Keywords: Shrimp; Taura syndrome virus; Yellow head virus; SYBR Green RT-PCR; Real-time PCR
www.elsevier.com/locate/jviromet
1. Introduction
Taura syndrome virus (TSV) and yellow headvirus (YHV) are the two most important RNAviruses of penaeid shrimp (Penaeus sp.) (Lightneret al., 1996). In the Western Hemisphere, TSV has
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–8270
caused serious economic losses, whereas, YHV isviewed as one of the most significant viral patho-gens in the Eastern Hemisphere (Brock, 1997;Flegel, 1997). The cumulative losses due to TSVin the Americas from 1992 to 1996 were estimatedto be US$1.2–2.0 billion (Lightner et al., 1996).YHV has affected significantly shrimp farming inSouth East Asian countries including Thailand,China, Malaysia, Indonesia and India (Lightner etal., 1996).
Taura syndrome disease, caused by the TSV,was first described in samples collected fromshrimp farms located near the mouth of the Taurariver in Ecuador in 1992 (Jimenez, 1992; Brock etal., 1995; Hasson et al., 1995). TSV virions arenon-enveloped, icosahedral, 31–32 nm in diame-ter and contain a single stranded positive senseRNA genome of �10 kb capable of encodingthree major (55, 40 and 24 kDa) and one minor(58 kDa) capsid proteins (Hasson et al., 1995;Bonami et al., 1997). We have cloned and se-quenced the 3�-end of TSV genome (Robles-Sik-isaka et al., 2001). Sequence analysis showed that,unlike mammalian picornaviruses, TSV capsidprotein genes are located at the 3�-end of thegenome and the TSV genome organization is sim-ilar to insect picornaviruses (Robles-Sikisaka etal., 2001).
YHV was first reported in 1990 with the occur-rence of mass mortalities in farm reared blacktiger shrimp (P. monodon) in Thailand (Chan-tanachookin et al., 1993). YHV virions have anenveloped bacilliform shape of 150–170×40–50nm in size (Wongteerasupaya et al., 1995). Theviral genome contains a single stranded, positivesense RNA and encodes four major structuralproteins of 170, 135, 67 and 22 kDa. The partialnucleotide sequence (open reading frame 1b) re-vealed that the genome organization of YHV isvery similar to the gill-associated virus (GAV),reported from Australia. It has been proposedthat YHV and GAV should belong to a newtaxon (proposed name Oka�irus) in the orderNidovirales that also included Coronaviruses,toroviruses and arteriviruses (Walker et al., 2001).
The current diagnostic methods for TSV andYHV include bioassay using indicator hosts, mon-itoring clinical signs, histopathology, dot blot, in
situ hybridization using virus specific gene probe,immunohistochemistry and by the polymerasechain reaction (PCR) (Lightner and Redman,1998). Although conventional PCR is most sensi-tive among these methods, it is unable to detect asingle copy of the viral genome in the infectedtissue. This is critical for the development of aspecific pathogen free shrimp-breeding programand for monitoring movement of live and frozenshrimp between countries. To address these issues,we have developed a rapid and highly sensitivereal-time quantitative PCR method using the Ge-neAmp® 5700 Sequence Detection System coupledwith SYBR Green chemistry. SYBR Green dyehas a high affinity for double-stranded DNA (ds-DNA) and exhibits enhancement of fluorescenceupon binding to the dsDNA. In the GeneAmp®
5700 Sequence Detection System, the fluorescenceof the SYBR Green dye is monitored at the endof the each cycle and the increase in fluorescenceabove background is dependent on the initialtemplate concentration (PE Biosystem GeneAmp®
5700 User Manual, 1998). The method does notneed any post PCR analyses and the specificity ofthe product is monitored by analyzing the meltingcurve (Ririe et al., 1997).
The objectives of the present study were (1) todetermine the sensitivity and specificity of SYBRGreen RT-PCR using the GeneAmp 5700 Se-quence Detection system in detecting TSV andYHV; and (2) to determine the TSV and YHVload in laboratory challenged shrimp.
