.I. Mol. Biol. (1987) 195, 835-845 Structure and Transcription Termination of a Lysine tRNA Gene from Xenopus Zaevis And& Mazabraud’, Daniel Scherlyl, Fritz Miiller2 Duri Rungger3 and Stuart G. Clarksonlt 1 DBpartement de Microbiologic Centre Midical Universitaire 9 Avenue de Champel 1211 GenEve 4, Switzerland 2 Zoologisches Institut Universitcit Freiburg, Pkrolles 1700 Freiburg, Switzerland 3 Dkpartement de Biologie Animale Universit6 de GenBve 154 Route de Malagnou 1224 Chine-Bougeries, Switzerland (Received 24 November 1986, and in revised form 30 January 1987) Termination of RNA polymerase III transcripts commonly occurs at clusters of T residues. A T4 tract located 72 base-pairs beyond a lysine tRNA gene from Xenopus lawis serves as an efficient termination site for the tRNALys precursors synthesized from this gene in homologous cell-free extracts. Nucleotides following this T tract influence the extent of read-through transcription in vitro, but in a way that differs from Xenopus 5 S RNA termination. Only w 50 7& of the transcripts initiated in vitro extend as far as this downstream T cluster. The remainder prematurely terminate at a second T4 tract located within the gene itself. The contrasting behaviour of these two T tracts in injected oocytes indicates that termination can be influenced by more than just RNA polymerase III alone, and that different components may contribute to, or hinder, termination at these sites. Prematurely terminated tRNA Lystranscripts are detectable in RNA from ovary tissue but not from a kidney cell line, suggesting that read-through transcription beyond intragenic T clusters can be modulated in viva. 1. Introduction RNA polymerase III is responsible for the synthesis of eukaryotic 5 S RNA, tRNA precursors, and certain other small cellular and viral RNAs. The genes for these non-translated RNAs are remarkable in that they contain sequences essential for their own t’ranscription (reviewed by Ciliberto et al., 1983). Specific initiation depends on these “internal control regions”, RNA polymerase III, and at least two transcription factors commonly called TFIIIB and TFIITC; a third factor, TFIIIA, is needed as well to initiate 5 S RNA synthesis correctly (Segall et al., 1980; Lassar et al., 1983). By contrast, termination of RNA polymerase III t)ranscripts appears to be a much less complex t Author to whom all correspondence should be sent. process. The simplest termination sites consist of four or more T residues in the non-coding DNA strand. This results in rU-dA hybrids that are known to be exceptionally unstable (Martin & Tinoco, 1980). For Xenopus 5 S RN-A genes, termination is efficient whenever such a T4 tract is surrounded by G+C-rich DNA; there is no requirement for dyad symmetry ahead of the T cluster, or for any secondary structure in the transcript (Bogenhagen & Brown, 1981). A hybridization assay further suggests that termination of Xenopus 5 S RNA transcripts requires no factors other than RNA polymerase III (Cozzarelli et al., 1983). The same appears to be true for the enzyme from calf thymus and HeLa cells (Watson et al., 1984). Most eukaryotic tRNA genesappear to terminate transcription in much the same way. Their 3’ 835 0 1987 Academic Press Inc. (London) Ltd.
Transcript
.I. Mol. Biol. (1987) 195, 835-845
Structure and Transcription Termination of a Lysine tRNA Gene from Xenopus Zaevis
And& Mazabraud’, Daniel Scherlyl, Fritz Miiller2 Duri Rungger3 and Stuart G. Clarksonlt
1 DBpartement de Microbiologic Centre Midical Universitaire
3 Dkpartement de Biologie Animale Universit6 de GenBve
154 Route de Malagnou 1224 Chine-Bougeries, Switzerland
(Received 24 November 1986, and in revised form 30 January 1987)
Termination of RNA polymerase III transcripts commonly occurs at clusters of T residues. A T4 tract located 72 base-pairs beyond a lysine tRNA gene from Xenopus lawis serves as an efficient termination site for the tRNALys precursors synthesized from this gene in homologous cell-free extracts. Nucleotides following this T tract influence the extent of read-through transcription in vitro, but in a way that differs from Xenopus 5 S RNA termination. Only w 50 7& of the transcripts initiated in vitro extend as far as this downstream T cluster. The remainder prematurely terminate at a second T4 tract located within the gene itself. The contrasting behaviour of these two T tracts in injected oocytes indicates that termination can be influenced by more than just RNA polymerase III alone, and that different components may contribute to, or hinder, termination at these sites. Prematurely terminated tRNA Lys transcripts are detectable in RNA from ovary tissue but not from a kidney cell line, suggesting that read-through transcription beyond intragenic T clusters can be modulated in viva.
1. Introduction
RNA polymerase III is responsible for the synthesis of eukaryotic 5 S RNA, tRNA precursors, and certain other small cellular and viral RNAs. The genes for these non-translated RNAs are remarkable in that they contain sequences essential for their own t’ranscription (reviewed by Ciliberto et al., 1983). Specific initiation depends on these “internal control regions”, RNA polymerase III, and at least two transcription factors commonly called TFIIIB and TFIITC; a third factor, TFIIIA, is needed as well to initiate 5 S RNA synthesis correctly (Segall et al., 1980; Lassar et al., 1983).
By contrast, termination of RNA polymerase III t)ranscripts appears to be a much less complex
t Author to whom all correspondence should be sent.
process. The simplest termination sites consist of four or more T residues in the non-coding DNA strand. This results in rU-dA hybrids that are known to be exceptionally unstable (Martin & Tinoco, 1980). For Xenopus 5 S RN-A genes, termination is efficient whenever such a T4 tract is surrounded by G+C-rich DNA; there is no requirement for dyad symmetry ahead of the T cluster, or for any secondary structure in the transcript (Bogenhagen & Brown, 198 1). A hybridization assay further suggests that termination of Xenopus 5 S RNA transcripts requires no factors other than RNA polymerase III (Cozzarelli et al., 1983). The same appears to be true for the enzyme from calf thymus and HeLa cells (Watson et al., 1984).
Most eukaryotic tRNA genes appear to terminate transcription in much the same way. Their 3’
835 0 1987 Academic Press Inc. (London) Ltd.
