Streptococcus pyogenes pili promote pharyngeal celladhesion and biofilm formation
Andrea G. O. Manetti,1 Chiara Zingaretti,1
Fabiana Falugi,1 Sabrina Capo,1 Mauro Bombaci,1
Fabio Bagnoli,1 Gabriella Gambellini,2
Giuliano Bensi,1 Marirosa Mora,1
Andrew M. Edwards,1 James M. Musser, 3
Edward A. Graviss,4 John L. Telford,1 Guido Grandi1*and Immaculada Margarit1
1Novartis Vaccines and Diagnostics, Via Fiorentina 1,53100, Siena, Italy.2Centro Interdipartimentale di Microscopia Elettronica,Università della Tuscia, Viterbo, Italy.3Center for Molecular and Translational HumanInfectious Diseases Research, The Methodist HospitalResearch Institute, Houston, TX 77030, USA.4Department of Pathology, Baylor College of Medicine,Houston, TX 77030, USA.
Summary
Group A Streptococcus (GAS, Streptococcus pyo-genes) is a Gram-positive human pathogen respon-sible for several acute diseases and autoimmunesequelae that account for half a million deaths world-wide every year. GAS infections require the capacityof the pathogen to adhere to host tissues andassemble in cell aggregates. Furthermore, a role forbiofilms in GAS pathogenesis has recently beenproposed. Here we investigated the role of GAS pili inbiofilm formation. We demonstrated that GAS pilus-negative mutants, in which the genes encoding eitherthe pilus backbone structural protein or the sortaseC1 have been deleted, showed an impaired capacityto attach to a pharyngeal cell line. The same mutantswere much less efficient in forming cellular aggre-gates in liquid culture and microcolonies on humancells. Furthermore, mutant strains were incapable ofproducing the typical three-dimensional layer withbacterial microcolonies embedded in a carbohydratepolymeric matrix. Complemented mutants had anadhesion and aggregation phenotype similar to thewild-type strain. Finally, in vivo expression of pili was
indirectly confirmed by demonstrating that most ofthe sera from human patients affected by GAS-mediated pharyngitis recognized recombinant piliproteins. These data support the role of pili in GASadherence and colonization and suggest a generalrole of pili in all pathogenic streptococci.
Introduction
Group A Streptococcus (GAS, Streptococcus pyogenes)is a Gram-positive pathogenic bacterium that exclusivelyinfects humans. Primary infections usually take place atthe level of the nasopharynx and skin and can result eitherin relatively mild diseases, such as pharyngitis, impetigoand cellulitis, or in very severe, life-threatening diseases,including myositis and necrotizing fascitis (Cunningham,2000).
As with many other bacteria, initiation of GAS infectionsrequires the capacity of the pathogen to adhere to hosttissues and assemble in cell aggregates. In addition, arole for biofilms in GAS pathogenesis has recently beenproposed and experimentally supported in a number ofrecent publications (Neely et al., 2002; Akiyama et al.,2003; Hidalgo-Grass et al., 2004; Cho and Caparon,2005; Baldassarri et al., 2006).
Biofilm represents a protected mode, which allows bac-teria to survive and proliferate in a hostile environment. Itsstructure, constituted by clusters of bacteria and carbohy-drate matrix interrupted by a complex network of chan-nels, allows sufficient nutrients to sustain growth and, atthe same time, to protect the bacteria from toxic com-pounds and reagents present in the environment, includ-ing those elicited by the innate and adaptive immuneresponses of the host (Costerton et al., 1999; Lewis,2001).
The pattern of biofilm development involves bacterialattachment to a solid surface, the formation of microcolo-nies and the differentiation into exopolysaccharide (EPS)-encased, mature biofilm (Hall-Stoodley et al., 2004).Several surface-associated proteins have been shown tobe involved in bacterial attachment to cells and in micro-colony formation in different pathogens (Costerton et al.,1999). In particular, many Gram-negative bacteria exploithair-like appendages protruding from the cell surface topromote attachment and aggregation to human cells(Helaine et al., 2005), microcolony formation and biofilm
formation (Di Martino et al., 2003; Klausen et al., 2003;Orndorff et al., 2004; Paranjpye and Strom, 2005) andultimately colonization of host tissue (Kirn et al., 2000).
We have recently shown that, like other Gram-positivebacteria (Ton-That and Schneewind, 2004), pathogenicGroup A and B streptococci are decorated with long pro-truding pilus-like structures (Lauer et al., 2005; Moraet al., 2005; Telford et al., 2006) which went unobserveddespite several decades of intensive research. In par-ticular, GAS pili are encoded by a highly variable 11 kbpathogenicity island known as the fibronectin-binding,collagen-binding, T-antigen (FCT) region. Four majorvariants of the FCT region have been described on thebasis of gene content and organization, each of whichcontains genes coding for pilus structural subunits (thebackbone protein and ancillary proteins) and for thesortase enzymes required for pilus assembly. Interest-ingly, all GAS isolates so far analysed carry and expressthe FCT pilus locus (F. Falugi et al., unpublished; Krato-vac et al., 2007), suggestive of a key, but so far unchar-acterized, role of pili in streptococcal interaction with thehuman host.
In this paper we demonstrate that GAS pili are requiredfor efficient attachment to human cells. GAS pilus-negative mutants, in which either the pilus backbonestructural protein or the sortase C1 gene has beendeleted, showed an impaired capacity to attach to a pha-ryngeal cell line. Furthermore, the same mutants weremuch less efficient in forming cellular aggregates in liquidculture and microcolonies on human cells. Finally, whenbiofilm formation was followed over several hours ofgrowth, mutant strains were incapable of producing thetypical three-dimensional layer constituted by the bacte-rial structured community enclosed in the polymericmatrix. Complementation of mutants with plasmids carry-ing the deleted genes restored the phenotypic behaviourobserved in the wild-type strain.
Taken together these data support the role of pili in GASadherence and colonization on human tissues and suggesta general role of pili in all pathogenic streptococci.
Results
Construction of GAS pilus-negative mutants,complemented strains and Lactococcus lactisexpressing GAS pili
To investigate the possible role of pili in adhesion, aggre-gation and biofilm formation in GAS, we took advantage oftwo in-frame deletion mutants of the pilus backbone gene(spy0128) or the sortase C1 gene (spy0129) previouslyobtained in the M1_SF370 strain (see Fig. 1A for a sche-matic organization of the pilus island in SF370, in whichthe deleted genes are highlighted in grey). In fact, inacti-
vation of either gene abolished pilus assembly as indi-cated by the disappearance of the typical protein bandladder which is observed in Western blots of total proteinextracts from wild-type SF370 using antisera against anyof the three pilus structural proteins (Mora et al., 2005).Complementation of the mutant strains with plasmids car-rying an intact, functional copy of the correspondingdeleted gene restored the capacity to form the high-molecular-weight ladder (data not shown).