2. Materials and methods
2.1. Virus challenge
Juvenile shrimp (Penaeus �annamei, �2–3 g)of a TSV susceptible line (Kona stock) developedby the Oceanic Institute, Hawaii and a TSV resis-tant line of shrimp (P. stylirostris) developed bySuper Shrimp, Inc. were used for this study. ForYHV detection work, Super Shrimp, Inc. P.stylirostris that are susceptible to YHV were used.Virus inoculum (TSV Mexican 1999 isolate, cour-tesy of Dr K.W. Hasson, Super Shrimp Inc. andYHV, courtesy of Dr D.V. Lightner, University
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 71
of Arizona, Arizona) was prepared by homogeniz-ing PCR confirmed TSV and YHV infected tailtissue in 2% saline (1:10 w/v) and centrifuging thehomogenate in a tabletop centrifuge (BeckmanMicrofuge Lite Model) at 12 000 rpm for 5 min.The supernatants were diluted to 1:10 before in-jecting the animals. Healthy juvenile shrimp wereinjected with a virus inoculum (30 �l �106
copies) using a 26-gauge needle and 1 ml tuber-culin syringe between the last 2–3 tail segmentson the ventral surface. Control group animalswere injected with a tail muscle homogenate fromPCR-confirmed virus negative healthy animals.Healthy tissue homogenate was prepared same asdescribed above. Animals were kept indoorswithin environmentally controlled tanks, rearedon a commercially available feed formulation(MADMAC-MS Dry pellet, Bio-Marine, Inc.Hawthorne, CA) and routinely monitored duringthe course of the study.
2.2. Isolation of total RNA
Virus challenged moribund animals were killedat 3–4 days post-injection (p.i.) for TSV suscepti-ble P. �annamei and YHV susceptible P. styliros-tris. For TSV resistant Super Shrimp P.stylirostris, animals were sacrificed 3–5 days p.i.The sampling time was based on the observationthat in Super Shrimp P. stylirostris TSV titer
attains a high level after 3–5 days p.i., as deter-mined by real-time reverse transcriptase poly-merase chain reaction (RT-PCR) (K.R. Klimpel,unpublished). Tail muscle tissue (�50 mg) fromvirus challenged as well as control animals weretaken for the extraction of RNA using TRIReagent™ (Molecular Research Center, Inc.Ohio). The RNA pellets were dissolved in DNase,RNase free distilled water and the yield of totalRNA was measured by using a spectrophotometer(Shimadzu UV-1201). The RNA quality was as-sessed by running the samples in a 1% formalde-hyde agarose gel following standard protocol(Sambrook et al., 1989). Total RNA was treatedwith DNase I using the MessageClean® kit ofGenHunter Corp. (Nashville, TN) before synthe-sizing cDNA for SYBR Green RT-PCR.
2.3. Cloning and sequencing of TSV, YHV,�-actin and elongation factor-1� genes
A list of primers used for the RT-PCR amplifi-cation of TSV, YHV, �-actin, and elongationfactor-1� (EF-1�) is given in Table 1. For TSV,YHV and �-actin RT-PCR, cDNA was synthe-sized using Omniscript™ cDNA synthesis proto-col (Qiagen, CA) and 1 �g total RNA in a 20 �lreaction volume. The RT-PCR mixture contained,4 �l cDNA reaction mixture, 1×PCR buffer(Sigma, St. Louis, MO), 1 �M dNTP, 1.25 �M of
Table 1Details of the primers used for the RT-PCR amplification of TSV, YHV, EF-1� and �-actin genes
ReferenceVirus/Control Primer name Primer sequence (5�-3�) Product sizegene (bp)
TSV TSVF1 TCAATGAGAGCTTGGTCC 220 Nunan et al. (1998)TSVR1 AGTAGACAGCCGCGCTTG
141F CGTCCCGGCAATTGTGAT 821 Tang and Lightner (1999)YHV962R GAATGGTATCACCGTTCAGTGTC
TT
H-AP1EF-1� AAGCTTGATTGCC 382 Dhar et al. (2001b)H-T11A AAGCTTTTTTTTTTTA
each forward and reverse primer and 0.6 U ofRED Taq DNA polymerase (Sigma) in a 25 �lreaction volume. The temperature profile for thePCR amplification was 94 °C 2 min followed by35 cycles of 94 °C 1 min, 55 °C 2 min, 72 °C 1min with extension at 72 °C 7 min. The PCRamplified products were run in a 1% agarose gelat 80 V for 1 h and stained with ethidium bromideto visualize the products on a UV transillumina-tor. The EF-1� gene was previously isolated froma white spot syndrome virus (WSSV) challengedP. stylirostris shrimp by using the mRNA differ-ential display technique (Dhar et al., 2001b).
TSV, YHV and �-actin cDNAs were clonedinto a TOPO cloning vector (Invitrogen, CA) andthe EF-1� cDNA was cloned into a PCR-TRAPvector (GenHunter Corp., Inc.). The recombinantplasmid DNA was sequenced in an automatedDNA sequencer (model ABI 373A, PE AppliedBiosystems). The Sequence analyses were carriedout using the NCBI BLAST search program(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) toconfirm identity between the cloned and the pub-lished sequences based on which the primers weredesigned (Table 1).
