Structure of Amylase Genes in Populations of PacificCupped Oyster (Crassostrea gigas): Tissue Expressionand Allelic PolymorphismD. Sellos,1,* J. Moal,2 L. Degremont,3 A. Huvet,2 J.-Y. Daniel,2 S. Nicoulaud,1 P. Boudry,3

J.-F. Samain,2 and A. Van Wormhoudt1

1Station de Biologie Marine du Museum National d’Histoire Naturelle, BP 225, 29900 Concarneau, France2Laboratoire de Physiologie des Invertebres. Institut Francais de Recherche pour l’Exploitation de la Mer (IFREMER),

Centre de Brest, BP 70, 29280 Plouzane, France3Laboratoire de Genetique et Pathologie, IFREMER, Station de Ronce les Bains, 17390 La Tremblade, France

Abstract: Using the previously determined complementary DNA Sequence of Crassostrea gigas amylase

(Y08370), we designed several oligonucleotide primers and used them with polymerase chain reaction (PCR)

technology to characterize oyster amylase gene sequences. Two genes encoding 2 different amylases were

characterized and sequenced. The 2 genes are similarly organized with 8 exons and 7 introns. Intron insertions

are found at the same location in the 2 genes. Sizes and nucleotide sequences are different for the different

introns inside each gene and different for the corresponding introns in the 2 genes. Comparing the 2 genes,

around 10% of the nucleotides are different along the exons, and comparing the 2 deduced protein sequences, a

mean value of 10.4% of amino acids are changed. Genes A and B encode mature proteins of, respectively, 500

and 499 amino acids, which present 94% similarity. A microsatellite (TC37) that constitutes the largest part of

intron 4 of gene A has been used as a polymorphic marker. A method consisting of a PCR step followed by

EcoRI digestion of the obtained fragments was used to observe polymorphism in these 2 genes. Six and 4 alleles

for genes A and B, respectively, have been sequenced, leading to a maximum of 2.9% base change. The 2 genes

are ubiquitously expressed in the different digestive tissues with quantitative differences. Gene A is strongly

expressed in the digestive gland and at a lower level in stomach, while gene B is preferentially expressed in the

labial palps. The microsatellite repeat was used in the analysis of 4 populations of Crassostrea gigas from the

French Atlantic coast. A high level of polymorphism observed with 30 different alleles of gene A inside the

populations should allow their characterization using the mean value of the microsatellite allelic distribution.

These populations showed a low level of differentiation (Fst between 0 and 0.011); however, the population of

Bonne Anse appeared to be distinguished from the other populations.

Key words: allelic polymorphism, microsatellite genetic markers, oyster populations, growth selection.

Received July 17, 2002; accepted September 3, 2002.

*Corresponding author: telephone +33-02-98-97-06-59; fax +33-02-98-97-81-24;

e-mail sellos@mnhn.fr

Mar. Biotechnol. 5, 360–372, 2003DOI: 10.1007/s10126-002-0089-7

� 2003 Springer-Verlag New York Inc.

INTRODUCTION

Despite the commercial importance of the world produc-

tion of mollusks and in particular of the oyster Crassostrea

gigas, basic knowledge of key physiologic processes in-

volved in growth and development remains poor. In this

respect, genes involved in pathways regulating growth,

development, and energy assimilation or capable of in-

ducing nutritional adaptation were searched. Genes en-

coding enzymes issued from multigene families are

expected to be used as genetic markers able to show dif-

ferential levels of expression as a consequence of environ-

mental differences in nutritional conditions or adaptative

capabilities of separate populations. The choice of

functional markers to characterize populations has

multiple interests since they can be used for breeding

programs if judiciously selected. A possible character for

selection programs would be the improvement of energy

transformation. The oyster industry is an extensive

activity in a highly variable food environment; better

optimization of food conversion could increase its pro-

ductivity. Moreover, assimilation and aneuploidy are the

main parameters explaining in situ growth variability. Ac-

tivities of digestive enzymes constitute a physiologic pa-

rameter affecting digestive capacity, and the control of such

a parameter may be important to maximize the assimila-

tion rate and consequently the rate of energy gain. Indeed,

good relationships have been reported between assimilation

rate and digestive enzymes in scallops. Among these

markers, we were interested by a-amylase, which is a key

enzyme for carbohydrate assimilation in mollusoks and is a

possible limiting enzyme in this metabolic pathway.

The Japanese oyster Crassostrea gigas represents the

main cultivated1 cupped oyster species in the world (FAO,

1999), and in France after its recent introduction following

the large destruction of endemic species Ostrea edulis and

introduced species Crassostrea angulata. Since its intro-

duction, the production of C. gigas has become the prin-

cipal activity of the French conchyliculture. However, the

increase of its production is correlated with a decrease of

productivity related to a limiting trophic capacity of the

environment (Heral, 1989).

First, genetic analysis of wild and cultured C. gigas

populations is of interest in order to assess the conservation

of diversity. In France only 2 areas produce spats, which are

then largely disseminated along the coasts, characterized by

variable environmental conditions. The genetic resources of

C. gigas have-already been estimated on a worldwide basis

with neutral molecular markers (Huvet et al., 2000) and

show a high level of polymorphism, which may provide a

good perspective for future selection. Indeed, controlled in-

troductions of cupped oyster populations may be of interest

to the aquaculture industry by providing desirable traits and

improved productivity through breeding programs.

Second, the environment may modify the structure of

animal populations by selective pressure. Studies have

shown decreased heterozygosity in polluted environments

(Park et al., 1999).

