S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 1

Index for Supplementary Information

Topic Page Supplementary Figures 2 Supplementary Tables 15 Supplementary Methods 19

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 2

Supplementary Figure 1. Variability in the expression of Elavl/Hu proteins in the adult mouse

CNS. Immunohistochemical detection of Elavl1/HuR (Blue) or neuronal Elavl4/HuD (brown) proteins

in brain (a) cortex, striatum, thalamus & cerebellum (x10) as opposed to their corresponding

expression in (b) hippocampal areas (x10; x40 CA regions & DG). Counterstains: Nuclear Fast Red

(NFR) and Hematoxylin (H). Complete overlaps are observed in the thalamus; partial overlaps with

areas of restricted expression are observed in cortex (HuD mostly in deep layers; HuR mostly in

external layers) and the hippocampus (HuR mostly in CA1 and Dentate Gyrus; HuD mostly in

CA2/CA3)

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 3

Supplementary Figure 2. Changes in the expression of hippocampal Elavl proteins in response to

kainic acid excitation in vivo. (a) Immunohistochemical detection of Elavl1/HuR (Blue) or neuronal

Elavl4/HuD (brown) proteins in the hippocampus of control and CN-KO mice in either resting state

(UT), or immediately after seizure cessation i.e. 3 hrs post challenge with 30mg kainic acid (KA) and

5 days after the challenge. Magnification:x40. Counterstains: Nuclear Fast Red (NFR) and

Hematoxylin (H). (b) Quantitation of hippocampal HuR and HuD signals in brains of resting and KA-

challenged control and CN-KO mice. Data derived from quantitation of immunohistochemical

photomicropgraphs (x40) using the IMAGE J software and from n=4-6 mice/group

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 4

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 5

Supplementary Figure 3. Primary hippocampal neurons from prenatal CN-KO mice show a

progressive degenerative response in culture. (a) PCR detection of the Camk2-Cre transgene and

the recombination Elavl1fl locus in genomic DNA from hippocampal cultures derived from Control

(Elavl1fl/fl) and CN-KO (Camk2-Cre+Elavl1fl/fl) embryos and cultured in vitro for 6, 8 and 10 days. PCR

products were amplified using specific primers (see Supplementary Methods) and resolved onto a

2% agarose gel. The unrecombined (flox) and Cre-recombined (ko) products are indicated.

DIV=Days in vitro. (b) qRT-PCR detection of the progressive expression of Cre mRNA between DIV6

and DIV8 in extracts from CN-KO hippocampal cultures using specific primers (see Supplementary

Methods). Data are presented as fold change ±SEM relative to background values from control

cultures and derive from qRT-PCR experiments using RNA from 3 individual cultures per time point.

* p<0.01. (c) Detection of HuR in control and CN-KO hippocampal cultures at DIV7 via fluorescent

immunocytochemistry using an anti-HuR specific antibody (Millipore; 07-468) and DAPI as a nuclear

counterstain. Shown are electronically overlayed images. Photomicrographs were acquired using a

Nikon ECLIPSE E800 microscope equipped with a Nikon DMX12000 digital camera and overlayed

using Adobe Photoshop C4. Scale bars are indicated. Note the absence of HuR from several intact

nuclei in the CN-KO cultures (white arrows). (d) Detection of neuronal β-tubulin via fluorescent

immunocytochemistry using a specific antibody (TUJ1) in DIV7 and DIV10 hippocampal cultures.

Shown are representative images acquired as above and depicting the extensive network of

neurites which is apparent in DIV7/DIV10 control cultures and in DIV7 CN-KO cultures. In contrast,

note the complete fragmentation of β-tubulin positive neurites in DIV10 CN-KO cultures. Scale bars

are indicated. (e) Representative microscopic images of DIV10 cultures acquired using Hoffman

optics on a Nikon TE300 inverted microscope equipped with a Nikon DS-5M Digital Camera. Note

the intact and 3-D view of control neuron somata and neurites and the flattened fragmented

appearance of CN-KO cultures. (f) Quantitation of live, control and CN-KO, hippocampal neurons

between DIV6 and DIV10 using Presto-BlueTM (Invitrogen) and acquisition through an InfiniteM200

fluorometer (Tecan). Histograph values (+SEM) represent normalized values to those from control

cultures at DIV6 and were derived from 3 individual cultures per time point. *denote values of

statistical difference with p<0.05. Note the rapid decline of CN-KO neurons particularly between

DIV8 and DIV10. (g) Quantitation of basal viability at DIV7 cultures used for glutamate and kainate

exposure in Figure 3a and during the window of 20hrs that all treatments took place. Data acquired

following Presto BlueTM

staining and fluorometry. Histograph values (+SEM) represent normalized

values to 0hrs for each culture and were derived from 3-5 individual cultures per time point.