2.4. SYBR Green RT-PCR
The primers used for SYBR Green RT-PCRare listed in Table 2. The primers were designedbased on the sequence of the cloned segment ofTSV, YHV, �-actin and EF-1� genes and usingthe Primer Express Software version 1.0 (PE Ap-
plied Biosystem). The primers were checked byrunning a virtual PCR and the amplificationswere analyzed for expected product, mispairingand primer dimer formation using a computerprogram (Amplify v1.2B, Dr William Engles,University of Wisconsin, Department of Genet-ics). The best primer set was taken foramplification.
The SYBR Green RT-PCR amplifications wereundertaken in a GeneAmp 9600 Thermocyclercoupled with a GeneAmp® 5700 Sequence Detec-tion System (PE Applied Biosystems). The cDNAsynthesis was carried out in a 20 �l reactionvolume containing 1 �g DNase I treated totalRNA, 1×RT-PCR buffer, 1 mM dNTPs (PEApplied Biosystems), 0.75 �M oligo dT, 4 U ofRNase inhibitor (PE Applied Biosystems) and 5U of MutiScribe™ reverse transcriptase (PE Ap-plied Biosystems). The cDNA reaction mixturewas diluted 1:10 using DNase, RNase free molec-ular biology grade water and 1 �l was taken foreach amplification reaction. The amplificationswere carried out in a 96 well plate in a 25 �lreaction volume containing 7.1 �l of 2×SYBR®
Green Master Mix (PE Biosystems), 0.24 �M eachof forward and reverse primers and 1 �l of the 1:10 diluted cDNA. The thermal profile for SYBRRT-PCR was 50 °C 2 min, 95 °C 10 min fol-lowed by 40 cycles of 95 °C 10 s and 60 °C 1min. In each 96 well plate, a dilution series of theplasmid standard for the respective virus was runalong with the unknown samples for the corre-sponding virus and the EF-1� control. Each sam-
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 73
ple had 2–3 replicates and all reactions wererepeated at least 3 times independently to ensurethe reproducibility of the results.
For comparing the efficiency of amplification ofEF-1� and �-actin genes with TSV and YHV,cDNA was synthesized in a 20 �l reaction volumeas described above. A serial dilution was thenmade using sheared salmon sperm DNA (5 ng/ml)as a diluent. SYBR Green RT-PCR was per-formed in a 96 well plate using 1 �l of each of thecDNA dilutions for TSV and YHV detectionalong with EF-1� and �-actin controls followingthe reaction parameters as described above.
2.5. TSV and YHV Plasmid standard forquantification by SYBR Green PCR
The plasmid DNAs containing 220 bp TSVinsert and 821 bp YHV insert were separatelylinearized by HindIII (Promega, WI) digestions.An aliquot of the digested plasmids were run in a1% agarose gel to confirm the digestion beforepurifying the remaining digestion reactions byQiaquick Gel Purification kit (Qiagen, CA). DNAwas quantified using a spectrophotometer (Shi-madzu UV-1201) and dilutions were made usingsheared salmon sperm DNA (5 ng/ml) as adiluent.
2.6. Data analyses
After a SYBR Green PCR run, data acquisitionand subsequent data analyses were done using the5700 Sequence Detection System (SDS Version1.3). In the 5700 Sequence Detection System, thefluorescence of SYBR Green against the internalpassive reference dye, ROX (�Rn) is measured atthe end of each cycle. A sample is consideredpositive when �Rn exceeds the threshold value.The threshold value is set at the midpoint of �Rn
vs. cycle number plot. For all the amplificationsdescribed in this paper, the threshold value of �Rn
was taken as 0.25. The threshold cycle (CT) isdefined as the cycle at which a statistically signifi-cant increase in Rn is first detected. Target cDNAcopy number and CT values are related inversely.A sample containing higher copies of the targetcDNA will cross the threshold at an earlier cycle
compared to a sample with lower copies of thesame target. The copy number of TSV and YHVsamples were determined by normalizing the CT
values of the samples with respect to EF-1� andthen extrapolating the normalized CT values tothe standard curve of the corresponding virus.
For further statistical analyses, the CT valueswere exported into a Microsoft Excel Worksheet.Regression analyses of the CT values of the cDNAdilution series were used to determine the amplifi-cation efficiency for TSV and YHV compared tothe corresponding EF-1� and �-actin controls.