To date, the structure of amylase genes is unknown in

marine bivalve species. Knowledge is also limited for in-

vertebrates, except that some introns have been observed in

insects (Boer and Hickey, 1986; Grosmann and James,

1993; Da Lage et al., 1992, 1996). These authors have

demonstrated the existence of differential expression and

different chromosomal localizations for these genes. The

structures of the tropical shrimp amylase genes have also

been determined (A. Van Wormhoudt and D. Sellos,

manuscript in preparation), and in contrast to insects, the

existence of 9 introns was reported, as has been determined

in vertebrates. Amylase isoforms have been widely used for

population studies in insects (Cariou and Da Lage, 1993;

Dainou et al., 1993), in which 4 different enzymes are en-

coded by 4 different genes, the expression of which is

subject to tissue- and stage-specific regulations in differ-

ent populations and strains. In mollusks, the structure of

one amylase complementary-DNA has been determined

in Pecten maximus (Le Moine et al., 1997), and in the

oyster (Moal et al., 2000). Better knowledge of the structure

of the amylase genes and of their polymorphism is neces-

sary to establish the genetic basis of this physiologic

parameter.

In this article we report for the first time, the charac-

terization of the structure of the amylase genes, their

quantitative tissue-specific expression, and their polymor-

phism as analyzed in different oyster populations sampled

along the Atlantic coast of France.

MATERIALS AND METHODS

Biological Material

Animals from the Bay of Concarneau were used to extract

DNA from the male gonad and RNA from different tissues

that were used, respectively for gene characterization and

the determination of expression patterns.

Structure of Amylase Genes in Pacific Cupped Oyster 361

Four wild populations were sampled from oyster-

farming areas: Arcachon (Gironde), Bonne Anse (Charente

Maritime), Seudre (La Tremblade, Charente Maritime),

and Port des Barques (Charente Maritime). The number of

sampled oysters was 46 for Bonne Anse and Port des Bar-

ques populations, 51 for Arcachon, and 198 for Seudre

populations. Gills were dissected from each individual and

immediately frozen in liquid nitrogen and stored at )70�Cuntil use.

Nucleic Acid Extractions

DNA was extracted following conventional methods as

previously described (Van Wormhoudt and Sellos, 1996).

As the last step, DNA was extensively dialyzed.

Total RNAs were extracted from digestive gland,

stomach, intestine, gonad, mantle, gills, and labial palps

using standard CTAB methods.

PCR Amplifications

Gene Structure

Several pairs of primers (HAMY0 · AMYH4;

HAMY1 · AMYH2; HAMY2 · AMYH1, HAMY3 ·AMYH0) were used to obtained the different regions of

gene A (Table 1). For gene B, only the pairs HA-

MY2 · AMYH1, HAMY5 · AMYH0, and HAM-

YB · GWR10 gave parts of the second gene. The 5¢ parts of

gene A (using reverse primers HSP1 and HSP2) and the 5¢half of gene B (using primers GWR3, GWR4, GWR5, and

GWR6) were determined by gene walking using the

Clontech kit.

PCR-RFLP Markers and Allele Sequencing

Specific primers of the amylase gene covering the exon 4,

intron 4 containing the microsatellite (in gene A), exon 5,

intron 5, and part of exon 6 were designed to specifically

amplify the same portions of gene A (primers HA and AH)

and gene B (HB and BH). The annealing temperature was

chosen between 55� and 72�C depending on the primer se-

quence. The obtained PCR fragments were characterized by

2% agarose gel electrophoresis with TAE buffer, extracted

from the gel with the Qiaquick gel extraction kit from Qiagen,

and cloned into the pGEMT-easy vector from Promega.

Double-stranded cloned DNA fragments were sequenced on

both strands with the T7 Sequenase quick-denatured plasmid

sequencing kit from USB corporation and 35S-dATP

Microsatellite Markers

Two primers (Hsat1 and Hsat2) located in the flanking

exons (4 and 5) of the microsatellite (intron 4) were used

to analyze the microsatellite polymorphism of gene A.

After kination of one primer (2 pmol Hsat1) with c-33P,

PCR was conducted at 54�C during 30 cycles with 10

pmol Hsat2 under standard conditions. Microsatellite

polymorphism was determined by electrophoresis of the

generated fragments on a denaturing 6% sequencing

polyacrylamide gel in TTE buffer. Alleles were given in

base pairs (bp).

RT-PCR Amplification for Tissue Expression

Total RNA (0.1 lg) was reverse transcribed by 5 U of

reverse transcriptase (RT, Promega) in 50 ll buffer at

42�C. An aliquot (1 ll) of the reverse reaction was directly

used as matrix for the PCR using Ready-To-Go PCR

beads from Amersham Pharmacia Biotech with the spe-

cific primers of genes A and B (HA-AH and HB-BH)

under the conditions previously described. The RT-PCR

yields were compared utilizing an actin fragment pro-

duced using a specific pair of primers (AV1 and AV2)

based on the Crassostrea virginica actin cDNA sequence

(Unger and Roesijadi, 1993).

Data Analysis

F statistics were calculated according to Weir and Cock-

erham (1984). All the computations and tests were done

using the package GENETIX Version 4.01 (Belkir et al.,

1996). Unbiased estimates and standard deviation of het-

erozygosity were calculated according to the Fis parameter.

Deviations from Hardy-Weinberg expectations were tested

in each sample with 1000 randomly generated permuta-

tions, resampling individual genotypes within the popula-

tion. The genetic differentiation for pairs of populations

was quantified with Fst parameters corresponding to the h

of Weir and Cockerham (1984). To test these values, 1000

permutation replicates were generated, and genotypes were

resampled between 2 populations. The statistical analyses

for size of microsatellite alleles were carried out by analysis

of variance using SYSTAT 9.0. Multiple comparisons were

made using the least-Squares method.