As already shown by Mora et al. (2005), gold-stainedimmune electron microscopy analysis of the wild-typeSF370 GAS strain using antibodies against the backbonepilus subunit, visualized the protein assembled in long,protruding pilus-like structures, and also partly associatedwith the bacterial surface (Fig. 1B). This is consistent withthe mechanism of pilus assembling that envisages thecovalent link of the pilus monomers to the membrane-associated sortase, and the subsequent sortase-mediated pilus polymerization (Telford et al., 2006). Asexpected on the basis of the Western blot analysis (seeabove), gold-stained electron microscopy analysis ofmutant and mutant-complemented strains confirmed thatboth genes encoding the backbone protein and thesortase C1 were indispensable for the proper formation ofthe pilus-like structures, in that their presence or absencecorrelated with the visualization of pili (Fig. 1C–F). It hasto be noted that a limited amount of backbone protein
Fig. 1. Expression of M1 pili in GAS SF370 and mutantderivatives.A. Schematic representation of FCT-2 region from GAS M1 strainSF370. Genes encoding the three pilins Spy0125 (Cpa), Spy0128(Backbone, Tee1) and Spy0130 are shown as thicker arrows.Genes deleted in the mutant strains are shown in grey.B–F. Immunoelectron microscopy images of wild-type GAS SF370(B), in-frame deletion mutants of the Tee1 gene spy0128 (C),sortase C1 spy0129 (D), the respective complemented strains (Eand F). Zoomed images are also shown (b–f). Bacteria werelabelled with mouse sera against the backbone protein followed bysecondary antibodies conjugated to 10 nm gold particles.Pre-immune sera were used as negative controls (data not shown).Scale bars: 200 nm.
appeared to be still visible on the surface of theSF370Dspy129 (Fig. 1D). Although not further investi-gated, this could be ascribable to the activity of the othersortases known to be present in GAS, which, with lowefficiency, might be capable of linking the protein to thesurface and of catalysing a few oligomerization reactions.
With the aim of further supporting the role of pili inbacterial adhesion and aggregation, we also created aLactococcus lactis recombinant strain carrying the entirepilus locus from GAS SF370. The FCT region was PCR-amplified using specific primers annealing upstream ofthe spy0125 gene and downstream of the spy0130 gene(see Experimental procedures) and the PCR productinserted into plasmid pAM401 downstream from the pro-moter region of Type I pilus island of Group B Streptococ-cus (GBS). Previous data from our laboratories indicatedthat this promoter was sufficiently strong to drive efficientGBS pilus expression in L. lactis (Buccato et al., 2006). Asshown in Fig. 2, L. lactis carrying the recombinant plasmid(Fig. 2B), but not the empty plasmid (Fig. 2A), acquiredthe capacity to produce the high-molecular-weight het-eropolymer and to assemble pilus-like structures protrud-ing out of the bacterial cell wall.
Role of GAS pili in bacterial adhesion to pharyngealhuman epithelial cells
We first asked the question whether pili could promotebacterial adhesion to confluent monolayers of humanpharyngeal cells (Detroit-562). To this aim, wild-typeGAS SF370, Dspy0128 and Dspy0129 strains weregrown to mid-exponential phase and, after repeated pas-sages through a syringe needle to dissociate bacterialcell aggregates, bacteria were added to human cellmonolayers and incubated at different times. Plateswere then washed to remove non-adhering bacteria andfinally adhering bacteria were colony counted. As shownin Fig. 3A, pili expression clearly favoured the capacityof GAS to adhere to epithelial cells even after a shortincubation time (5 min). At 30 min incubation, over five-fold difference in adherence was observed between thewild type and the pilus-negative mutant. When bacterialincubation with epithelial cells was prolonged to 120 min,the difference in adhesion between the wild type andmutant strain was still statistically significant but lesspronounced.
Altogether, these data strongly suggest that pili exert anactive role in promoting a rapid attachment of GAS to hosttissues.
The role of GAS pili in adhesion to human cells wasfurther supported by comparing the number of piliated andnon-piliated L. lactis bacteria, which after 15 min incuba-tion, adhered to Detroit-562 cells. As shown in Fig. 3B, theexpression of GAS pili on the surface of L. lactis signifi-
cantly increased the capacity of the bacterium to bindhuman cells. The extent of the difference in bindingcapacity, which in the particular experiment shown in thefigure was over fourfold, was slightly variable (rangingfrom two- to fourfold), probably because of the intrinsicinstability of the plasmid carrying the pilus island leadingto chromosomal integration and/or loss of the pilus genesduring the growth in broth culture (~4 h) prior to use inadhesion experiments (data not shown).
Role of GAS pili in bacterial aggregation
When GAS SF370 is grown in liquid medium to mid-logphase and then agitation is interrupted, bacterial cells
Fig. 2. Expression of M1 pili in L. lactis MG1363. Immunoblotanalysis (upper panels) and immunoelectron microscopy images(lower panels) of L. lactis carrying the empty vector pAM401 (A)and of a derivative strain harbouring the M1 pilus region in thesame plasmid (B). For immunoblots, sera against the three pilincomponents Spy0125, Spy0128 and Spy0130 were used to probecell-wall fractions of each strain. Cross-reacting proteins present inthe recipient L. lactis are indicated (*). For immunoelectronmicroscopy images, bacteria were labelled with mouse sera againstthe backbone protein followed by secondary antibodies conjugatedto 10 nm gold particles. Pre-immune sera were used as negativecontrols (data not shown). Scale bars: 200 nm.
precipitate in approximately 30 min, remarkably reducingthe optical density of the culture (Fig. 4). Confocal micros-copy revealed that the cellular precipitate appears like amass of tightly associated cells (Fig. 5) which, to be sepa-rated, require repeated passage through a syringe needle.
To test whether pili might contribute to the aggregationand sedimentation of bacteria, the pilus-negativeDspy0128 and Dspy0129 mutant strains were grown tomid-log phase and the formation of the bacterial precipi-tate under non-agitated growth conditions was followedand compared with that observed with the wild-type strain.As shown in Fig. 4, differently from the wild-type strain, noappreciable sedimentation could be observed in the cul-tures of either pilus mutants. Microscopic analysis of thecultures revealed that mutant cells were no longercapable of making aggregates (Fig. 5). When the mutantswere complemented with plasmids carrying the corre-sponding deleted genes, the aggregation phenotype was
almost completely recovered (Fig. 5), despite the plasmidinstability observed in the complemented strains in theabsence of antibiotic (data not shown). Interestingly,L. lactis expressing the GAS pilus also appeared toacquire the capacity to form long chains of adhering cells(Fig. 6).
To test whether the tendency of piliated GAS to makeaggregates in liquid culture was also maintained in bac-teria grown in the presence of human cells, wild-type andpilus-negative strains were cultured to mid-log phase andthen bacteria were dissociated and added to a monolayerof epithelial cells. After 15 min of incubation, non-adheringbacteria were removed and the capacity of adhering bac-teria to form aggregates after 120 min of growth in thepresence of human cells was followed by confocalmicroscopy. As shown in Fig. 7, after 2 h incubation thegrowing wild-type strain formed extensive clumps of cells,which had a typical appearance of microcolonies extend-ing in 3D space (Fig. 7D and G). In the case of the twomutant strains, aggregates were clearly much smaller insize and did not form multilayered structures (Fig. 7E, F,H, I).
Bacterial adhesion to human pharyngeal cells is directlymediated by pilus-like structures
The preceding data raised the possibility that pilus-mediated aggregation may have contributed to theobserved increased bacterial adhesion to Detroit-562cells. To address this issue, wild-type bacterial cell aggre-gates were thoroughly separated by several passagesthrough a syringe needle to obtain single cells or verysmall bacterial chains as for pili mutants. Wild-type disag-gregated bacteria as well as Dspy0128 and Dspy0129mutant strains were added to human cell monolayers andincubated for very short times (1 min) to avoid cellre-aggregation. Plates were washed to remove non-
Fig. 3. Role of pili in adhesion to humanpharyngeal cells. Adherence of GAS SF370WT, Dspy0128 and Dspy0129 mutants (A) andL. lactis expressing M1 pilus (B) to Detroit-562cells. Cell monolayers were infected with GASstrains (moi 100:1) for 5, 15, 30 or 120 min orwith L. lactis strains (moi 10:1) for 15 min.Each experiment was performed in triplicatewells and repeated three times. Adherence isexpressed as percentage of adhering versustotal bacteria at each time point. Error barsrepresent the standard deviation of the meanvalue.
