Date post: | 21-Nov-2023 |
Category: |
Documents |
Upload: | independent |
View: | 0 times |
Download: | 0 times |
Supplemental Materials Include
(1) Supplemental Methods
(2) References used in Supplemental Materials
(3) Legends to Supplemental Figures
(4) Supplemental Figures 1-7
(5) Supplemental Tables 1-6
Supplemental Methods
In Vitro Methyltransferase Assay. In vitro methyltransferase activity assays were
carried out with the recombinant methyltransferases (full-length of SETD2 or NSD1-3)
or complexes (a trimeric EZH2-EED-SUZ12 complex of PRC2) by monitoring the tritium
incorporation from S-adenosylmethionine (3H-SAM) to the peptide substrates as
previously described(1).
Plasmid. MSCV retroviral expression vectors of MLL-AF9 and MLL-ENL were used as
described before(2). EZH1 construct was a gift from Dr. Vittorio Sartorelli.
Antibodies. Antibodies used in immunoblot include those against H3K27me3 (Millipore
07-449 and Abcam 6002, 1:5,000), H3K27me2 (Millipore 07-452, 1:5,000), H3K27me1
(Active Motif 39377, 1:5000), H3K27ac (Abcam 4729, 1:2,000), H3K4me3 (Abcam 8580
and Active Motif 39159, 1:5,000), H3K36me3 (Abcam 9095, 1:5,000), H3K36me1
(ab9048, 1:1,000); H3K36me2 (Active Motif 39255, 1:1,000), general H3 (Abcam 1791,
1:10,000), EZH2 (BD Biosciences 612666, 1:1,000), SUZ12 (Abcam 12073, 1:1,000),
and Tubulin (Sigma, 1:10,000). The antibodies used for ChIP-Seq are H3K27me3
(Millipore 07-449), H3K27ac (Abcam 4729) and SUZ12 (Abcam 12073).
Flow Cytometry Analysis. Single-cell suspension prepared from tissue culture or the
mouse bone marrow and spleen was stained with the diluted antibodies and analyzed
with a Beckman-Coulter CyAn ADP flow cytometer as previously described(2, 3). The
used antibodies include those against c-Kit (FITC, BD Pharmingen 553354), Gr-1 (PE,
BD Pharmingen 553128), Mac-1/Cd11b (APC, BD Pharmingen 557686), B220 (PE, BD
Pharmingen 553090), Ter119 (Biotin, eBioscience 13-5921), CD3e (Biotin, eBioscience
13-0031), and H3K27me3 (Cell Signaling 9733BF, custom-made and dissolved in PBS
instead of Tris buffer, followed by in-house conjugation to AlexaFlour-488 or AlexaFlour-
647 with AlexaFlour Antibody Labeling Kit [Life Technologies]). For the biotinylated
primary antibodies, we used an anti-Biotin antibody (PE, Miltenyi 130-090-756) for flow
analysis. All antibodies were used at 1:100–1:300 dilutions. Profiles of flow cytometry
were analyzed by the Summit 4.2 software according to manufacturer’s specification.
Assays of Cell Proliferation, Wright-Giemsa Staining and Apoptosis. All of the
used human cell lines were purchased from the ATCC or DSMZ Cell Bank and cultured
as recommended. Approximately 20,000 of cells were plated in triplets in the presence
of various concentrations of compounds at day 1, and the numbers of viable cells were
counted using a TC20 automated cell counter (BioRad) every 3-4 days. Medium
containing the compounds was refreshed every 2-3 days, and the cell concentration
was kept under 1-2 million per mL as recommended. Wright-Giemsa staining was
performed as previously described(4). Cell apoptotic assay was performed using the
Annexin V-FITC Early Apoptosis Detection Kit (Cell Signaling). Images of cell staining
were captured with an EVOS-XL Cell Imaging System (Life Technologies).
Colony Formation Unit (CFU) Assay. Approximately 200-500 leukemia progenitor
cells were initially plated in replicates in the methylcellulose medium (MethoCult™ GF
M3434; StemCell Technologies) pre-added with DMSO or compounds. For serial re-
plating, approximately 5,000-10,000 cells isolated from colonies in the previous plating
were seeded again in the same semi-solid medium. CFUs were scored by direct
quantification every 7-9 days post seeding. Identity of each colony was defined by
morphology according to manufacturer’s specification.
Cell Cycle Profiling. Exponentially dividing cells were seeded in the medium containing
either DMSO or compounds. A million of mock-treated versus compound-treated cells
were washed with ice-cold PBS and fixed in pre-chilled methanol (80%), followed by
staining with PBS added with 20 µg/ml propidium iodide (Sigma), 0.1% Triton-X100, and
200 µg/ml RNase A (Roche). DNA contents of cells were then detected with a CyAn
ADP flow cytometer (Beckman-Coulter), and then analyzed by ModFit Software (Verity
Software House).
Gene Knockdown. miR30-based shRNAs targeting EED (clone 1820) and Renilla
(control) were kindly provided by Dr. Chris Vakoc(5) and then sub-cloned into sites of
XhoI and EcoRI of an inducible shRNA expression system, TRMVP-IR(6) (pSIN-TRE-
dsRed-miR30-PGK-Venus-IRES-rtTA3, Addgene 27994). Cells were infected with
TRMPVIR virus and sorted based on Venus+ signals, following by treatment with
doxycycline (Sigma-Aldrich) at a final concentration of 2 µg/ml to induce shRNA
expression. Gene knockdown efficiency was determined by real time PCR.
Real-Time PCR. Reverse transcription was performed with random primers and the
cDNA Reverse Transcription kit according to the manufacturers protocols (Invitrogen
and Biorad). PCR amplicons (usually 80–150 bp) were designed to span over introns,
and quantitative PCR was performed in triplicate using the SYBR Green master mix
reagent on an ABI 7900 qPCR system (Applied Biosystems). The real-time PCR signals
are typically examined in triplicates and normalized to those of the β-Actin or Gapdh
gene.
ChIP Followed by Quantitative PCR (ChIP-qPCR). ChIP was performed using a
previously described protocol(3). ChIP signals were represented as a percentage of
input chromatin, and fold of enrichment was calculated by normalizing against signals of
nonspecific IgG.
ChIP-sequencing (ChIP-Seq) and Data Analysis. Briefly, all sequencing reads were
mapped to the mouse genome (mm9) using the BWA alignment software(7), and
unique reads mapped to a single best-matching location with no more than two
mismatches were kept, which were then subject to removal of reads generated by PCR-
caused duplicates using the Picard and Samtools. Profiles of ChIP-Seq read densities
were displayed in the Integrative Genomics Browser (IGB, Affymertrix) or Integrative
Genomics Viewer (IGV, Broad Institute). The MACS software(8) was used for peak
identification with data from input as controls and default parameters. In-house scripts
were used to assign peaks to promoter proximal (±2kb of transcription start site, TSS),
promoter distal (-50kb to -2kb of TSS), or gene body (+2kb of TSS to +2kb of
transcription end site), using the mouse RefSeq annotation as reference. In-house
scripts were also used to compute and compare ChIP-Seq reads across samples. The
CpG island annotation from the UCSC browser was used to associate H3K27me3
peaks to CpG islands. In all analyses, 1-bp intersection was considered as peak
overlapping, and unless specified otherwise, the peaks from mock treatment were used
as the base peaks for comparing data between mock and compound treatments. To
generate heatmaps of ChIP-Seq densities, reads from ChIP-Seq and input sequencing
were computed using a 100-bp window across the TSS (-10kb to +10Kb of TSS). After
normalization against the sequencing depths and the subtraction of the input from the
ChIP-Seq signals, the obtained data were used to generate heatmaps.
In Vivo Leukemia Assay and Compound Treatment Studies. The murine model of
MLL-rearranged leukemia was generated by retroviral delivery of MLL-AF9-IRES-GFP
into lineage-negative bone marrow stem/progenitor cells, followed by bone marrow
transplantation as previously described(2, 3). To generate the secondary leukemia, 2
million leukemia cells isolated from bone marrow were suspended in 200µl of sterile
PBS and intravenously introduced to the sub-lethally irradiated (300 Rads) syngeneic
Balb/c mice (12-week-old) by tail-vein injection. Leukemic development was assessed
by complete blood counting (CBC) of peripheral blood (HemaVet ® 950 LV CBC, Drew
Scientific Group) and treatment with UNC1999 was commenced on the day when the
counts in white blood cells (WBC) were found significantly elevated. The powder of
UNC1999 (verified by HPLC and mass spectrometry) was slowly dissolved and
incorporated to vehicle (0.5% of sodium carboxymethylcellulose [NaCMC] and 0.1% of
Tween-80 in sterile water) with continuous trituration by a pestle and mortar. After
transfer to a conical tube, the UNC1999-vehicle mixture was subject to vigorous vortex
and brief sonication to achieve a homogenous suspension at a formulation
concentration of 20 mg/mL. UNC1999 or vehicle control was administered orally twice
daily [BID] at a dose of 50 mg/kg. Mice were inspected daily, and complete blood counts
measured twice per week; mice exhibiting a terminal leukemia phenotype (lethargy,
splenomegaly and limb paralysis) were sacrificed, and cells isolated from leukemic
tissues were subjected to further pathological analysis as described before(2, 3).
All procedures pertaining to animal handling, care, and treatment were performed
according to guidelines approved by the Institutional Animal Care and Use Committee
(IACUC) of the University of North Carolina at Chapel Hill.
Chemistry Synthesis, Purification and Verification. HPLC spectra for all compounds
were acquired using an Agilent 6110 Series system with UV detector set to 254 nm.