3. Results
3.1. Analytical sensiti�ity of SYBR Green PCRusing plasmid DNA template
The analytical sensitivity of SYBR Green PCRwas determined by using a serial dilution of TSVand YHV plasmid DNA as template for amplifi-cation. Dilution series of plasmid standard con-tained 1.51–2.42×106 copies for TSV and1.33–2.12×106 copies for YHV. A linear rela-tionship between the input plasmid DNA and theCT values with regression coefficient (r2) greaterthan 0.99 were obtained for both the viruses. Themean CT values of replicate assays ranged from19.383�0.267 (for 2.42×106 copies) to 40.0�0.0 (for 1.51 copies) for TSV and 18.601�0.169(for 2.12×106 copies) to 38.944�0.337 (for 1.33copies) for YHV, respectively (Fig. 1, Table 3).The coefficient of variation was less than 4.0% forboth TSV and YHV samples (Table 3).
3.2. Comparison of amplification efficiency ofTSV and YHV with EF-1� and �-actin controls
To compare the amplification efficiency of TSVand YHV with the internal control genes, EF-1�and �-actin, a serial dilution of the cDNA derivedfrom TSV and YHV infected samples were made.If the amplification efficiency of TSV and YHVwith the corresponding internal controls, EF-1�and �-actin, is very similar then the difference inslope (�s) of curves for the virus and the corre-sponding internal controls will approach to 0. The
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–8274
�s value of TSV and EF-1� was −0.139 andTSV and �-actin was −0.833 (Fig. 2A). The �svalue of YHV and EF-1� (+0.033) was closer
than the �s value of YHV and �-actin (+0.378)(Fig. 2B).
To determine the sample to sample variation inthe EF-1� and �-actin CT values, SYBR GreenRT-PCR was run for TSV, EF-1� and �-actin orYHV, EF-1� and �-actin in parallel in the same96 well plate. For the TSV samples, the CT valuesfor EF-1� ranged from 21.502 to 25.023 and theCT values of �-actin ranged from 19.437 to 25.955(Table 4). For the YHV samples, the CT valuesfor both EF-1� and �-actin genes were quitevariable although the variability for �-actin CT
values (20.418–29.405) were slightly higher thanEF-1� CT values (21.395–29.807) for the corre-sponding samples (Table 4).
3.3. Amplification specificity for TSV, YHV,EF-1� and �-actin genes
Since the SYBR Green RT-PCR does not in-volve any post-PCR analysis, amplification of spe-cific vs. non-specific products was confirmed byanalyzing the dissociation curve of the target am-plicons. A dissociation curve with a single peak attemperature expected for that amplicon indicatedspecific amplification. The amplification profilesand the dissociation curves for TSV and YHValong with their corresponding internal controls(EF-1� and �-actin) are shown in Fig. 3 and Fig.4. When amplification was undertaken withcDNA from TSV infected shrimp, a significantincrease in SYBR Green fluorescence wasrecorded with a CT value of 31.25 (Fig. 3A).Amplification using cDNA from healthy shrimp,did not provide any significant increase in fluores-cence indicating absence of TSV specific target(Fig. 3A). The dissociation curves showed a singlepeak at melting temperature (Tm=72.0 °C) ex-pected for the TSV amplicon only in the TSVinfected, but not in the healthy sample (Fig. 3B).However, both healthy and the TSV infected sam-ple provided successful amplification of EF-1�and �-actin genes (Fig. 3C and E) with a singlepeak at expected melting temperature (Tm=79.2 °C for EF-1� and Tm=78.8 °C for �-actin)(Fig. 3D and F).
For YHV sample, only the cDNA from in-fected but not healthy animals provided the am-
Fig. 1. The standard curve for TSV (A) and YHV (B) obtainedby SYBR Green PCR using plasmid DNA as template. Thenumber of copies of TSV plasmid DNA added to each reac-tion mixture (corresponding to the numbers on the linearcurve in panel A) were as follows: (1) 2.42×106, (2) 2.42×105, (3) 2.42×104, (4) 2.42×103, (5) 2.42×102, (6) 2.42×101, (7) 12.1, (8) 6.05, (9) 3.03 and (10) 1.51. For YHV sample,the plasmid copy numbers (corresponding to the numbers onthe linear curve in panel B) were as follows: (1) 2.12×106, (2)2.12×105, (3) 2.12×104, (4) 2.12×103, (5) 2.12×102, (6)2.12×101, (7) 10.6, (8) 5.3, (9) 2.6 and (10) 1.33.