362 D. Sellos et al.

RESULTS

Gene Structure

The total lengths were 6062 bp for gene A and 5398 bp for

gene B. The two amylase genes are characterized by the

same organization with the existence of 8 exons separated

by 7 introns (Figure 1). Sizes of exons largely varied from

37 bases for the smallest exon 8 to 521 bases for the largest

exon 4. Comparing homologous exons between the 2 genes,

sizes were similar except for a deletion in gene B of the 3

nucleotides coding for the glutamine in position 279 in

protein A (Figure 2). Sizes for introns were different within

a given gene (for example), in gene A, from 123 to 1309

nucleotides), but also for a given intron between the 2

genes. A microsatellite repeat (TC37) is located in intron 4

of gene A starting 3 nucleotides after the GT donor site. It

represents 47% of the whole intron. In gene B, the highest

corresponding TC repeat contains only 3 consecutive rep-

etitions of this motif. All the exon/intron junctions are

found at the same locations and with homologous junction

types for the 2 genes. The two encoded proteins also have

the same type of organization, with the presence of a 20-

residue-long signal peptide and a mature enzyme 499 to

500 residues long. For the whole coding sequence, 166

nucleotide changes were noted. The highest level of sub-

stitution was observed for exon 1 (16% of the nucleotides

of gene B when compared with A), and for exons 4, 5, and

6. The lowest level of change was seen for exon 2, with only

Table 1. PCR Primer Sequencesa

Location

Name Nucleotide sequence Gene Exon Bases

HAMY0 GTGCCTCCTCTATGTGGGTGTC A 1 1068–1089

HAMY1 ATTTCCCCTCCTAATGAGAAC A 3 3170–3190

HAMY2 GCGGGATATTTGAATCAC A 4 3737–3754

HAMY3 GCGACAGAGTTCATGTTG A 6 4705–4722

AMYH4 TACATTCCGATCCACTGTTG A 4 3623–3604

AMYH2 CAACATGAACTCTGTCGC A 6 4722–4705

AMYH1 TCTGAAGTTCCCGCGTTG A 7 5406–5392

AMYH0 ATGTCGTCACCTTCTTTACCGAACC A 8 5936–5912

HAMYB TACTGCTTTGGTGCCCCCTCTT B 1 402–423

HSP1 ACCGACACCCACATAGAGGAGGCACCAA A 1 1091–1065

HSP2 GGAGGCACCAAAGTATTACTTGGAACAT A 1 1075–1048

GWR3 AGGTATATAAAGGGTTTGGTTCCTGCAGTA B 4 2789–2760

GWR4 AATAGGCGGTATTCAAATCATGCAGTCTCT B 4 2758–2729

GWR5 GACCTTATTACATCTCTGTATCATATCTCGG B 3 2112–2082

GWR6 GAGGTCAGCCTCGTTTCCACTTCTGGTGA B 3 2082–2056

GWR10 CCACTCAAACAGGTGCGTGATGGTGTGA B 2 1223–1196

GWHB1 AATACCAACAAAGAGGGGGCACCAAAGCA B 1 433–405

GWHB2 AGGGGGCACCAAAGCAGTACTTGGAACAT B 1 420–392

HA AGCACGGGAGACGGCAAT A 4 3623–3640

AH TGAGGGGGGCCCTGCCAAT B 4 4820–4802

HB AGCACAGGAGATGGCGGC A 6 2518–2535

BH TGAGGGGGTCCCATCCAGC B 6 3749–3732

HSat1 ACCGGTATTGCCCGAGTTACAA A 4 3941–3962

HSat2R AGTTAGGCATCCCCCATTGTTC A 5 4180–4159

H9 TCCGGAACCGGAACTGCTGGT B 4 2419–2439

AP1 TCACCAACTGGGATGACAT Actin

AP2rev TGATCCACATCTGTTGGAAGGTGG Actin

aNames and sequences of the oligonucleotide primers used for the different PCR amplification and gene walking experiments to establish the sequence of

the amylase genes and the polymorphism of the alleles are given. Location inside the genes and positions are given related to numbering on the 2 genes.

Structure of Amylase Genes in Pacific Cupped Oyster 363

Figure 1. Schematic representation of the structure of amylase genes

in Crassostrea gigas. The 2 genes were constructed from overlapping

PCR fragments amplified from a single animal with several pairs of

oligonucleotide primers. 5¢ Noncoding regions were obtained by

gene walking. A minisatellite was found in intron 2 and a

microsatellite (black box) in intron 4 of gene A. Arrows indicate

the locations of the different primers used. Nucleotide and amino

acid changes of gene B compared with gene A are given below each

exon. Gray boxes correspond to exons.

Figure 2. Organization and alignment of the coding sequences of A

and B amylase genes in Crassostrea gigas. (Acceptor and donor

nucleotide sequences are given for each intron. The deduced amino

acid sequences of A and B amylases are given above the nucleotide

alignment. When the residue is different in B protein than in protein

A, it is shown by ‘‘residue A/residue B.’’ The deduced protein

sequence corresponding to the signal peptide is indicated in boldface.

Amino acid numbering starts with the N-amino-terminus serine of

the mature enzyme.

364 D. Sellos et al.

1.6%. This exon also had the highest value of GC content,

62 to 66%, while all the others had a GC level between 44%

and 52%. The same relationship was not confirmed for

exon 7, with the lowest GC value (45%) and only a few

changes in nucleotides (4.5%). Finally, identity between A

and B genes was determined to be around 60%. Identity

between c-DNAs for A and B (i.e., for coding sequences)

was 89%.