Samples were injected (5 µL) onto an Agilent Eclipse Plus 4.6 x 50 mm, 1.8 µM, C18
column at room temperature. Method 1: A linear gradient from 10% to 100% B (MeOH +
0.1% acetic acid) in 5.0 min was followed by pumping 100% B for another 2 minutes
with A being H2O + 0.1% acetic acid. Method 2: A linear gradient from 50% to 100% B
(MeOH + 0.1% acetic acid) in 5.0 min was followed by pumping 100% B for another 2
minutes with A being H2O + 0.1% acetic acid. The flow rate was 1.0 mL/min. Mass
spectra (MS) data were acquired in positive ion mode using an Agilent 6110 single
quadrupole mass spectrometer with an electrospray ionization (ESI) source. Nuclear
Magnetic Resonance (NMR) spectra were recorded at Varian Mercury spectrometer
with 400 MHz for proton (1H NMR) and 100 MHz for carbon (13C NMR); chemical shifts
are reported in ppm (δ). Preparative HPLC was performed on Agilent Prep 1200 series
with UV detector set to 254 nm. Samples were injected onto a Phenomenex Luna 75 x
30 mm, 5 µΜ, C18 column at room temperature. The flow rate was 30 mL/min. A linear
gradient was used with 10% (or 50%) of MeOH (A) in 0.1 % TFA in H2O (B) to 100% of
MeOH (A). HPLC was used to establish the purity of target compounds, all compounds
had > 95% purity using the HPLC methods described above unless noted otherwise.
High-resolution (positive ion) mass spectrum (HRMS) for compound UNC1999 was
acquired using a Thermo LTqFT mass spectrometer under FT control at 100000
resolution.
Chemical Docking Studies. Docking of UNC1999 into the EZH2 apo crystal structure
(PDB: 4MI0) was performed using the Schrodinger Suite, release 2013-1-Maestro,
version 9.4 (Schrödinger, New York, NY). Specifically, glide standard precision docking
was used to obtain an initial conformation before selecting poses for energy
minimization. MacroModel was used to minimize the selected structures using the
OPLS-2005 force field and PRCG method of minimization as described before(9).
Scheme of Chemistry Synthesis used in the study
NN
OHO
Br
NOHNO
NN
Br N
B
NNBoc
OO
NNN
Boc
NN
HNO
NO
NNN
NN
HNO
NO
HNO
H2N
HNO
HN
Boc
HNO
HN
UNC1756 Route
UNC3142 Route
HNO
HNO
NN
Br
HNO
NO
NN
Br
HNO
NO
NN
Br N
B
NNBoc
OO
NNN
Boc
NN
NO
HNO
NNN
NN
NO
HNO
UNC3142
UNC1756
(a) (b) (c), (d)
(e) (f) (g)
(h) (i), (j)
Reagents and Conditions: (a) K2CO3, CH3-I, DMF, rt, 95%; (b) Pd(PPh3)4, K2CO3,
H2O:Dioxane, µ-wave, 150 0C, 60%; (c) TFA:DCM, rt; (d) Acetone, acetic
acid,NaBH3CN, MeOH, 0 0C à rt, 58%; (e) Di-tert-butyl dicarbonate, THF, rt, 97%; (f)
LAH, THF, reflux, 67%; (g) EDCI, HOBt, TEA, DMF, rt, 44%; (h) Pd(dppf)Cl2·DCM,
K2CO3, H2O:Dioxane, reflux, 76%; (i) TFA:DCM, reflux; (j) Acetone, AcOH, NaBH3CN,
MeOH, 0 0C à rt, 53%.
6-bromo-N-((1,6-dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1-
isopropyl-1H-indazole-4-carboxamide. 6-bromo-1-isopropyl-N-((6-methyl-2-oxo-4-
propyl-1,2-dihydropyridin-3-yl)methyl)-1H-indazole-4-carboxamide, prepared as
previously reported (10) (.100 g, .225 mmol) was dissolved in DMF (1 mL) and K2CO3
(.080 g, .579 mmol) was added to the reaction. The contents were stirred at RT for ~15
minutes before adding CH3-I (.050 mL, .803 mmol). The contents were then stirred at
RT overnight. After completion of the reaction the mixture was diluted with MeOH and
purified using HPLC to afford 6-bromo-N-((1,6-dimethyl-2-oxo-4-propyl-1,2-
dihydropyridin-3-yl)methyl)-1-isopropyl-1H-indazole-4-carboxamide (.096 g, .209 mmol,
93.2%) as a yellow solid. 1H NMR (400 MHz, cd3od) δ 8.33 (s, 1H), 8.02 (s, 1H), 7.62 (s,
1H), 6.23 (s, 1H), 4.95 (dt, J = 10.3, 6.6 Hz, 1H), 4.57 (s, 1H), 3.58 (s, 2H), 2.81 – 2.63
(m, 1H), 2.41 (s, 2H), 1.76 – 1.45 (m, 4H), 1.01 (t, J = 7.4 Hz, 2H). HPLC (method 1):
95%: tR = 5.850 min: MS (ESI): 459 [M+H]+.
NNN
Boc
NN
HNO
NO
tert-butyl 4-(5-(4-(((1,6-dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-
yl)methyl)carbamoyl)-1-isopropyl-1H-indazol-6-yl)pyridin-2-yl)piperazine-1-
carboxylate. 6-bromo-N-((1,6-dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-
1-isopropyl-1H-indazole-4-carboxamide, (.096 g, .209 mmol) was dissolved in 2 mL
H2O:Dioxane (1:5) in a microwave vessel, and then added tert-butyl 4-(5-(4,4,5,5-
tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-yl)piperazine-1-carboxylate, prepared as
previously reported[2], (.1 g, .256 mmol), K2CO3 (.088 g, .639 mmol), and
Tetrakis(triphenylphosphine)palladium(0) (.05 eq, ~2 mg). The mixture was then placed
in a microwave reactor for 20 minutes at 150 0C. The crude product was separated
using Brine:EA, washing 3x with EA. The organic layers were combined, dried with
Na2SO4, concentrated in vacuo, and purified using HPLC to yield tert-butyl 4-(5-(4-(((1,6-
dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)carbamoyl)-1-isopropyl-1H-
indazol-6-yl)pyridin-2-yl)piperazine-1-carboxylate as a white powder (.082 g, .128 mmol,
60.1%). 1H NMR (400 MHz, cd3od) δ 8.46 – 8.30 (m, 1H), 8.09 – 7.98 (m, 1H), 7.84 –
7.69 (m, 1H), 7.45 – 7.30 (m, 1H), 6.32 – 6.18 (m, 1H), 5.19 – 4.97 (m, 1H), 4.61 (s,
1H), 3.85 – 3.63 (m, 4H), 3.57 (s, 2H), 2.81 – 2.67 (m, 1H), 2.41 (s, 2H), 1.70 – 1.54 (m,
4H), 1.51 (s, 4H), 1.02 (t, J = 7.3 Hz, 2H). HPLC (method 1): 95%: tR = 6.176 min: MS
(ESI): 642 [M+H]+.
N-((1,6-dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1-isopropyl-6-(6-
(4-isopropylpiperazin-1-yl)pyridin-3-yl)-1H-indazole-4-carboxamide (UNC3142).
tert-butyl 4-(5-(4-(((1,6-dimethyl-2-oxo-4-propyl-1,2-dihydropyridin-3-
yl)methyl)carbamoyl)-1-isopropyl-1H-indazol-6-yl)pyridin-2-yl)piperazine-1-carboxylate
(.040 g, .062 mmol) was dissolved in DCM (0.25 mL) and added TFA (0.25 mL). The
reaction was stirred for ~2 hours until complete. Then, the contents were concentrated
in vacuo, dissolved in MeOH (0.40 mL), and placed in an ice bath. Acetone (.058 mL,
0.79 mmol) and acetic acid (.045 mL, 0.79 mmol) were then added to the reaction. After
cooling to 0 0C, NaBH3CN (.025 g, 0.40 mmol) was added and the reaction was stirred
for 15 minutes. Then the ice bath was removed and the contents were allowed to warm
to RT overnight. After completion, the MeOH was removed in vacuo and the crude
product was isolated by separating with EA:Brine, 3x EA washes. The organic layers
were combined, dried with Na2SO4, and purified using HPLC to give N-((1,6-dimethyl-2-
oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1-isopropyl-6-(6-(4-isopropylpiperazin-1-
yl)pyridin-3-yl)-1H-indazole-4-carboxamide as a brown oil (.021 g, .036 mmol, 58.1%).
1H NMR (400 MHz, cdcl3) δ 8.49 (d, J = 2.2 Hz, 1H), 8.39 (s, 1H), 7.80 (td, J = 8.8, 4.2
Hz, 1H), 7.69 (s, 1H), 7.58 (s, 1H), 6.73 (d, J = 8.8 Hz, 1H), 5.97 (s, 1H), 4.88 (s, 1H),
4.65 (d, J = 5.9 Hz, 1H), 3.68 (s, 2H), 3.53 (s, 2H), 3.04 – 2.45 (m, 4H), 2.32 (s, 2H),
1.72 – 1.52 (m, 5H), 1.25 (s, 3H), 1.14 (d, J = 6.0 Hz, 3H), 1.02 (s, 2H). HPLC (method
1): 95%: tR = 4.635 min: MS (ESI): 585 [M+H]+.
tert-butyl ((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)carbamate. 3-
(aminomethyl)-6-methyl-4-propylpyridin-2(1H)-one (1.00 g, 5.60 mmol), prepared as
previously reported(10), was dissolved in THF (20.0 mL) and added di-tert-butyl
dicarbonate (1.22 g, 5.60 mmol). The mixture was then stirred at RT for 4 hours. After
completion, the contents were separated with ethyl acetate (3X) and brine. The organic
layers were combined, dried with Na2SO4, and concentrated in vacuo. The crude
product was then used for the next step (1.50 g, 97%).
6-methyl-3-((methylamino)methyl)-4-propylpyridin-2(1H)-one. tert-butyl ((6-methyl-
2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)carbamate (0.70 g, 2.50 mmol) was
dissolved in THF (50.0 mL) and a solution of LAH (0.95 mg, 25.0 mmol) in THF (50.0
mL) was added to the mixture dropwise; the mixture was heated to reflux for 4 hours.
After completion, the contents were cooled to 0 0C, added 0.5 N NaOH, and extracted
with ethyl acetate 3x. The organic layers were combined, dried with Na2SO4, and
combined to give 6-methyl-3-((methylamino)methyl)-4-propylpyridin-2(1H)-one (.332 g,
67% yield) as a yellow oil. 1H NMR (300 MHz, cdcl3) δ 5.891 (s, 1H), 3.659 (s, 2H),
2.520-2.494 (m, 2H), 2.418 (s, 3H), 2.256(s, 3H), 1.565-1.514 (m, 2H), 0.980-0.931 (t,
3H, J=7.2 Hz).