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 75
Table 3The cycle threshold (CT) values of replicate assays for TSV and YHV plasmid DNA dilutions
a The CT value is the average of 3 replicates of SYBR Green PCR run of that experiment.b Standard deviation.c Coefficient of variation.
plification of virus-specific product (Fig. 4A). Thedissociation curves indicated that the ampliconhad melting temperature (Tm=79.2 °C) as ex-pected for the YHV specific product (Fig. 4B).However, both healthy and infected samples pro-vided successful amplification of EF-1� and �-actin genes (Fig. 4C and E) with each dissociationcurve showing a single peak at the expected melt-ing temperature for EF-1� and �-actin (Fig. 4Dand F).
3.4. Reproducibility of the SYBR Green assay
To assess the reproducibility of SYBR Greenassays, amplifications were carried out indepen-dently on different days. In a 96 well plate, eachsample had 3–4 replicates. The coefficient of vari-ation for the CT values of TSV, YHV, EF-1� and
�-actin genes were less than 5.0% indicating thatthe assay was highly reproducible (Table 4).
3.5. Determining the load of TSV and YHV inlaboratory challenged shrimp by SYBR GreenRT-PCR
The TSV and YHV viral load in the laboratory-challenged shrimp was determined by normalizingthe CT values of the virus with EF-1� CT valuesand then extrapolating the normalized CT valuesof the samples to the standard curves of thecorresponding virus. The TSV load in P. �annamei(Kona stock) varied from 54 to 6745 copies/�g oftotal RNA and the TSV load in Super Shrimp P.stylirostris was 5–135 copies/�g of total RNA.The YHV load in the Super Shrimp P. stylirostrisvaried from 4.5×103 to 2.89×105 copies/�g of
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–8276
total RNA. This indicated that Super Shrimp P.stylirostris has greater resistance to TSV comparedto P. �annamei (Kona stock) but it is highlysusceptible to YHV.
4. Discussion
The shrimp aquaculture industry has expandedrapidly over the last three decades. This has coin-cided with the emergence of new viral pathogensthat were unknown previously to shrimp farming.In addition, there have been considerable move-ments of live and frozen shrimp from one country
to another increasing the risk of spread of diseasesinto naive populations (Lightner et al., 1996). Forexample, until 1998 the geographic distribution ofTSV was restricted to the Americas. From late1998 to early 1999, TSV epizootics were recordedin Taiwan that was attributed to the introductionof TSV contaminated postlarvae and spawnersfrom Ecuador and elsewhere in the Latin Americato Taiwan (Tu et al., 1999). To prevent the spreadof viral epizootics and to monitor the movementof live and frozen shrimp among countries andcontinents, there is a growing and urgent need todevelop rapid and highly sensitive detectionmethods.
Fig. 2. Relative amplification efficiency curves for (A) TSV and (B) YHV compared to EF-1� and �-actin using cDNA as template.
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 77
Table 4Inter-experimental variabilities in the cycle threshold (CT) values of TSV and YHV samples and their corresponding internal controls(EF-1� and �-actin) using cDNA as template
NT, not tested.a For each sample, the CT value is the average of 2–3 replicates of SYBR Green PCR run of that day.b Standard deviation.c Coefficient of variation.
The real-time RT-PCR described here is highlysensitive. It is capable of detecting up to a singlecopy equivalent of the TSV or the YHV genome(Fig. 1). In SYBR Green RT-PCR, it takes 40cycles (CT=40) to detect a single copy of a viralgenome (Perkin Elmer User Manual, GeneAmp®
5700 Sequence Detection System, User Manual,1998). A linear relationship between the inputplasmid DNA and the CT values was observedfrom 106 down to a single copy of both TSV andYHV. Detection of viruses over such a largedynamic range is useful for measuring the viralload in animals with different levels of infection.Thus SYBR Green RT-PCR provides a continu-ous scale for measuring the viral load. In addi-tion, since SYBR Green RT-PCR is capable ofdetecting a single copy of viral genome, it will beuseful to detect sub-clinical infections. Due toexquisite sensitivity of SYBR Green PCR, it ishighly susceptible to PCR carry over or othercontamination. Therefore, laboratory hygienepractices should be followed very strictly to pre-
vent any potential contamination that may givefalse positive result. In addition, any negativeresult as well as samples with CT values close to40 should be tested at least twice for confirmation.