836 A. Mazabraud et, a,l.
flanking regions contain T clusters in the non- coding DNA strand, usually within 20 bpt of the end of the mature tRNA coding sequence. Whenever analysed, tRNA precursors made in vitro have been found to end with a variable number of 3’ IT residues (usually three or four) that coincide with the position of the T cluster (reviewed by Clarkson. 1983). Mutations that create stretches of four, five or six consecutive T residues within tRNA genes can cause transcription to terminate prematurely at these intragenic sites (Koski et al., 1980; Traboni et al., 1984). Conversely, the removal of extragenic T tracts results in efficient read-through transcription (Adeniyi-Jones et aZ., 1984; Allison & Hall, 1985).
Recent evidence suggests, however, that RNA polymerase III is able to utilize other kinds of termination signals as well as conventional T clusters. A cloned mouse 5 S RNA gene appears to terminate transcription efficiently in vitro within an 43 cluster (Emerson $ Roeder, 1984). thereby suggesting the involvement of a mechanism other than rU-dA instability. A related site has also been found in a human Ah family repeat: -SOY/, of the RNA made in vitro terminates within an A, tract that is preceded by an imperfect hairpin, the remaining read-through products ending at a, downstream T5 cluster (Hess et al.. 1985). This combination of an A tract and imperfect dyad symmetry suggests some similarit’y to rho dependent sites in prokaryotes (reviewed by Platt. 1986).
In addition, the rules governing behaviour at, T clusters now appear to be more complex than is commonly supposed. Significant read-through t)ran- scription occurs, both in vitro and in vim, when the T, cluster behind a yeast tyrosine tRNA gene is shortened to T,; when shortened to T4 termination is completely abolished (Allison & Hall, 198.5). Yeast RNA polymerase JII thus seems to require a longer T stretch than the Xenopus enzyme. Such 3’ flanking sequence deletion mutants also exhibit, a reduced ability to compete for limiting transcrip- tion factor(s) in cell-free extracts (Sharp et al., 1983; Wilson et al., 1985; Allison & Hall, 1985).
Here we report the sequence of a lysine tRNA gene from X. Zaevis and its transcriptional properties in homologous cell-free extracts, injected oocytes, and in vivo. The gene contains two T4 tracts, one within the coding sequence and the other some considerable distance downstream. Both seem to function as transcription terminators but in
ways that do not fit the simple rules for Xenopus 5 S RNA termination.
2. Materials and Methods
(a) DNA manipulations
Clone lt210 contains a single copy of a 3.18 kb tandemly repeated Hind111 DNA fragment from
t Abbreviations used: lop, base-pairs; kb, lo3 bases or base-pairs.
X. la&s (Clarkson et ~1.. 1978). The 450 bp I~:wK I Hind111 fragment, of this repeat was sequenced on hot h DNA strands by the chemical method (Maxam Cy- Gilbert, 1980). This fragment was then inserted brtwrrri thaw EcoRT and HindIT sit,es of pBR322 t,o yield t,he t RNALY’ gene subclone pXltLys.
To construct 3’ flanking region deletion ruut.ants (Fig. 5). pXltLgs DNA was digested with HphI and tht, resulting 3’ overhangs were resected by inc*ubation with T4 DNA polymerase in the presence of unlabellrd dNTPs. After digestion with EcoRI. the 406 bp EcoKIIHpAI fragment, containing the tRNALy’ gene (Fig. 3) was isolated from a 6?” polyacrylamidr gel. This was their ligated to 3 different vector DNAs to yield mutants A. t3 and (1 (Fig. 5). For mutant A. pHR322 DNA was cleaved with (‘1~1, the 6’ overhangs were filled in by incuba,tion with t,he Klenow fragment. of DNA polymerasr I and unlabelled dNTPs, and t,hr plasmid DNA was then digested wit,h F=coRI. The vwtors for rnutmt,s I3 MICE (’ were similarly prepared. except that CflnT was replaced by Hind111 and E’coRV. respect’ivrly. The DNA srqucn(?tb was det,ermined for the resected HphI- pRR322 ,junc*tion within each mutant (Fig. 5).
8-l 06 extracts (VVeil et rrl.. 1979) were prepared fronr a X. la&s kidney cell line as described (Koski et al.. 1980). Analytical reactions (20 ,nl) contained PO my- Hepes (pH 7.9). 70 mivr-KC], 5 mM-MgC1,. 0.5 mm-tiithiothreitol. I5 pM-[a-32P]GTP. 150 P&I each unlabrlled ATP. CTP and IYTP. 10 mM-creat,ine phosphate, 20 units of human placental ribonuclease inhibitor (Amersham). IO ~1 of S-100 extract, and 10 ng of supercoiled plasmid DNA/ml. l’reparativr reactions (100 to 400 jLI) contained appropriately larger amounts of the above components with 3 unlabelled rNTPs and either [a-32P]GTP or ]a-32P]CTP. After incubation at 20°C for 0.3 to 3 h. newly synthesized RNA was recovered by extra&ion with phenol and was fract,ionated on 0.5 mm thicak 12O,, polyacrylamide/83 M urea gels as described (Hipskind & Clarkson. 1983). Labelled RNA bands were detecated I,) autoradiography with Kodak X-ray film at 4°C’ a.nd w,re quantified by the Cerenkov radiation in excaised gel slic,es.
RNA was elutrd from t,he gel slices (Maxam bi (Gilbert. 1980) and was rharacterized by RNase T, fingerprint,ing, secondary analyses with RNase A and RNase T2. itnd
5’-end group analyses with RNase T, and nuclease i’, as described (Koski d al.. 1980).
