Veterinary Immunology and Immunopathology 164 (2015) 93–100
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology
j ourna l h omepa ge: www.elsev ier .com/ locate /vet imm
Short Communication
Ribavirin stimulates the immune response of Atlantic salmon
A. Rivas-Aravenaa,b,!, S. Guajardoc, B. Valenzuelad, J. Cartagenaa, M.I. Imaraid,E. Spencera, A.M. Sandinoa,c
a Laboratorio de Virología, Centro de Biotecnología Acuícola, Universidad de Santiago de Chile, Santiago, Chileb Departamento de Aplicaciones Nucleares, Comisión Chilena de Energía Nuclear, Santiago, Chilec Activaq S.A. General del Canto 460, Santiago, Chiled Laboratorio de Inmunología, Centro de Biotecnología Acuícola, Universidad de Santiago de Chile, Santiago, Chile
a r t i c l e i n f o
Article history:Received 26 August 2014Received in revised form29 December 2014Accepted 5 January 2015
Keywords:RibavirinAquacultureFish infectionFish immunologyFish T-cellsRibavirin and immune response
a b s t r a c t
Ribavirin is a synthetic nucleotide analog capable of inhibiting or even preventing someviral infections in mammals and also in fish. It has been seen by others that ribavirin byitself is able to stimulate the immune system of mammals, causing a differentiation of T-cells to T helper 1 cells (Th)-1. In this work, we evaluated the immune effect of ribavirinin vitro on kidney cells from Atlantic salmon and in vivo by oral administration of ribavirinto Atlantic salmon. For this purpose, the transcripts of immune molecules Tbet, GATA3,CD8, CD4, IFN!, IFN", IL-4/13, IL-10, IL-12, IL-15 and TGF-B were quantified. The resultsshow that ribavirin administered orally in food to Atlantic salmon increased IFN" and CD4transcripts in the in vivo assays and, in addition, increased IL-12, IL-15 and CD8 in the in vitroanalyses, indicating that the treatment stimulates a Th1 type response in salmon.
Ribavirin is a synthetic nucleotide analog used asinhibitor of a large number of viruses in mammals andother vertebrates (Beaucourt and Vignuzzi, 2014). In fish, ithas been reported that some viral infections are inhibitedby ribavirin. In particular, infections with viral hemorrhagicsepticemia virus (VHSV) (Marroqui et al., 2007), chumsalmon reovirus (CSV) (DeWitte-Orr and Bols, 2007), infec-tious pancreatic necrosis virus (IPNV) (Jashés et al., 1996;Migus and Dobos, 1980), infectious hematopoietic necro-sis virus (IHNV) (Hudson et al., 1988) and infectious salmon
! Corresponding author at: Laboratorio de Virología, Centro de Biotec-nología Acuícola, Facultad de Química y Biología, Universidad de Santiagode Chile, Avenida Libertador Bernardo O’Higgins 3363, Santiago, Chile.Tel.: +56 2 7181115; fax: +56 2 6812108.
anemia virus (ISAV) (Rivas-Aravena et al., 2011) have beenshown to be dramatically reduced by ribavirin.
Ribavirin inhibits viral replication by several mech-anisms. Inhibition of cellular inosine monophosphatedehydrogenase (IMPDH) by ribavirin reduces the intra-cellular pool of guanosine mono-, di- and triphosphate(GMP, GDP and GTP) (Leyssen et al., 2005; Oxford, 1975;Streeter DG et al., 1973; Sun et al., 2007), decreasing therate of viral and cellular RNA synthesis (Jashés et al., 1996;Leyssen et al., 2005) and the capping of mRNAs (Bougieand Bisaillon, 2004; Goswami et al., 1979). Poliovirus poly-merase 3Dpol can incorporate ribavirin triphosphate (RTP)as either GTP or ATP analog, resulting in several mutationson the gRNA in the progeny, which inhibit the infectivityof the poliovirus (Crotty et al., 2000, 2001). Incorpora-tion of RTP into nascent genomic RNA could also cause anearly termination of RNA synthesis or the misincorpora-tion of cytidine and uridine, instead of guanidine or adenineproducing a “lethal mutagenesis” in viral progeny (Crottyet al., 2000; Vignuzzi et al., 2005). Moreover, some viral
94 A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100
polymerase (Cassidy and Patterson, 1989; Eriksson et al.,1977; Fernandez-Larsson et al., 1989; Prochaska et al.,1993; Severini et al., 1995; Wray et al., 1985), transcriptase(Rankin et al., 1989) and guanylyltransferase (Goswamiet al., 1979) may be inhibited directly by ribavirin.