*denote values of statistical difference with p<0.01

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 6

Supplementary Figure 4. Expression of Elavl mRNAs in CN-KO hippocampal cultures. qRT-PCR

detection of Elavl1, Elavl2, Elavl3 and Elavl4 mRNAs in extracts from hippocampal cultures at DIV7

(Control: white bars; CN-KO: black bars) using specific primers (see Supplementary Methods).

Cultures were either left untreated or treated with 100μM Glutamate for 4hrs. Data are presented

as fold change ±SD relative to control cultures and derive from qRT-PCR experiments using RNA

from 3 individual cultures per time point. * p<0.01.

0

1

2Elavl1/HuR Elavl2/HuB Elavl3/HuC Elavl4/HuD

- +Glu - +Glu - +Glu - +Glu

mRN

A (F

old-

Chan

ge re

lati

ve to

non-

chal

leng

ed C

ontr

ol)

*

*

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 7

Supplementary Figure 5. HuR controls ROS production but not glutathione generation. (a) HT-22 neurons were transfected with shHuR and sh-scramble plasmids. The efficiency of shHuR was monitored by western blot analysis of HuR. GAPDH is shown as a loading control. (b) Quantification of HuR protein in mixed transfectants (ScP; HuRP) and isolated clonal populations presented as percentage of HuR in parental HT-22 cells. The clones selected as HuRhi (control), HuRmod and HuRlo are indicated. (c) Representative flow cytometric detection of DCFDA uptake in HT-22 cells containing or lacking HuR and following challenge with variable concentrations of Glutamate for 10 hrs. Values correspond to mean fluorescence intensity. See also Figure 3. (d) Enzymatic detection of glutathione in extracts from HT-22 sublines in the presence of increasing quantities of glutamate and for a period of 10hrs. (e) Immunodetection of Cycloxygenase 2 (COX2) and superoxide dismutases (SOD1, 2) in extracts from HuR containing and lacking HT-22 cells and following exposure to 4mM of glutamate for the indicated timepoints. GAPDH is shown as loading control.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 8

Supplementary Figure 6. HuR does not affect the sensitivity of HT-22 cells to peroxide,

cyclohexamide or TNF. Cell viability plots from MTT assays with HT-22 sublines responding to

increasing doses of hydrogen peroxide (left histogram), 10ng of recombinant mTNF, 1μg/ml

cyclohexamide (CHX) and CHX+TNF for a period of 24hrs. Data shown as mean+SD from 2

independent experiments with n=4 cultures/group.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 9

Supplementary Figure 7. Mitochondrial ATP synthase expression in CA1 neurons from CN-KO mice

challenged with KA. Immunohistochemical detection of mitochondrial ATP synthase (catalytic subunit α;

brown). Counterstain: Hematoxylin. (a) In low magnification the CA1 region magnified in (b) is shown in a

black box. Red box indicates CA2/3 region magnified in main Figure 3e. In (b) notice the granular

perinuclear and axonal staining.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 10

Supplementary Figure 8. HuR does not affect the response of MAPK/SAPK signals to glutamate.

(a) Immunodetection of native and phosphorylated forms of ERK1/2 and p38 kinases in protein

extracts from HT22 sublines challenged with glutamate (4mM) for 6, 10 and 20h. GAPDH is shown

as loading control. (b) Cell viability plots from MTT assays with HT-22 sublines responding to 4mM

glutamate following a preincubation with either the MEK1 inhibitor PD98059 (for 6hrs) or the p38

inhibitor SB203580 (for 2hrs) or DMSO vehicle. Data are shown as mean +SD from 3 individual

experiments. *P<0.05 versus treated cells.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 11