The protocol is that of Rungger & Tiirler (1978) with minor modifications. Small pieces of X. laeais ova,rp were digested with 0.2% collagenase (t,ype I, Sigma) in OR2 medium (Eppig & Steckmann, 1976) minus calcium by slow stirring in a spinner flask for 1 to I.5 h at room temperature. Released oocytes free of follicle cells werca washed extensively and left for at least 1 h at 19°C’ in OR’2 medium plus calcium and 50 rig/ml each of streptomycin, penicillin and kanamycin. The ooc.ytes were then centrifuged (Kressmann et ccl.. 1977) at 400 g for 10 min at 19°C. Mature stage VT oocytes showing a faint whitish area in t,hr: dark animal hemisphcrtb (indicating the nuclear position) were rnanuallv selecateti. Samples (1 ng) of supercoiled plasmid DNAs wew
tRNA Gene Transcription Termination 837
resuspended in 10 ~1 of 88 mM-NaCl, 1 mM-KC], 15 mM- Hepes (pH 7.0) and N 10 nl of each DNA solution was injected into an oocyte nucleus. After 2 h at 19”C, 0.1 PCi of [a-32P]GTP was injected into the cytoplasm. Batches of 10 oocytes were used for each time point; injection of label into the last of each batch was taken as time zero. After 5, 10 or 15 min, total RNA was recovered by treatment with proteinase K/SDS, extraction with phenol and precipitation with ethanol (Probst et al., 1977). RNA samples from 2 oocyte equivalents were electrophoresed through 0,5 mm thick 8.3 M-urea/l2% polyacrylamide gels and were exposed to preflashed X-ray film and an intensifying screen (Cawo SE-6) at -70°C for 1 to 3 days.
(e) Northern blot analysis
Total RNA was isolated from X. Zaewis tissue culture kidney cells and from whole ovary tissue by the guanidinium/hot phenol method (Feramisco et al., 1982). A 20 pg sample of each RNA, together with unlabelled RNA that had been recovered from 20 ~1 S-100 reactions containing either pBR327 or pXltLys DNAs, was electrophoresed through 2mm thick 10% polyacrylamide/8.3 M-urea gels at 20 W for 2.75 h. Gels were gently shaken twice for 15 min in 12 mM-Tris. HCl, 6 miw-sodium acetate, 0.3 mM-EDTA (pH 7.5) and the RNA was then transferred to GeneScreen membranes (New England Nuclear) by overnight electrophoresis at 20 V at 4°C in a Trans-Blot apparatus (Bio-Rad). Membranes were washed in fresh buffer for 10 min, air dried for 30 min, then irradiated with short-wave ultraviolet light for 10 min at 4000 pW/cm’. Prehybridization was at 45°C for 2 h in 0.9 M-NaCl, 50 miw-Tris . HCl (pH 7.5) 5 mM-EDTA. 0.1 y0 SDS. Filters were then hybridized for 16 h under the same conditions with 10 pmol of a 5’-labelled synthetic oligonucleotide complementary to positions 7 to 32 of the mature tRNALYs sequence. After 3 quick rinses in 6 x SSC
at room temperature (1 xSSC is 0.15 iw-SaCl. 0.015 M-
trisodium citrate), filters were washed with 0.1 x SSC for 30 min at room temperature, air dried. then exposed to preflashed X-ray film and an intensifying screen at -70°C for 2 to 7 days.
3. Results
(a) DNA sequence analysis
The DNA examined here is a segment, of a 3.18 kb tandemly repeated fragment of X. laevis DNA (Clarkson et al., 1978) whose organization is shown in Figure 1. Sequence analysis of both strands of the 450 bp of DNA between the unique EcoRI site and a terminal Hind111 site revealed the presence of a putative lysine tRNA gene with the indicated polarity. The coding sequence is uninter- rupted and is identical to that of tRNALyS from rabbit liver (Raba et al., 1979) except for a single G to C transversion at position 6 of the aminoacyl stem. The 3’.terminal CCA is not encoded, in common with all known nuclear tRNA genes (Sprinzl et al., 19856). An unusual feature of the 3’- flanking region is the lack of a T cluster in the non- coding DNA strand close to the gene; the nearest such cluster is located over 70 bp away (see Fig. 3, below). A second rare feature for a,n RNA polymerase III gene is the presence of four contiguous T residues within the gene itself (see Fig. 3).
(b) Transcription of the tRNALY” gene in vitro
To test the functionality of the tRNALyS gene, the sequenced EcoRI-Hind111 fragment was inserted
Figure 1. Origin of the X. Zaevis tRNALYS gene, strategy for its sequencing, and cloverleaf structure of its mature transcript. (a) Location and polarity of the tRNA genes within the 3.18 kb repeat; filled boxes indicate mature tRNA coding regions. (b) The 450 bp of sequenced DNA in subcloned pXltLys. (c) Sequencing strategy; fragments labelled at their 5’ ends (continuous lines) or 3’ ends (broken lines) were sequenced by the chemical method. (d) Cloverleaf structure of the mature tRNALyS gene transcript (base-pairs are indicated by dashes). The arrowed C is replaced by a G in rabbit liver tRNAljYS (Raba et al., 1979). Nucleotides are shown in unmodified form. The 3’ CCA,, is added post- transcriptionally.
838 iz. Mazabruud et al.
Figure 2. In-vitro transcripts of the tRNALY” gene and their RNase T, fingerprints. (a) pXltLys was incubated at PO’ ( with [M-~‘P]GTP in a X. laevis S-100 extract for 20 min (lane l), 1 h (lane 2) and 3 h (lanes 3 to 5). cc-Amanitin wa,s included at either 1 pg/ml (lane 4) or 250 pg/ml (1 ane 5). RNA products were electrophoresed through a thiu I 200 polyacrylamide/8.3 Y-urea gel and were autoradiographed. (b) to (e) RR’ase T, fingerprints of R,SA-LI Iabrilrd with (b) [E-~~P]GTP or (d) [E~~P]UTP. and of RNA-L3 labelled with ((8) [a-32P]GTP or (e) [E~~P]I.~TP. Thr RXasr T, products are numbered as in Table 1 and Fig. 3.
between these two sites of the plasmid pBR322 and the resulting subclone pXltLys was then assayed in S-100 extracts of a X. Eaevis kidney cell line (Weil et al., 1979). Two major transcripts are found after short incubation times, RNA-L1 of -160 nucleo- tides, and RNA-L3 of -40 nucleotides (Fig. 2(a)). These two species accumulate with the kinetics of primary transcripts, in approximately equimolar amounts. and each appears t’o be slightly hetero- geneous in length. Longer incubation results in the appearance of a third species, RNA-LB, migrating at the position of mature tRNA (- 76 nucleotides). Synthesis of these transcripts is almost entirely abolished by 250 pg cr-amanitinlml (Fig. 2(a)) and is thus mediated by RNA polymerase III. Most of the residual synthesis is found in the form of RNA-L3 transcripts (Fig. 2(a)) but t’his is to be expected since cr-amanitin blocks elongation as well as initiation (Cachet-Meilhac & Chambon, 1974) and RNA-L3 is only -250/b the length of RNA-Ll.