It has been documented that the administration ofinterferon-alpha (IFN!) and ribavirin can modulate theimmune system in mammals. In fact, the combinatory ther-apy of IFN! and ribavirin in HCV patients caused higherCD4 proliferation than the administration of only IFN!and promoted a Th1/Th2T helper differentiation (Marinhoet al., 2004). Furthermore, in vitro treatment with ribavirinalone in human T-cells could modulate the expression pro-file of some cytokines, increasing IL-2, IFN" and TNF! andsuppressing IL-4/13, IL-5 and IL-10, allowing the differ-entiation to Th1 cell (Tam et al., 1999b). This effect ofribavirin on the modulation of cytokines was also shownin vivo in a mouse model (Tam et al., 1999a). Other groupshave also reported the Th1 polarization caused by rib-avirin in humans and mice (Langhans et al., 2012; Martinet al., 1998; Ning et al., 1998; Trapero-Marugan et al.,2006).
Although ribavirin has inhibitory effects on some fishviruses, its effect on the immune system had not beenevaluated yet. Knowledge on the immune system of fish islimited, but increasing numbers of cytokines and immunemolecules, and also some T-cell markers in fish, havebeen identified (Reyes-Cerpa et al., 2012). The majortranscription factors involved on Th1 and Th2 cell differ-entiation, Tbet and GATA3, respectively, were describedon salmonids (Kumari et al., 2009; Wang et al., 2010).Besides, cytokines and immune molecules associated withTh1 (IFN", TNF!, IL-12), Th2 (IL-4/13) and regulatory T-cells (Treg; IL-10, TGF-#1) have been described in fish(Boschi et al., 2011; Castro et al., 2011; Liu et al., 2008;Moore et al., 2009). However, the development of antibod-ies against fish immune molecules has been scarce, and nocommercial antibodies against salmon cytokines are avail-able.
Usually, vaccines against viruses in aquaculture are notefficient enough to prevent disease. The lack of knowl-edge about the functioning of the immune system hindersthe efficient design of vaccines. The major concern is thatgenerally there is no correlation between the antibodyresponse elicited by the vaccination and the vaccine pro-tection against the pathogen (Cuesta et al., 2010; de lasHeras et al., 2010; Dorson et al., 1978; Gomez-Casado andColl, 2011; Koellner and Kotterba, 2002). Therefore, it isimportant to progress in the search for strategies that allowstimulating cellular immune response in fish mimickingthe pathogen infection, thereby reinforcing the action ofvaccines.
The present study investigated the effect of the adminis-tration of ribavirin in food to Atlantic salmon (Salmo salar).In order to clarify whether ribavirin exerts an effect onthe immune response of fish, we analyzed the expres-sion of immunological markers of T-cell differentiationin vitro and in vivo. Our results show that oral administra-tion of ribavirin to Atlantic salmon can promote an immuneresponse related to Th1 cells. These results gave us valuableinformation on the immune response of fish and on
the use of ribavirin as an antiviral and immunostimu-lant.
2. Materials and methods
2.1. Treatment of Atlantic salmon with ribavirin
Healthy post-smolt Atlantic salmon with an averageweight of 100 g were kept in 200 L tanks with 25 ppt ofsalinity at a density of 22 kg/m3, a temperature of 14–18 "Cand oxygen flow rate of 5.8–7.1 mg/L. Samples of fish weretaken at this point to evaluate the initial levels of transcripts(day 0). Then, 168 fish were treated with 6.5 $mol of rib-avirin/kg of fish for 10 days in the feed, in duplicate farmingtanks as described (Rivas-Aravena et al., 2011). After that,the fish were fed without ribavirin. At days 4, 10, 20, 30and 40 after treatment with ribavirin started, the spleensof 6 fish of each tank (12 fish in total) were extracted forposterior analysis. Analysis of the cytokine expression wasperformed using day 0 (before administration of ribavirin)as a control.
2.2. Treatment of kidney cells of Atlantic salmon withribavirin in vitro
Atlantic salmon weighing 50 g were obtained from alocal farm and were maintained at the immunology lab-oratory facilities at 15 "C in tanks at a biomass of 22 kg/m3
with continuous oxygen support and fed daily with a com-mercial diet. After 2 weeks of acclimation, the kidneys offive fish were separately and aseptically removed and dis-aggregated in RPMI-1640 medium (Gibco), supplementedwith 10% FCS, 4 mM L-glutamine (Hyclone), 40 $M 2-mercaptoethanol (Gibco) and 50 $g/mL gentamycin (USBBiological). Each cell suspension was filtered through a100-mesh membrane filter, centrifuged at 400 # g for10 min and the pellets were suspended in supplementedRPMI-1640.