6-bromo-1-isopropyl-N-methyl-N-((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-
yl)methyl)-1H-indazole-4-carboxamide. 6-methyl-3-((methylamino)methyl)-4-
propylpyridin-2(1H)-one (.232 g, 1.18 mmol) was dissolved in DMF (10.0 mL) and
added 6-bromo-1-isopropyl-1H-indazole-4-carboxylic acid (.330 g, 1.18 mmol), prepared
as previously reported(10), EDCI (.338 g, 1.77 mmol), HOBt (.239 g, 1.77 mmol) and
TEA (0.49 mL). The reaction was then stirred at room temperature overnight. The
contents were diluted with H2O, stirred for 1 hour, and then filtered to collect a yellow
solid. The product was then washed with H2O and DEE to give 6-bromo-1-isopropyl-N-
methyl-N-((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1H-indazole-4-
carboxamide (.230 g, 44%) as a white solid. 1H NMR (300 MHz, cdcl3), (Rotamers), δ
13.137 (m, 1H), (8.072, 7.945) (s, 1H), (7.634, 7.489) (s, 1H), 7.275-7.270 (m, 1H),
5.999(s. 1H), 4.766-4.743(m, 2H), 2.905(s, 3H), 2.712-2.661 (t, 2H, J=7.6 Hz), 2.15 (s,
3H, ), 1.552(m, 8H), 1.042-0.993 (t, 3H J=7.4 Hz).
tert-butyl 4-(5-(1-isopropyl-4-(methyl((6-methyl-2-oxo-4-propyl-1,2-
dihydropyridin-3-yl)methyl)carbamoyl)-1H-indazol-6-yl)pyridin-2-yl)piperazine-1-
carboxylate. 6-bromo-1-isopropyl-N-methyl-N-((6-methyl-2-oxo-4-propyl-1,2-
dihydropyridin-3-yl)methyl)-1H-indazole-4-carboxamide (.152 g, 0.33 mmol) was
dissolved in a mixture of 5 mL H2O:Dioxane (1:5) and then tert-butyl 4-(5-(4,4,5,5-
tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-yl)piperazine-1-carboxylate (.142 g, .364
mmol), prepared as previously reported (1), and KOAc (.098 g, 1.00 mmol) were added
to the flask. The mixture was purged and placed under argon atmosphere and added
1,1'-Bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex
(.027 g, .033 mmol), and the reaction was heated to reflux for 5 hours. After
completion, the contents were cooled, diluted with EtOAc, washed with H2O, and dried
over Na2SO4. The crude product was then concentrated and prepared for silica
chromatography with (DCM/MeOH = 40/1) to give tert-butyl 4-(5-(1-isopropyl-4-
(methyl((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)carbamoyl)-1H-
indazol-6-yl)pyridin-2-yl)piperazine-1-carboxylate (.175 g, 76%) as a white solid. 1H
NMR (300 MHz, cdcl3), (Rotamers), δ 8.48 (s, 1H), (8.106, 7.944) (s, 1H), 7.803-
7.775(m, 1H), 7.508-7.389(m, 3H), 6.752-6.723(d, 1H, J=8.7 Hz), (5.990, 5.819) (s,
1H), 4.907(s, 2H), 3.590-3.582(m, 7H), (3.066, 2.935) (s, 3H), 2.712-2.685 (m, 1H),
2.289(s. 4H), 1.601-1.580(m, 8H), 1.489(s, 9H), 1.042-0.995 (t, 3H J=7.0 Hz).
1-isopropyl-6-(6-(4-isopropylpiperazin-1-yl)pyridin-3-yl)-N-methyl-N-((6-methyl-2-
oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1H-indazole-4-carboxamide
(UNC1756). tert-butyl 4-(5-(1-isopropyl-4-(methyl((6-methyl-2-oxo-4-propyl-1,2-
dihydropyridin-3-yl)methyl)carbamoyl)-1H-indazol-6-yl)pyridin-2-yl)piperazine-1-
carboxylate (.173 g, 2.96 mmol) was dissolved in DCM (2.0 mL) and added an XS of
TFA. The product (.042 g, .010 mmol) was concentrated in vacuo, dissolved in MeOH
(5.0 mL), and placed in an ice bath. Acetone (1.0 mL, 13.6 mmol) and acetic acid (.065
mL, 1.10 mmol) were then added to the reaction. After cooling to 0 0C, NaBH3CN (.034
g, 0.54 mmol) was added and the reaction was stirred for 15 minutes. Then the ice
bath was removed and the contents were allowed to warm to RT overnight. After
completion, the MeOH was removed in vacuo and the crude product was isolated by
separating with DCM:Brine, 3x DCM washes. The organic layers were combined, dried
with Na2SO4, and purified using HPLC to give 1-isopropyl-6-(6-(4-isopropylpiperazin-1-
yl)pyridin-3-yl)-N-methyl-N-((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-
1H-indazole-4-carboxamide as a brown oil (.023 g, .393 mmol, 53%). 1H NMR (300
MHz, cdcl3), (Rotamers), δ 8.48 (s, 1H), (8.106, 7.944) (s, 1H), 7.803-7.775(m, 1H),
7.508-7.389(m, 3H), 6.752-6.723(d, 1H, J=8.7 Hz), (5.990, 5.819) (s, 1H), 4.907(s,
2H), 3.590-3.582(m, 7H), (3.066, 2.935) (s, 3H), 2.712-2.685 (m, 1H), 2.289(s. 4H),
1.601-1.580(m, 8H), 1.489(s, 9H), 1.042-0.995 (t, 3H J=7.0 Hz).
Reference: 1. K. D. Konze et al., An Orally Bioavailable Chemical Probe of the Lysine Methyltransferases EZH2
and EZH1. ACS Chem Biol, (2013). 2. G. G. Wang, L. Cai, M. P. Pasillas, M. P. Kamps, NUP98-‐NSD1 links H3K36 methylation to Hox-‐A
gene activation and leukaemogenesis. Nature cell biology 9, 804-‐812 (2007). 3. G. G. Wang et al., Haematopoietic malignancies caused by dysregulation of a chromatin-‐binding
PHD finger. Nature 459, 847-‐851 (2009). 4. G. G. Wang, M. P. Pasillas, M. P. Kamps, Meis1 programs transcription of FLT3 and cancer stem
cell character, using a mechanism that requires interaction with Pbx and a novel function of the Meis1 C-‐terminus. Blood 106, 254-‐264 (2005).
5. J. Shi et al., The Polycomb complex PRC2 supports aberrant self-‐renewal in a mouse model of MLL-‐AF9;Nras(G12D) acute myeloid leukemia. Oncogene 32, 930-‐938 (2013).
6. J. Zuber et al., Toolkit for evaluating genes required for proliferation and survival using tetracycline-‐regulated RNAi. Nat Biotechnol 29, 79-‐83 (2011).
7. H. Li, R. Durbin, Fast and accurate long-‐read alignment with Burrows-‐Wheeler transform. Bioinformatics 26, 589-‐595 (2010).
8. Y. Zhang et al., Model-‐based analysis of ChIP-‐Seq (MACS). Genome Biol 9, R137 (2008). 9. E. R. Polak, G, Note sur la Convergence de Méthodes de Directions Conjuguées. Revenue
Francaise Informat. Recherche Operationelle, Serie Rouge 16, 35 (1969). 10. S. K. Verma, Tian, X., LaFrance, L. V., Duquenne, C., Suarez, D. P., Newlander, K. A., Romeril, S. P.,
Burgess, J. L., Grant, S. W., Brackley, J. A., Graves, A. P., Scherzer, D. A., Shu, A., Thompson, C., Ott, H. M., Aller, G. S. V., Machutta, C. A., Diaz, E., Jiang, Y., Johnson, N. W., Knight, S. D., Kruger, R. G., McCabe, M. T., Dhanak, D., Tummino, P. J., Creasy, C. L., and Miller, W. H. , Identification of Potent, Selective, Cell-‐Active Inhibitors of the Histone Lysine Methyltransferase EZH2. ACS Med Chem Lett 3, 1091-‐1096 (2012).
11. H. R. Jung, D. Pasini, K. Helin, O. N. Jensen, Quantitative mass spectrometry of histones H3.2 and H3.3 in Suz12-‐deficient mouse embryonic stem cells reveals distinct, dynamic post-‐translational modifications at Lys-‐27 and Lys-‐36. Mol Cell Proteomics 9, 838-‐850 (2010).
Supplemental Figure Legends
Supplemental Figure 1. A small-molecule UNC1999, and not its inactive analog
UNC2400, selectively and potently suppresses H3K27me3/2.
(A) A docking model of UNC1999 (green) with the SET domain of EZH2 (blue; PDB:
4MI0) revealing that the backbone carbonyl and backbone amide nitrogen of H688 and
the side chain amide nitrogen of N689 in EZH2 form hydrogen bonds (red dotted lines)
with the acyclic amide and pyridone of UNC1999.
(B) Scheme of chemical synthesis of UNC3142 and UNC1756, with either position of
R1 and R2 (shown in main Figure 1A-B) modified by a single N-methyl group.
(C-D) Summary of relative abundances of the H3(27-40) peptide species bearing dual
methylation of H3K27 and H3K36me1 (panel C) or H3K36me2 (panel D) after the
indicated compound treatments as measured by mass spec (data shown in
Supplemental Table 1). Panels underneath plot show H3K27 ‘demethylation’ effect by
UNC1999, which explain the observed increases in peptide species that contain
H3K36me1 or H3K36me2 alone (shown in blue in bar graph; UNC1999 versus DMSO
or UNC2400).
(E) Relative abundances of peptides with dual methylation of H3K27 and H3K36me2 in
Suz12-/- versus wild-type ES cells as shown by mass spec analysis in a previously
published work(11). Panels underneath plot explain the observed increases in peptide
species that contain H3K36me2 alone (shown in blue in bar graph; Suz12-/- versus wt).
(F) The overall level of H3K36me2, H3K36me1, or un-modified H3K36 after compound
treatments by combining the relative abundances of all the H3(27-40) peptide species
containing each of these modifications (as measured by mass spec, Supplemental
Table 1).