Comparing the deduced amino acid sequences, 54

residues are changed between protein B and protein A, yet

the pI values of the 2 different amylases are very similar

(7.28 for B and 7.32 for A). The highest percentage of

difference is found for that part of the protein corre-

sponding to the signal peptide (29% of changes), and fol-

lowing this for a large central domain of the protein from

residues 92 to 378 (encoded by exons 4 to 6). The areas

showing the lowest amino acid changes are encoded by

exon 2 (2.1% of residues modified between amino acids 6

and 40) and by exon 7 (2.7% of change between amino acid

379 and the carboxy-terminal residue). Overall, 94% sim-

ilarity was found for the mature protein sequence.

Promoter regions were characterized for the two genes.

Only gene B revealed a characteristic organization with a

TATA box located 61 bp from the initiation codon and a

CAAT box 100 bp upstream from the start of the coding

sequence. The presence of some putative regulatory ele-

ments (glucose responsible element and AACACGCCT and

ATTGAAT [AP1] binding site motifs) is discussed. The 5¢noncoding parts of the 2 cDNAs are very similar.

Allelic Polymorphism

Given that exons 4, 5, and 6 presented the more variable

sequences, specific primers were designed on both strands

of this sequence for each gene (primers HA and AH and

HB and BH for gene A and gene B, respectively). This

allowed a PCR-RFLP approach based on EcoRI restriction

patterns on the gene portion between exons 4 and 6. A

second polymorphism was analyzed on gene A because of

the presence of a microsatellite locus on intron 4.

With this method, 6 different allelic profiles were de-

termined for gene A (A1–A6) and 4 for gene B (B1–B4). The

presence of 1 EcoRI site in A1, 2 sites in A2-A3-A4-A6, and no

site in A5, and the existence of 1 sites in B1, 2 sites in B2, and

no site in B3-B4 was confirmed by the sequences (temporary

accession numbers for alignments: An1014211962 and

An1014217288) and explains the different A1-A6 and B1-B4

profiles obtained initially. However, the sequence analysis

showed that allele A2 mainly differed from alleles A3-A4-A6

by the location of the second EcoRI site, while differences

between alleles A3 and A4 were mainly explained by the size of

the microsatellite. Alleles A2 and A6, which represent the 2

EcoRI sites at the same location, differed by a large 206-bp

insertion in intron 5.

Within the allele A family, compared with A1, we

noted 21, 38, 33, and 21 nucleotide substitutions, respec-

tively, for A2, A3, A4, and A5 on a total of 1194 bases.

These changes in nucleotides are mainly seen in introns

(ranging from 2.7% to 5.3% respectively, in introns 4 and

5 and 0.1% to 2% in exons 4 and 6), and as such no

differences in amino acids were evident between alleles.

The size of the TC repeat was variable from 24 repeats in

A5, to 39 in A3. In the population analysis, the micro-

satellite DNA spanned from 5 to 52 repeats, which largely

increased the number of polymorphic alleles. Besides the

variation of the number of TC repeats in the microsatel-

lite, the PCR fragments corresponding to alleles A2, A3,

A4, A5, and A6 exhibited polymorphism in size due to

deletions of 28, 20, 47, 57, and 33 nucleotides, respectively,

in comparison with A1. For the B alleles, we observed 25

and 35 substitutions in B2 and B3, respectively, compared

with the B1 sequence. In this case, changes in exons were

about 1.2% to 1.5%, while changes in introns were 2.9%

to 4.2%. However, these substitutions induced changes in

amino acids between alleles: 4 for B2, 1 for B3, and 3 for

B4.

In allele B, at the corresponding location, we noted the

existence of a TC-rich sequence formed with 2 imperfect

TC repeats, TCTCTTTCTCT and TCTGTCTCTTCT, which may

correspond to the emerging or disappearing TC microsat-

ellite. This fragment did not show any polymorphism in the

determined sequences.

Tissue Expression

The RT-PCR experiment was performed using the same

specific primers (HA-AH and HB-BH). Gene A was

expressed strongly in the digestive gland, at a lower level in

stomach, at a very low level in labial palps, mantle, and

intestine (Figure 3). Gene B was expressed strongly in labial

palps and at a lower level in the different digestive tissues.

The observed intensities were compared with the yield of

amplification obtained with an actin marker, using the

same amount of RNA solution and the specific actin

primers AV1 and AV2.

Structure of Amylase Genes in Pacific Cupped Oyster 365

Population Structure

Four oyster populations originating from 4 French oyster-

farming locations (Bonne Anse, Arcachon, Seudre, and

Port des Barques) were studied. Two markers (EcoRI pro-

files after specific amplification using the pairs of primers

HA-AH and HB-BH, and the length of the TC microsat-

ellite in gene A) were analyzed to determine the genetic

structure of these populations and the genetic differentia-

tion between them.

PCR-RFLP Markers

In all 4 populations, allele A1 represented 74% to 79% of the

total, and allele B1 was also strongly represented with 80% to

87% of the total (Table 2). Allele A5 was not represented in the

Seudre population. In the same manner, alleles B3 and B4

were not seen in the Port des Barques population. The use of

one restriction enzyme enabled the detection of rare alleles, as

shown in Table 2, but these were not sufficient for population

characterization. In fact, when we considered ‘‘homozyg-

otes’’ A1-A1 and B1-B1, the use of the restriction site AluI

allowed a better characterization of these genotypes, although

this was still not sufficient (Table 3). The presence of A6 was

recorded for all the different populations.

