plant secondary metabolism. Phytochemistry

71(4):338–350. doi:10.1016/j.phytochem.2009.12.012

Ergen NZ, Budak H (2009) Sequencing over 13 000 expressed

sequence tags from six subtractive cDNA libraries of wild and

modern wheats following slow drought stress. Plant, Cell

Environ 32(3):220–236. doi:10.1111/j.1365-3040.2008.01915.x

Ergen NZ, Dinler G, Shearman RC, Budak H (2007) Identifying,

cloning and structural analysis of differentially expressed genes

upon Puccinia infection of Festuca rubra var. rubra. Gene

393(1–2):145–152

Ergen NZ, Thimmapuram J, Bohnert HJ, Budak H (2009) Transcrip-

tome pathways unique to dehydration tolerant relatives of

modern wheat. Funct Integr Genomics 9(3):377–396. doi:

10.1007/s10142-009-0123-1

Fan P, Feng J, Jiang P, Chen X, Bao H, Nie L, Jiang D, Lv S, Kuang

T, Li Y (2011) Coordination of carbon fixation and nitrogen

metabolism in Salicornia europaea under salinity: comparative

proteomic analysis on chloroplast proteins. Proteomics 11(22):

4346–4367. doi:10.1002/pmic.201100054

Ferro M, Salvi D, Brugiere S, Miras S, Kowalski S, Louwagie M,

Garin J, Joyard J, Rolland N (2003) Proteomics of the

chloroplast envelope membranes from Arabidopsis thaliana.

Mol Cell Proteomics 2(5):325–345. doi:10.1074/mcp.M300005-

MCP200

Flexas J, Medrano H (2002) Drought-inhibition of photosynthesis in

C3 plants: stomatal and non-stomatal limitations revisited. Ann

Bot 89(2):183–189

Galle A, Csiszar J, Secenji M, Guoth A, Cseuz L, Tari I, Gyorgyey J,

Erdei L (2009) Glutathione transferase activity and expression

patterns during grain filling in flag leaves of wheat genotypes

differing in drought tolerance: response to water deficit. J Plant

Physiol 166(17):1878–1891. doi:10.1016/j.jplph.2009.05.016

Gao L, Yan X, Li X, Guo G, Hu Y, Ma W, Yan Y (2011) Proteome

analysis of wheat leaf under salt stress by two-dimensional

difference gel electrophoresis (2D-DIGE). Phytochemistry

72(10):1180–1191. doi:10.1016/j.phytochem.2010.12.008

Ge P, Ma C, Wang S, Gao L, Li X, Guo G, Ma W, Yan Y (2012)

Comparative proteomic analysis of grain development in two

spring wheat varieties under drought stress. Anal Bioanal Chem

402(3):1297–1313. doi:10.1007/s00216-011-5532-z

Gill SS, Tuteja N (2010) Polyamines and abiotic stress tolerance in

plants. Plant Signal Behav 5(1):26–33

Groppa MD, Benavides MP (2008) Polyamines and abiotic stress:

recent advances. Amino Acids 34(1):35–45. doi:10.1007/s00726-

007-0501-8

Guo G, Ge P, Ma C, Li X, Lv D, Wang S, Ma W, Yan Y (2012)

Comparative proteomic analysis of salt response proteins in seedling

roots of two wheat varieties. J Proteomics 75(6):1867–1885. doi:

10.1016/j.jprot.2011.12.032

Hrmova M, Fincher GB (2001) Structure-function relationships of

beta-D-glucan endo- and exohydrolases from higher plants. Plant

Mol Biol 47(1–2):73–91

Huang XY, Chao DY, Gao JP, Zhu MZ, Shi M, Lin HX (2009) A

previously unknown zinc finger protein, DST, regulates drought

and salt tolerance in rice via stomatal aperture control. Genes

Dev 23(15):1805–1817. doi:10.1101/gad.1812409

Ingram J (2011) A food systems approach to researching food security

and its interactions with global environmental change. Food

Secur 3(4):417–431. doi:10.1007/s12571-011-0149-9

Kantar M, Unver T, Budak H (2010) Regulation of barley miRNAs

upon dehydration stress correlated with target gene expression.