To determine the effect of ribavirin on T-cell differen-tiation, 1 # 106 kidney cells per well obtained from eachfish separately were seeded in 96-well plates in RPMI com-plete medium and incubated with 0, 0.5, 1 and 5 $g/mL ofribavirin for 48 h at 15 "C. Control cells were cultured with-out ribavirin. At the end of the experiment, the RNA wasextracted and the cytokine expression levels were com-pared in treated and control cells.
2.3. Determination of cytotoxicity of ribavirin on cells ofkidney
About 1.8 # 108 cells from the kidney were incubatedwith 0, 0.1, 0.5, 1, 5 and 7 $g/mL of ribavirin. After 48 h, cellswere washed two times in PBS and incubated with 1 $g/mLof propidium iodide for 10 min. Cells were washed withPBS, and the percentage of viable cells was determined in anFACS CANTO II, BD (Becton Dickinson) flow cytometer usingthe FL-2 channel. The cytotoxicity was evaluated from thedependence on the number of cells treated with ribavirin,relative to the number of control cells.
A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100 95
Table 1Sequences of primers used in this study.
Primer Sequence GenBank accession number Reference
Tbet-F GGTAACATGCCAGGGAACAGGA FM863825 Wang et al. (2010)Tbet-R TGGTCTATTTTTAGCTGGGTGATGTCTGGATA3-F CCAAAAACAAGGTCATGTTCAGAAGG FM863826 Wang et al. (2010)GATA3-R TGGTGAGAGGTCGGTTGATATTGTG18S-F CTTAGATGTCCGGGGCT FJ710874.1 Self design18S-R CTCGGCGAAGGGTAGACAIFN!-F CGTCATCTGCAAAGATTGGA AY216595 Ingerslev et al. (2009)IFN!-R GGGCGTAGCTTCTGAAATGAIFN"-F AAGGGCTGTGATGTGTTTCTG AY795563 Ingerslev et al. (2009)IFN"-R TGTACTGAGCGGCATTACTCCCD4-F CCGCTGTCTGTGGCGTCGGTT AY973030.1 Self designCD4-R CCCCGACTCCGCCCATCTCACD8! F TGGGCCAGCCCCTATGACAAC NM 001124263.1 Self designCD8! R TGCCCCGGAGCTGCCATTCTIL10-F GGGTGTCACGCTATGGACAG EF165029 Ingerslev et al. (2009)IL10-R TGTTTCCGATGGAGTCGATGTGF#1-F AGTAGCCAGTGGGTTCATGG EU082211 Self designTGF#1-R AGCTCTCGGAAGAAACGACAIL-15 F TATTGAGCTGCCTGAGTGCCAC NM 001279065.1 Self designIL-15 R AAGATGCAGTGGTCATTGTAGATGTCIL-12 F GAGCCAAGTCTTATGGCTGC BT049114 Self designIL-12 R GTTCAAACTCCAACCCTCCAIL-4/13 F GTCAGAGGAACTTCTGGAAACA FN820500.1 Takizawa et al. (2011)IL-4/13 R GTTGTAAACCCTCAGATGTCG
2.4. Real-time qRT-PCR
Total RNA from cells extracted from kidney using in vitroor spleen using in vivo treatment was extracted with Tri-zol (Invitrogen), according to the manufacturer’s protocol.Reverse transcription (RT) was performed using 1.5 $g oftotal RNA previously treated with DNAse, 1# RT buffer(Promega), 200 U M-MLV RT (Promega), 0.2 mM dNTPs(Promega), 25 U RNasin (Promega) and 0.5 $g RandomPrimer (Promega) in a final volume of 25 $L. For theqPCR reaction, 1# Brilliant SYBR® Green QPCR Master Mix(Stratagene), 30 nM Reference Dye and 2 $L of RT reactionwere used as template in a reaction volume of 20 $L. The18S, Tbet, GATA3, CD4, CD8!, INF!, INF", IL-4/13, IL-10,IL-12, IL-15 and TGF#1 cDNAs were quantified using theprimers shown in Table 1. The primer concentration was0.5 $M for each. The thermal profile of all cDNAs was eval-uated starting with a denaturation step of 10 min at 95 "C,followed by 40 cycles of 15 s at 95 "C, 15 s at 58 "C and 30 sat 72 "C for 18S and IL-15 determination; 15 s at 95 "C, 35 sat 57 "C and 35 s at 72 "C for GATA3; 30 s at 95 "C, 15 s at60 "C and 40 s at 72 "C for Tbet; 30 s at 95 "C, 15 s at 60 "Cand 35 s at 72 "C for INF", INF!, IL-10, IL-12, CD4, CD8 andTGF-#1 and 30 s at 95 "C, 15 s at 58 "C and 35 s at 72 "C forIL-4/13. The melting curve for all transcripts was 1 min at95 "C, 30 s at 55 "C and 30 s at 95 "C. 18S mRNA was used asa reference in the analysis of the expression.