Supplementary Figure 9. Comparative detection of Elavl/Hu proteins in Total Brain and HT22 extracts. Protein extracts were prepared in RIPA buffer + protease inhibitors; the same amount of extract per tissue was loaded 6 times onto the same 12% SDS PAGE along with marker (Bluestar Prestain protein marker-Nippon, MWP03). Following electroblotting, the membrane was cut in strips and each strip was incubated with the antibody indicated. Following incubations with the corresponding HRP-conjugated secondary antibodies, blots were aligned on a solid surface and then developed using ECL-Prime except for the GAPDH stripe that was developed independently in ECL+. In (a) cropped stripes are shown aligned horizontally for comparison to marker values ranging from 35 to 48kDa and the signals recognized by the 3A2 antibody. In (b) cropped stripes are aligned vertically to compare with GAPDH and indicate the predicted sizes for each RBP. (c) Immunoblots indicating the absence of an anti- HuB positive signal in HT-22 extracts relative to brain tissue and HuR signals following incubation of the same membrane with the anti-HuR antibody.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 12

Supplementary Figure 10. Holistic RNP immunoprecipitation analysis for the detection of HuR:specific associations in glutamate challenged neurons. (a) Diagrammatic representation of our strategy to identify HuR-targeted neuronal mRNAs involved the glutamate toxicity. (b) Immunodetection of Elavls (3A2 antibody) in an RNP:immunoprecipitation assays from HT-22 cells challenged with 4mM Glutamate for 10hrs using anti-Elavl antisera or IgG. RNA isolated from these RNPs was used for microarray hybridizations. (c) VENN diagram derived from the bioinformatic comparison of Elavl:RNP associated RNAs to those appearing as differentially expressed (DEGs) from glutamate challenged HT-22 cells containing or lacking HuR. (d) Representative immunodetection of Elavl1/HuR or Elavl4/HuD in RNP:immunoprecipitation assays from glutamate challenged HT-22 cells using Elavl1/HuR or Elavl4/HuD antisera or IgG. RNA isolated from these RNPs was used for validation of specific associations.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 13

Supplementary Figure 11. Decay of target mRNAs in HuR proficient and deficient HT-22 cells in

the presence or absence of glutamate (4mM). Shown are semilogarithmic plots of the data (mean

+SD and regression lines) from three independent experiments. For statistical measurements, half-

life values derived from each experiment are compared in Figure 7a.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 14

Supplementary Figure 12. Monosome/Polysome in extracts from HT22 cells challenged with 4mM

glutamate for 8hrs. (a) Representative UV absorption profiles (OD 254nm) of eluted fractions

indicating the peaks corresponding to free RNA (F), monosomal (Mon) and polysomal (Poly)

fractions from HuRhi or HuRlo

HT22 cells that were analyzed in Figure 7b. (b) qRT-PCR analysis of the

Gapdh mRNA extracted in each fraction. The quantity of the mRNA in each fraction is presented as

the percentage of the total quantity measured. Data presented from 2 independent experiments.

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 15

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 16

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 17

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 18

Suppl. Table 4: mRNAs predicted to be commonly represented in neuronal Elavl/Hu and HuD * RNPsEnsembl ID Gene Name GF ** PPLR