(c) Sequence analysis of thr in-vitro transcripts
Rh’As Ll, L2 and L3 were gel-purified from preparative reactions containing [c~-~~P]GTP or [E-~~P]UTP. RNase T, fingerprints were prepared for each species, some of which are shown in Figure 2. The resulting oligonucleotides were then identified by secondary analyses with RNase A, RNase T, and, in some cases, nuclease P, (Table 1). The oligonucleotide assignments establish that all
three kinds of RNAs are derived from sequences within and around this t’RNALy” gene.
RNA-L1 is a primary transcript that, initiates with a pppGp five nucleotides in front, of the maturt, t,RNA coding sequence. Tts sequence is czo-linear with the gene and continues into the 3-fa.nking region. The 3’ end is slight,ly heterogeneous with UUUAACCVUI’,, and IK!ITAA(‘(‘L~lTC’V’,,, as t)he predominant RNase T, products.
R,NA-L2 is identified as thth mature-length tRNALy”. It contains pGp as thr 5’.t8erminal nucleotide. and some modified nucleotidrs are present (but in sub-molar yields) at their rxprct~rd positions (D16. 1120. 1147 and T54; Raba ut (11.. 1979). Although not directly demonstrated. the 3’ t)erminal CCA,, also seems t’o be present,.
RKA-I,3 is a second primary transcript that initiates with the same pppGp as R,KALl. The much simpler RIVA-I,3 fingerprint lacks oligo- nucleotides from t.hr 3’ end of the gene and trailer sequences. Two new spots are found after I’TP labelling, ACI’I’I:,, and A(‘UI’ITIToH. t,hat are derived from the heterogeneous 3’ end.
The results of these sequence analyses (sum rna~‘- ized in Fig. 3) suggest, that) -50°& of’ the irb-citro initiation events at the G at -5 give rise to t’hek long t,RNA precursor, RNA-L1 ~ t*hat terminates heterogeneously within the T4 cluster lorat,ed 76 bp beyond the 3’ end of the gene. The 5’ leader and 3’ trailer sequences are subsequently removed and some base modifications are introduced to yield t.hc
tRNA Gene Transcription Termination 839
Table 1 Sequence of RNase TI products of RNA-Ll, RNA-L2 and RNA-L3
Xumbrrt
RNase T, products:
Sequencef [a-=P]GTP§
RNA labelled with:
[E~~P]UTP§
Common to LI, L2 and L3:
1 Gp (U)
3 AGp (C)
7 I-CGp (G)
8 L’AGp (A)
10 CCCGp (C)
15 (‘UCAGp (U)
16a CAUAGp (C)
1X CAIKAGp (A)
Common to LI and L2:
1 Gp (G. cl, C)
2 CGP (C) 3 AGp (G) 1” I’UCGp (G)
11 YCCAGp (G)
19 L-CCCUGp (U)
20 WCAAGp (U)
23 ACUUUUAAUCUGp (A)
Common to Ll and L3: lrGp (C)
CAGp (U)
PPPGP ((7
1 5a
p.5’
spH%jic to Ll. 1
2
1
*it,
6 9
11
13
16b
17 21
22
24
&‘a
e3’b e3’r
Gp (IT, C) CGp (G)
LlGp (A. UT)
ACGp (C, U)
AAGp (U) IWGp (A)
UCCGp (U)
C’UAGp (G)
I’C‘AAGp (U)
VAAAGp (C) CCUUAAGp (U)
CCUUC’UCUGp (A)
SAAAlrAAACACACGp (U)
I’IJUAACCUU,,
TUUABCCUUU,, t-IJUAACCUUUU,,
Specijic to L2. m.5’
m3’ PUP (C)
CCAO,,
ACUUU,, UP, ACp ACUUPU OH i& AG -’ -
AGP -2, cp
AGP
cp
AGP AGp
AGp
GP cp AGp
CP> GP AGp
vp AAGp
up
vp AGP
PP&II
CP, GP -- up A* AAGp
UP - CP - AGp AAGP AAAkp
AAGp
up
cp
pGpll
Gp -
(‘p, AGp EJp-
AUp -
CP, Gp IJp. AAGp
6, Cp > ACp > AAUp
AGP -
Gp -
Gp -
CP, Up, AAGp
CP, UP Gp, AAAAUp
KCP -
UP, cp vp cp -‘-
t Numbered as in Figs 2 and 3. $ Assignments are based on the positions of the oligonucleotides in the fingerprints, the mobilities and molar yields of the products of
RNase A and RNase T2 digestion, and the DNA sequence. Nearest neighbour bases are shown in parentheses. 5 Columns list the labelled products after digestion with RNase A. Nucleotides that remain labelled after digestion with RNase Tz are
underlined. Products absent from the fingerprints are shown by dashes. 11 Oligonucleotides were digested with RNase T, and nuclease P,, and the products were then subjected to LiCl chromatography on
polyethyleneimine-cellulose to characterize the 5’ end groups.
Figure 3. Sequences within and around the tRNALy” gene and of it,s in-vitro transcripts. The RNasr ‘1; producats specific to the precursor, RNA-Ll, and to the short transcript, RNA-LS. are shown below their sequences. Common oligonucleotides are shown only below the sequence of the mature-length tRNA, RN,4-L2. All 3 t,ranscripts are aligned with the non-coding DNA strand sequence, which is numbered from the first nucleotide of the fkoRT site. Nuc>leotidrBs corresponding to the mature tRNA are enclosed in a box. The indicated HphT site was used to const,ruct the drlrtion mutants sho& in Fig. 5.
mature-length tRRjA, RNA-LB. The remaining initiation events at the G at’ -5 generate a shorter primary transcript, RNA-L3, whose heterogeneous 3’ end coincides with the intragenic T4 cluster.