(G) Immunoblots of H3K36me2 and H3K36me1 after treatment with 3 µM of compound
for the indicated duration. hr, hour; d, day.
(H-K) Effect of a wide range of concentrations of UNC1999 on in vitro methylation
mediated by four different H3K36-specific methyltransferases—SETD2 (panel H), NSD1
(panel I), NSD2 (panel J) and NSD3 (panel K). Y-axis represents the relative
percentage of enzyme activities after normalization to mock.
(L-M) Summary of H3K27me3 levels, as quantified by flow cytometry analysis, in EOL-1
human leukemia cells and MLL-ENL-transformed murine leukemia cells after treatment
with DMSO, or 2 µM of UNC2400 or UNC1999 for the indicated duration. Y-axis
represents the mean (white) and medium (black) value of H3K27me3 signals. d, days of
treatment.
(N) Flow cytometry analysis of H3K27me3 in MLL-ENL-transformed murine leukemia
cells after the indicated treatment.
(O-P) Immunoblots show the total cellular level of PRC2 components (EZH2 and
SUZ12) in MLL-AF9- (panel O) or MLL-ENL-transformed (panel P) leukemia cells after
treatment with 2 µM of compounds. Tubulin and total histones serve as control.
Supplemental Figure 2. UNC1999, but not GSK126 and UNC2400, efficiently
suppresses inhibits growth of MLL-rearranged leukemia cells.
(A) Flow cytometry analysis of H3K27me3 in DB lymphoma cells treated with different
concentrations of GSK126 (top) or UNC1999 (bottom) for 4 days.
(B-C) Relative proliferation of an MLL-AF9-transformed murine leukemia progenitor line
(m-MLL-AF9-puro) treated with a range of concentrations of GSK126 (panel B) or
UNC1999 (panel C) for 3, 6, 9 or 12 days. Y-axis represents the percentage of the total
number of cells after normalization to DMSO treatment, and is presented as the mean
of triplicates ± stdev.
(D-E) Relative proliferation of two independent MLL-AF9-transformed leukemia lines (m-
MLL-AF9-puro and m-MLL-AF9-GFP) after a 6-day (panel D) or 12-day (panel E)
treatment with various concentrations of UNC1999 or GSK126. Y-axis represents the
relative proliferation after normalization to DMSO treatment. *, p<0.05; **, p<0.01; ns,
not statistically significant.
(F) Signal intensities extracted from microarray studies showing EZH2, EZH1, EED and
SUZ12 gene expression levels in different MLL-AF9-transformed murine leukemia
progenitors.
(G-I) Relative proliferation of MLL-AF9- (panel G) or MLL-ENL-transformed (panel H)
murine leukemia cells and EOL-1 human leukemia cells (panel I) treated with various
concentrations of UNC1999. Y-axis represents the percentage of the total cell number
normalized to DMSO treatment and presented as the mean of triplicates ± SD.
Supplemental Figure 3. UNC1999, and not UNC2400, promotes differentiation,
suppresses colony formation, and induces apoptosis in MLL-rearranged leukemia
cells.
(A) Light microscopy of Wright-Giemsa staining of MLL-ENL-transformed murine
leukemia progenitors treated with the indicated concentration of UNC1999 for 8 days.
(B) Flow cytometry analysis of Cd11b in MLL-AF9-transformed murine leukemia cells
after treatment with 3 µM of UNC1999 (red) or UNC2400 (blue) for 8 days.
(C) Summary of percentage of live and early or late apoptotic populations of MLL-ENL-
or MLL-AF9-transformed murine leukemic progenitors after the indicated treatment with
DMSO, UNC1999 or UNC2400 for 6 days.
Supplemental Figure 4. UNC1999, and not UNC2400, de-represses the defined
Polycomb target genes.
(A) Summary of the up-regulated (blue) and down-regulated (red) transcripts in two
independent MLL-AF9-transformed leukemia lines following a 5-day treatment with 3
µM of UNC1999 versus control compounds or after knockdown of EED (shEED) or
Renilla (shRen), as identified by microarray analysis with a cut-off of fold-change (FC) of
>1.5 and p value of <0.05.
(B) RT-qPCR detecting the expression of EED six days post induction of an EED-
specific shRNA (shEED) versus control shRNA against Renilla (shREN). ***, p<0.001.
(C) Venn diagram of the up-regulated transcripts shown in panel A.
(D-E) GSEA reveals significant enrichment of H3K27me3+/H3K4me3+ bivalent genes
(panel D) and H3K27me3-positive genes (panel E) in UNC1999-treated versus DMSO-
treated samples.
(F) Gene Ontology (GO) analysis revealing significant enrichment of the indicated gene
pathway in the transcripts up regulated by UNC1999 versus DMSO.
Supplemental Figure 5. Re-activation of the Cdkn2a locus plays a critical role in
UNC1999-mediated growth inhibition.
(A) RT-qPCR showing that UNC1999-mediated de-repression of p16Ink4a and p19Arf
is dose-dependent in MLL-AF9-immortalized leukemia cells. d, days of treatment. *,
p<0.05; **, p<0.01; ns, not significant.
(B) Representative histograms of DNA contents, as measured by propidium iodide (PI)
staining, in MLL-ENL-transformed murine leukemia cells after 8-day treatment with 3 µM
of compound.
(C) Following UNC1999 treatment, RT-qPCR shows lack of p16Ink4a and p19Arf gene
expression in two p16Ink4a-/-;p19Arf-/- progenitor lines transformed by MLL-AF9 in
contrast to their wild-type counterparts.
Supplemental Figure 6. ChIP-Seq reveals UNC1999-induced loss of H3K27me3
and concurrent gain of H3K27ac in MLL-AF9-transformed leukemia progenitors.
(A-C) IGB view of the distribution of ChIP-Seq read densities (normalized by the ChIP-
seq read depths) for input (black), H3K27me3 (red), H3K27ac (blue) or SUZ12 (purple)
at the HoxA gene cluster and Evx1 (panel A), Bcl11a (panel B) and Fzd3 (panel C) in
MLL-AF9-transformed leukemia progenitors after treatment with DMSO or 3µM of
UNC2400 or UNC1999 for 4 days.
(D) Boxplots showing a significant reduction in the H3K27me3 ChIP-Seq signals after
treatment with UNC1999, especially at the H3K27me3 peaks located at non-promoter
regions (distal enhancers and intergenic regions). ChIP-Seq read densities were
normalized against sequencing depths, followed by a comparison between those
obtained from mock-, UNC1999-, or UNC2400-treated samples.
(E) The fractions of SUZ12 peaks showing reduction in ChIP-Seq signals by 1.5-fold or
more in UNC1999-treated (red circle) or UNC2400-treated (cross) samples in
comparison to mock treatment. The SUZ12 peaks and their densities shown on X-axis
were first defined and then grouped by the number of ChIP-Seq reads identified in the
mock-treated sample; Y-axis represents the fraction in each group of SUZ12 peaks that
show reduction in ChIP-Seq reads by 1.5-fold or more in the compound-treated samples
in comparison to mock treatment, after normalization of ChIP-Seq reads to the
sequencing depths and peak sizes.
(F) IGB view of the distribution of SUZ12 (purple) ChIP-Seq read densities (normalized
by the ChIP-seq read depths) across the Cdkn2a/b locus.
(G) Quality control of H3K27ac ChIP showing the high and undetectable H3K27ac
signals at TSS of the active β-actin gene and a silenced intergenic locus on
chromosome 8 (chr8_int), respectively.
Supplemental Figure 7. UNC1999 prolongs survival of MLL-AF9 induced myeloid
leukemia in vivo.
(A) Summary of the counts of pellets as measured by complete blood counting of
peripheral blood cell from the vehicle- and UNC1999-treated leukemic mice at the
indicated date post-transplantation.
(B) Summary of quantifications of the cell cycle status of cells isolated from bone
marrow or spleen of each individual examined leukemic mouse from either the vehicle-
(LV) or UNC1999-treated (LT) cohorts.
(C-D) Representative flow cytometry profiles of leukemia cell population (labeled by the
bicistronic GFP-expression in x-axis) and Mac-1 (y-axis) in the bone marrow (BM) or
spleen (SP) of MLL-AF9-induced leukemic mice after treatment with either vehicle or
50mg/kg UNC1999.