Funct Integr Genomics 10(4):493–507. doi:10.1007/s10142-010-

0181-4

Kantar M, Lucas SJ, Budak H (2011a) Drought stress: molecular

genetics and genomics approaches. In: Turkan I (ed) Advances

in botanical research, vol 57. Plant responses to drought and

salinity stress: developments in a post-genomic era. Elsevier,

Burlington, pp 445–493

Kantar M, Lucas SJ, Budak H (2011b) miRNA expression patterns of

Triticum dicoccoides in response to shock drought stress. Planta

233(3):471–484. doi:10.1007/s00425-010-1309-4

Kausar R, Arshad M, Shahzad A, Komatsu S (2012) Proteomics

analysis of sensitive and tolerant barley genotypes under drought

stress. Amino Acids. doi:10.1007/s00726-012-1338-3

Kong FJ, Oyanagi A, Komatsu S (2010) Cell wall proteome of wheat

roots under flooding stress using gel-based and LC MS/MS-

based proteomics approaches. Biochim Biophys Acta

1804(1):124–136. doi:10.1016/j.bbapap.2009.09.023

Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu J-K (2001)

The Arabidopsis HOS1 gene negatively regulates cold signal

transduction and encodes a RING finger protein that displays

cold-regulated nucleo–cytoplasmic partitioning. Genes Dev

15:912–924. doi:10.1101/gad.866801

Liu JH, Kitashiba H, Wang J, Ban Y, Moriguchi T (2007) Polyamines

and their ability to provide environmental stress tolerance to

plants. Plant Biotechnol J 24:117–126

Lobell DB, Schlenker W, Costa-Roberts J (2011) Climate trends and

global crop production since 1980. Science 333(6042):616–620.

doi:10.1126/science.1204531

Lucas S, Dogan E, Budak H (2011a) TMPIT1 from wild emmer

wheat: first characterisation of a stress-inducible integral mem-

brane protein. Gene 483(1–2):22–28. doi:10.1016/j.gene.2011.

05.003

Lucas S, Durmaz E, Akpinar BA, Budak H (2011b) The drought

response displayed by a DRE-binding protein from Triticum

dicoccoides. Plant Physiol Biochem 49(3):346–351. doi:

10.1016/j.plaphy.2011.01.016

Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive

oxygen species homeostasis and signalling during drought and

salinity stresses. Plant, Cell Environ 33(4):453–467. doi:

10.1111/j.1365-3040.2009.02041.x

Mohammadi M, Kav NN, Deyholos MK (2007) Transcriptional

profiling of hexaploid wheat (Triticum aestivum L.) roots

identifies novel, dehydration-responsive genes. Plant Cell Envi-

ron 30(5):630–645. doi:10.1111/j.1365-3040.2007.01645.x

Mohapatra PK, Patro L, Raval MK, Ramaswamy NK, Biswal UC,

Biswal B (2010) Senescence-induced loss in photosynthesis

enhances cell wall beta-glucosidase activity. Physiol Plant

138(3):346–355. doi:10.1111/j.1399-3054.2009.01327.x

Moller AL, Pedas P, Andersen B, Svensson B, Schjoerring JK, Finnie

C (2011) Responses of barley root and shoot proteomes to long-

term nitrogen deficiency, short-term nitrogen starvation and

ammonium. Plant, Cell Environ 34(12):2024–2037. doi:

10.1111/j.1365-3040.2011.02396.x

Moolna A, Bowsher CG (2010) The physiological importance of

photosynthetic ferredoxin NADP ? oxidoreductase (FNR) iso-

forms in wheat. J Exp Bot 61(10):2669–2681. doi:10.1093/jxb/

erq101

102 Plant Mol Biol (2013) 83:89–103

123

Narita Y, Taguchi H, Nakamura T, Ueda A, Shi WM, Takabe T

(2004) Characterization of the salt-inducible methionine syn-

thase from barley leaves. Plant Sci 167(5):1009–1016. doi:

10.1016/j.plantsci.2004.05.039

Navarre DA, Wendehenne D, Durner J, Noad R, Klessig DF (2000)

Nitric oxide modulates the activity of tobacco aconitase. Plant

Physiol 122(2):573–582

Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002)

Hydrogen peroxide and nitric oxide as signalling molecules in

plants. J Exp Bot 53(372):1237–1247

Nishizawa Y, Saruta M, Nakazono K, Nishio Z, Soma M, Yoshida T,

Nakajima E, Hibi T (2003) Characterization of transgenic rice

plants over-expressing the stress-inducible beta-glucanase gene

Gns1. Plant Mol Biol 51(1):143–152

Nogues S, Baker NR (2000) Effects of drought on photosynthesis in

Mediterranean plants grown under enhanced UV-B radiation.