(d) Origin of RNA- L3
The simultaneous appearance of RNA-L1 and RNA-L3 early in the in-vitro reactions (Fig. 2(a)) suggests that the short length of RNA-L3 is caused by premature transcription termination rather than aberrant cleavage of RNA-Ll. This interpretation is supported by two other lines of evidence. First, addition of 300 pg cr-amanitin/ml to a 30-minute transcription reaction permits the subsequent’ conversion of RNA-L1 to RNA-L2 (Fig. 4(a)). However, RNA-L3 shows no concomitant accumulation but only a small increase (< 10% by densitometry) that is attributed to the minor fraction of a-amanitin-resistant transcripts noted earlier (Fig. 2(a)). Second, when gel-purified RNA- Ll is incubated in fresh S-100 extract, the precursor is processed to the mature tRNA, RNA-LB, but RNA-L3 is undetectable (Fig. 4(b)).
These results thus indicate that -50% of the transcripts initiated in vitro are stopped before a functional product can be synthesized. The extent of this premature termination is rather surprising because the intragenic T4 tract resembles a weak Xenopus 5 S RNA termination site (Bogenhagen $
Brown, 1981) in being flanked by A-rich sequences (AGACTTTTAATC).
(e) Ejfeects of deletion-substitutiorLs in thr 3’ jlanking region
The sequences just around the extragenic ‘I’, tract, (AACCTTTTAACT) are also more A-rich than G+C-rich pet the tRNALys precursor, RNA-LI. terminates with high efficiency at this site (Fig. 2(a)). This site is, however, embedded within a relatively T-rich region (13 of the 21 nucleotides between positions 395 to 415 are T residues, Fig. 3). This region includes, in particular, a 7; ctlust,er tha,t conceivably may contribute t,o termination efficiency. To test this possibil&y, the JIKA downstream from the T4 tract was deleted and replaced by three different plasmid DNA sequences. When assayed in the cell-free extract,, two of the resulting mutants (mutants B and C’. Fig. 5) terminate at the ‘I?, tract with the same high efficiency as the wild-type gene. Hence termination at the T4 tract is not dependent, upon the presence of the downstream T, cluster.
The third mutant (mutant A, Fig. 5) represents an interesting case because it does generate a small amount of read-through transcription. This implies that the nature of the sequences beyond the T4 tract can influence termination efficiency at that site. It is striking, however, that the ‘I’, tract of t)his
tRNA Gene Transcription Termination 841
56 7%
RT
1
Ll -
L2-
L3,
(0) (b) Figure 4. u-Amanitin chase and processing in vitro of
the tRNALy” precursor. (a) A 30-min reaction in vitro containing pXltLys and [E~*P]GTP was brought to 300 pg a-amanitin/ml. Incubation was continued at 20°C for a further 0 min (lane l), 20 min (lane 2), 40 min (lane 3) and 60 min (lane 4). (b) RNA-L1 was gel-purified from a preparative reaction in vitro containing pXltLys and [E~~P]GTP and was incubated at 20°C with fresh S-100 extract for 0 min (lane 5), 20 min (lane 6), 40 min (lane 7) and 80 min (lane 8). RNA products were electrophoresed through thin 12% polyacrylamide/&3 M- urea gels and were autoradiographed.
mutant is followed by CG residues and yet it is the only one to yield any read-through transcripts.
(f ) Transcriptotion in micro-injected X. laevis oocytes
To examine the behaviour of these intra and extra-genie termination sites in a more in viva-like assay, the wild-type and deletion mutant plasmid DNAs were injected into the nucleus of mature X. laevis oocytes. The oocytes were incubated for two hours at 19°C to permit nucleosomes to assemble on the injected DNA (Wyllie et al., 1978; Zentgraf et al., 1979). The cytoplasm was then injected with [a-32P]GTP and total RNA was recovered 5 to 15 minutes later. These short labelling periods were chosen because oocytes process homologous tRNA precursors very rapidly; indeed, a significant fraction of the tRNALys
Figure 5. In-vitro transcripts and DNA sequences of 3’- flanking region deletion mutants. Plasmid DNA from pXltLys (wt) and 3 deletion mutants (A, R and C) was incubated at 20°C with [c(-32P]GTP in a X. Zaevis S-100 extract for 2 h. RNA was extracted, fractionated on a thin 12 y0 polyacrylamide/8.3 M-urea gel, and autoradio- graphed. Readthrough products are denoted by RT. The non-coding DNA strand sequences are numbered positively from the last nucleotide of the mature tRNALyS sequence. Natural 3’-flanking DNA is shown in capitals; small capitals indicate substituted plasmid DNA sequences.
precursor is converted to mature-length tRNA within a five-minute pulse label (Fig. 6).
The read-through transcripts that are synthes- ized in vitro from mutant A (Fig. 5) are not detectable in injected oocytes (Fig. 6). It is possible that they are made but are then rapidly degraded, or that they terminate further downstream and migrate with the radioactivity near the gel origin. The simpler interpretation, however, is that the extragenic T4 tract behaves as a very efficient termination site in oocytes.
842 A. Mazabraud et al.
wt A B C '1 2 3' 4 5 6
Figure 6. Transcripts of the wild-type gene and deletion mutants in injected oocytes. Plasmid DNA from pXltLys (wt) and the 3 deletion mutants (A, B and C) were injected into the nucleus of stage VI oocytes. After a 2 h incubation at 19”C, the oocytes were pulse-labelled by cytoplasmic injection of [E~‘P]GTP for 5 min (lane l), 10min (lane 2) or 15 min (lanes 3 to 6). RNA was extracted, fractionated on a thin 12% polyacryl- amide/%3 M-Urea gel, and autoradiographed. The radio- activity near the gel origin is also found after inject’ion of pBR322 DNA and is largely due to endogenous ribosomal RNA synthesis (data not shown).