Fig. 4. Sedimentation of GAS SF370 wild type (WT) comparedwith knockout mutants. GAS SF370 and mutant strains lacking thepilus backbone (Dspy0128) or the sortase needed forpolymerization (Dspy0129) were grown in THY to OD600 = 0.6,before agitation was interrupted and sedimentation was followed bymeasuring OD600 at regular time intervals in the upper part of thetubes.
adhering bacteria and finally adhering bacteria werecolony counted or, in parallel experiments, analysed byconfocal microscopy.
As shown in Fig. 8A, the number of bacteria adhering toepithelial cells after a very short period of incubation wasstill 10 times higher in the case of disaggregated wild-typebacteria than in the non-piliated mutants (P < 0.05). Inaddition, confocal microscopy revealed (Fig. 8D) that,while pili mutant strains grew in straight bacterial chains,wild-type bacteria, shortly after disaggregation, appearedas folded chains. The folded phenotype is likely to be dueto microaggregation between bacteria in the same chain.Finally, a comparison of the number of discrete microag-gregates adhering to the Detroit-562 cells still showed asignificant difference between wild-type and pilus mutants(Fig. 8B and C, P < 0.05).
These data demonstrated that pilus-like structures ofdisaggregated cells directly favour bacterial adhesion.
As already pointed out, pili are constituted by threeprotein subunits, the backbone protein and the ancillaryproteins 1 and 2. An interesting question is which of the
proteins contribute to the adhesion to epithelial cells. Toaddress this issue, we analysed the ability of the recombi-nant Tee1 (Spy0128), Cpa (Spy0125) and Spy0130 pro-teins to bind Detroit-562 cell line. Cells were incubated withincreasing concentrations of purified proteins (Fig. 9B) andtheir binding capacity was measured by FACS usingprotein-specific polyclonal antibodies.As shown in Fig. 9A,both ancillary proteins Cpa and Spy0130 bound epithelialcells in a dose-dependent manner, while no binding activitywas observed for the backbone protein and the negativecontrol protein Sag0823 from Streptococcus agalactiae.While it cannot be excluded that the backbone protein canbind the epithelial cells only in the properly assembledoligomeric form, the data suggest that both ancillary pro-teins intervene in the pilus-dependent interaction of GAS tohuman tissues.
In conclusion, these data clearly indicate that pili notonly favour GAS adhesion to epithelial cells, but alsoremarkably contribute to the capacity of the pathogen toaggregate in liquid culture and to form microcolonies onliving surfaces.
Fig. 5. Pilus-dependent aggregation of GAS SF370. Confocal microscopy images of GAS SF370 wild type (WT), deletion mutants Dspy0128,Dspy0129, complemented strains Dspy0128 (pAMspy0128) and Dspy0129 (pAMspy0129) grown to late exponential phase onpolylysine-coated coverslips and stained with anti-GAS whole cell (yellow) and anti-Spy0128 (purple) sera.
Fig. 6. Aggregation phenotype of piliexpressing L. lactis. Light microscopy analysisof L. lactis strains MG1363 (pAM401) (A) orMG1363 (pAMpilM1) expressing M1 pilus (B).
We subsequently analysed the role of pili in biofilm forma-tion. To this aim, we used two frequently applied proce-dures in biofilm studies (O’Toole and Kolter, 1998; Cho andCaparon, 2005). According to the first procedure, a 1:10dilution of an overnight culture in C-medium at 37°C wasadded to polystyrene plastic wells and incubated at roomtemperature for 24 h, the supernatant was discarded andthe biofilm was visualized with 0.2% crystal violet. Asshown in Fig. 10, wild-type SF370 strain was approxi-mately five- to sixfold more efficient than the pilus-negativemutants in generating biofilm on polystyrene. Comple-mented mutants, which as already pointed out, have atendency to lose the plasmids carrying the complementinggene in the absence of antibiotic selective pressure, par-tially recovered the capacity to make biofilm on plastic.
The second experimental procedure to analyse biofilmformation exploited confocal microscopy of GAS growingon polylysine-coated coverslips, using antibodies againstwhole bacteria and pilus Spy0128 backbone protein tovisualize bacteria, and FITC-conjugated Concanavalin Ato visualize the EPS matrix. Wild-type and complementedbacteria were able to produce the extracellular polysac-charide matrix, as detectable by the lectin Concanavalin Alabelled with FITC (Fig. 11A, C and E). This polysaccha-ride matrix was almost absent in mutant strains adheringto the plastic surface (Fig. 11B and D). After 72 h thebiofilm formed by the wild-type strain showed an averagethickness of 10.8 mm while the two mutants failed to forma significant multilayered, mature biofilm (Fig. 11). Thecomplemented strains Dspy0128pAM(spy0128) andDspy0129pAM(spy0129) at least partially restored thecapacity to form biofilms whose average thickness,
Fig. 7. Confocal microscopy analysis of microcolony formation by wild-type (WT) GAS SF370 and mutant strains during adhesion toDetroit-562 pharyngeal cell line. Cell monolayers were infected with WT and mutant GAS SF370; wells were washed three times with PBSafter 15 min to remove unattached bacteria and infection was allowed to continue to 120 min. Eukaryotic cells were stained withphalloidin-conjugated Alexa Fluor 647 (blue), while bacteria were stained with polyclonal anti-GAS serum (yellow).A–C. SF370 WT, pilus backbone deletion mutant Dspy0128 or sortase mutant Dspy0129 at 15 min infection.D–F. SF370 WT Dspy0128 and Dspy0129 at 120 min infection.G–I. Three-dimensional images after 120 min infection.
measured in the areas of microcolony accumulation, was11.8 mm and 4.5 mm respectively.
Expression of pili in the human host
Having demonstrated that pili exert an important role inpromoting GAS adhesion to epithelial cells and biofilmformation on abiotic supports in vitro, a key questionwas whether these phenomena occur in vivo as well. A
first step to address this issue was the demonstrationthat pili are expressed when the pathogen is in thehuman host. We investigated in vivo expression of piliindirectly by analysing the presence of antibodies spe-cific to pilin components in patients suffering from GAS-associated pharyngitis, the assumption being that if piliare exposed on the surface of invading bacteria theymay elicit a specific antibody response. For the analysisof pilin-specific antibodies in humans we capitalized on
Fig. 8. Pili directly promote adhesion tohuman pharyngeal cells.A and B. Adherence of disaggregated GASSF370 wild type (WT), Dspy0128 andDspy0129 mutants to Detroit-562 cells. Cellmonolayers were infected with GAS strains(moi 500:1) for 1 min. Each experiment wasperformed in triplicate wells. Adherence isexpressed as percentage of adhering versustotal bacteria (A) and as number of bacterialmicrocolonies in 10 randomly chosen fieldsupon confocal microscopy analysis(magnification 20¥) (B). Error bars representthe standard deviation, of the mean.C and D. Confocal microscopy images ofSF370 WT, pilus backbone deletion mutantDspy0128 and sortase mutant Dspy0129 at1 min infection of Detroit cells at 20¥ (C) and60¥ magnification (D).
Fig. 9. Fluorescence-activated cell sortinganalysis of pilin protein binding to Detroit-562cells.A. Cells were incubated with increasingconcentrations of the recombinant proteins.Bound pilin proteins were detected withspecific antibodies and fluorescent secondaryantisera. MFI, net mean fluorescenceintensity; ctrl, negative control.B. SDS-PAGE analysis of the purifiedrecombinant proteins used in this experiment.
the availability of a GAS protein array assembled in ourlaboratories (M. Bombaci et al., unpubl. results). Thearray carries 120 recombinant GAS surface-associatedproteins, including 11 pilin subunits (four backboneproteins and seven ancillary proteins) correspondingto M1, M3, M6 and M12 strains and belonging to thefour major FCT types so far identified in GAS (Moraet al., 2005). Sequence analysis of 50 isolates demon-strates that the GAS pilus locus is highly variable (F.Falugi et al., unpubl. results). This notwithstanding, when100 sera from children suffering from GAS pharyngitiswere analysed (see Experimental procedures), 76 ofthem reacted with at least one pilin protein. Particularly,as shown in Fig. 12A, 31 sera recognized at least one ofthe M1 pilus components while 52, 60 and 62 serareacted with M3, M6 and M12 pilus proteins respectively.This suggests either cross-reaction among homologoussubunits, or the fact that patients had experiencedrepeated infections from more than one GAS strain, orboth.