J Exp Bot 51(348):1309–1317

Parker R, Flowers TJ, Moore AL, Harpham NV (2006) An accurate

and reproducible method for proteome profiling of the effects of

salt stress in the rice leaf lamina. J Exp Bot 57(5):1109–1118.

doi:10.1093/jxb/erj134

Peng Z, Wang M, Li F, Lv H, Li C, Xia G (2009) A proteomic study

of the response to salinity and drought stress in an introgression

strain of bread wheat. Mol Cell Proteomics 8(12):2676–2686.

doi:10.1074/mcp.M900052-MCP200

Petrov VD, Van Breusegem F (2012) Hydrogen peroxide-a central

hub for information flow in plant cells. AoB Plants 2012:pls014.

doi:10.1093/aobpla/pls014

Qin F, Sakuma Y, Tran LSP et al (2008) Arabidopsis DREB2A-

interacting proteins function as RING E3 ligases and negatively

regulate plant drought stress–responsive gene expression. Plant

Cell 20:1693–1707. doi:10.1105/tpc.107.057380

Ravanel S, Block MA, Rippert P, Jabrin S, Curien G, Rebeille F,

Douce R (2004) Methionine metabolism in plants: chloroplasts

are autonomous for de novo methionine synthesis and can import

S-adenosylmethionine from the cytosol. J Biol Chem 279(21):

22548–22557. doi:10.1074/jbc.M313250200

Riccardi F, Gazeau P, de Vienne D, Zivy M (1998) Protein changes in

response to progressive water deficit in maize. Quantitative

variation and polypeptide identification. Plant Physiol 117(4):

1253–1263

Salekdeh GH, Siopongco J, Wade LJ, Ghareyazie B, Bennett J (2002)

Proteomic analysis of rice leaves during drought stress and

recovery. Proteomics 2(9):1131–1145. doi:10.1002/1615-9861

(200209)2:9\1131:AID-PROT1131[3.0.CO;2-1

Sappl PG, Heazlewood JL, Millar AH (2004) Untangling multi-gene

families in plants by integrating proteomics into functional

genomics. Phytochemistry 65(11):1517–1530. doi:10.1016/j.

phytochem.2004.04.021

Shin KH, Kamal AHM, Cho K, Choi JS, Jin Y, Paek NC, Lee YW,

Lee JK, Park JC, Kim HT, Heo HY, Woo SH (2011) Defense

proteins are induced in wheat spikes exposed to Fusarium

graminearum. Plant Omics J 4(5):270–277

Sinclair TR (2011) Challenges in breeding for yield increase for

drought. Trends Plant Sci 16(6):289–293. doi:10.1016/j.tplants.

2011.02.008

Tanksley SD, McCouch SR (1997) Seed banks and molecular maps:

unlocking genetic potential from the wild. Science 277(5329):

1063–1066

Townsend DM, Manevich Y, He L, Hutchens S, Pazoles CJ, Tew KD

(2009) Novel role for glutathione S-transferase pi. Regulator of

protein S-Glutathionylation following oxidative and nitrosative

stress. J Biol Chem 284(1):436–445. doi:10.1074/jbc.M805586200

Wang MC, Peng ZY, Li CL, Li F, Liu C, Xia GM (2008) Proteomic

analysis on a high salt tolerance introgression strain of Triticum

aestivum/Thinopyrum ponticum. Proteomics 8(7):1470–1489.

doi:10.1002/pmic.200700569

Wingler A, Lea PJ, Quick WP, Leegood RC (2000) Photorespiration:

metabolic pathways and their role in stress protection. Philos

Trans R Soc Lond B Biol Sci 355(1402):1517–1529. doi:

10.1098/rstb.2000.0712

Yan S, Tang Z, Su W, Sun W (2005) Proteomic analysis of salt stress-

responsive proteins in rice root. Proteomics 5(1):235–244. doi:

10.1002/pmic.200400853

Yoda H, Hiroi Y, Sano H (2006) Polyamine oxidase is one of the key

elements for oxidative burst to induce programmed cell death in

tobacco cultured cells. Plant Physiol 142(1):193–206. doi:

10.1104/pp.106.080515

Yun SJ, Martin DJ, Gengenbach BG, Rines HW, Somers DA (1993)

Sequence of a (1-3,1-4)-beta-glucanase cDNA from oat. Plant

Physiol 103(1):295–296. doi:10.1104/Pp.103.1.295

Zhang H, Guo C, Li C, Xiao K (2008) Cloning, characterization and

expression analysis of two superoxide dismutase (SOD) genes in

wheat (Triticum aestivum L.). Frontiers Agric China 2(2):

141–149. doi:10.1007/s11703-008-0023-5

Zhang M, Li G, Huang W, Bi T, Chen G, Tang Z, Su W, Sun W (2010)

Proteomic study of Carissa spinarum in response to combined heat

and drought stress. Proteomics 10(17):3117–3129. doi:10.1002/

pmic.200900637

Plant Mol Biol (2013) 83:89–103 103

123