2.5. Quantification and analysis
The quantification of each gene expressionwas conducted using the relative expressionapproach, according to the Pfaffl mathematicalmodel (Pfaffl, 2001) Etarget
senger levels as reference gene. Immune molecules of the
in vitro experiment were evaluated for statistically signif-icant differences by the ANOVA and Bonferroni methods.Immune molecules of in vivo experiment were evaluatedby the Student’s t-test and unpaired t-test. P < 0.05 wasconsidered significant change.
3. Results and discussion
3.1. Ribavirin stimulates cytokine expression in spleencells of Atlantic salmon in vivo
To investigate whether ribavirin exerts an effecton immune response, we analyzed the expression ofimmunological markers. There are few functional data tocharacterize immune cells in fish. Limited numbers of anti-body markers of immune molecules in salmonids havebeen developed, and no commercial antibodies nor func-tional assays are available; so to evaluate the immuneresponse and the T-cell stimulation, we determined theexpression of cytokines and immune marker transcriptsin salmon cells (Boschi et al., 2011; Castro et al., 2011;Kumari et al., 2009; Liu et al., 2008; Moore et al., 2009;Wang et al., 2010). This approach is valid because cytokineproteins are typically synthetized soon after the transcrip-tion is stimulated, thus the correlation between transcriptand protein levels is very strong (Liu et al., 2003; Mooreet al., 2001).
The analysis of the effects of orally administered rib-avirin on the immune response of Atlantic salmon is shownin Fig. 1. Results showed that CD4 expression was 10times higher at day 4, during drug administration (Fig. 1).This can be related to a proliferative event of CD4 T-cellsassociated with ribavirin uptake (Marinho et al., 2004;Tam et al., 1999a,b). IFN" had an average increase of70 times on day 4. Levels of both transcripts drop tobasal levels after 10 days of ribavirin administration. No
96 A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100
Fig. 1. Determination of cytokine mRNAs in the spleen of Atlantic salmon treated with ribavirin. Fish were fed for 10 days with a mixture of commercialfood and ribavirin. Cytokine evaluation in the spleen of 11 or 12 fish was performed at days 4, 10, 20, 30 and 40 days of the treatment. Ribavirin wasremoved at day 10, and fish were fed commercial food. Pfaffl analysis was performed using day 0 as control and 18S mRNA expression as reference. Valuescorresponding to zero are not represented in the logarithmic scale but they are included for the mean calculation. *P < 0.05 was considered statisticallysignificant difference between experimental and control group.
statistically significant changes were observed in Tbetand GATA3 expression. There was an increasing trend inthe transcript level of the antiviral cytokine IFN!, whichshowed a 10-fold increase on day 4, that also decrease tobasal levels on day 10. The regulatory cytokines IL-10 andTGF#1 have an important increment reaching to 412- and3-fold increase on day 4, and 111- and 22-fold increaseon day 10, respectively, but this occurs only in three orfour fish, suggesting a regulatory event at least in part ofthe group of animals. Interestingly, return of expressionto baseline levels when ribavirin is removed (days 20, 30
and 40) indicates that effects are due to this nucleotideanalog.
Altogether, results show that when administered orally,ribavirin induces in salmon a Th1 type response, probablyrelated to activation of CD4+ T-cells.
3.2. Ribavirin stimulates cytokine expression in kidneycells of Atlantic salmon in vitro
For further evaluation of the effect of ribavirin onimmune cells, we directly incubated ribavirin with
A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100 97
Fig. 2. Determination of cytokine mRNA expression of isolated kidney cells of Atlantic salmon treated with ribavirin in vitro. Kidney cells were isolated fromfish and incubated with 0, 0.5, 1 and 5 $g/mL of ribavirin. mRNA expression was determined at day 2 of treatment through Pfaffl analysis using non-treatedcells as control and 18S mRNA expression as reference. *P < 0.05 was considered significant change.