The SYBR Green RT-PCR was not only highlysensitive but also very specific for detecting TSV,YHV and the internal control genes, EF-1� and�-actin. The specificity of SYBR Green RT-PCRwas determined by monitoring the amplificationprofile and the dissociation curve of the targetamplicons. In SYBR Green RT-PCR, a sample isconsidered positive when the amplification plotcrosses the threshold value. For example, in Fig.3A the amplification plot of TSV infected sampleexceeds the threshold value at cycle number 31.45whereas the amplification plot of the healthy sam-ple did not exceed the threshold line. To ensurethat the amplification plot obtained for TSV in-fected sample was indeed due to the amplificationof TSV specific product, the dissociation curve ofthe product was analyzed (Fig. 3B). Since thedissociation curve of a product depends on its GC
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 79
Fig. 3. The amplification plots and the corresponding dissociation curves of TSV, EF-1� and �-actin genes. The melting temperature(Tm) of each amplicon is shown alongside its dissociation curve.
content, length and sequence composition; am-plification of a specific versus non-specific productcould be differentiated by examining the dissocia-tion curve. The TSV amplicon provided a dissoci-ation curve with a single peak at 72.0 °C which isexpected for the TSV specific amplicon. To deter-mine the quality and any variation in the amountof input RNA as well as the efficiency of thereverse transcriptase reaction in both healthy andTSV infected samples, EF-1� and �-actin geneswere amplified in parallel to the target virus. Bothhealthy and TSV infected samples provided suc-cessful amplification of EF-1� and �-actin genes
with the dissociation curve showing a single peakat the expected temperature (Tm for EF-1� was79.2 °C and Tm for �-actin was 78.8 °C, Fig.3C–F). Similar observations were recorded forYHV amplicon and the EF-1� and �-actin con-trols for the corresponding samples (Fig. 4A–F).
In addition to sensitivity and specificity, SYBRGreen RT-PCR is very rapid and robust in na-ture. It takes about 2 h to run a 96 well plate fromthe time the plate is put into the instrument. Afteramplification, the data analysis takes a few min-utes. In a 96 well plate, 22 samples can be run ata time with two replicates for each virus sample,
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–8280
internal control, positive control and negativecontrol. Thus, SYBR Green RT-PCR can be usedfor high throughput assays for YHV and TSVdetection. In recent years, real-time RT-PCRbased on TaqMan chemistry, has been used forthe detection of RNA viruses infecting plants(Roberts et al., 2000), animals (Moody et al.,
2000; Komurian-Pradel et al., 2001; Oleksiewiczet al., 2001) and to quantitate cellular transcriptsin yeast and mammals (Kang et al., 2000;Leutenegger et al., 1999; Schmittgen et al., 2000).Schmittgen et al. (2000) compared the endpointRT-PCR to TaqMan and SYBR Green real-timeRT-PCR to evaluate the time course of mRNA
Fig. 4. The amplification plots and the dissociation curves of YHV, EF-1� and �-actin genes. The melting temperature (Tm) of eachamplicon is shown alongside its dissociation curve.
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–82 81
formation and decay of human chimeric �globin gene. Both real-time RT-PCR methodsproduced a 4- to 5-log dynamic range of am-plification compared to 1-log dynamic range forendpoint RT-PCR. They reported that althoughboth real-time RT-PCR methods provided com-parable dynamic range and sensitivity, SYBRGreen detection was more precise and produceda more linear decay plot than the TaqMan de-tection system. In contrast to SYBR Green de-tection, multiple fluorogenic probes can be usedin a TaqMan assay to detect more than onetarget in a reaction. However, TaqMan assay ismore costly than SYBR Green assay.
Recently, we isolated EF-1� by mRNA differ-ential technique while comparing the RNAfingerprints of healthy and WSSV, a doublestranded DNA containing virus, infected shrimp(Dhar et al., 2001b). The EF-1� was expressedconstitutively in both healthy and WSSV in-fected shrimp. We compared the amplificationefficiency and sensitivity of EF-1� and �-actinto that of TSV and YHV to determine which ofthese two genes could serve as a better internalreference. Ideally, the amplification efficiency aswell as the sensitivity of an internal controlshould be comparable to the RNA under studyand the internal control should be expressed atan equivalent level irrespective of tissue used,stages of development and the experimentaltreatments (Bustin, 2000). The sensitivity (Y in-tercepts) and amplification efficiency (slope) ofEF-1� was greater than �-actin when comparedto both TSV and YHV amplification. For exam-ple, the sensitivity (Y intercept 39.765) and am-plification efficiency (slope −3.582) of TSV wasmore similar to EF-1� (Y intercepts 40.121,slope −3.443) than �-actin (Y intercepts 34.984and slope −2.749) (Fig. 2A). Similarly, theslope and the intercepts of YHV curve weremore similar to the EF-1� than �-actin (Fig.2B). There is considerable evidence that the �-actin transcription varies widely in response toexperimental treatment in human breast epithe-lial cells, porcine tissues and canine myocardium(reviewed in Bustin, 2000). In the current study,Both EF-1� and �-actin showed variation intheir level of expression in TSV and YHV in-
fected samples. However, based on the sensitiv-ity and the amplification efficiency, as well asthe level of variation, EF-1� appeared to be abetter internal reference for SYBR Green RT-PCR detection of TSV and YHV.