To further support the evidence that patient sera dorecognize GAS pili, seven highly reactive sera against M1FCT-2 pilus were tested for their ability to bind the surfaceof L. lactis engineered with the pilus locus from M1_SF370.All seven sera specifically recognized the surface of the M1pilus-expressing strain, while no recognition was observedfor non-reactive sera used as control. Figure 12 shows, asan example, fluorescence microscopy analysis of L. lactisexpressing the GAS M1 pilus (Figure 12E) and of L. lactiscarrying the empty pAM401 plasmid (negative control,Figure 12D), probed against one of the highly reactivesera. Together these data demonstrate that sera fromGAS-infected patients have specific anti-pili antibodiesand strongly support the conclusion that pili are expressedby GAS during infection.
Discussion
Like many human commensal and pathogenic bacteria,S. pyogenes is capable of attaching to, and colonizinghost mucosal surfaces and epithelia. Recent experimen-tal evidence suggests that this colonization process maylead to biofilm formation, which may play a key role inGAS pathogenesis. For instance, Akiyama and cowork-ers (Akiyama et al., 2003) reported the presence ofbiofilm-like structures in skin sections from patients withimpetigo and atopic dermatitis, while Takemura et al.(2004) identified GAS as members of root canal multi-species biofilms. Finally, Hidalgo-Grass et al. (2004)observed structured GAS communities in necrotizingfasciitis lesions.
At present, several GAS components have been char-acterized that enable the pathogen to adhere to surfacescoated with matrix molecules and to eukaryotic cells(Courtney et al., 2002; Frick et al., 2000). However, onlyrecently, attempts to dissect the contribution of each GAScomponent to biofilm formation have been initiated. Choand Caparon have shown that the deletion of either theemm gene coding for the M Protein or the hasA generesponsible for the production of hyaluronic capsule pre-vented GAS M5_HSC5 from forming biofilm on polysty-rene (Cho and Caparon, 2005).
In addition to the role of the emm and hasA structuralgenes, the effect of the inactivation of regulatory proteinson biofilm formation has been investigated. In particular, aphenotype similar to the Demm mutant was observedwhen the genes encoding the CovR and Mga transcriptionregulatory proteins were deleted (Frick et al., 2000). Fur-thermore, Lembke et al. (2006) have recently shown thatinactivation of the putative quorum sensing regulatorypeptide SilC makes GAS strains incapable of forming
Fig. 10. Biofilm formation by GAS SF370 wildtype (WT), pilus knockout mutants andcomplemented strains. Bacteria wereincubated in C-medium for 24 h at roomtemperature in multi-well plates and adherentbacteria were stained with crystal violet. Aphotograph (A) and a chart with the meanand standard deviation OD540 values (B) of arepresentative experiment are shown.Bacterial growth was measured in parallel forall strains as control (data not shown) andexperiments were repeated at least threetimes.
biofilm, confirming the role of quorum sensing in the regu-lation of biofilm development, as reported for other bac-terial species (Loo et al., 2000; Cvitkovitch et al., 2003;Gilmore et al., 2003; Merritt et al., 2003; Hancock andPerego, 2004; Pillai et al., 2004).
It has been postulated that the MSCRAMMs (for ‘micro-bial surface components recognizing adhesive matrix
molecule’), some of which encoded by genes located inthe FCT region of the GAS genome, are other potentialcandidate proteins involved in biofilm formation (Lembkeet al., 2006). As we have recently shown that the FCTpathogenicity island promotes the synthesis and assem-bly of pilus-like structures (Mora et al., 2005) and in con-sideration of the fact that pili are important players in
Fig. 11. Confocal microscopy analysis of biofilm maturation in GAS SF370 wild type (WT), pilus knockout mutants and complemented strains.Bacteria were grown in C-medium at room temperature on polylysine-coated coverslips. Medium was changed every 24 h. Coverslips wererecovered after 72 h, fixed and stained with anti-GAS whole cell (blue) and anti-Spy0128 (red) sera, and with FITC-conjugated ConA (green)to reveal EPS. Thickness of biofilms was measured in different points of each field, and the mean and standard deviations of at least sixmeasurements are reported in the table.A–E. X-Z, X-Y sections and three-dimensional view of 72 h biofilm growth formed by SF370 wild type (WT), deletion mutant Dspy0128, thecorresponding complemented strain, deletion mutant and complemented strain of Dspy0129.
biofilm formation in several Gram-negative bacteria (DiMartino et al., 2003; Klausen et al., 2003; Orndorff et al.,2004; Paranjpye and Strom, 2005) and in the Gram-positive bacteria Streptococcus parasanguis (Froeligerand Fives-Taylor, 2001) and Enterococcus faecalis (Nal-lapareddy et al., 2006; Tendolkar et al., 2006), in thepresent work we have investigated whether pili influencethe capacity of GAS to make biofilm.
Indeed, our data clearly show that wild-type GAS SF370adheres to human epithelial cells, forms aggregates inliquid culture and microcolonies on the cells, and is capableof generating mature biofilm. All these properties areseverely impaired when pili expression is abrogated bydeleting either the gene coding for the pilus backbonestructural protein or the gene encoding the sortase indis-pensable for pilus assembly (Mora et al., 2005).
In particular, adhesion of mutant strains to pharyngealcells was remarkably reduced at short incubation times,indicating a role for pili in promoting the rapid attachmentof GAS to host tissues. At longer incubation times differ-ences in adhesion between wild-type and mutant strainswere still significant but less pronounced, suggesting therelevance of other GAS proteins in the interaction withhost cells (Cunningham, 2000). During the review processof this manuscript, the role of pili in adhesion to tonsil,primary keratinocyte and HaCaT host cells has been dem-onstrated by Abbot et al. (published online) using SF370wild type and pilus mutants.
Furthermore, bacterial aggregation, a precondition ofbiofilm formation both in Gram-negative and in Gram-positive pathogens (Chiavelli et al., 2001; Klausen et al.,2003; Paranjpye and Strom, 2005; Watnick and Kolter,1999), was clearly impaired in pilus-negative mutantsboth in liquid growth and during cell infection. In addition,when grown on solid surfaces, the mutant strains did notdevelop the typical three-dimensional structures observedin the wild-type SF370 strain. Finally, the observation thatConcanavalin A-stained material is more abundant in thecellular aggregates formed on solid surface by wild-typeand complemented strains further supports our evidencethat pili are involved in the maturation of S. pyogenes EPScontaining biofilms.
While we have clearly shown the importance of pili inaggregation, adhesion and biofilm formation under in vitroexperimental conditions, to solidly assign a biological sig-nificance to these findings, evidence of pili expressionduring infection should be provided. To address thisimportant issue, we have analysed the immuneresponses of GAS-infected human patients against bothpilin subunits and pili expressed on the surface of arecombinant L. lactis strain. Our data indicate that pili areamong the most immunogenic and broadly recognizedGAS antigens. This would also explain why, to escape theselective pressure of the host immune system, GAS piliappear to undergo a substantial genetic variability.