Figure 7. Northern blot analysis of in-&YI RKA. Total R,NA from X. Zaewis tissue culture kidney cells (lane I) and whole ovary tissue (lane 2) was electrophoresed through a 2 mm thick lo?,& polyacrylamide/8.3 M-urea gel. Unlabelled RNA recovered from reactions i7/ l+trcj containing pXltLF DNA (lane 3) or pBR327 IJK-;.L\ (lane 4) was fractionated on the same gel. The KNAs were transferred t,o a GeneScreen membrane. which was then probed with a labelled oligonuc+otide complementary to positions 7 to 32 of the mature tRNALy” sequence
In contrast, the intragenic T4 tract seems to function with the same efficiency in injected oocytes as in vitro to prematurely terminate a large fraction of the tRNALyS gene transcripts. Thus, all three mutants and the wild-type gene produce RNA-L3 during short pulse labels of injected oocytes (Fig. 6). Moreover, in an experiment similar to that shown in Figure 4(b), a nuclear injection of the tRNALyS precursor RNA-L1 results in its conversion to mature-length tRNA, but not to RNA-L3 (data not shown).
(g) Northern analysis qf in-viva hW;l
To determine whether premature terminat’ion of’ tRNALy” gene transcripts also o(.curs ~‘71 rGvo. samples of total RNA from whole ovary tissue and from the X. laevis kidney cell line were fractionated on a denaturing polyacrylamide gel. and were electrophoretically transferred t,o a GeneScreen membrane. To incorporate internal controls. pXltLys and pBR327 DNAs were separately incubated in S-100 extracts in the presence of unlabelled rNTPs; the resulting KNAs wercl gel- fractionated and transferred to t,he samp membrane. The blot was then probed with a .i’- labelled synthet,ic oligonuc~leot ide that is
tRNA Gene Transcription Termination 843
complementary to nucleotides 7 to 32 of the mature lysine tRNA. The end-points of this 26-mer (5’ GTCTGATGCTCTACCGACTGAGCTAT) were chosen to start just before the U, tract of the tRNA and to end just before the unpaired C residue in its aminoacyl stem (Fig. 1). Inspection of other vertebrate tRNA sequences and their genes (Sprinzl et al., 1985a.b) suggests that this probe should be highly specific for tRNALY” transcripts.
The RNA from the pBR327 control reaction exhibits hybridization in the RNA-L2 region of the blot (Fig. 7, lane 4) due to the presence of endogenous tRNAs in S-100 extracts. The hybridization is mainly confined to two bands and these same two bands are also found in the remaining three RNA samples. The presence of this doublet in the mature tRNA region, rather than a heterogeneous collection of bands, indicates that the oligonucleotide probe is indeed specific for tRNALy” transcripts. This is supported by hybrid- ization to the tRNA precursor region of the blot: the positive control shows the expected strong signal with the in-vitro synthesized RNA-L1 (Fig. 7. lane 3), and only a limited number of precursor bands are evident in the somatic cell and ovarian RNAs (Fig. 7, lanes 1 and 2). Moreover, different length tRNA precursors are revealed when oligo- nucleotide probes specific for tRNATy’ transcripts are annealed to comparable blots (E. Gouilloud, S. G. Clarkson & E. Kawashima, unpublished results).
The hybridization intensity of the RNA-L2 doublet is not much stronger than that of the in- Ltivo precursor bands (Fig. 7, lanes 1 and 2). It is also noteworthy that all characterized vertebrate lysine tRNA isoacceptors have the same length (Raba et aZ., 1979; Sprinzl et al., 1985a,b). For these reasons, the longer of the RNA-L2 bands is tentatively identified as the mature tRNALys (anticodon UCTU), which may hybridize less efficiently because of extensive base modification, and the shorter as an undermodified intermediate that lacks the mature 3’ CCA,, terminus.
Of more biological interest, RNA-L1 is not detectable in either ovary RNA or kidney cell RNA, yet both contain bands of hybridized precursors that differ in length. As discussed below, this may imply that different kinds of lysine tRNA genes are active in these two tissues. Finally, and most important, a faint band corresponding in length to RNA-L3 is present in the steady-state ovary RNA but is absent from the kidney cell RNA. This suggests that premature termination of lysine tRNA transcripts can indeed occur in vivo.
4. Discussion
The most unusual structural features of the X. laevis lysine tRNA gene reported here are the positions of two T4 tracts in the non-coding DNA strand. One is found some 76 nucleotides beyond the 3’ end of the mature tRNA coding sequence. The second is locat,ed within the gene itself, at
positions 33 to 36, and corresponds to the anticodon and its adjacent 5’ nucleotide (Figs 1 and 3). When incubated in homologous S-100 extracts, t)he gene is transcribed by RNA polymerase III and associated factors to yield approximately equimolar amounts of two major transcripts, denoted RNA-L1 and RNA-L3 (Fig. 2). Fingerprint and secondary analyses demonstrate that RNA-L1 is a N 160. nucleotide tRNALyS precursor that initiates with a pppGp five nucleotides in front of the mature tRNA coding sequence and ends with two, three or four U residues within the extragenic T4 tract. The -4O- nucleotide RNA-L3 initiates at the same position but its similarly heterogeneous 3’ end coincides with the intragenic T4 tract (Figs 2 and 3; Table 1).
Several lines of evidence suggest that the 3’ ends of these transcripts are formed by transcription termination rather than cleavage of longer tran- scripts. The two RNAs are formed very early in the reactions, both in vitro and in injected oocytes; they are also found in longer incubations, together with mature length tRNA, RNA-LB, that is formed by 5’ and 3’ end processing of RNA-L1 (Figs 2 and 6). These processing events can occur during an cr-amanitin chase, but RNA-L3 does not accumulate under these conditions (Fig. 4(a)). Gel-purified RNA-L1 can also be converted to RNA-L2, both in vitro and in injected oocytes, but in neither case is any RNA-L3 detectable (Fig. 4(b) and data not shown). Transcripts extending beyond an extra- genie T4 tract can similarly be converted in vitro to mature-length tRNA without giving rise to inter- mediate products that end within the T cluster (data not shown). Although these results do not rigorously exclude the possibility that the variable number of U residues found at the 3’ ends of RNA- Ll and RNA-L3 are generated by processing events rather than termination, they suggest that any such processing would be imprecise, very rapid, and coupled to transcription. It is also worth noting that the number of U residues at the 3’ ends of tRNA precursors can be reduced by lowering the UTP concentration in the cell-free reactions (Hagenbiichle et aE., 1979; Koski & Clarkson, 1982). This result is not that expected for a processing reaction. It suggests instead that RNA polymerase HI pauses at T clusters and that this pausing is an integral feature of termination at these sites.