ENSMUSG00000039988 Ankrd13c ankyrin repeat domain 13c 2,1502 1,0000ENSMUSG00000067336 Bmpr2 bone morphogenetic protein receptor, type II (serine/th 3,6940 1,0000ENSMUSG00000032076 Cadm1 cell adhesion molecule 1 1,6791 1,0000ENSMUSG00000029836 Cbx3 chromobox 3 3,5215 1,0000ENSMUSG00000062929 Cfl2 cofilin 2, muscle 2,2938 1,0000ENSMUSG00000024576 Csnk1a1 casein kinase 1, alpha 1 3,5167 1,0000ENSMUSG00000028156 Eif4e eukaryotic translation initiation factor 4E 2,6337 1,0000ENSMUSG00000046785 Epm2aip1 EPM2A (laforin) interacting protein 1 3,1201 1,0000ENSMUSG00000032966 Fkbp1a FK506 binding protein 1a 1,8035 0,9999ENSMUSG00000025040 Fundc1 FUN14 domain containing 1 1,8750 1,0000ENSMUSG00000029405 G3bp2 GTPase activating protein (SH3 domain) binding protein 2,4410 1,0000ENSMUSG00000026675 Hsd17b7*** hydroxysteroid (17-beta) dehydrogenase 7 2,7890 1,0000ENSMUSG00000024423 Impact imprinted and ancient 1,8327 1,0000ENSMUSG00000066324 Impad1 inositol monophosphatase domain containing 1 1,8723 0,9994ENSMUSG00000069662 Marcks myristoylated alanine rich protein kinase C substrate 8,0145 1,0000ENSMUSG00000062270 Morf4l1 mortality factor 4 like 1 1,6687 1,0000ENSMUSG00000069769 Msi2 musashi RNA-binding protein 2 1,6901 1,0000ENSMUSG00000039542 Ncam1 neural cell adhesion molecule 1 3,8635 1,0000ENSMUSG00000017376 Nlk nemo like kinase 2,3133 1,0000ENSMUSG00000026434 Nucks1 nuclear casein kinase and cyclin-dependent kinase subs 3,6241 1,0000ENSMUSG00000024122 Pdpk1 3-phosphoinositide dependent protein kinase 1 2,5758 1,0000ENSMUSG00000014956 Ppp1cb protein phosphatase 1, catalytic subunit, beta isoform 2,1705 1,0000ENSMUSG00000037643 Prkci protein kinase C, iota 1,5557 1,0000ENSMUSG00000030704 Rab6 RAB6A, member RAS oncogene family 1,6386 1,0000ENSMUSG00000062232 Rapgef2 Rap guanine nucleotide exchange factor (GEF) 2 4,6924 1,0000ENSMUSG00000075376 Rc3h2 ring finger and CCCH-type zinc finger domains 2 4,1080 1,0000ENSMUSG00000022664 Slc35a5 solute carrier family 35, member A5 1,8716 0,9987ENSMUSG00000025986 Slc39a10 solute carrier family 39 (zinc transporter), member 10 1,6232 0,9890ENSMUSG00000006818 Sod2^ superoxide dismutase 2, mitochondrial 2,3602 1,0000ENSMUSG00000019998 Stx7 syntaxin 7 2,3881 1,0000ENSMUSG00000056429 Tgoln1 trans-golgi network protein 1,7369 1,0000ENSMUSG00000029390 Tmed2 transmembrane emp24 domain trafficking protein 2 2,5265 1,0000ENSMUSG00000029390 Tmed2 transmembrane emp24 domain trafficking protein 2 1,8008 0,9999ENSMUSG00000058317 Ube2e2 ubiquitin-conjugating enzyme E2E 2 2,0291 1,0000ENSMUSG00000050148 Ubqln2 ubiquilin 2 1,9237 1,0000ENSMUSG00000029684 Wasl Wiskott-Aldrich syndrome-like (human) 2,4990 1,0000ENSMUSG00000022634 Yaf2 YY1 associated factor 2 1,6453 0,9998ENSMUSG00000026872 Zeb2 zinc finger E-box binding homeobox 2 4,3976 1,0000ENSMUSG00000049672 Zfp161 zinc finger and BTB domain containing 14 3,5318 1,0000

*Data derived from the bioinformatic comparison of the Elavl/HuR IP's presented here to Elavl4 Ips presented in Bolognani et al., Nucl. Acid Res, 2010, 38,117-130** Fold enrichment values in Elavl/Hu:RNA-IPs relative to IgG-IP:RNAs and the corresponding microarray analysis*** Found as differentially expressed in HuRlo cells^ Verified in this report

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 19

SUPPLEMENTARY METHODS

Cellular Assays

Cell viability assays were performed as described in the main mathods or as indicated in

supplementary Figure 3. MAPK/SAPK inhibitors were added 2 hrs (for SB203580; SantaCruz) or 6

hrs (PD98059; Calbiochem) prior to glutamate challenge. For alternative assays, cells were treated

with H2O2

(Sigma) and murine TNF (Peprotech) in the absence or presence of Cyclohexamide

(Sigma). The flow cytometric detection of ROS was performed as in protocols described in the

DCFDA Cellular ROS Detection Assay Kit (Abcam).

Protein analysis via immunoblots

For blots in supplementary Figures 5 and 8, total protein extracts from HuRhi, HuRmod and HuRlo

HT22 were prepared in RIPA buffer. Equimolar amounts of protein were analyzed on SDS-

polyacrylamide gels (10-12%) and blotted onto nitrocellulose membranes (Protran BA 85, GE

Healthcare). Probing antibodies included: COX2 from Cayman Chemical, SOD1 (ab13498), SOD2

(ab13533) from abcam, ERK (K-23), p-ERK (E-4), P38 (H-147) from Santa Cruz, pP38 (12F8) from Cell

Signaling and GAPDH (6C5) from Ambion. Primary antibodies were detected with horseradish

peroxidase-conjugated secondary antibodies (Southern Biotechnologies) and visualized by

enhanced chemiluminescence (ECL+; Amersham).