There are a number of open issues that await furtherfuture investigations. First of all, the fact that mutantslacking either the M protein, or the hyaluronic capsule orthe pili are not capable of biofilm growth on both abioticand living surfaces clearly indicates that this is a multifac-torial phenotype. In other words, biofilm formationappears to require a complex network of interactions that
Fig. 12. Reactivity of human patient sera with GAS pili.A. Analysis of sera from pharyngitis patients with a proteinmicroarray carrying pilus components from four different FCT types.Y-axis, percentage of sera reacting with at least one piluscomponent (black bar) or with any of the four pilus type spottedproteins (grey bars).B–E. L. lactis carrying the empty pAM401 plasmid (B and D) orexpressing the GAS M1 pilus (C and E) were incubated with serumfrom a human patient infected with a GAS M1 strain. Boundantibody was detected with Cy3-conjugated anti-human IgGsecondary antibodies and visualised by confocal microscopy (Dand E). The presence of bacteria was confirmed by phase contrastmicroscopy (B and C).
can be perturbed even through the inactivation of singlenetwork components. However, the exact interaction androle of each biofilm former remain largely unknown.
A second open question that deserves further atten-tion refers to which of the pilin components act as ligandfor epithelial cell binding and are directly responsible forthe aggregating phenotype. One possible candidate isthe collagen binding adhesin (cpa; Kreikemeyer et al.,2005), the role of which is currently being investigatedfollowing the binding capacity to epithelial cells of non-polar knockout mutants. These mutants should still becapable of assembling pili even if lacking the ancillaryprotein (Telford et al., 2006). While these experimentsare in progress, the results here described on thebinding capacity of the recombinant pilin components tothe epithelial cells seem to confirm that pilus ancillaryproteins play a major role in tissue recognition. Ourbinding data would suggest that the backbone proteinpredominantly exerts a structural function while theancillary proteins promote bacterial adhesion and mightbe involved in tissue tropism.
Another important question is why the GAS capacityto form biofilm appears not to be universal but ratherstrain-dependent. Recently, two groups (Baldassarriet al., 2006; Lembke et al., 2006) have shown thatseveral GAS isolates are incapable of growing in biofilm,and that in other strains biofilm formation depends uponthe nature of the surface used for experimentally testingbiofilm growth. For instance, Lembke and coworkersdemonstrated that some isolates require collagen toform biofilm, others fibronectin or fibrinogen, otherslaminin, and yet other strains can form biofilm on poly-styrene even in the absence of any coating proteins(Lembke et al., 2006). There are a number of possibleexplanations for this observed variability in biofilm for-mation. One likely possibility is that other components,in addition to the ones so far characterized, are requiredfor biofilm growth and that these additional componentsare not expressed in all circulating strains. A secondpossible explanation is the existing high variability of Mand pilin proteins. Over 160 different M serotypes havebeen described so far (B. Beall, http://www.cdc.gov/ncidod/biotech/strep/types_emm103-124.htm) and weare accumulating data indicating that there is quiteextensive variability in amino acid sequences of thebackbone and Cpa pilus proteins encoded in the differ-ent FCT regions (F. Falugi et al., unpublished). Finally,the level of expression of the proteins involved in biofilmformation might affect the capacity of GAS to assembleinto a mature biofilm and the complex network of generegulation existing in S. pyogenes (Courtney et al.,2002) is expected to play a key role in this respect.
In conclusion, our data indicate that one of the mainroles of GAS pili is to facilitate the interaction with host
cells and allow the bacteria to switch from planktonic tobiofilm growth, and this property is expected to offer thepathogen a competitive advantage to counteract thearsenal of defensive responses the human host mountsupon GAS invasion. As pili have recently been describedin Corynebacterium diphteriae, S. agalactiae and Strepto-coccus pneumoniae, our observations may promote dis-covery of similar functions in these major humanpathogens.
Experimental procedures
Bacterial strains, media and growth conditions
Streptococcus pyogenes SF370 was grown in Todd–Hewittmedium supplemented with 0.5% yeast extract (THY, Difco),or THY agar supplemented with 5% defibrinated sheep blood.C-medium for biofilm plate assays (Lyon et al., 1998) con-tained 0.5% proteose peptone #3 (Difco), 1.5% yeast extract(Difco), 10 mM K2HPO4, 0.4 mM MgSO4, 17 mM NaCl, andwas adjusted to pH 7.5. L. lactis, subspecies cremoris,MG1363 was grown at 30°C in M17 (Difco) supplementedwith 0.5% glucose (GM17). Escherichia coli was grown inLuria Broth. Selective media contained 10 mg ml-1 chloram-phenicol or 1 mg ml-1 erythromycin for GAS, 20 mg ml-1
chloramphenicol for L. lactis and 20 mg ml-1 chloramphenicolor 100 mg ml-1 erythromycin for E. coli.
Construction of GAS deletion and complementationmutants
In-frame deletion and complementation mutants of GASSF370 were constructed as already described (Mora et al.,2005). Briefly, in-frame deleted gene products were obtainedby splicing-by-overlap-extension PCR (Horton et al., 1990)using primers 1–4 for spy0128 and 5–8 for spy0129, reportedin Table 1. The amplification product was cloned using BamHIand XhoI restriction sites in the temperature-sensitive shuttlevector pJRS233 (Perez-Casal et al., 1993). Transformationand allelic exchanges were performed as described(Caparon and Scott, 1991; Perez-Casal et al., 1993;Framson et al., 1997). Transformants were selected on THYplates with 1 mg ml-1 erythromycin (Sigma) at 30°C. Afterallelic exchange experiments drug-sensitive colonies werescreened by PCR for the absence of the target allele.
Complementation plasmids were constructed by splicing-by-overlap-extension PCR using primers 9–14 for pAM-spy0128 and 9–12 plus 15 and 16 for pAMspy0129 (Table 1)to amplify the fragment that includes the spy0128 or spy0129gene, the predicted promoter and a r-independentterminator. The PCR product was digested with BamHI andligated to BamHI-digested pAM401 (Wirth et al., 1986).
Introduction of the GAS pilus region into L. lactis
The genomic region between the Ribosome Binding Site ofgene spy0125 and the stop codon of spy0130 was amplifiedusing primers 17 and 18 reported in Table 1, which allowedintroduction of NotI and BglII restriction sites. The PCRproduct was cloned into a shuttle vector carrying the pro-
moter and terminator regions of GBS adhesin island-2(Buccato et al., 2006) to obtain pAMpilM1. The constructwas then inserted into L. lactis MG1363 competent cells byelectroporation, and transformants selected on GM17 plateswith 20 mg ml-1 chloramphenicol. Drug-resistant colonieswere screened by PCR. Expression of the pilus subunitsand their assembly into a covalently bound polymeric struc-ture was confirmed by Western blot analysis and Immuno-electron microscopy using specific mouse polyclonalantisera.
Immunoblots of bacterial cell-wall fractions
Bacterial cell-wall enriched fractions were prepared asdescribed previously (Mora et al., 2005). Briefly, bacteriagrown in THY to OD600 = 0.4 at 37°C were pelletted, washedonce in PBS, suspended in 1 ml ice-cold protoplasting buffer[40% sucrose; 0.1 M KPO4, pH 6.2; 10 mM MgCl2; EDTA-freeprotease inhibitors (Roche); 2 mg ml-1 lysozyme; 400 units ofmutanolysin (Sigma)] and incubated at 37°C for 3 h. Aftercentrifuging at 13 000 g for 15 min, the supernatants (cell-wall fractions) were separated by 3–8% gradient gels(NuPAGE Tris-acetate gels, Invitrogen) and transferred tonitrocellulose membranes (Bio-Rad). Immunoblot analyseswere performed by incubating with mouse polyclonal antisera(Mora et al., 2005) at a 1:500 dilution, secondary antibody(ECL, horseradish peroxidase-linked anti-mouse IgG, GEHealthcare) at a 1:5000 dilution and developed with ECLenhanced chemiluminescence detection substrate (Super-Signal West Pico, Pierce).