Whether transcription continues beyond the T clusters seems to depend mainly on the number of T residues and, only secondarily, on the nature of the surrounding DNA sequences. Thus, clusters of five or more T residues, flanked by a variety of sequences, almost invariably constitute efficient termination sites in Xenopus cell-free extracts or injected oocytes (Silverman et al., 1979; Koski et al., 1980; Bogenhagen & Brown, 1981; Hofstetter et al., 1981; Koski & Clarkson, 1982; Hipskind & Clarkson, 1983; Adeniyi-Jones et al.. 1984). Surrounding sequences seem to exert an influence only when the T cluster is shortened. In particular, a T4 tract flanked by G +C-rich DNA efficiently terminates Xenopus 5 S RNA gene transcripts in
844 il. Mazabraud et al.
vitro, whereas read-through products are formed when two or more consecutive A residues are located within three nucleotides preceding or following the T cluster (Bogenhagen & Brown, 1981).
It is therefore surprising that the extragenic T4 tract constitutes such an efficient termination site in vitro, despite being followed by two A residues (Fig. 5). Sequences even further downstream are not essential because in two cases (mutants B and C, Fig. 5) they can be replaced by plasmid DNA without impairing termination. In these cases the T4 tract is followed by an A dinucleotide (mutant B) or by AT residues (mutant C). Some read- through transcripts are produced, however, from a third construct (mutant A, Fig. 5): but in this case the T4 tract is followed by CG residues. Hence. termination at this T4 cluster in vitro is influenced by nucleotides immediately downstream but in a way that is exactly contrary to the simple 5 S “rules”.
The read-through transcripts from mutant A are not visible after short pulse labels of injected oocytes (Fig. 6). This might mean that the read- through transcripts are more unstable, or that they terminate further downstream, but it is simpler to suppose that termination is now fully efficient at the extragenic T4 tract. This, in turn, may imply a requirement for the DNA to be in a chromatin-like configuration, that the S-100 extracts contain a component inhibitory for termination, or that a factor required for termination at this site is less abundant or less active in the extracts. These possibilities have not yet been distinguished but the ability of purified RNA polymerase III to st,op synthesis at T clusters (Cozzarelli et al., 1983; Watson et al., 1984) indicates that at least this aspect of termination can occur without the need for additional components to impart a special configuration to the DNA template, or to act in some other way. However, cessation of synthesis and transcript release could well be two distinct processes. The first appears to require only the “core” RNA polymerase III but the second may need additional protein(s) for certain sites, as in factor-dependent termination in prokaryotes (reviewed by Platt, 1986).
The intragenic T4 tract is also followed by two ,4 residues yet this site appears to prematurely terminate -50% of the transcripts initiated in
vitro (Fig. 2). This property is not unique to the Xenopus tRNALyS gene. Its counterpart in Drosophila contains an identical anticodon loop and it also produces, in a homologous cell-free system, large amounts of short transcripts whose 3’ ends terminate within the intragenic T4 tract (DeFranco et al., 1982). Moreover, this Drosophila tRNALy” gene contains a fully base-paired anticodon stem. Hence a destabilization of this region, as in the Xenopus gene (Fig. 1). is not necessary for the production of these short transcripts. Very recent evidence further suggests that premature termina- tion can also occur in vitro within the sequence
TTATTTT in the gene for adenovirus \‘A RNA IT (Wu & Cannon, 1986).
The T4 tract within the Xenopus t K3.\‘~Y” gtancl seems to function with the same eficiency in /vitro as in injected oocytes (Figs 2 and 6). The question thus arises of why clell-free ext,rac:ts and oocytrs should be equally competent for terminat,ion tavents at this site, but not at t)he extragenic T,, t)racbt of mutant, A (Figs 5 and 6). One obvious feature tha,t distinguishes these two sites is their position. one being located between t’he essential A and 1% blotak promoter elements and the other down&earn f’rom both elements. This raises the possibility t.hat the> proximity of tightly bound t’ranscript,ion facators may actually aid t,ermination at intragenica ‘I’ clusters. Mutational analysis is compatible with t’his view but it also underscores t,he importanc*e of t,hc number of T residues and their sequence context or precise position. Thus, some mut,ations that creat,r internal T4 tracts do not impede transcription (mutants I!21 and 1132: Koski et al.. 1980). whereas others lead to premature termination (mutants T27 and T35; Traboni et al., 1984): this process becomes highly eficient a.t internal runs of five or six 7 residues (Koski ef al., 1980).
Finally. RNA-L3 appears t,o be present in small amounts in steady-state RN,4 from ovarian t,issue but not from cult,ured kidney cells (Fig. 7). In interpreting these findings it should be noted that this tRNALys gene is present, on a 1)NA fragment that is tandemly rrpeat)ed several hundred-fold in the X. laevis genome (Clarkson et al.. 197X), and that tRNALyS coding sequences have also hrrn found OII the tandem repeats of a second major tK,NB gent cluster (Rosent,hal & Doering. 1983). Hencltb t I-16, failure to detect RNA-L] in 7ti?:o (Fig. 7) ma,? impI> that the gene reported here is a non-fllnct,ioll;tl variant, and that the precursor bands a,nd RNA-I2 found in ovarian RNA are derived from lysitlfb t,RNA genes in this second cluxt,er. The presenc*e of different-length t RNALYS precursors in the kidne? cell RNA (Fig. 7) may similarly imply that ycht another class of genes is transcribed in somat,+ ~~~11s. Irrespective of the genetic origin of t.he i7/-~~%/,~~ RNA-L3, its presence in ovary RN-4 and absetrcbta from somatic cell RNA suggests t,hat tht% extent of- read-through transcription beyond int’ragenica T clusters can be regulated %,n ~ilio. This, in turn, would offer one level of cont,rol for t,hr amount. of mature gene produc+.