Microsatellite Marker

Across the 4 populations, the total number of observed

alleles for gene A, based on size polymorphism of the mi-

crosatellite, was very high (40 alleles). Fragments generated

by PCR amplification ranged from 176 to 272 bp. Conse-

quently, the TC repeated sequences comprised from 11 to

105 nucleotides. The distribution of the size of the micro-

satellite alleles gave an oriented repartition of the short

microsatellite repeats for the Bonne Anse population with a

mean size of 43.1 ± 4.5 nucleotides, while the 3 other

populations had larger size repeats with mean values of

59.2 ± 3.4, 55.6 ± 4.5, and 56.4 ± 5.2 nucleotides for

Seudre, Arcachon, and Port des Barques, respectively

(Figure 4). In this respect the Bonne Anse population

presented a significantly different mean size of the micro-

satellite (95% confidence interval). Gene diversity averaged

0.95 for the 4 populations. Three populations displayed Fis

values indicating significant heterozygote deficiencies,

ranging from 0.08 (Arcachon population) to 0.11 (Port des

Barques population). Only the Bonne Anse population had

an Fis value that was not significantly different from 0: i.e.,

0.04 (Table 4A).

The level of genetic differentiation between pairs of

populations, estimated with pairwise Fst values, was found

to range from 0 to 0.011 (exact mean Fst = 0.0074; Table

4B). Only 1 value, out of the 6 tested, was significantly

different from 0, between Arcachon and Bonne Anse

populations (Fst = 0.011).

DISCUSSION

Gene Structure

Amylase belongs to a multigene family. In humans, Amy1 is

the salivary enzyme and Amy2 the pancreatic enzyme. Four

amylases are observed in Drosophila. The 2 genes inside the

2 clusters were produced by duplication (Shibata and

Yamazaki, 1995). Intron-exon arrangements are similar for

both genes in oyster. The structure of the gene also varies

between genus: 8 exons are identified here in the C. gigas

amylase gene, 10 in the human pancreatic gene, and 11 in

the human salivary gene (Nakamura et al., 1984). Among

insects, the amylase gene presents either no or one intron in

D. melanogaster (Da Lage et al., 1996, 2001). The marked

differences in intron sizes, the high level of nucleotide

changes in the exons, and the strong divergence in intron

sequences indicate an ancient duplication event and a long

evolutionary history from an ancestral gene structure when

compared with the likely recent duplication of the cellulase

genes in other mollusks (Xu et al., 2001). In Mytilus edulis,

Figure 3. Tissue expression of A and B genes in Crassostrea gigas. Lane 1

is intestine; lane 2, stomach; lane 3, mantel; lane 4, digestive gland; lane

5, labial palps. Row A is gene A: 35 cycles at 58�C using HA and AH

primers. Row B is gene B: 40 cycles at 66�C using HB and BH primers.

Row C is actin: 40 cycles at 52�C using AV1 and AV2 primers.

366 D. Sellos et al.

only one conservative nucleotide difference is observed for

exon sequences and around 97% similarity is determined in

corresponding introns. This must also be modified to take

into consideration the difference in evolutionary clock

rates, depending on the given taxon, when compared with

the rapid evolution of insect amylase genes for which we

observed differences in intron organization.

Some motifs in the promoter region of gene B are

similar to those found in Drosophila and could be sites for

regulatory elements (Choi and Yamazaki, 1994). An AP1

putative binding site and a common element, AACACGCCT,

are present and may have a regulatory function. However,

no analogous glucose or sterol regulatory elements have

been detected (Grossman et al., 1997). The apparent ab-

Table 2. Distribution (in %) of the Different Alleles and Loci for the Two Oyster Amylase Genes Among the Four Populations of the

French Atlantic Coasta

Allele/Locus Bonne Anse Arcachon Port des Barques Seudre

Allele

A1 77 79 74 74.6

A2 14.5 9 12 18.3

A3 2.2 5 3 3.1

A4 2.2 3 4 2.5

A5 2.2 2 3 0

A6 2.2 1 3 1.5

Locus

A1A1 60 65 60 54.8

A1A2 20 18.5 17 27.9

A1A3 4.5 2 6 5.1

A1A4 4.5 2 2 4.6

A1A5 2 4 4 0

A1A6 4.5 2 2 2

A2A2 4.5 0 2 4.1

A2A4 0 0 2 0.5

A2A5 0 0 2 0

A3A3 0 0 0 0.5

A3A4 0 4 0 0.5

A4A4 0 2 2 0

Allele

B1 80 84.5 86 87.4

B2 12.5 9 14 10.6

B3 7 5 0 2

B4 1 1 0 0

Locus

B1B1 70 70 72.5 76.6

B1B2 14 16 21 17.3

B1B3 7 10 0 4.1

B1B4 2 0 0 0

B2B2 4.5 2 6.5 2

B2B3 2.5 0 0 0

B2B4 0 2 0 0

Sample number 43 49 47 19

aThe size of the sample used in indicated. A1 = 230, 950; A2 = 230, 550, 400; A3 = 230, 450, 490; A4 = 230, 430, 490; A5 = 1140; A6 = 230, 800, 400. B1 =

430, 820; B2 = 430, 300, 500; B3 = 1240; B4 = 430, 750.

Structure of Amylase Genes in Pacific Cupped Oyster 367

sence of regulatory sites for control of the expression of

gene A could be related to a genetically close location of the

2 genes on the chromosome, as in vertebrates (Pittet and

Schibler, 1985; Gumucio et al., 1988) given that pancreatic

and salivary amylase genes are located on the same chro-

mosome. In contrast, amylases are located on 2 different

chromosomes in Drosophila, in which up to 7 copies have

been detected, although these genes are arranged together

in 2 clusters (Da Lage et al., 1992).