UNC1999 (7d) (4d)
UNC2400 (4d;7d)DMSO (4d;7d)
0
500
1000
1500
DMSO 2d
DMSO 5d
DMSO 7d
UNC24
00 4d
UNC24
00 7d
UNC19
99 2d
UNC19
99 4d
UNC19
99 5d
UNC19
99 7d
H3K
27m
e3 le
vels
(a
rbitr
ary
fluor
esce
nce
units
)
EOL-1 mean median
0
400
800
1200
H3K
27m
e3 le
vels
(a
rbitr
ary
fluor
esce
nce
units
)
C D E F
Supplemental Figure S1
-EZH2
-tubulin
DMSO 3d
UNC2400 3d
UNC1999 3d
DMSO 5d
UNC1999 5d
A B
H I J K
UNC1756
UNC3142
0 10 20 30 40 50 60 70 80
H3K36me2 H3K36me1 H3K36unmodified
DMSO UNC2400 UNC1999
fo segatnecrep llarevO
seditpep gniniatnoc-63K3
H
6hr d1 d2 d4 UNC1999
DM
SO
total H3
α-H3K36me1
α-H3K36me2
0%
20%
40%
60%
80%
100%
K27(me3)SAPATGGVK36(me1)KPHR
K27(me2)SAPATGGVK36(me1)KPHR
K27(me1)SAPATGGVK36(me1)KPHR
KSAPATGGVK36(me1)KPHR
UNC1999
UNC1999
UNC1999
UNC1999(2 replicates) D
MS
O
UN
C24
00
ecnadnubA evitale
R
K27(me3)SAPATGGVK36(me2)KPHR
K27(me2)SAPATGGVK36(me2)KPHR
K27(me1)SAPATGGVK36(me2)KPHR
KSAPATGGVK36(me2)KPHR
UNC1999(2 replicates)
UNC1999
UNC1999
UNC1999
H3(27-40) peptides with K36me2
H3(27-40) peptides with K36me1
G
MLL-ENL (murine)
WT Suz12-/-
K27(me3)SAPATGGVK36(me2)KPHR
K27(me2)SAPATGGVK36(me2)KPHR
KSAPATGGVK36(me2)KPHR
Suz12-/-
Suz12-/-
H3.2(27-40) peptides with K36me2
N692V691
S690
H689
N688
V621
A622
W624
G623
F686
F665L666F667
N668
L669
D725
R727
Y726F724
α-Tubulin
DMSO
UNC1999
α-EZH2
α-SUZ12
Total histone
α-H3K27me3
DM
SO
0042C
NU
0%
20%
40%
60%
80%
100% ecnadnubA evitale
R
0%
20%
40%
60%
80%
100% ecnadnubA evitale
R
DMSO 4d
DMSO 7d
UNC24
00 4d
UNC24
00 7d
UNC19
99 4d
UNC19
99 5d
UNC19
99 7d
L M O
N P
mumixa
m %
FACS signal intensity
mean median
A B C
D E F
G H I
Supplemental Figure S2
m-MLL-ENL
0%
20%
40%
60%
80%
100%
EOL-1
0%
20%
40%
60%
80%
100%
120%
m-MLL-AF9 (puro) : UNC1999
)detaert-O
SM
D . sv( noit ar efil orP
%
m-MLL-AF9 (puro) : GSK126
d4 d8 d12 d16
0%
20%
40%
60%
80%
100%
d4 d8 d12 d16
d3 d6 d9 d12
nsns ns
ns **
**
*
**
**
**
**
2 /1 /0.5 μM DMSO
2 /1 /0.5 μM DMSO
100 mumixa
m %
mumixa
m %
75
50
25
0
100
75
50
25
0
DB(UNC1999)
DB(GSK126)
101 102 10
101 102 10
m-MLL-AF9 (puro)
m-MLL-AF9 (GFP)
GSK126UNC1999 GSK126UNC1999
0%
20%
40%
60%
80%
100%
120%
0.1μM 0.25μM 0.5μM 1μM 2μM 3μM
Day 12
ns nsns ns
***** **
*** *** **
**ns
UNC1999 (μM)0 0.1 1 10
noitarefil orP
% ) det aert-
OS
MD . sv(
100
80
60
40
20
0
m-MLL-AF9
d3 d6 d9 d120%
20%
40%
60%
80%
100%
120%
m-MLL-AF9 (puro)
m-MLL-AF9 (GFP)
GSK126UNC1999 GSK126UNC1999
0%
20%
40%
60%
80%
100%
120%
0.1μM 0.25μM 0.5μM 1μM 2μM 3μM
Day 6
FACS signal intensity
noitarefil orP evit al e
R
noit ar efil orP evit al e
R 0
1000
2000
3000
4000
Ezh2 Ezh1 Eed Suz12 sl eveL noi sser px
E eneG
FACS signal intensity
)detaert-O
SM
D . sv( noit ar efil orP
%
noit ar efil orP
% ) det aert-
OS
MD . sv(
noit ar efil orP
% ) det aert-
OS
MD . sv(
m-MLL-AF9 (six arrays)
3
3
0.10 μM 0.25 μM 0.50 μM 1 μM 2 μM 3 μM
0.10 μM 0.25 μM 0.50 μM 1 μM 2 μM 3 μM
0.10 μM 0.25 μM 0.50 μM 1 μM 2 μM 3 μM
0.10 μM 0.25 μM 0.50 μM 1 μM 2 μM 3 μM
DMSO 3μM UNC1999 2μM UNC1999 0.5μM UNC1999
mumixa
m %
Cd11b
A B
0%
20%
40%
60%
80%
100%
DM
SO
U
NC
2400
3μ
M
0.1μ
M
0.25
μM
1μ
M
2μM
3μ
M
DM
SO
U
NC
2400
3μ
M
UN
C19
99 3μ
M
early apoptotic alive
UNC1999
MLL-ENL MLL-AF9
egatnecreP lle
C
late apoptotic
Supplementary Figure S3
C
DMSOUNC1999
A B C
D E
F
Supplemental Figure S4N
umbe
r of G
enes
Up Down
FC >1.5; p < 0.05
-8 -7 -6 -5 -4 -3 -2 -1 0
regulation of myeloid cell differentiation regulation of erythrocyte differentiation eosinophil fate commitment myeloid cell development tissue development stem cell development regulation of cell differentiation organ development cell morphogenesis cell differentiation regulation of hemostasis negative regulation of cell proliferation developmental process regulation of developmental process negative regulation of cellular process multicellular organismal development regulation of multicellular organismal development cell morphogenesis involved in differentiation cell development nervous system development regulation of multicellular organismal process system development anatomical structure development
Log10 (p value)
MEISSNER_NPC_WITH_H3K4ME3_AND_H3K27ME3
0.20
0.40
0.00
NES = 1.412p = 0.064FDR q = 0.245
erocS tne
mhcirnE
UNC1999 controlenrichment profile hits
shEED vs
shRen
UNC1999 vs
UNC2400 UNC1999
vs DMSO
1
594 668
362
0
136 170
46
0
100
200
300
400
500
600
700
800
UNC2400 vs DMSO
UNC1999 vs DMSO
UNC1999 vs UNC2400
shEED vs shRen
ACEVEDO_LIVER_CANCER_WITH_H3K27ME3_UP
0.20
0.40
0.00
NES = 1.357p = 0.000FDR q = 0.235
erocS tne
mhcirnE
UNC1999 controlenrichment profile hits
0
2
4
6
8
10
shREN shEED
EED
Rel
ativ
e ex
pres
sion
(n
orm
aliz
ed b
y G
AP
DH
)
***
0
100
200
300
400
Arb
itrar
y m
RN
A le
vels
G0-G1 (54.4%) G0-G1 (65.5%)G0-G1 (53.7%)
G2-M (3.5%) G2-M (5.0%) G2-M (1.8%)S (42.1%) S (41.3%) S (32.7%)
DNA content DNA content DNA content
WT
Ink4a-/-;Arf-/-
WT
Ink4a-/-;Arf-/-
A B
C
Supplemental Figure S5
Cel
l cou
nt n
umbe
r
UNC1999UNC2400DMSO
Fold
cha
nge
in g
ene
expr
essi
on
(nor
mal
ized
to D
MS
O)
UNC1999; 7d
0 5
10 15 20 25 30 35 40
DMSO 0.25 M 1.25 M 2 M 3 M
p16Ink4a p19Arf
**
**
**
**
**
ns ns ns
p16Ink4a p19Arf
line#1 line#2
0
2
4
6
8
10
12
-actin_tss chr8_int
H3K
27ac
leve
ls
(rel
ativ
e to
5%
inpu
t) UNC2400 UNC1999
Supplemental Figure S6
10 20 30 40 50 60
020
4060
8010
0
SUZ12 ChIP-seq read density in DMSO
% p
eaks
with
> 1
.5−f
old
redu
ctio
n
UNC2400UNC1999
0
Input (UNC2400)
Input (UNC1999)
H3K27me3 (UNC2400)
H3K27me3 (UNC1999)
H3K27ac (UNC2400)
H3K27ac (UNC1999)
HoxA1 A2 HoxA3 A5/A6 /A7 A9 A10 A11 HoxA13 Evx1
(0, 100)
SUZ12 (UNC2400)
SUZ12 (UNC1999)
SUZ12 (mock)
SUZ12 (UNC2400)
SUZ12 (UNC1999)
SUZ12 (DMSO)
H3K27ac (UNC2400)
H3K27ac (UNC1999)
Bcl11a
Input (UNC2400)
Input (UNC1999)
H3K27me3 (UNC2400)
H3K27me3 (UNC1999)
H3K27ac (UNC2400)
H3K27ac (UNC1999)
Input (UNC2400)
Input (UNC1999)
H3K27me3 (UNC2400)
H3K27me3 (UNC1999)
Input (DMSO)
H3K27me3 (DMSO)
20 Kb 20 Kb
20 KbA
B C
D
E F G
mockUNC2400
UNC1999 mock
UNC2400UNC1999
−20
24
68
10
H3K
27m
e3 re
ad d
ensi
ty, l
og2
promoter non−promoterp < 2.2e-16 p < 2.2e-16
0
10
20
30
40
50
60
70
80
LV2 LV3 LT1 LT3 LT5 LV1 LV2 LV3 LT1 LT3 LT5 LT6
G0/G1 S G2/M
Bone Marrow Spleen
Per
cent
age
of c
ells
104
103
102
101
100
101 102 103 104
Mac
-I
gfp(MLL-AF9)
104
103
102
101
100
101 102 103 104
Mac
-I
gfp(MLL-AF9)
33.7 0.1
4.6 61.5
vehicle (SP)
45.7 0.3
3.3 50.7
UNC1999 (SP)104
103
102
101
100
101 102 103 104
Mac
-Igfp(MLL-AF9)
104
103
102
101
100
101 102 103 104
Mac
-I
gfp(MLL-AF9)
18.5 0.1
4.3 77.3
vehicle (BM)
29.9 0.1
2.3 67.7
UNC1999 (BM)
A B
C D
Supplemental Figure S7
0
250
500
750
1000
Plat
elet
s (x
1,0
00/u
L)
Platelet
10d 16d 18d 25d 27d 30d
Vehicle UNC1999
Peptide Sequence (modification*)Peptide H3(3-‐8) DMSO UNC2400 UNC1999
TKQTAR 87.5668 88.889 88.1882TK4(me1)QTAR 10.7014 10.3745 10.7892TK4(me2)QTAR 1.22126 0.527532 0.760891TK4(me3)QTAR 0.510461 0.208985 0.261738
Peptide H3(9-‐17) DMSO UNC2400 UNC1999KSTGGKAPR 19.737 21.5255 16.0454
K9(me1)STGGKAPR 13.0097 15.91 14.3973K9(me2)STGGKAPR 16.1268 15.455 16.6309K9(me3)STGGKAPR 12.788 13.0587 15.8985K9STGGK14(ac)APR 8.77739 11.727 12.0545
K9(me1)STGGK14(ac)APR 10.5788 9.96745 10.458K9(me2)STGGK14(ac)APR 9.10446 7.27957 8.47041K9(me3)STGGK14(ac)APR 4.19161 2.95011 4.18693K9(ac)STGGK14(ac)APR 1.23405 1.0416 1.33674
Peptide H3(18-‐26) DMSO UNC2400 UNC1999KQLATKAAR 70.6333 72.6935 71.8845
KQLATK23(me1)AAR 0.463847 0.746466 0.54664K18(me1)QLATKAAR 0.535328 0.500476 0.324485K18(ac)QLATKAAR 4.75632 4.77685 4.07197KQLATK23(ac)AAR 21.3273 19.0457 20.7263
K18(ac)QLATK23(ac)AAR 2.28389 2.237 2.44619
Peptide H3(27-‐40) replicate 1 replicate 2 average KSAPATGGVKKPHR 12.5268 15.9538 39.839 39.6905 39.76475
K27(me1)SAPATGGVKKPHR 33.0437 32.9908 18.2758 27.2298 22.7528K27(me2)SAPATGGVKKPHR 21.6247 18.5069 3.14655 3.14913 3.14784K27(me3)SAPATGGVKKPHR 5.19754 4.1425 0.28025 0.141249 0.2107495K27(ac)SAPATGGVKKPHR 0.189522 0.25083 0.442955 0.313998 0.3784765KSAPATGGVK36(me1)KPHR 0.197987 0.0778141 14.2535 6.81673 10.535115
K27(me1)SAPATGGVK36(me1)KPHR 4.27134 4.69443 8.58491 5.94388 7.264395K27(me2)SAPATGGVK36(me1)KPHR 8.86975 9.10557 3.9802 4.55026 4.26523K27(me3)SAPATGGVK36(me1)KPHR 3.20114 2.9349 1.00995 1.07911 1.04453
KSAPATGGVK36(me2)KPHR 2.10592 2.17001 6.31617 6.74054 6.528355K27(me1)SAPATGGVK36(me2)KPHR 5.16873 5.61108 3.07698 3.53976 3.30837K27(me2)SAPATGGVK36(me2)KPHR 0.365458 0.264297 0.0223601 0.0156692 0.01901465K27(me3)SAPATGGVK36(me2)KPHR 0.0997172 0.0731504 undetected undetected 0K27(me1)SAPATGGVK36(me3)KPHR 3.13768 3.22396 0.740181 0.750764 0.7454725
Relative percentage (%)**
UNC1999DMSO UNC2400
Supplemental Table S1. Summary of the relative percentages for each detected histone peptide species from MLL-ENL-transformed murine leukemia progenitor cell lines following 4-day treatment with DMSO, 3uM of UNC2400 or UNC1999, as measured by quantitative mass spectrometry analysis.