Electron microscopy
Group A Streptococcus were grown on THY blood agar platesand resuspended in PBS. Formvar carbon-coated nickelgrids were floated on drops of bacterial suspensions for5 min, fixed in 2% PFA for 5 min, and placed in blocking
solution (PBS containing 1% normal rabbit serum and 1%BSA) for 30 min. The grids were then floated on drops ofprimary antiserum diluted 1:20 in blocking solution for 30 minat room temperature, washed, and floated on secondary anti-body conjugated to 10 nm gold particles diluted 1:10 in 1%BSA for 30 min. Bacteria were then fixed again for 10 min.The grids were washed with PBS then distilled water and airdried and examined using a TEM GEOL 1200EX II transmis-sion electron microscope. Pre-immune sera from the sameanimals were used as negative controls.
Eukaryotic cell cultures and adherence assay
The human pharynx carcinoma cell line Detroit-562 (ATCCCCL-138) was cultured in Dulbecco’s modified Eagle’smedium (EMEM; Life Technologies Gibco BRL) supple-mented with 10% FCS (Life Technologies) and 5 mMglutamine (Life Technologies) at 37°C in an atmosphere con-taining 5% CO2. For adherence assays, cells were resus-pended at a concentration of approximately 3 ¥ 105 cells ml-1
in EMEM, and 1 ml seeded into 24 well tissue culture plates(Nunc), which were then incubated for 24 h. For time-courseexperiments bacteria from exponential phase cultures(OD600 = 0.4) were collected by centrifugation (3000 g,5 min), resuspended in conditioned EMEM and used to infectcell monolayers at 37°C in a 5% CO2 atmosphere. Multiplici-ties of infection (moi) of 100:1 and 10:1 were used for GASand for L. lactis strains respectively. For 1 min adhesionassays, bacteria grown up to OD600 = 0.2 were resuspendedin PBS and used at a moi of 500:1. After infection, wells wereextensively washed with PBS to remove unattached bacteria,incubated with 1% saponin to lyse eukaryotic cells, andadherent bacteria were plated for enumeration. The averagenumber of bacteria recovered per ml was determined foreach single assay from three independent wells. Tests wererepeated at least three times and the percentage of adheringbacteria versus total bacteria was calculated for each time
Table 1. Primers used for the deletion of spy0128 (1–4), spy0129 (5–8), complementation of spy0128 (9–14) and spy0129 (9–12, 15, 16) andcloning of the whole M1 pilus region in L. lactis (17–18).
point. In order to determine the statistical significance ofadhesion data, the Student’s t-test was used. P < 0.05 wereconsidered statistically significant. For 1 min adhesionexperiments, bacteria adhering to Detroit cells were analysedin parallel by confocal microscopy (see below for stainingprocedures). The number of bacterial microcolonies wascounted for each strain in 10 randomly chosen fields (mag-nification 20¥) and average and standard deviationcalculated.
Binding assay
Detroit-562 cells were non-enzymatically detached from thesupport using Sigma cell dissociation solution, harvested andresuspended in PBS. Cells (2 ¥ 105) were mixed with differentconcentrations (0, 10, 50, 100 or 200 mg ml-1) of each recom-binant protein; Spy0125 (Cpa), Spy0128 (Tee1), Spy0130and an unrelated protein as negative control (Sag0823 ofS. agalactiae) and incubated for 1 h at room temperature.After two washes with PBS, cells were incubated with mousepolyclonal antisera against each protein (diluted 1:200) for1 h at 4°C in PBS. After two washes, the preparations wereincubated on ice for 1 h with R-phycoerythrin-conjugatedgoat antibody to mouse immunoglobulin, and cells were sub-sequently analysed with a FACS-Scan flow cytometer. Thenet mean fluorescence intensity for each protein was calcu-lated by subtracting from the signal the fluorescence intensityof the cells incubated with the sera alone.
Recombinant protein construction and purification
The recombinant proteins Spy0125, Spy0128, Spy0130 andSag0823 were obtained as described before (Mora et al.,2005). Briefly, the genes corresponding to each protein wereamplified by PCR from GAS (strain SF370) or GBS (strain2603) genomic DNA and ligated into E. coli plasmid vectorpET21b+ (Novagen) to produce 6xHis-tagged proteins.Primers used to clone spy0125, spy0128 and spy0130 geneswere listed elsewhere (Mora et al., 2005), whereas primersused to clone Sag 0823 were: 01688gwfor GGGGACAAGTTTGTACAAAAAAGCAGGCTCTACAAAAGAATATCAAAATTAT and 01688gwrev GGGGACCACTTTGTACAAGAAAGCTGGGTTTTTCATATCAAAAACTATCG. Recombi-nant fusion proteins were then purified by immobilized metalion affinity chromatography using Ni-activated HisTrapcolumns and subsequently by gel filtration using HiLoadSuperdex 200. Purified proteins were subjected to SDS-PAGE and gels were stained with Coomassie blue. The iden-tities of the purified proteins were confirmed by matrix-assisted laser desorption/ionization (MALDI-TOF) massspectrometry. Briefly, protein bands were excised from theCoomassie-stained gels, and in-gel digested with trypsin.Resulting peptides were analysed by MALDI-TOF massspectrometry, and protein identifications were deduced fromthe peptide mass fingerprint analysis using MASCOT run in alocal database.
Determination of bacterial aggregation
Group A Streptococcus strains were grown under agitation inTHY at 37°C to OD600 = 0.6. Tubes were then incubated
without agitation and the precipitation rate was determined bymeasuring OD600 in the upper part of the tubes at regular timeintervals during 2 h.
Group A Streptococcus aggregation was also observedusing confocal laser scanning microscopy (CLSM). Approxi-mately 2 ¥ 108 bacteria grown to OD600 = 0.2 were seeded in12 well plates containing sterile glass coverslips coated withpolylysine and grown for 2 h to late exponential phase.Samples were then fixed with paraformaldehyde in 100 mMphosphate buffer pH 7.4 for 15 min, washed with PBS andblocked with PBS 3% (w/v) BSA, 1% (w/v) saponin (blockingsolution) for 15 min. After incubation with primary antibodies(rabbit-anti-GAS and mouse-anti-Spy0128) for 1 h at roomtemperature, samples were washed in blocking solution andincubated for a further 30 min at room temperature with sec-ondary antibodies Alexa Fluor 647 goat anti-rabbit and AlexaFluor 568 goat anti-mouse (Molecular Probes). Coverslipswere then washed with blocking solution, mounted on glassslides with the Slow Fade reagent kit containing 4,6-diamidino-2-phenylindole dihydrochloride (Molecular Probes)and viewed on a Bio-Rad Radiance 2000 Scanning LaserConfocal Microscope.
To further investigate the role of GAS M1 pili in bacterialaggregation, L. lactis (pAM401) and L. lactis (pAMpilM1)were grown in GM17 to mid-log phase (OD600 = 0.6). Thebacterial suspension (20 ml) was placed on a glass slide,covered with a coverslip and images were acquired by thetransmission mode of the confocal microscope using phasecontrast optics.
Biofilm formation plate assay
For each strain, an overnight culture (C-medium, 37°C) wasdiluted 1:10 and 1 ml added per well of a 24 well plate. Plateswere incubated at room temperature for 24 h. The mediumwas then removed and adherent bacteria stained with crystalviolet (0.2% in ddH2O, room temperature, 10 min). Crystalviolet was recovered with 1% SDS and biomass was quanti-fied by measuring OD540.