98 A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100
leukocytes from kidney isolated from non-treated Atlanticsalmon, and the cytokine profile expression was analyzed.We used concentrations of 0, 0.5, 1 and 5 $g/mL of ribavirinduring 2 days, concentrations that were able to protectSHK-1 cells from infection with ISAV, as was described(Rivas-Aravena et al., 2011). Expression of cytokines andtranscription factor related to Th1 (Tbet, IFN", IL-12), Th2(GATA3, IL-4/13) and Treg (IL-10, TGF-#1) cells, as wellas the cytokine IL-15 involved in proliferation and surfacemarkers CD4 and CD8! were evaluated.
Fig. 2 shows that the highest increase of almost all thecytokine transcription levels in isolated kidney cells wasachieved at 0.5 $g/mL of ribavirin with the exception of IL-12 and IL-10, in which the highest stimulation was reachedat 1 and 5 $g/mL of ribavirin, respectively. Ribavirin treat-ment causes the largest effect on the increase of cytokineexpression related to Th1 cells, i.e. IFN" (4.9 times), Tbet(41.5 times) and IL-12 (3 times). The increase in the expres-sion of those molecules is higher than the stimulation ofcytokines related to Th2 cells: GATA-3 (3.5 times) and IL-4/13 (2.8 times). In mammals, IFN" is produced by Th1 andNK cells stimulated by IL-12, provoking increased MHC Iexpression, phagocytic activity stimulation and differen-tiation of CD4 to Th1. Thus, the expression of moleculesrelated to Th1: IFN", Tbet and IL-12 that have the largestincrease on kidney cells treated with ribavirin, comparedto molecules related to Th2 cells, suggests that an antiviralresponse can be exerted (Zou et al., 2005). At the same time,an increase on CD4 and CD8! was achieved, which is con-sistent with a Th1 differentiation and antiviral response.The increment of IFN" also suggests stimulation of theinnate response by activation of NK cells. That activationof NK cells and the consequent IFN" production are inagreement with an increased expression of CD4 in vivo.On the other hand, CD4, CD8! and IL-15 mRNA levelsshowed increases of 2.8, 4.8 and 8 times in vitro, respec-tively. IL-15 is a T-cell growth factor and shows a pivotalrole for the stimulation and maintenance of memory T-cells(Wang et al., 2007). Hence, the increase of IL-15 is consis-tent with the stimulation of the expression of CD8! andCD4 (Langhans et al., 2012; Marinho et al., 2004; Martinet al., 1998; Ning et al., 1998; Tam et al., 1999a; Tam et al,1999b; Trapero-Marugan et al., 2006).
The decreasing of the response to higher levels of rib-avirin was not due to cytotoxic effects of treatment (Fig. 3).This decrease in the expression of CD4 and IFN" at day 10may be related to the activation of the anti-inflammatoryimmunosuppressive cytokine IL-10 or TGF-#1 (Zhang et al.,2012; Zou et al., 2003). TGF-#1 is a suppressive cytokinethat together with IL-10 suppresses the inflammatoryresponse (Schjetne et al., 2007). In fact, an increase of TGF-#1 and IL-10 mRNA expression was seen in kidney in vitro,but further analyses are required to assess this issue. It isalso possible that the expression of IL-10 and TGF-#1 comesfrom the activation of Treg cells, but more investigation isneeded to evaluate a potential effect of ribavirin on salmonT-cells.
In summary, ribavirin increased IFN" and CD4 tran-scripts in the in vivo assays and increased IL-12, IL-15 andCD8 in the in vitro analyses; thus they suggest that treat-ment stimulates a Th1 type response in salmon. Other
Fig. 3. Determination of cytotoxicity of ribavirin on kidney cells. Kidneycells were incubated with 0, 0.1, 0.5, 1 and 5 and 7 $g/mL of ribavirin. 48 hlater, cells were incubated with propidium iodide and the number of cellswas determined by flow cytometry. Viability of treated cells with respectto the control is shown for each concentration of ribavirin.
types of responses (Th2 and Th17) that may escort Th1in vivo response have to be tested. The effect of ribavirinon the expression of salmon cell markers and cytokines isof particular importance because ribavirin can be used forimproving the health of fish in aquaculture. The Th1 typeof response is extremely important as a complementarystimulus in the vaccination of fish, for example, adminis-tering it together with the vaccine, because most vaccinesdeveloped for fish until now are not efficient enough to pre-vent the disease (Gomez-Casado and Coll, 2011). Even theantibody response in fish is not fully developed, and whendeveloped, it is not correlated with disease protection.Therefore, it is important to find stimuli that can activatecellular immunity in fish, which is expected to be moreefficient to establish protection against virus and intracel-lular pathogens. Our results suggest that ribavirin is a goodcandidate as antiviral and immunostimulant supplementadministered with food.