Peptide H3(73-‐83) DMSO UNC2400 UNC1999EIAQDFKTDLR 86.1581 88.0067 85.9555
EIAQDFK79(me1)TDLR 10.1282 10.0887 8.96825EIAQDFK79(me2)TDLR 3.71369 1.90458 5.07627
Peptide H4(4-‐17) DMSO UNC2400 UNC1999GKGGKGLGKGGAKR 61.8483 56.24 47.078
GK5(ac)GGKGLGKGGAKR 0.976512 1.69458 1.39404GKGGK8(ac)GLGKGGAKR 0.65592 1.06536 0.631697GKGGKGLGK12(ac)GGAKR 3.2719 4.00504 5.2027GKGGKGLGKGGAK16(ac)R 22.1632 28.7981 36.4307
GK5(ac)GGK8(ac)GLGKGGAKR 0.211515 0.166883 0.164136GK5(ac)GGKGLGK12(ac)GGAKR 0.855339 0.695115 0.707435GK5(ac)GGKGLGKGGAK16(ac)R 1.36173 1.02734 0.794228GKGGK8(ac)GLGK12(ac)GGAKR 0.349738 0.445863 0.369785GKGGK8(ac)GLGKGGAK16(ac)R 2.86879 1.65903 2.16513GKGGKGLGK12(ac)GGAK16(ac)R 3.1588 2.46827 3.22782
GK5(ac)GGK8(ac)GLGK12(ac)GGAKR 0.264648 0.25772 0.237819GK5(ac)GGK8(ac)GLGKGGAK16(ac)R 0.285343 0.206238 0.212775GK5(ac)GGKGLGK12(ac)GGAK16(ac)R 0.630415 0.386243 0.342134GKGGK8(ac)GLGK12(ac)GGAK16(ac)R 0.479671 0.40055 0.600936
GK5(ac)GGK8(ac)GLGK12(ac)GGAK16(ac)R 0.618127 0.483729 0.440624
Peptide H4(20-‐23) DMSO UNC2400 UNC1999KVLR 13.4188 15.6014 13.1106
K20(me1)VLR 34.5502 34.0812 33.1653K20(me2)VLR 48.5287 46.802 49.6076K20(me3)VLR 3.50228 3.51538 4.1165
*ac, acetylation; me1/2/3, mono, di, or tri-methylation; **, relative abundance (in percentage or %) for each listed peptide isoforms following treatment.
Transcripts Cluster Id
Gene Symbol
p value (Corrected)
Regulation
Fold change (FC)
Average Expression -‐DMSO [n=5]
Average Expression -‐UNC1999 [n=6]
Average Expression -‐UNC2400 [n=5] Gene description
17294458 Rhobtb3 6.834E-‐06 up 5.80 42.03 243.77 44.49 Rho-‐related BTB domain containing 3
17354378 Ppic 6.834E-‐06 up 5.12 107.74 552.05 109.85 peptidylprolyl isomerase C
17543691 Phka1 6.834E-‐06 up 3.26 59.09 192.84 63.68 phosphorylase kinase alpha 1
17498847 Lass4 1.126E-‐05 up 3.11 161.74 503.59 141.19 LAG1 homolog, ceramide synthase 4
17249898 Galnt10 1.126E-‐05 up 2.55 85.36 217.61 85.10 UDP-‐N-‐acetyl-‐alpha-‐D-‐galactosamine:polypeptide N-‐acetylgalactosaminyltransferase 10
17392937 Sox12 1.126E-‐05 up 2.46 53.15 130.67 49.34 SRY-‐box containing gene 12
17456710 Tspan33 1.126E-‐05 up 1.76 38.55 67.72 39.64 tetraspanin 33
17415606 Nfia 1.283E-‐05 up 2.05 69.91 143.02 72.56 nuclear factor I/A
17294694 1.285E-‐05 up 3.43 87.23 299.16 74.0517233347 Gja1 1.285E-‐05 up 3.22 82.70 266.32 79.15 gap junction protein, alpha 1
17369368 Ncs1 1.285E-‐05 up 2.98 133.02 396.46 120.72 neuronal calcium sensor 1
17396492 Eif5a2 1.300E-‐05 up 2.08 142.63 296.10 164.54 eukaryotic translation initiation factor 5A2
17276674 Gphn 1.490E-‐05 up 1.78 621.64 1106.32 591.38 gephyrin
17220059 Cdc42bpa 1.982E-‐05 up 4.47 31.56 141.03 30.60 CDC42 binding protein kinase alpha
17458734 Plekha8 1.982E-‐05 up 2.16 76.76 166.02 83.40 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
17456721 Smo 2.098E-‐05 up 4.96 282.34 1401.67 261.75 smoothened homolog (Drosophila)
17466921 Jazf1 2.221E-‐05 up 3.60 44.82 161.23 47.91 JAZF zinc finger 1
17311179 Fzd6 2.485E-‐05 up 3.05 32.55 99.38 33.32 frizzled homolog 6 (Drosophila)
17427033 Mllt3 2.577E-‐05 up 1.59 203.66 323.73 201.37 myeloid/lymphoid or mixed-‐lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
17368550 Rxra 3.565E-‐05 up 4.04 70.48 284.62 79.46 retinoid X receptor alpha
17544545 Armcx2 3.565E-‐05 up 2.64 63.26 166.69 57.21 armadillo repeat containing, X-‐linked 2
17228588 Ralgps2 3.609E-‐05 up 3.20 37.94 121.54 36.57 Ral GEF with PH domain and SH3 binding motif 2
17538096 Rnf128 3.686E-‐05 up 2.91 48.37 140.52 49.76 ring finger protein 128
17223985 Ikzf2 4.491E-‐05 up 3.09 319.43 988.44 290.79 IKAROS family zinc finger 2
17313811 Fbln1 5.955E-‐05 up 1.70 39.34 66.75 39.59 fibulin 1
17293103 Gkap1 6.168E-‐05 up 4.00 124.68 499.09 108.43 G kinase anchoring protein 1
Supplemental Table S2. List of the differentially expressed transcripts in two different MLL-‐AF9-‐transformed leukemia progenitor lines following treatment of 3uM of DMSO, UNC2400 or UNC1999 for 4-‐5 days and then examined by microarray analysis with a cut-‐off of >1.5-‐fold and p <0.01.