Total Glutathione measurement

Quantification of glutathione (GSH) levels in HuRhi, HuRmod, HuRlo

and HT22p cells after glutamate

treatment was performed with Glutathione Assay Kit according to manufacturer protocol (Cayman

Chemical Company). Cells were challenged with 3 and 6mM of glutamate.

RNA Labeling and Affymetrix Expression Array processing

300 ng of total RNA was used to generate biotinylated complementary RNA (cRNA) for each

treatment group using the Total RNA Target Labeling protocol (Affymetrix, Santa Clara, CA) as

described at the GeneChip® Whole Transcript (WT) Sense Target Labeling Assay Manual v4 (701880

Rev. 4). In short, isolated total RNA was checked for integrity using the RNA 6000 Nano LabChip kit

on the Agilent Bioanalyzer 2100 (Agilent Technologies, Inc., Palo Alto, CA) and concentration using

the ND-1000Nanodrop (Thermo Fisher Scientific, Wilmington, Delaware USA). Poly-A RNA control

kit and RNA of interest were reverse transcribed using a T7-(N)6 primer and Superscript II reverse

transcriptase GeneChip® WT cDNA Synthesis Kit (Affymetrix, Santa Clara, CA). Polymerase I from

the same kit was used for second strand cDNA synthesis. Biotinylated cRNA was synthesized from

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 20

the double stranded cDNA using T7 RNA polymerase and a biotin-conjugated pseudouridine

containing nucleotide mixture provided in the IVT Labeling Kit (Affymetrix, Santa Clara, CA). The

cRNA was purified with GeneChip® Sample Cleanup Modules (Affymetrix, Santa Clara, CA). 10 μg of

purified cRNA were used for second cycle cDNA synthesis with Random primers and Superscript II

reverse transcriptase. GeneChip® Sample Cleanup Module (Affymetrix, Santa Clara, CA) was used to

purify the resulted single stranded DNA (ssDNA). Fragmentation of 5.5μg ssDNA was performed and

the resulted product was labeled with DNA Labeling Reagent, GeneChip® WT Terminal Labeling Kit

(Affymetrix, Santa Clara, CA). The product was hybridized for 16 hours to MOGene 1.0 ST arrays in

an Affymetrix GeneChip® Hybridization Oven 640. Immediately following hybridization, the

GeneChip® arrays are washed and stained with streptavidin-phycoerythrin conjugate, GeneChip®

Hybridization wash and stain kit (Affymetrix, Santa Clara, CA), using automated protocol on a

GeneChip®

Fluidics Station 450, followed by scanning on an Affymetrix GeneChip® Scanner 3000 at

570nm. The Affymetrix eukaryotic hybridization control kit and Poly-A RNA control kit were used to

ensure efficiency of hybridization and cRNA amplification. All cRNA were synthesized and processed

simultaneously. Images and data were acquired using the Affymetrix® GeneChip® Command

Console® Software (AGCC) where initial quality check of the experiment was performed. The Partek

Software Genomics suite (Partek Incorporated Missouri 63141, USA) was used for the analysis of

the data. Background correction applied to the data using RMA background correction adjusted for

GC content and quantile normalization was performed with median polish probeset summarization.

A principal Component analysis produced the initial list for statistical selection.

Bioinformatic Analysis To identify differentially expressed genes (DEGs) between HuRhi vs HuRlo cells or RNAs enriched in

Hu:RNA Immunoprecipitations over IgG ips, corrected microarray intensity values were further

processed via a Bayesian method that includes probe-level measurement error into the detection

of the differentially expressed genes (probability of positive log-ratio –PPLR- algorithm; Liu, X.,

Milo, M., Lawrence, N. D., & Rattray, M. (2006). Probe-level measurement error improves accuracy

in detecting differential gene expression. Bioinformatics, 22(17), 2107-2113.). The genes

characterized as up-regulated have a probability positive log-ratio (PPLR value) of 0.94 and above

with a mean log-ratio between control and experimental genes (LRM value), higher than 0.85.