One of the obstacles in the development ofvirus resistant lines in shrimp is the lack ofmethod(s) for quantification of viruses. Lack ofestablished crustacean cell lines further empha-sizes the need to develop methods for virusquantitation. Recently, we have developed areal-time PCR assay based on SYBR Greenchemistry for the detection and quantification oftwo penaeid DNA viruses, infectious hypoder-mal and haematopoietic necrosis virus (IHHNV)and WSSV (Dhar et al., 2001a). We used theSYBR Green PCR method, along with randomamplified polymorphic DNA (RAPD) technique,to identify genetic markers in P. stylirostrisshrimp populations that differ in their IHHNVload (Hizer et al., 2002). Thus, SYBR GreenRT-PCR, along with other molecular tech-niques, will be useful for developing TSV andYHV resistant lines in shrimp.
In summary, the SYBR Green RT-PCRmethod described above is a major developmentin the detection and quantification of TSV andYHV in shrimp. The method is very rapid,highly sensitive and is applicable to routine highthroughput assay making it a suitable tool fordiagnostic, epidemiological and genetic studies inshrimp aquaculture.
Acknowledgements
The authors would like to thank Dr K.W.Hasson for his comments on the manuscript andTony Dettori and Dorain Thompson for theirhelp in maintaining the animals during the viruschallenge experiments. The research was partlyfunded through a grant from the US Depart-ment of Commerce, SBIR Grant 50-DKNA-1-90057 to KRK. DNA sequencing was performedby the Molecular Pathology Shared Resource,University of CA, San Diego, Cancer Center,which is funded in part by NCI Cancer CenterSupport Grant c5P0CA23100-16.
A.K. Dhar et al. / Journal of Virological Methods 104 (2002) 69–8282
References
Bonami, J.R., Hasson, K.W., Mari, J., Poulos, B.T., Lightner,D.V., 1997. Taura syndrome of marine penaeid shrimp:characterization of the viral agent. J. Gen. Virol. 78,313–319.
Brock, J.A., 1997. Special topic review: Taura syndrome, adisease important to shrimp farms in the Americas. WorldJ. Microbiol. Biotechnol. 13, 415–418.
Brock, J.A., Gose, R., Lightner, D.V., Hasson, K.W., 1995. Anoverview of Taura syndrome, an important disease offarmed Penaeus �annamei. In: Browdy, C.L., Hopkin, J.S.
(Eds.). Swimming through troubled water. Proceedings of thespecial session on shrimp farming. World AquacultureSociety, Baton Rouge, pp. 84–94.
Bustin, S.A., 2000. Absolute quantification of mRNA usingreal-time reverse transcription polymerase chain reactionassays. J. Mol. Endocrinol. 25, 169–193.
Chantanachookin, C., Boonyaratpalin, S., Kasornchandra, J.,Direkbusarakom, S., Ekpanithanpong, U., Supamataya, K.,Sriurairatana, S., Flegel, T.W., 1993. Histology and ultra-structure reveal a new granulosis-like virus in Penaeusmonodon affected by yellow-head disease. Dis. Aquat. Org.17, 145–157.
Dhar, A.K., Roux, M.M., Klimpel, K.R., 2001a. Detection andquantification of infectious hypodermal and hematopoieticnecrosis virus and white spot virus in shrimp using real-timequantitative PCR and SYBR Green chemistry. J. Clin.Microbiol. 39, 2835–2845.
Dhar, A.K., Klimpel, K.R., Roux, M.M., Astrofsky, K., Fox.J.G., 2001b. Use of mRNA differential display to identifythe differentially expressed genes from white spot virusinfected shrimp (Penaeus stylirostris), Plant and AnimalGenome IX, The International Conference on the Status ofPlant and Animal Genome Research, January 13–17, SanDiego, CA.