Acknowledgments
This work was supported by Fondecyt-Chile (3120149)and CONICYT-Chile (Proyecto de Cooperación Interna-cional ACE-09. We Maria Teresa Castillo for her excellentmanagement of culture cells.
References
Beaucourt, S., Vignuzzi, M., 2014. Ribavirin: a drug active against manyviruses with multiple effects on virus replication and propagation.Molecular basis of ribavirin resistance. Curr. Opin. Virol. 8C, 10–15.
Boschi, I., Randelli, E., Buonocore, F., Casani, D., Bernini, C., Fausto, A.M.,Scapigliati, G., 2011. Transcription of T cell-related genes in teleostfish, and the European sea bass (Dicentrarchus labrax) as a model. FishShellfish Immunol. 31, 655–662.
Bougie, I., Bisaillon, M., 2004. The broad spectrum antiviral nucleosideribavirin as a substrate for a viral RNA capping enzyme. J. Biol. Chem.279, 22124–22130.
Cassidy, L.F., Patterson, J.L., 1989. Mechanism of La Crosse virus inhibitionby ribavirin. Antimicrob. Agents Chemother. 33, 2009–2011.
Castro, R., Bernard, D., Lefranc, M.P., Six, A., Benmansour, A., Boudinot, P.,2011. T cell diversity and TcR repertoires in teleost fish. Fish ShellfishImmunol. 31, 644–654.
A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100 99
Crotty, S., Cameron, C.E., Andino, R., 2001. RNA virus error catastrophe:direct molecular test by using ribavirin. Proc. Natl. Acad. Sci. U.S.A. 98,6895–6900.
Crotty, S., Maag, D., Arnold, J.J., Zhong, W., Lau, J.Y., Hong, Z., Andino,R., Cameron, C.E., 2000. The broad-spectrum antiviral ribonucleosideribavirin is an RNA virus mutagen. Nat. Med. 6, 1375–1379.
Cuesta, A., Chaves-Pozo, E., de Las Heras, A.I., Saint-Jean, S.R., Perez-Prieto,S., Tafalla, C., 2010. An active DNA vaccine against infectious pancre-atic necrosis virus (IPNV) with a different mode of action than fishrhabdovirus DNA vaccines. Vaccine 28, 3291–3300.
de las Heras, A.I., Rodriguez Saint-Jean, S., Perez-Prieto, S.I., 2010. Immuno-genic and protective effects of an oral DNA vaccine against infectiouspancreatic necrosis virus in fish. Fish Shellfish Immunol. 28, 562–570.
DeWitte-Orr, S.J., Bols, N.C., 2007. Cytopathic effects of chum salmonreovirus to salmonid epithelial, fibroblast and macrophage cell lines.Virus Res. 126, 159–171.
Dorson, M., Castric, J., Torchy, C., 1978. Infectious pancreatic necrosis virusof salmonids: biological and antigenic features of a pathogenic strainand of a non-pathogenic variant selected in RTG-2 cells. J. Fish Dis. 1,309–320.
Eriksson B, H.E., Johansson, N.G., Larsson, A., Misiorny, A., Norén, J.O.,Philipson, L., Stenberg, K., Stening, G., Stridh, S., Oberg, B., 1977. Inhi-bition of influenza virus ribonucleic acid polymerase by ribavirintriphosphate. Antimicrob. Agents Chemother. 11, 946–951.
Fernandez-Larsson, R., O’Connell, K., Koumans, E., Patterson, J.L., 1989.Molecular analysis of the inhibitory effect of phosphorylated ribavirinon the vesicular stomatitis virus in vitro polymerase reaction. Antimi-crob. Agents Chemother. 33, 1668–1673.
Gomez-Casado, E.A., Coll, J.M., 2011. A comparative review on European-farmed finfish RNA viruses and their vaccines. Vaccine 29,2657–2671.
Hudson, J.B., Graham, E.A., Simpson, M.F., 1988. The efficacy of amantadineand other antiviral compounds against two salmonid viruses in vitro.Antivir. Res. 9, 379–385.
Ingerslev, H.C., Ronneseth, A., Pettersen, E.F., Wergeland, H.I., 2009. Dif-ferential expression of immune genes in Atlantic salmon (Salmo salarL.) challenged intraperitoneally or by cohabitation with IPNV. Scand JImmunol 69, 90–98.
Jashés, G.M., González, M., López-Lastra, M., De Clercq, E., Sandino, A.,1996. Inhibitors of infectious pancreatic necrosis virus (IPNV) repli-cation. Antivir. Res. 29, 309–312.