Furthermore, the modulated level of expression of

each gene in the different tissues along the digestive tract

requires tissue-specific regulatory elements. PCR experi-

ments using primers located at each end of the 2 genes

failed to produce an intergenic spacer of limited size,

Table 3. Distribution of the AluI-Generated Alleles from A1A1 and B1B1 Homozygote Genotypes (as determined by EcoRI digestion)a

Allele % Allele %

A11-A11 52 B11-B11 70

A11-A12 3 B11-B12 4

A11-A13 22 B11-B13 4

A11-A14 16 B11-B14 4

A12-A13 3 B10-B10 4

A12-A14 3 B10-B11 12.5

A11 = 68, 295, 769, 61 B10 = nc

A12 = 68, 295, 543, 226, 61 B11 = 365, 819, 16

A13 = 363, 769, 61 B12 = 365, 51, 725, 43, 16

A14 = 68, 838, 226, 61 B13 = 260, 125, 51, 690, 43, 43, 16

B14 = 290, 100, 520, 230, 16

aTwenty-five homozygotes were selected randomly and digested by a second restriction enzyme (AluI). Results are expressed as percentages. Four different

profiles were determined for A1 and 5 for B1. Sizes of the produced fragments in the different profiles are given in base pairs.

Figure 4. Allelic frequencies of gene A microsatellite determined by size length in different populations. Sizes on graphs indicate PCR fragment

lengths and are given in base pairs. Msv is mean microsatellite value of repeat length with standard deviation.

368 D. Sellos et al.

confirming the proximity of the 2 genes on the same

chromosome. Distances between homologous genes

(which encode the same protein) may be important; 20

kb separates Amy1 and Amy2 in D. kikkawai (Inomata

and Yamazaki, 2000).

There is 94% overall identity of protein A with protein

B, 78% with another bivalve mollusk (Pecten maximus)

amylase (Le Moine et al., 1997), and 58% with human

amylase and winter flounder (Douglas et al., 2000). Only

36% to 41% similarity was found with insects and shrimp

amylases (Van Wormhoudt and Sellos, 1996). The same

level of amino acid changes (11.5%) was found between the

2 shrimp amylase variants. These changes are generally

expected through concerted evolution if the gene copies are

physically close to each other.

Interestingly, the fragment of 206 bp inserted into in-

tron 5 of allele 6 presented some homology with the se-

quence of Richettsia (Andersson et al., 1998). The presence

of this insertion in allele A6 in the individuals of the different

populations confirms their common origin. However, the

number of changes in the 2 sequences is in favor of an an-

cient recombination. It should be interesting, by comparison

with other populations, to estimate when this fragment was

introduced in the oyster genome. The presence of Rickettsia

in oysters was reported by Renault and Cochennec (1994), as

the insertion of a small DMA fragment of this bacteria could

be the mark of an ancient infection in crustacean popula-

tions before it caused large mortalities in oyster.

Tissue Expression

Both genes are transcribed at different apparent levels de-

pending on the tissue. The fact that gene A is preferentially

expressed in the digestive gland, and gene B in labial palps,

could be related to the existence of 2 different locations of

expression of the pancreatic and salivary genes, as is the

case in mammals. Preliminary results also indicate a high

level of expression of gene B in gills. This finding should be

confirmed and may be correlated with the function of

mammalian salivary amylases. Quantitative expression

should be followed in the different tissues of the oyster at

different stages of development to determine the ontology

of gene expression with regard to specific changes in diet

during development and metamorphosis. Localization of

amylase in the stomach has been previously reported by in

situ hybridization (Henry et al., 1993). Quantitative dif-

ferential expression was also reported in insects and ver-

tebrates (Hagenbuchle et al., 1980; Grossman et al., 1997).

The 2 amylase enzymes are likely to support different

catalytic activities, allowing the animal to adapt to

environmental constraints due to nutritional conditions. In

the amplified fragments, however, the alleles described

Table 4A. Variability Parameters for Microsatellite Gene A Locus in Each Population

Parametera Seudre Arcachon Bonne Anse Port des Barques

Nall 25 23 28 25

Ho 0.87 0.90 0.93 0.85

He 0.97 0.97 0.96 0.95

Fis 0.1b 0.08b 0.04 0.11b

Table 4B. Pairwise Fst Values Matrix and Statistical Tests for Microsatellite Data in Each Population

Population N Seudre Arcachon Bonne Anse Port des Barques

Seudre 40 0 0 0.008 0.009

Arcachon 51 0 0.011b 0.003

Bonne Anse 46 0 0.006

Port des Barques 46 0

aNumber of alleles (Nall), observed heterozygosity (Ho), gene diversity5 (He), Fis (F statistic of Wright, 1951) calculated according to Weir and Cockerham

(1984), which represents an estimate of departure from Hardy-Weinberg proportions. The significance of the Fis values was estimated by general

permutations (1000) of individual genotypes within each population.bSignificant at the P < 0.05 level.

Structure of Amylase Genes in Pacific Cupped Oyster 369

encode the same translated protein sequence for gene A.

However, 4 and 1 amino acid changes are observed in the

amplified sequence from alleles B2 and B3 compared with

B1, respectively. Amino acid substitutions between B alleles

were not found in any of the 5 highly conserved regions,

and it is likely that they have little influence on enzymatic

activity. Other regions, such as B3 strand which can confer

distinct isozyme-specific properties (Rodenburg et al.,

1994), should be studied. Progress in the characterization

of isozyme variants will provide useful information on the

genotype-phenotype relation.