17430373 Zbtb8a 6.690E-‐05 up 3.15 55.52 174.70 57.24 zinc finger and BTB domain containing 8a
17235243 Efna2 6.690E-‐05 up 1.70 59.08 100.46 64.54 ephrin A2
17468298 Exoc6b 6.813E-‐05 up 2.54 204.93 521.15 218.87 exocyst complex component 6B
17310673 Ank 7.769E-‐05 up 1.94 317.91 617.90 331.72 progressive ankylosis
17414212 Fsd1l 7.769E-‐05 up 1.69 41.47 70.29 42.66 fibronectin type III and SPRY domain containing 1-‐like
17290865 Epdr1 7.851E-‐05 up 2.19 47.42 103.71 44.25 ependymin related protein 1 (zebrafish)
17324643 Bdh1 7.851E-‐05 up 1.99 61.00 121.09 65.83 3-‐hydroxybutyrate dehydrogenase, type 1
17417551 Zswim5 8.155E-‐05 up 4.11 47.41 194.82 51.03 zinc finger, SWIM domain containing 5
17467171 Vopp1 8.155E-‐05 up 2.03 131.10 265.96 117.06 vesicular, overexpressed in cancer, prosurvival protein 1
17427147 Cdkn2a 8.422E-‐05 up 4.01 71.34 285.94 68.40 cyclin-‐dependent kinase inhibitor 2A
17428509 Faah 8.635E-‐05 up 2.51 90.02 225.88 91.09 fatty acid amide hydrolase
17348138 9430020K01Rik8.748E-‐05 up 2.77 114.20 316.39 116.66 RIKEN cDNA 9430020K01 gene
17257405 Tanc2 9.132E-‐05 up 3.08 32.00 98.70 31.84 tetratricopeptide repeat, ankyrin repeat and coiled-‐coil containing 2
17402193 Arhgap29 9.132E-‐05 up 2.30 35.63 82.00 35.21 Rho GTPase activating protein 29
17353032 Fam59a 9.132E-‐05 up 2.27 65.96 149.85 70.22 family with sequence similarity 59, member A
17460861 Slc41a3 9.132E-‐05 up 1.75 124.84 218.02 148.71 solute carrier family 41, member 3
17291275 Lrrc16a 9.132E-‐05 up 1.74 62.22 108.31 65.47 leucine rich repeat containing 16A
17306477 Slc7a8 9.218E-‐05 up 1.75 1923.84 3371.07 1912.58 solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
17456001 Glcci1 9.218E-‐05 up 1.73 296.42 511.60 277.27 glucocorticoid induced transcript 1
17537895 Ngfrap1 9.218E-‐05 up 1.51 1625.92 2448.33 1532.89 nerve growth factor receptor (TNFRSF16) associated protein 1
17366953 Prkcq 9.796E-‐05 up 2.87 45.45 130.36 48.95 protein kinase C, theta
17484382 Inpp5a 9.823E-‐05 up 1.52 186.69 283.33 188.44 inositol polyphosphate-‐5-‐phosphatase A
17356288 Ctsf 9.944E-‐05 up 3.41 44.45 151.62 44.52 cathepsin F
17308361 Bmp1 9.944E-‐05 up 1.90 41.24 78.46 44.23 bone morphogenetic protein 1
17236288 Igf1 1.086E-‐04 up 5.63 45.29 255.13 51.99 insulin-‐like growth factor 1
17318950 Csf2rb2 1.167E-‐04 up 2.45 984.22 2413.75 1068.64 colony stimulating factor 2 receptor, beta 2, low-‐affinity (granulocyte-‐macrophage)
17224771 Serpine2 1.170E-‐04 up 4.76 55.64 264.94 48.35 serine (or cysteine) peptidase inhibitor, clade E, member 2
17223138 Pgap1 1.170E-‐04 up 3.02 69.17 208.56 106.86 post-‐GPI attachment to proteins 1
17422659 B930041F14Rik1.170E-‐04 up 2.88 171.45 493.53 170.97 RIKEN cDNA B930041F14 gene
17470187 Zfp9 1.170E-‐04 up 1.98 48.85 96.85 42.36 zinc finger protein 9
17277170 Acot6 1.170E-‐04 up 1.95 40.62 79.36 36.79 acyl-‐CoA thioesterase 6
17539241 Map3k15 1.170E-‐04 up 1.75 149.25 261.55 129.70 mitogen-‐activated protein kinase kinase kinase 15
17430645 Nkain1 1.370E-‐04 up 3.78 84.77 320.45 85.83 Na+/K+ transporting ATPase interacting 1
17312054 Khdrbs3 1.392E-‐04 up 4.06 68.17 276.59 56.75 KH domain containing, RNA binding, signal transduction associated 3
17341975 Npw 1.420E-‐04 up 2.20 59.06 129.82 53.90 neuropeptide W
17323589 Klhl22 1.429E-‐04 up 2.24 175.57 392.95 160.07 kelch-‐like 22 (Drosophila)
17271168 Prkca 1.453E-‐04 up 1.98 159.68 316.02 168.56 protein kinase C, alpha
17321263 Adcy6 1.719E-‐04 up 2.82 37.43 105.61 37.26 adenylate cyclase 6
17268120 Pdk2 1.719E-‐04 up 2.13 77.98 166.05 78.18 pyruvate dehydrogenase kinase, isoenzyme 2
17262600 Tcf7 1.719E-‐04 up 1.67 50.09 83.85 44.44 transcription factor 7, T cell specific
17411103 Lphn2 1.843E-‐04 up 4.28 39.03 167.06 40.67 latrophilin 2
17215576 Agap1 1.921E-‐04 up 2.61 216.68 565.87 176.17 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
17462202 Rasgef1a 2.034E-‐04 up 1.81 34.02 61.59 39.65 RasGEF domain family, member 1A
17433055 Kif1b 2.146E-‐04 up 2.07 186.83 386.41 199.09 kinesin family member 1B
17240226 Marcks 2.152E-‐04 up 2.76 53.62 147.92 58.79 myristoylated alanine rich protein kinase C substrate
17374098 Lgr4 2.152E-‐04 up 2.30 67.86 155.74 65.97 leucine-‐rich repeat-‐containing G protein-‐coupled receptor 4
17276934 Ttc9 2.329E-‐04 up 1.57 33.80 52.99 34.17 tetratricopeptide repeat domain 9
17233273 Dcbld1 2.605E-‐04 up 3.31 40.76 135.11 42.22 discoidin, CUB and LCCL domain containing 1
17228164 Lamc1 2.613E-‐04 up 2.05 225.54 461.52 313.22 laminin, gamma 1
17218349 Glul 2.827E-‐04 up 2.01 352.16 706.13 411.88 glutamate-‐ammonia ligase (glutamine synthetase)
17310912 Laptm4b 2.838E-‐04 up 3.11 291.99 906.90 287.42 lysosomal-‐associated protein transmembrane 4B
17400622 Lix1l 3.061E-‐04 up 1.65 357.67 590.76 348.50 Lix1-‐like
17312191 4930572J05Rik3.141E-‐04 up 1.73 459.72 796.75 444.46 RIKEN cDNA 4930572J05 gene
17498251 Phlda2 3.332E-‐04 up 2.07 34.90 72.11 40.90 pleckstrin homology-‐like domain, family A, member 2
17226203 Epb4.1l5 3.332E-‐04 up 2.03 106.35 215.78 104.10 erythrocyte protein band 4.1-‐like 5
17479183 Fam174b 3.356E-‐04 up 2.33 229.88 535.30 238.91 family with sequence similarity 174, member B
17415391 3.485E-‐04 up 2.98 40.15 119.78 42.2317313705 Parvb 3.485E-‐04 up 2.44 99.58 243.43 105.87 parvin, beta
17358375 Smarca2 3.485E-‐04 up 1.81 437.42 789.54 404.82 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
17475580 Blvrb 3.485E-‐04 up 1.63 146.33 238.73 151.58 biliverdin reductase B (flavin reductase (NADPH))
17237170 Pawr 3.510E-‐04 up 1.97 65.11 128.41 63.44 PRKC, apoptosis, WT1, regulator
17433977 Agrn 3.846E-‐04 up 1.85 115.32 213.14 107.60 agrin
17351473 Slmo1 3.925E-‐04 up 1.93 44.26 85.47 45.93 slowmo homolog 1 (Drosophila)
17520886 Ryk 4.039E-‐04 up 5.11 74.78 382.02 55.77 receptor-‐like tyrosine kinase
17296084 Zswim6 4.434E-‐04 up 1.69 404.45 681.89 411.56 zinc finger, SWIM domain containing 6
17248304 Ubtd2 4.531E-‐04 up 1.67 520.31 870.95 503.02 ubiquitin domain containing 2
17510735 Smad1 4.653E-‐04 up 2.81 46.55 130.87 45.35 SMAD family member 1
17460831 Aldh1l1 4.655E-‐04 up 2.46 48.58 119.62 51.65 aldehyde dehydrogenase 1 family, member L1
17246284 Suox 4.852E-‐04 up 1.74 198.21 344.45 201.89 sulfite oxidase
17287536 Tspan17 4.883E-‐04 up 2.03 254.56 517.77 288.21 tetraspanin 17
17217500 Kdm5b 4.883E-‐04 up 1.84 363.63 668.45 303.45 lysine (K)-‐specific demethylase 5B
17397497 Foxo1 5.573E-‐04 up 1.68 105.14 176.66 107.87 forkhead box O1
17409284 Celsr2 5.670E-‐04 up 1.70 47.00 80.10 41.78 cadherin, EGF LAG seven-‐pass G-‐type receptor 2 (flamingo homolog, Drosophila)
17468828 Plxna1 5.696E-‐04 up 3.59 119.58 429.32 137.28 plexin A1
17325159 Mylk 5.696E-‐04 up 1.77 61.64 109.29 52.89 myosin, light polypeptide kinase
17247852 Bcl11a 5.754E-‐04 up 2.35 255.78 601.84 260.00 B cell CLL/lymphoma 11A (zinc finger protein)
17334638 Prss34 5.905E-‐04 up 7.03 70.06 492.26 69.82 protease, serine, 34
17470930 Leprel2 5.905E-‐04 up 2.11 106.51 225.19 107.35 leprecan-‐like 2
17516450 Pvrl1 5.905E-‐04 up 1.88 49.87 93.71 55.67 poliovirus receptor-‐related 1
17285097 Dip2c 5.937E-‐04 up 4.77 43.76 208.85 40.44 DIP2 disco-‐interacting protein 2 homolog C (Drosophila)
17305520 Ear1 6.123E-‐04 up 5.74 25.24 144.82 24.77 eosinophil-‐associated, ribonuclease A family, member 1