We thank ,Janine (‘orlet for expert twhnical amistitnw. Dr Eric Kawashima (B&en S.A.) for oligonucleotidr synthesis. and an anonymous revirwer for helpful criticism. A.M. was on leave of absence from the (‘entrc National de la Recherche Soientifiyur. This work was supported by grants from the Swiss Kational Srit~ncv Foundation.
. References
Adeniyi-,Jones. S., Romeo. 1’. H. & ZaslofE M. (1984). Nucl. Acids Res. 12. 1101-I 116.
Allison, D. S. & Hall. J3. D. (1985). E,:MHO J. 4. X57- 2664.
tRNA Gene Transcription Termination 845
Bogenhagen. 1). F. & Brown, D. D. (1981). Cell, 24, 261- Martin, F. H. & Tinoco. I. (1980). Nucl. ,4cida Res. 8, 270. 2295-2299.
Ciliberto. C., Castagnoli, L. & Cortese. R. (1983). Curr. Top. Develop. Biol. 18, 59-88.
Clarkson. S. G. (1983). In Eukaryotic Genes: Their Structure, Activity and Regulation (Maclean, N.. Gregory, S. P. & Flavell, R. A., eds), pp. 239-261. Butterworths Press. London.
Clarkson. S. C.. Kurer. 17. & Smith, H. 0. (1978). CeZZ, 14, 713-724.
Maxam, A. M. & Gilbert, W. (1980). Methods Enzymol. 65. 499-560.
Platt, T. (1986). Annu. Rev. Biochem. 55, 339-372. Probst. E., Kressmann, A. & Birnst’iel, M. I,. (1977).
J. Mol. Biol. 135, 709-732.
(lorhet-Meilhac. M. & Chambon, P. (1974). Biochim. Biophyys. Acta. 353. 1606184.
(‘ozzarelli. N. R,.. Gerrard? S. P., Schlissel, M., Brown, D. D. & Bogenhagen. I). F. (1983). Cell, 34. 829-835.
DeFranco, I>., Burke, K. B., Hayashi, S., Tener. G. M.. ,Miller. R. (1. 8: Siill. D. (1982). NucZ. Acids Res. 10, 5799-5808.
Raba. M., Limburg, K., Burghagen, M., Katzr, J. R., Simseck, M., Heckman, ,J. E., RajBhandary, U. L. & Gross H. J. (1979). Eur. J. Biochem. 97, 305-318.
Rosenthal, 1). 8. & Doering, J. L. (1983). J. Biol. Chem. 258. 7402-7410.
Rungger, I). & Tiirler, H. (1978). Proc. Nut. .4cad. Sci.. G.S.A. 75, 6073-6077.
Segall, ,J.. Matsui, T. & Roeder. R. (:. (1980). J. Biol. Chem. 255, 11986-I 1991.
Emerson. B. M. CG Roeder, R. G. (1984). J. Biol. Chem.
259, 7926.-7935. Eppig, J. ?J. & Steckmann, M. 1~. (1976). In vitro, 12. 173%
179. Feramisco. J. R.. Smart, J. E., Burridge, K., Helfman,
D. M. & Thomas G. P. (1982). .I. Biol. Chem. 257, 11024-11031.
Hagenbiichle, 0.. Larson, D., Hall, G. I. & Sprague, K. I’. (1979). (lell, 18, 1217-1229.
Hess. J.. Perez-Stable, C., Wu, G.-J., Weir, B., Tinoco, I. & Shen. C.-K. J. (1985). J. Mol. Biol. 184, 7-21.
Hipskind, R. A. & Clarkson. S. G. (1983). Cell, 34, 881l 890.
Sharp, S. Dingermann, T., Schaack, J., DeFranco. D. & Still, I). (1983). J. Biol. Chem. 258, 2440-2446.
Silverman, S., Schmidt, O., S611, D. & Hovemann, B. (1979). J. Biol. Chem. 254. 10290-10294.
Sprinzl. M.. Mall. ,J., Meissner, F. & Hartmann, T. (1984a). Nucl. Acids Res. 13, rllr49.
Sprinzl. M., Vorderwiilbecke, T. & Hartmann. T. (1985b). LVucl. Acids Res. 13, r51-r104.
Traboni, C.. Ciliberto, G. & Cortese. R. (1984). Cell, 36, 179-187.
Watson. J. B.. Chandler, D. W. & Gralla, J. (1984). Nucl. Acids Res. 12, 5369-5384.
Hofstetter, H., Kressmann, A. & Birnstiel, M. L. (1981). Cell, 24. 573-585.
Koski. R. A. h Clarkson, S. G. (1982). J. Biol. Chem. 257, 4514-4521.
Weil. P. A., Segall, ,J.. Harris. B., Ng. S.-Y. & Roeder. R. G. (1979). J. Biol. Chem. 254, 616336173.
Wilson. E. T.. Larson. D., Young, L. S. & Sprague, K. U. (1985). J. Mol. Biol. 183, 153-163.
Wu, G.-J. & Cannon, R. E. (1986). J. Biol. Chem. 261, 12633312642.
Koski, R. A.. Clarkson. S. G., Kurjan, ,J., Hall, B. D. & Smith, M. (1980). (Yell. 22. 415-425.
Kressmann, A., Clarkson, S. G.. Telford, J. L. & Birnstiel, M. L. (1977). Cold Spring Harbor Symp. Quant. Biol. 42. 1077.-1082.
Wyllie. A. H., Laskey. R. A., Finch, ,J. & Gurdon, J. B. (1978). Develop. Biol. 64. 178-188.
Zentgraf, H. W., Trendelenburg, M. F.. Spring, H., Scheer, LT., Franke, W. W., Miiller, U., Drury, K. C. & Rungger, D. (1979). Expt. Cell Res. 122, 3633375.
Lassar. A. B.. Martin, P. I,. & Roeder. R. G. (1983). Science. 222. 740-748.
Edited by P. Chambon
Note added in proof. These sequence data have been submitted to the EMBL/GenBank Data Libraries under the accession number YOO163.