Population Structure

The use of only one restriction enzyme is not enough for

studying different populations. Only 2.9% to 4.2% base

changes are detected between the different alleles, and the

use of 2 restriction enzymes allows the discrimination of

75% of the different alleles (Table 3). By using only one

restriction enzyme, 6 different haplotypes were recognized

for gene A. One of these haplotypes that was studied further

(A1) could be segregated into 4 different substructures by

using AluI, suggesting a high total number of alleles,

comparable to the results obtained with the microsatellite

marker. A systematic study of the different alleles should be

conducted in different oyster populations in relation to the

study of amylase properties and assimilation rates.

The level of microsatellite polymorphism, shown by

the number of alleles and the high gene diversity, was

higher than in most genetic studies using microsatellite

markers (Hansen et al., 1999) but in agreement with an-

other population genetics study conducted using such

markers in cupped oyster populations (Huvet et al., 2000).

The high levels of polymorphism observed are likely to be

related to the life history traits of most marine bivalves,

including large fecundity, external fertilization, broad larval

dispersal, and large effective population sizes.

When we used the microsatellite marker, the genetic

differentiation appeared low, possibly as a result of oyster

transplantation between the different French oyster-farming

areas. In addition to this anthropic action, gene flow can be

supposed to be high between close geographic locations

because of the planctonic larval phase of such marine biv-

alves. Indeed, sampled locations are separated by a maxi-

mum of 200 km and a minimum of 20 km. Nevertheless, a

significant genetic differentiation appeared between the

Bonne Anse and the Arcachon populations, as indicated by

the oriented repartition of the number of microsatellite re-

peats: the Bonne Anse population showing mean allelic size

lower than in the Arcachon population. In the same way, even

if the genetic differentiation (estimated with Fst index) was

not significantly different from 0, the mean size of micro-

satellite alleles was lower in the Bonne Anse population than

in the other populations (Seudre and Port des Barques).

Heterozygote deficiencies have been seen in many

studies based on allozyme markers on marine bivalves (Singh

and Green, 1984; Zouros3 and Foltz, 1984). A recent study in

the genus Crassostrea reported strong heterozygote defi-

ciencies at microsatellite loci, which can best be explained by

null alleles personal results. Our results concerning the

characterization of the microsatellite of gene A confirm this.

Null alleles were not detected by PCR because of a mutation

in the complementary sequence corresponding to the primer

or an artifact during amplification. Furthermore, in our data,

a few individuals showed no amplification at 1 of the 3 loci,

for which they were probably null homozygous. In these

cases, PCRs were repeated 3 times to verify that the results

were not due to experimental error. The best way to reduce or

eliminate these null alleles would be to design new primers.

ACKNOWLEDGMENTS

This study was supported by financial grants from IFR-

EMER and from the Conseil Regional Bretagne and Pays de

la Loire (PR Physiologie and GENEPHYS programme), and

the Conseil Regional de Bretagne and the Conseil General

du Finistere provided financial support for sequencing

equipment.

Note: The novel nucleotide sequences reported here

have been submitted to the EMBL Nucleotide Sequences

Database and have been allocated the following accession

numbers: AF320688, AF367494, ALIGN_000427 (gene A),

and ALIGN_000428 (gene B).

REFERENCES

Andersson, S.G., Zomorodipour, A., Andersson, J.O., Sicheritz-

Ponten, T., Alsmark, U.C., Podowski, R.M., Naslund, A.K.,

Eriksson, A.A.S., Winkler, H.H., and Kurland, C.G. (1998). The

genome sequence of Rickettsia prowazekii and the origin of mi-

tochondria. Nature 12:133–140.

Belkir, K., Borsa, P., Goudet, J., Chikhi, L., and Bonhomme, F.

(1996). Genetix, logiciel sous windows TM pour la genetique des

populations. Montpellier, France: Laboratoire Genome et Popu-

lations, CNRS UPR 9060, Universite de Montpellier II.

370 D. Sellos et al.

Boer, P.M., and Hickey, D.A. (1986). The alpha-amylase gene in

Drosophila melanogaster: nucleotide sequence, gene structure and

expression motifs. Nucleic Acids Res 14:8399–8411.

Cariou, M.L., and Da Lage, J.L. (1993). Isozymes polymorphisms.

In: Drosophila ananassae, Genetical and Biological Aspects, Tobari,

Y.N., ed. Tokyo: Japan Scientific Societies Press, 160–171.

Choi, J.I., and Yamazaki, T. (1994). Molecular analysis of cis-

regulatory sequences of the a-amylase gene in D. melanogaster: a

short 5¢-flanking region of Amy distal gene is required for full

expression of Amy proximal gene. Jpn J Genet 69:619–635.

Dainou, O., Cariou, M.L., Goux, J.M., and David, J.R. (1993).

Amylase polymorphism in Drosophila melanogaster: haplotype

frequencies in tropical African and American populations. Genet

Selection Evol 25:133–155.

Da Lage, J.L., Lemeunier, F., Cariou, M.L., and David, J.R. (1992).

Multiple amylase genes in Drosophila ananassae and related spe-

cies. Genet Res Camb 59:85–92.

Da Lage, J.L., Klarenberg, A., and Cariou, M.L. (1996). Variation

in sex-, stage- and tissue-specific expression of the amylase genes

in Drosophila ananassae. Heredity 76:9–18.

Da Lage, J.L., Van Wormhoudt, A., and Cariou, M.L. (2001).

Diversity and evolution of a-amylase genes in animals. Biologia

Bratislava 57(11).

FAO (1999). Year book of fisheries statistics. World aquaculture

production 88(2):178 p.

Douglas, S.E., Mandla, S., and Gallant, J.W. (2000). Molecular

analysis of the amylase gene and its expression during develop-

ment in the winter flounder, Pleuronectes americanus. Aquaculture

190:247–260.