Flegel, T.W., 1997. Special topic review: major viral diseases ofthe black tiger prawn (Penaeus monodon) in Thailand. WorldJ. Microbiol. Biotechnol. 13, 433–442.
Hasson, K.W., Lightner, D.V., Poulos, B.T., Redman, R.M.,White, B.L., Brock, J.A., Bonami, J.R., 1995. Taura syn-drome in Penaeus �annamei : demonstration of a viraletiology. Dis. Aquat. Org. 23, 115–126.
Hizer, S., Dhar, A.K., Klimpel, K.R., Garcia, D.K., 2002.RAPD markers as predictors of infectious hypodermal andhematopoietic necrosis virus (IHHNV) resistance in shrimp(Penaeus stylirostris). Genome 45, 1–7.
Jimenez R., 1992. Sindrome de Taura (resumen). Acuaculturadel Ecuador, Guayaquil 1, 1–16.
Kang, J.J., Watson, R.M., Fisher, M.E., Higuchi, R., Gelfand,D.H., Holland, M.J., 2000. Transcript quantitation in totalyeast RNA using kinetic PCR. Nucleic Acids Res., 28.
Komurian-Pradel, F., Paranhos-Baccala, G., Sodoyer, M.,Chevallier, P., Mandrand, B., Lotteau, V., Andre, P., 2001.Quantitation of HCV RNA using real-time PCR andfluorimetry. J. Virol. Meth. 95, 111–119.
M.U., Hofmann-Lehmann, Lutz, H., 1999. Quantitativereal-time PCR for the measurement of feline cytokinemRNA. Vet. Immunol. Immunopathol. 71, 291–305.
Lightner, D.V., Redman, R.M., Poulos, B.T., Nunan, L.M.,Mari, J.L., Hasson, K.W., 1996. Risk of spread of penaeidshrimp viruses in the Americas by the international move-ment of live and frozen shrimp. Rev. Sci. Tech. Off. Int. Epiz.16, 146–160.
Moody, A., Sellers, S., Bumstead, N., 2000. Measuring infec-tious bursal disease virus RNA in blood by multiplexreal-time quantitative RT-PCR. J. Virol. Meth. 85, 55–64.
Nunan, L.M., Poulos, B.T., Lightner, D.V., 1998. Reversetranscription polymerase chain reaction (RT-PCR) used forthe detection of Taura Syndrome Virus (TSV) in experimen-tally infected shrimp. Dis. Aquat. Org. 34, 87–91.
Oleksiewicz, M.B, Donaldson, A.I., Alexandersen, S., 2001.Development of a novel real-time RT-PCR assay for quan-titation of foot-and-mouth disease virus in diverse porcinetissues. J. Virol. Meth. 92, 25–35.
Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Productdifferentiation by analysis of DNA melting curves during thepolymerase chain reaction. Anal. Biochem. 270, 154–160.
Robles-Sikisaka, R., Garcia, D.K., Klimpel, K.R., Dhar, A.K.,2001. Nucleotide sequence of 3�-end of the genome of Taurasyndrome virus of shrimp suggests that it is related to insectpicornaviruses. Arch. Virol. 146, 941–952.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. MolecularCloning: A Laboratory Manual, second ed. Cold SpringHarbor Laboratory, Cold Spring Harbor, NY.
Schmittgen, T.D., Zakrajsek, B.A., Mills, A.G., Gorn, V.,Singer, M.J., Reed, M.W., 2000. Quantitative reverse tran-scription-polymerase chain reaction to study mRNA decay:comparison of endpoint and real-time methods. Anal.Biochem. 285, 194–204.
Tang, R., Lightner, D.V., 1999. A yellow head virus gene probe:application to in situ hybridization and determination of itsnucleotide sequence. Dis. Aquat. Org. 35, 165–173.
Walker, P.J., Cowley, J.A., Spann, K.M., Hodgson, R.A.J.,Hall, M.R., Withyachumnarkul, B., 2001. Yellow headcomplex viruses: Transmission cycles and topographicaldistribution in the Asia-Pacific region. In: Browdy, C.L.,Jory, D.E. (Eds.), The new Wave, Proceedings of the SpecialSession on Sustainable Shrimp Farming. World Aquacul-ture Society, Baton Rouge, Louisiana, pp. 292–300.
Wongteerasupaya, C., Sriurairatana, S., Vickers, J.E., Anutara,A., Boonsaeng, V., Panyim, S., Tassanakajon, A., Withy-achumnarnkul, B., Flegel, T.W., 1995. Yellow-head virus ofPenaeus monodon is an RNA virus. Dis. Aquat. Org. 22,45–50.