Equivalently for down regulation the PPLR value was set lower than 0.06 with an LRM value below -

0.5. To identify transcription factors correlating to DEGs we used the T-facts database (Essaghir A,

Toffalini F, Knoops L, Kallin A, van Helden J, Demoulin JB: Transcription factor regulation can be

accurately predicted from the presence of target gene signatures in microarray gene expression

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 21

data. Nucleic Acids Res. 2010 Jun 1;38(11):e120). Statistics were extracted regarding up or down

regulation of the predicted Transcription Factors relating with all the differentially expressed genes

from total RNA and the significantly enriched genes from the RIP. All predicted transcription factors

with a set number of 1000 permutations.

Quantitative RT-PCR and genomic PCR The list below indicates the oligonuclotide pairs used for the amplification of selected RNAs and genomic DNA (for Cre and the Elavl1 locus)

Name Sequence 5’ to 3’ Atp2b4 sense Atp2b4 antisense Atp5a1 sense Atp5a1 antisense Atp5b sense Atp5b antisense

BCL2 sense BCL2 antisense Cirbp sense Cirbp antisense Cre gene/RNA sense Cre gene/RNA antis Cyt C sense Cyt C antisense FOXO1 sense FOXO1 antisense Gja1 sense Gja1 antisense Elav1 sense Elav1 antisense Elavl1 gene prim. 1 Elavl1 gene prim. 2 Elavl1 gene prim. 3 Elavl2 sense Elavl2 antisense Elavl3 sense Elavl3 antisense Elavl4 sense Elavl4 antisense Myc sense Myc antisense Nrf2 sense Nrf2 antisense NQO1 sense NQO1 antisense Prkar2α sense Prkar2α antisense

GGAAAGAACGTGATACCTCCAAA GGCTGCGATCTCTAGGATGATG TCTCCATGCCTCTAACACTCG CCAGGTCAACAGACGTGTCAG GGTTCATCCTGCCAGAGACTA AATCCCTCATCGAACTGGACG

ATGCCTTTGTGGAACTATATGGC GGTATGCACCCAGAGTGATGC TGTCCTTTACCACCACCACT GACTCAGCTTCGACACCAAC ATTACCGGTCGATGCAACGAGT CAGGTATCTCTGACCAGAGTCA GCAAGCATAAGACTGGACCAAA TTGTTGGCATCTGTGTAAGAGAATC AGATGAGTGCCCTGGGCAGC GATGGACTCCATGTCACAGT ACAGCGGTTGAGTCAGCTTG GAGAGATGGGGAAGGACTTGT ATGTCTGGTGGTTATGAAGA AGCTTTGCAGATTCAACCTC GTTCCATGGCTCCCCATATC TGTCCATCTGCACGAGACTA TGGCACTCACTGAACTGGAA ACACAGCCAATGGTCCAACC TTCCCGGAGTCAACTGGTGA ATGGTCACTCAGATACTGGGG TTCTGGGGTAGGTAGTTGACG TGGACCGACATCCAATACAA CCTGAATTCCTCTTGGGTCA AGAGCTCCTCGAGCTGTTTG ACGGAGTCGTAGTCGAGGTC TAGATGACCATGAGTCGCTTGC GCCAAACTTGCTCCATGTCC AGGATGGGAGGTACTCGAATC AGGCGTCCTTCCTTATATGCTA CCGTATGGGCAGATTGAGTA CTACTAAATACAAACAACAAAAACCCT

S k l i r i s & P a p a d a k i e t a l . , S u p p l e m e n t a r y I n f o r m a t i o n P a g e | 22

Ppargc1α sense Ppargc1α antisense Ppargc1β sense Ppargc1β antisense Sema3α sense Sema3α antisense Sod1 sense Sod1 antisense Sod2 sense Sod2 antisense GAPDH sense GAPDH antisense B2M sense B2M antisense

CCGTAAATCTGCGGGATGATG CAGTTTCGTTCGACCTGCGTAA CTTGCTAACATCACAGAGGATATCTTG GGCAGGTTCAACCCCGA GGATGGGTCCTCATGCTCAC TGGTGCTGCAAGTCAGAGCAG CAAGCGGTGAACCAGTTGTG TGAGGTCCTGCACTGGTAC GCCTGCACTGAAGTTCAATG ATCTGTAAGCGACCTTGCTC TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG TTCTGGTGCTTGTCTCACTGA CAGTATGTTCGGCTTCCCATTC