Koellner, B., Kotterba, G., 2002. Temperature dependent activation ofleucocyte populations of rainbow trout, Oncorhynchus mykiss, afterintraperitoneal immunisation with Aeromonas salmonicida. Fish Shell-fish Immunol. 12, 35–48.
Langhans, B., Nischalke, H.D., Arndt, S., Braunschweiger, I., Nattermann, J.,Sauerbruch, T., Spengler, U., 2012. Ribavirin exerts differential effectson functions of cd4(+) Th1, th2, and regulatory T cell clones in hepatitisC. PLoS ONE 7, e42094.
Leyssen, P., Balzarini, J., De Clercq, E., Neyts, J., 2005. The predominantmechanism by which ribavirin exerts its antiviral activity in vitroagainst flaviviruses and paramyxoviruses is mediated by inhibitionof IMP dehydrogenase. J. Virol. 79, 1943–1947.
Liu, Y., Moore, L., Koppang, E.O., Hordvik, I., 2008. Characterization ofthe CD3zeta, CD3gammadelta and CD3epsilon subunits of the T cellreceptor complex in Atlantic salmon. Dev. Comp. Immunol. 32, 26–35.
Marinho, R.T., Pinto, R., Santos, M.L., Lobos, I.V., Moura, M.C., 2004. Effectsof interferon and ribavirin combination therapy on CD4+ proliferation,lymphocyte activation, and Th1 and Th2 cytokine profiles in chronichepatitis C. J. Viral Hepat. 11, 206–216.
Marroqui, L., Estepa, A., Perez, L., 2007. Assessment of the inhibitory effectof ribavirin on the rainbow trout rhabdovirus VHSV by real-timereverse-transcription PCR. Vet. Microbiol. 122, 52–60.
Martin, J., Navas, S., Quiroga, J.A., Pardo, M., Carreno, V., 1998. Effectsof the ribavirin–interferon alpha combination on cultured peripheralblood mononuclear cells from chronic hepatitis C patients. Cytokine10, 635–644.
Migus, D.O., Dobos, P., 1980. Effect of ribavirin on the replication of infec-tious pancreatic necrosis virus in fish cell cultures. J. Gen. Virol. 47,47–57.
Moore, K.W., de Waal Malefyt, R., Coffman, R.L., O’Garra, A., 2001.Interleukine-10 and the interleukine-10 receptor. Annu. Rev.Immunol. 19, 683–765.
Moore, L.J., Dijkstra, J.M., Koppang, E.O., Hordvik, I., 2009. CD4 homologuesin Atlantic salmon. Fish Shellfish Immunol. 26, 10–18.
Ning, Q., Brown, D., Parodo, J., Cattral, M., Gorczynski, R., Cole, E., Fung,L., Ding, J.W., Liu, M.F., Rotstein, O., Phillips, M.J., Levy, G., 1998. Rib-avirin inhibits viral-induced macrophage production of TNF, IL-1,the procoagulant fgl2 prothrombinase and preserves Th1 cytokineproduction but inhibits Th2 cytokine response. J. Immunol. 160,3487–3493.
Oxford, J.S., 1975. Inhibition of the replication of influenza A andB viruses by a nucleoside analogue (ribavirin). J. Gen. Virol. 28,409–414.
Pfaffl, M.W., 2001. A new mathematical model for relative quantificationin real-time RT-PCR. Nucleic Acids Res. 29, e45.
Prochaska, H.J., Yeh, Y., Baron, P., Polsky, B., 1993. Oltipraz, an inhibitor ofhuman immunodeficiency virus type 1 replication. Proc. Natl. Acad.Sci. U.S.A. 90, 3953–3957.
Rankin, J.T., Eppes, S.B., Antczak, J.B., Joklik, W.K., 1989. Studies on themechanism of the antiviral activity of ribavirin against reovirus. Virol-ogy 168, 147–158.
Reyes-Cerpa, S., Maisey, K., Reyes-López, F., Toro-Ascuy, D., Sandino, A.,Imarai, M., 2012. Fish Cytokines and Immune Response. In: Turker,H. (Ed.), New Advances and Contributions to Fish Biology. , doi10.5772/53504. ISBN 978-953-51-0909-9.
Rivas-Aravena, A., Vallejos-Vidal, E., Cortez-San Martin, M., Reyes-Lopez,F., Tello, M., Mora, P., Sandino, A.M., Spencer, E., 2011. Inhibitory effectof a nucleotide analog on infectious salmon anemia virus infection. J.Virol. 85, 8037–8045.