Confocal microscopy analysis of GAS strains adheringto Detroit-562 cell line
Detroit-562 cells (5 ¥ 105) were seeded on glass coverslipscoated with polylysine in 12 well plates. After 24 h, 1 ¥ 108 cfuof each strain from logarithmic growth were extensively pipet-ted to break possible aggregates and used to infect mono-layers at 37°C in a 5% CO2 atmosphere. After 15 mintriplicate wells were washed three times with PBS to removeunattached bacteria and stained (see below). Three addi-tional wells were washed as well after 15 min, incubated up to120 min and washed again. For analysis by CLSM, cells werefixed, blocked and stained with rabbit-anti-GAS and withAlexa Fluor 488-conjugated goat anti-rabbit (MolecularProbes) as a secondary antibody. Detroit cells were stainedwith Alexa Fluor 647-conjugated phalloidin (MolecularProbes). Coverslip mounting and viewing were performed asalready described. Three-dimensional immunofluorescenceimages were reconstructed from 0.5 mm confocal optical sec-tions using VOLOCITY 3.6 (Improvision, Lexington, MA,USA).
Confocal microscopy analysis of biofilm maturation
Group A Streptococcus strains were grown overnight inC-medium at 37°C and a 1:10 dilution inoculated at roomtemperature on polylysine-coated glass sterile coverslipspositioned in 50 ml falcon tubes containing 10 ml of freshC-medium, as described elsewhere (Cho and Caparon,2005). Medium (5 ml) was replaced every 24 h. Sampleswere fixed after 72 h, blocked and stained with rabbit-anti-GAS and mouse-anti-Spy0128 primary antibodies and AlexaFluor dye 647 goat anti-rabbit and Alexa Fluor dye 568 goatanti-mouse as secondary antibodies (Molecular Probes).EPS was stained using FITC-conjugated lectin ConcanavalinA (Sigma). Coverslip mounting, viewing and three-dimensional reconstruction were performed as alreadydescribed. Thickness of biofilms was determined in differentpoints of each field using VOLOCITY 3.6 (Improvision, Lex-ington, MA, USA), and the mean and standard deviations ofat least six measurements was calculated.
Reactivity of human patient sera with L. lactisexpressing the GAS M1 pilus
Lactococcus lactis cells were grown to OD600 = 0.4 at 37°C,seeded on glass coverslips coated with polylysine and incu-bated for 2 h at 37°C. Samples were then fixed, blockedwith BSA (as described above) and incubated with humansera (diluted 1:200) from pharyngitis patients. Coverslipswere washed and bound antibody detected with Cy3-labelled anti-human IgG (Molecular Probes). Coverslipmounting and viewing were performed as already described(above). Images were acquired both by the transmissionmode of the confocal microscope using phase contrastoptics to reveal L. lactis cells, and by a Bio-Rad Radiance2000 Scanning Laser Confocal Microscope to detectimmunofluorescence.
Protein array analysis of human sera
Detailed array construction and analysis will be publishedelsewhere. Briefly, 120 surface predicted proteins fromS. pyogenes were expressed in E. coli as 6xHis- or GST-tagged recombinant proteins and purified by affinitychromatography. Proteins were spotted in quadruplicate(0.35 ng spot-1) onto nitrocellulose slides using the VersArrayChipWriterTM Pro System (Bio-Rad) equipped with TeleChemquill pins (TeleChem International Sunnyvale, CA, USA). Thearray included 11 pilin subunits (four backbone proteins andseven ancillary proteins) isolated from M1, M3, M6 and M12strains. Increasing concentrations of human IgGs were usedto obtain a standard curve for array calibration andnormalization. Negative controls consisted of PBS.
Sera, collected from 3- to 16-year-old pharyngitis patientsfrom which GAS were isolated, were provided by BaylorCollege of Medicine and used to probe arrays (1:1000 finaldilution, 1 h at room temperature). Arrays were then washedthree times (5 min each time) in PBS, 0.1% Tween (TPBS),followed by incubation for 1 h with Cy3-labelled anti-humanIgG (1:1000). Slides were washed with TPBS, PBS and milliQsterile water and dried at 37°C for 10–20 min in the dark.
Fluorescence intensities were detected using a ScanArray5000 Unit (Packard, Billerica, MA, USA) at high resolution(10 mm pixel size) and quantified with ImaGene 6.0 software(Biodiscovery, CA, USA). Analysis of collected data was per-formed using in house developed software. Standard curvefluorescence intensity signals ranged from 0 to 65 535 pixelsand followed a sigmoid curve. Intensity signals above 15 000pixel (starting point of the linear range in the sigmoid curve)were used as threshold for positive reactivity.
Acknowledgements
We thank Gianni Pozzi (University of Siena) for GAS SF370strain; V. Pinto, V. Nardi Dei and M. Mariani for purification ofrecombinant proteins; T. Maggi for mouse immunization withrecombinant proteins and Giorgio Corsi and AntoniettaMaiorino for helping in manuscript preparation. This work hasbeen partially funded by NIH and by Italian MIUR.
References
Abbot, E.L., Smith, W.D., Siou, G.P.S., Chiriboga, C., Smith,R.J., Wilson, J.A., Hirst, B.H., and Kehoe, M.A. (2007) Pilimediate specific adhesion of Streptococcus pyogenes tohuman tonsil and skin. Cell. Microbiol. (OnlineEarlyArticles). doi: 10.1111/j.1462-5822.2007.00918.x.
Akiyama, H., Morizane, S., Yamasaki, O., Oono, T., andIwatsuki, K. (2003) Assessment of Streptococcus pyo-genes microcolony formation in infected skin by confocallaser scanning microscopy. J Dermatol Sci 32: 193–199.
Baldassarri, L., Creti, R., Recchia, S., Imperi, M., Facinelli, B.,Giovanetti, E., et al. (2006) Therapeutic failures of antibi-otics used to treat macrolide-susceptible Streptococcuspyogenes infections may be due to biofilm formation. J ClinMicrobiol 44: 2721–2727.
Buccato, S., Maione, D., Rinaudo, C.D., Volpini, G., Taddei,A.R., Rosini, R., et al. (2006) Use of Lactococcus lactisexpressing pili from group B Streptococcus as a broad-coverage vaccine against streptococcal disease. J InfectDis 194: 331–340.
Chiavelli, D.A., Marsh, J.W., and Taylor, R.K. (2001) Themannose-sensitive hemagglutinin of Vibrio cholerae pro-motes adherence to zooplankton. Appl Environ Microbiol67: 3220–3225.
Cho, K.H., and Caparon, M.G. (2005) Patterns of virulencegene expression differ between biofilm and tissue commu-nities of Streptococcus pyogenes. Mol Microbiol 57: 1545–1556.
Costerton, J.W., Stewart, P.S., and Greenberg, E.P. (1999)Bacterial biofilms: a common cause of persistentinfections. Science 284: 1318–1322.
Courtney, H.S., Hasty, D.L., and Dale, J.B. (2002) Molecularmechanisms of adhesion, colonization, and invasion ofgroup A streptococci. Ann Med 34: 77–87.
Cunningham, M.W. (2000) Pathogenesis of group A strepto-coccal infections. Clin Microbiol Rev 13: 470–511.
Cvitkovitch, D.G., Li, Y.H., and Ellen, R.P. (2003) Quorumsensing and biofilm formation in streptococcal infections.J Clin Invest 112: 1626–1632.
Di Martino, P., Cafferini, N., Joly, B., and Darfeuille-Michaud,A. (2003) Klebsiella pneumoniae type 3 pili facilitateadherence and biofilm formation on abiotic surfaces. ResMicrobiol 154: 9–16.