Grossman, G.L., and James, A.A. (1993). The salivary gland of the

vector mosquito, Aedes aegypti; expressed a novel member of the

amylase gene family. Insect Mol Biol 1:223–232.

Grossman, G.L., Campos, Y., Severson, D.W., and James, A.A.

(1997). Evidence for two distinct members of the amylase gene

family in the yellow fever mosquito, Aedes aegypti. Insect Mol Biol

27:769–781.

Gumucio, D.L., Wiebauer, K., Caldwell, R.M., Samuelson, L.C.,

and Meisler, M.H. (1988). Concerted evolution of human amylase

genes. Mol Cell Biol 8:1197–1205.

Hagenbuchle, O., Bovery, R., and Young, R.A. (1980). Tissue-

specific expression of mouse a-amylase genes: nucleotide sequence

of isoenzyme mRNAs from pancreas and salivary gland. Cell

21:179-187.

Hansen, M.M., Mensberg, K.L.D., and Berg, S. (1999). Postglacial

recolonization patterns and genetic relationships among whitefish

(Coregonus sp.) populations in Denmark, inferred from mito-

chondrial DNA and microsatellite markers. Mol Ecol 8(2):239–

252.

Henry, M., Benlimane, N., Boucaud-Camou, E., Mathieu, M.,

Donval, A., and Van Wormhoudt, A. (1993). The amylase se-

creting cells of the stomach of the scallop, Pecten maximus, ul-

trastructural, immunohistochemical and immunocytochemical

characterizations. Tissue Cell 25:537–548.

Heral, M. (1989). Traditional oyster culture in France. Aquacul-

ture 1:342–387

Huvet, A., Lapegue, S., Magoulas, A., and Boudry, P. (2000).

Mitochondrial and nuclear DNA phylogeography of Crassostrea

angulata, the Portuguese oyster endangered in Europe. Conser-

vation Genet 1(3):251–262.

Inomata, N., and Yamazaki, T. (2000). Evolution of nucleotide

substitutions and gene regulation in the amylase multigenes in

Drosophila kikkawai and its sibling species. Mol Biol Evol

17(4):601–615.

Le Moine, S., Sellos, D., Moal, J., Daniel, J.Y., San Juan Serrano, F.,

Samain, J.F., and Van Wormhoudt, A. (1997). Amylase in Pecten

maximus (Mollusca, bivalves): protein and cDNA characteriza-

tion; quantification of the expression in the digestive gland. Mol

Mar Biol Biotechnol 6(3):228–237.

Moal, J., Daniel, J.Y., Sellos, D.Y., Van Wormhoudt, A., and Sa-

main, J.F. (2000). Amylase mRNA expression in Crassostrea gigas

during feeding cycles. J Comp Physiol B 170:21–26.

Nakamura, Y., Ogama, M., Nishida, T., Emi, M., Kosaki, G.,

Himeno, S., and Matsubara, K. (1984). Sequence of cDNAs for

human salivary and pancreatic a-amylases. Gene 28: 263–270.

Park, K.S., Song, J.I., Choe, B.L., and Kim, S.J. (1999). Amylase

polymorphism of Littorina brevicula from polluted and unpolluted

sites, Korea BULL. Environ. Contamination Toxicol 63:633–638.

Pittet, A.C., and Schibler, U. (1985). Mouse a-amylase loci; AMY-

1 and AMY-2, are closely linked. J Mol Biol 182:359–365.

Renault, T., and Cochennec, N. (1994). Rickettsia-like organisms

in the cytoplasm of gill epithelial cells of the Pacific oyster. J

Invertebrate Pathol 64(2):160–162.

Rodenburg, K.W., Juge, N., Guo, X.J., Sogaard, M., Chaix, J.C.,

and Svensson, B. (1994). Domain protruding at the third b strand

of the a/b barrel in barley a-amylase confers distinct isozyme-

specific properties. Eur J Biochem 221:277–284.

Shibata, H., and Yamazaki, T. (1995). Molecular evolution of the

duplicated Amy locus in the Drosophila melanogaster species

subgroup: concerted evolution only in the coding region and an

excess of nonsynonymous substitutions in speciation. Genetics

141:223–236.

Structure of Amylase Genes in Pacific Cupped Oyster 371

Singh, S.M., and Green, R.R. (1984). Excess of allozyme homo-

zygoty in marine molluscs4 and its possible biological significance.

Malacologia 25:569–581.

Unger, M.E., and Roesijadi, G. (1993). Sensitive assay for mol-

luscan metallothionein induction based on ribonuclease protec-

tion and molecular titration of metallothionein and actin mRNAs.

Mol Mar Biol Biotechnol 2(5):319–324.

Van Wormhoudt, A., and Sellos, D. (1996). Cloning and se-

quencing analysis of three amylase cDNAs in the shrimp Penaeus

vannamei (Crustacea Decapoda), evolutionary aspects. J Mol Evol

42:543–551.

Weir, B.S., and Cockerham, C.C. (1984). Estimating F-statistics

for the analysis of population structure. Evolution 38:1358–1370.

Wright, S. (1951). The genetical structure of populations. Annals

of eugenics 15:323–354.

Xu, B., Janson, J.-J., and Sellos, D. (2001). Cloning and sequencing

of a molluscan endo-B-1,4-glucanase gene from the blue mussel,

Mytilus edulis. Eur J Biochem 268:3718–3727.

Zouros, E., and Foltz, D.W. (1984). Minimal selection require-

ments for the correlation between heterozygoty and growth, and

for the deficiency of heterozygotes, in oyster populations. Dev

Genet 4:393–405.

372 D. Sellos et al.