Schjetne, K.W., Fredriksen, A.B., Bogen, B., 2007. Delivery of antigento CD40 induces protective immune responses against tumors. J.Immunol. 178, 4169–4176.
Severini, A., Liu, X.Y., Wilson, J.S., Tyrrell, D.L., 1995. Mechanismof inhibition of duck hepatitis B virus polymerase by (-)-beta-L-2$ ,3$-dideoxy-3$-thiacytidine. Antimicrob. Agents Chemother. 39,1430–1435.
Streeter, D.G., Witkowski, J.T., Khare, G.P., Sidwell, R.W., Bauer,R.J., Robins, R.K., Simon, L.N., 1973. Mechanism of action of1-d-ribofuranosyl-1,2,4-triazole-3-carboxamide (Virazole), a newbroad-spectrum antiviral agent. Proc. Natl. Acad. Sci. U.S.A. 70,1174–1178.
Sun, Y., Chung, D.-H., Chu, Y.-K., Jonsson, C.B., Parker, W.B., 2007. Activ-ity of ribavirin against Hantaan virus correlates with production ofribavirin-5$-triphosphate, not with inhibition of IMP dehydrogenase.Antimicrob. Agents Chemother. 51, 84–88.
Takizawa, F., Koppang, E.O., Ohtani, M., Nakanishi, T., Hashimoto, K.,Fischer, U., Dijkstra, J.M., 2011. Constitutive high expression ofinterleukin-4/13A and GATA-3 in gill and skin of salmonid fishes sug-gests that these tissues form Th2-skewed immune environments. MolImmunol 48, 1360–1368.
Tam, R.C., Lim, C., Bard, J., Pai, B., 1999a. Contact hypersensitivity responsesfollowing ribavirin treatment in vivo are influenced by type 1 cytokinepolarization, regulation of IL-10 expression, and costimulatory signal-ing. J. Immunol. 163, 3709–3717.
Tam, R.C., Pai, B., Bard, J., Lim, C., Averett, D.R., Phan, U.T., Milovanovic, T.,1999b. Ribavirin polarizes human T cell responses towards a type 1cytokine profile. J. Hepatol. 30, 376–382.
Trapero-Marugan, M., Garcia-Buey, L., Munoz, C., Quintana, N.E., Moreno-Monteagudo, J.A., Borque, M.J., Fernandez, M.J., Salvanes, F.R., Medina,J., Moreno-Otero, R., 2006. Sustained virological response to pegin-terferon plus ribavirin in chronic hepatitis C genotype 1 patients isassociated with a persistent Th1 immune response. Aliment Pharma-col. Ther. 24, 117–128.
Vignuzzi, M., Stone, J.K., Andino, R., 2005. Ribavirin and lethal mutagen-esis of poliovirus: molecular mechanisms, resistance and biologicalimplications. Virus Res. 107, 173–181.
Wang, T., Holland, J.W., Carrington, A., Zou, J., Secombes, C.J., 2007.Molecular and functional characterization of IL-15 in rainbow troutOncorhynchus mykiss: a potent inducer of IFN-gamma expression inspleen leukocytes. J. Immunol. 179, 1475–1488.
Wang, T., Holland, J.W., Martin, S.A., Secombes, C.J., 2010. Sequence andexpression analysis of two T helper master transcription factors, T-bet and GATA3, in rainbow trout Oncorhynchus mykiss and analysis oftheir expression during bacterial and parasitic infection. Fish ShellfishImmunol. 29, 705–715.
Wray, S.K., Gilbert, B.E., Noall, M.W., Knight, V., 1985. Mode of actionof ribavirin: effect of nucleotide pool alterations on influenza virusribonucleoprotein synthesis. Antivir. Res. 5, 29–37.
100 A. Rivas-Aravena et al. / Veterinary Immunology and Immunopathology 164 (2015) 93–100
Zhang, A., Chen, D., Wei, H., Du, L., Zhao, T., Wang, X., Zhou, H., 2012.Functional characterization of TNF-alpha in grass carp head kidneyleukocytes: induction and involvement in the regulation of NF-kappaBsignaling. Fish Shellfish Immunol. 33, 1123–1132.
Zou, J., Carrington, A., Collet, B., Dijkstra, J.M., Yoshiura, Y., Bols, N., Sec-ombes, C., 2005. Identification and bioactivities of IFN-gamma in
rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine char-acterized functionally in fish. J. Immunol. 175, 2484–2494.
Zou, J., Clark, M.S., Secombes, C.J., 2003. Characterisation, expression andpromoter analysis of an interleukin 10 homologue in the puffer fish,Fugu rubripes. Immunogenetics 55, 325–335.