Framson, P.E., Nittayajarn, A., Merry, J., Youngman, P.,and Rubens, C.E. (1997) New genetic techniques forgroup B streptococci: high-efficiency transformation,maintenance of temperature-sensitive pWV01 plasmids,and mutagenesis with Tn917. Appl Environ Microbiol 63:3539–3547.
Frick, I.M., Morgelin, M., and Bjorck, L. (2000) Virulent aggre-gates of Streptococcus pyogenes are generated byhomophilic protein–protein interactions. Mol Microbiol 37:1232–1247.
Froeliger, E.H., and Fives-Taylor, P. (2001) Streptococcusparasanguis fimbria-associated adhesin fap1 is requiredfor biofilm formation. Infect Immun 69: 2512–2519.
Gilmore, K.S., Srinivas, P., Akins, D.R., Hatter, K.L., andGilmore, M.S. (2003) Growth, development, and geneexpression in a persistent Streptococcus gordonii biofilm.Infect Immun 71: 4759–4766.
Hall-Stoodley, L., Costerton, J.W., and Stoodley, P. (2004)Bacterial biofilms: from the natural environment to infec-tious diseases. Nat Rev Microbiol 2: 95–108.
Hancock, L.E., and Perego, M. (2004) The Enterococcusfaecalis fsr two-component system controls biofilm devel-opment through production of gelatinase. J Bacteriol 186:5629–5639.
Helaine, S., Carbonnelle, E., Prouvensier, L., Beretti, J.L.,Nassif, X., and Pelicic, V. (2005) PilX, a pilus-associatedprotein essential for bacterial aggregation, is a key to pilus-facilitated attachment of Neisseria meningitidis to humancells. Mol Microbiol 55: 65–77.
Hidalgo-Grass, C., Dan-Goor, M., Maly, A., Eran, Y., Kwinn,L.A., Nizet, V., et al. (2004) Effect of a bacterial pheromonepeptide on host chemokine degradation in group A strep-tococcal necrotising soft-tissue infections. Lancet 363:696–703.
Horton, R.M., Cai, Z.L., Ho, S.N., and Pease, L.R. (1990)Gene splicing by overlap extension: tailor-made genesusing the polymerase chain reaction. Biotechniques 8:528–535.
Kirn, T.J., Lafferty, M.J., Sandoe, C.M., and Taylor, R.K.(2000) Delineation of pilin domains required for bacterialassociation into microcolonies and intestinal colonizationby Vibrio cholerae. Mol Microbiol 35: 896–910.
Klausen, M., Heydorn, A., Ragas, P., Lambertsen, L., Aaes-Jorgensen, A., Molin, S., and Tolker-Nielsen, T. (2003)Biofilm formation by Pseudomonas aeruginosa wild type,flagella and type IV pili mutants. Mol Microbiol 48: 1511–1524.
Kratovac, Z., Manoharan, A., Luo, F., Lizano, S., Bessen,D.E. (2007) Population genetics and linkage analysis ofloci within the FCT region of Streptococcus pyogenes.J Bacteriol. 189: 1299–1310.
Kreikemeyer, B., Nakata, M., Oehmcke, S., Gschwendtner,C., Normann, J., and Podbielski, A. (2005) Streptococcuspyogenes collagen type I-binding Cpa surface protein.
Lauer, P., Rinaudo, C.D., Soriani, M., Margarit, I., Maione, D.,Rosini, R., et al. (2005) Genome analysis reveals pili ingroup B Streptococcus. Science 309: 105.
Lembke, C., Podbielski, A., Hidalgo-Grass, C., Jonas, L.,Hanski, E., and Kreikemeyer, B. (2006) Characterization ofbiofilm formation by clinically relevant serotypes of group Astreptococci. Appl Environ Microbiol 72: 2864–2875.
Lewis, K. (2001) Riddle of biofilm resistance. AntimicrobAgents Chemother 45: 999–1007.
Loo, C.Y., Corliss, D.A., and Ganeshkumar, N. (2000) Strep-tococcus gordonii biofilm formation: identification of genesthat code for biofilm phenotypes. J Bacteriol 182: 1374–1382.
Lyon, W.R., Gibson, C.M., and Caparon, M.G. (1998) A rolefor trigger factor and an rgg-like regulator in the transcrip-tion, secretion and processing of the cysteine proteinase ofStreptococcus pyogenes. EMBO J 17: 6263–6275.
Mora, M., Bensi, G., Capo, S., Falugi, F., Zingaretti, C.,Manetti, A.G., et al. (2005) Group A Streptococcus producepilus-like structures containing protective antigens andLancefield T antigens. Proc Natl Acad Sci USA 102:15641–15646.
Nallapareddy, S.R., Singh, K.V., Sillanpaa, J., Garsin, D.A.,Hook, M., Erlandsen, S.L., and Murray, B.E. (2006)Endocarditis and biofilm-associated pili of Enterococcusfaecalis. J Clin Invest 116: 2799–2807.
Neely, M.N., Pfeifer, J.D., and Caparon, M. (2002)Streptococcus-zebrafish model of bacterial pathogenesis.Infect Immun 70: 3904–3914.
Orndorff, P.E., Devapali, A., Palestrant, S., Wyse, A., Everett,M.L., Bollinger, R.R., and Parker, W. (2004)Immunoglobulin-mediated agglutination of and biofilm for-mation by Escherichia coli K-12 require the type 1 pilusfiber. Infect Immun 72: 1929–1938.
O’Toole, G.A., and Kolter, R. (1998) Initiation of biofilm for-mation in Pseudomonas fluorescens WCS365 proceedsvia multiple, convergent signalling pathways: a geneticanalysis. Mol Microbiol 28: 449–461.
Paranjpye, R.N., and Strom, M.S. (2005) A Vibrio vulnificustype IV pilin contributes to biofilm formation, adherence toepithelial cells, and virulence. Infect Immun 73: 1411–1422.
Perez-Casal, J., Price, J.A., Maguin, E., and Scott, J.R. (1993)An M protein with a single C repeat prevents phagocytosis ofStreptococcus pyogenes: use of a temperature-sensitiveshuttle vector to deliver homologous sequences to thechromosome of S. pyogenes. Mol Microbiol 8: 809–819.
Pillai, S.K., Sakoulas, G., Eliopoulos, G.M., Moellering, R.C.,Jr, Murray, B.E., and Inouye, R.T. (2004) Effects of glucoseon fsr-mediated biofilm formation in Enterococcus faecalis.J Infect Dis 190: 967–970.
Takemura, N., Noiri, Y., Ehara, A., Kawahara, T., Noguchi,N., and Ebisu, S. (2004) Single species biofilm-formingability of root canal isolates on gutta-percha points. Eur JOral Sci 112: 523–529.
Telford, J.L., Barocchi, M.A., Margarit, I., Rappuoli, R., and
Grandi, G. (2006) Pili in gram-positive pathogens. Nat RevMicrobiol 4: 509–519.
Tendolkar, P.M., Baghdayan, A.S., and Shankar, N. (2006)Putative surface proteins encoded within a novel transfer-able locus confer a high-biofilm phenotype to Enterococcusfaecalis. J Bacteriol 188: 2063–2072.
Ton-That, H., and Schneewind, O. (2004) Assembly of pili inGram-positive bacteria. Trends Microbiol 12: 228–234.
Watnick, P.I., and Kolter, R. (1999) Steps in the developmentof a Vibrio cholerae El Tor biofilm. Mol Microbiol 34: 586–595.
Wirth, R., An, F.Y., and Clewell, D.B. (1986) Highly efficientprotoplast transformation system for Streptococcus faeca-lis and a new Escherichia coli-S. faecalis shuttle vector.J Bacteriol 165: 831–836.