17538628 Fgd1 6.123E-‐04 up 1.87 48.42 90.42 46.40 FYVE, RhoGEF and PH domain containing 1
17320720 Prickle1 6.123E-‐04 up 1.55 45.02 69.88 46.77 prickle homolog 1 (Drosophila)
17307354 Atp8a2 6.215E-‐04 up 1.72 47.11 80.96 50.92 ATPase, aminophospholipid transporter-‐like, class I, type 8A, member 2
17519699 Ddx43 6.400E-‐04 up 1.92 31.53 60.48 30.18 DEAD (Asp-‐Glu-‐Ala-‐Asp) box polypeptide 43
17431607 C1qb 6.402E-‐04 up 5.58 57.67 321.61 65.57 complement component 1, q subcomponent, beta polypeptide
17292058 Elovl2 6.412E-‐04 up 1.52 41.73 63.56 44.22 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-‐like 2
17305042 Bmpr1a 6.434E-‐04 up 4.06 35.29 143.12 32.21 bone morphogenetic protein receptor, type 1A
17317858 Ptk2 6.434E-‐04 up 1.91 37.59 71.83 37.22 PTK2 protein tyrosine kinase 2
17428094 Zfyve9|3110021N24Rik6.434E-‐04 up 1.68 49.82 83.90 46.49 zinc finger, FYVE domain containing 9 | RIKEN cDNA 3110021N24 gene
17326510 Pros1 6.500E-‐04 up 2.16 41.97 90.82 53.26 protein S (alpha)
17470468 Mical3 6.670E-‐04 up 1.55 108.80 168.11 112.21 microtubule associated monoxygenase, calponin and LIM domain containing 3
17522958 Ctdspl 6.839E-‐04 up 1.63 303.13 493.90 288.16 CTD (carboxy-‐terminal domain, RNA polymerase II, polypeptide A) small phosphatase-‐like
17308772 9030625A04Rik6.913E-‐04 up 1.83 73.35 134.59 60.12 RIKEN cDNA 9030625A04 gene
17405746 Rarres1 7.001E-‐04 up 2.36 56.23 132.81 55.13 retinoic acid receptor responder (tazarotene induced) 1
17307738 Fzd3 7.106E-‐04 up 3.07 44.97 137.91 37.14 frizzled homolog 3 (Drosophila)
17221792 Fam135a 7.189E-‐04 up 4.16 45.96 191.22 51.08 family with sequence similarity 135, member A
17286641 Dsp 7.793E-‐04 up 2.72 390.66 1064.20 238.96 desmoplakin
17511377 Neto2 7.975E-‐04 up 1.70 373.26 633.20 391.88 neuropilin (NRP) and tolloid (TLL)-‐like 2
17427494 Dock7 8.046E-‐04 up 3.03 158.80 480.94 182.46 dedicator of cytokinesis 7
17302092 Tsc22d1|Gm195978.046E-‐04 up 1.91 56.73 108.10 65.93 TSC22 domain family, member 1 | predicted gene, 19597
17239539 Hebp2 8.046E-‐04 up 1.88 41.43 77.86 40.68 heme binding protein 2
17392690 Acss1 8.046E-‐04 up 1.63 287.99 469.32 286.43 acyl-‐CoA synthetase short-‐chain family member 1
17248276 Hba-‐a2|Hba-‐a18.116E-‐04 up 5.17 45.27 234.11 45.02 hemoglobin alpha, adult chain 2 | hemoglobin alpha, adult chain 1
17320614 Kif21a 8.116E-‐04 up 1.98 39.53 78.42 38.58 kinesin family member 21A
17438389 C530008M17Rik8.459E-‐04 up 1.94 67.03 129.73 65.24 RIKEN cDNA C530008M17 gene
17223283 Satb2 8.502E-‐04 up 2.11 183.52 386.99 195.86 special AT-‐rich sequence binding protein 2
17291935 8.502E-‐04 up 1.66 63.27 104.89 54.6717465373 Impdh1 8.502E-‐04 up 1.62 369.34 597.06 290.13 inosine 5'-‐phosphate dehydrogenase 1
17313000 Kdelr3 8.708E-‐04 up 2.77 74.02 204.68 76.66 KDEL (Lys-‐Asp-‐Glu-‐Leu) endoplasmic reticulum protein retention receptor 3
17404585 Zmat3 8.845E-‐04 up 4.16 101.81 423.10 120.91 zinc finger matrin type 3
17357640 Ms4a4a 8.845E-‐04 up 3.15 58.56 184.40 89.68 membrane-‐spanning 4-‐domains, subfamily A, member 4A
17290420 Zmynd11 9.228E-‐04 up 1.58 553.16 876.26 567.77 zinc finger, MYND domain containing 11
17358905 Hectd2 9.555E-‐04 up 2.09 35.67 74.45 33.54 HECT domain containing 2
17390823 Slc30a4 9.576E-‐04 up 2.73 44.23 120.74 43.71 solute carrier family 30 (zinc transporter), member 4
17510823 Gab1 9.646E-‐04 up 1.68 87.08 146.13 87.11 growth factor receptor bound protein 2-‐associated protein 1
17312746 Kctd17 9.715E-‐04 up 1.90 105.76 201.30 118.83 potassium channel tetramerisation domain containing 17
17370807 Fmnl2 9.783E-‐04 up 2.92 29.87 87.20 29.44 formin-‐like 2
17453242 Auts2 1.038E-‐03 up 1.87 131.20 245.81 122.75 autism susceptibility candidate 2
17249036 Gfpt2 1.038E-‐03 up 1.81 36.83 66.50 35.96 glutamine fructose-‐6-‐phosphate transaminase 2
17251728 Zbtb4 1.038E-‐03 up 1.52 80.39 122.00 75.67 zinc finger and BTB domain containing 4
17498673 Camsap3 1.038E-‐03 up 1.50 42.76 64.33 43.90 calmodulin regulated spectrin-‐associated protein family, member 3
17363903 Prkg1 1.041E-‐03 up 2.52 59.56 150.32 57.40 protein kinase, cGMP-‐dependent, type I
17371019 Tanc1 1.041E-‐03 up 2.00 73.85 147.38 57.01 tetratricopeptide repeat, ankyrin repeat and coiled-‐coil containing 1
17464803 Ica1 1.076E-‐03 up 2.35 99.97 235.42 83.85 islet cell autoantigen 1
17333418 Mllt4 1.076E-‐03 up 1.74 70.67 122.68 69.70 myeloid/lymphoid or mixed-‐lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
17318750 Rbfox2 1.076E-‐03 up 1.57 50.16 78.93 54.83 RNA binding protein, fox-‐1 homolog (C. elegans) 2
17261575 Ranbp17 1.121E-‐03 up 2.43 60.32 146.86 61.44 RAN binding protein 17
17284065 Cdc42bpb 1.121E-‐03 up 1.89 172.70 326.92 182.35 CDC42 binding protein kinase beta
17362953 Ms4a7 1.147E-‐03 up 5.06 62.32 315.46 100.89 membrane-‐spanning 4-‐domains, subfamily A, member 7
17404835 Bbs7 1.167E-‐03 up 1.84 64.76 118.84 71.31 Bardet-‐Biedl syndrome 7 (human)
17241512 Tet1 1.195E-‐03 up 1.93 103.45 199.65 88.20 tet methylcytosine dioxygenase 1
17534746 Cxx1c 1.201E-‐03 up 2.18 36.82 80.18 39.61 CAAX box 1 homolog C (human)
17306507 Slc22a17 1.237E-‐03 up 1.84 71.34 131.56 71.88 solute carrier family 22 (organic cation transporter), member 17
17355026 Atp8b1 1.282E-‐03 up 2.12 40.86 86.80 41.28 ATPase, class I, type 8B, member 1
17403866 Ptger3 1.296E-‐03 up 2.41 73.88 177.73 71.71 prostaglandin E receptor 3 (subtype EP3)
17363025 Stx3 1.303E-‐03 up 3.32 85.47 283.78 96.93 syntaxin 3
17459520 Reep1 1.304E-‐03 up 1.91 60.00 114.65 59.95 receptor accessory protein 1
17450618 Tgfbr3 1.315E-‐03 up 2.33 47.03 109.49 43.57 transforming growth factor, beta receptor III
17540059 Porcn 1.333E-‐03 up 1.65 68.90 113.73 71.92 porcupine homolog (Drosophila)
17221197 Tcf24 1.361E-‐03 up 2.85 51.93 147.85 49.81 transcription factor 24
17369613 Aif1l 1.361E-‐03 up 1.59 76.38 121.34 74.90 allograft inflammatory factor 1-‐like
17266698 Myo1d 1.362E-‐03 up 3.72 51.84 193.03 53.37 myosin ID
17273714 Adcy3|Cenpo1.364E-‐03 up 1.74 84.45 146.73 81.73 adenylate cyclase 3 | centromere protein O
17498365 Mrgpre 1.395E-‐03 up 1.67 71.20 119.12 79.47 MAS-‐related GPR, member E
17367163 Cacnb2 1.441E-‐03 up 2.16 78.30 168.79 65.65 calcium channel, voltage-‐dependent, beta 2 subunit
17401610 Gstm5|4933431E20Rik1.448E-‐03 up 2.72 76.16 206.93 77.55 glutathione S-‐transferase, mu 5 | RIKEN cDNA 4933431E20 gene
17418035 Cited4 1.462E-‐03 up 4.66 88.85 414.18 67.66 Cbp/p300-‐interacting transactivator, with Glu/Asp-‐rich carboxy-‐terminal domain, 4
17384021 Stxbp1 1.505E-‐03 up 1.65 237.10 392.09 228.82 syntaxin binding protein 1
17218186 Fam129a 1.506E-‐03 up 2.65 126.61 335.37 116.24 family with sequence similarity 129, member A
17342581 Decr2 1.557E-‐03 up 1.66 325.70 542.18 349.42 2-‐4-‐dienoyl-‐Coenzyme A reductase 2, peroxisomal
17543286 Spin4 1.603E-‐03 up 1.64 35.20 57.86 36.45 spindlin family, member 4
17460634 Gata2 1.604E-‐03 up 1.87 1746.79 3271.60 1852.96 GATA binding protein 2
17346618 Nudt12 1.604E-‐03 up 1.62 68.40 110.64 63.68 nudix (nucleoside diphosphate linked moiety X)-‐type motif 12
17436545 Nat8l 1.607E-‐03 up 2.09 133.84 280.16 129.79 N-‐acetyltransferase 8-‐like
17408414 Fam46c 1.610E-‐03 up 2.50 66.78 167.26 69.93 family with sequence similarity 46, member C
17517831 Cyp11a1 1.638E-‐03 up 9.90 104.52 1034.79 143.07 cytochrome P450, family 11, subfamily a, polypeptide 1
17276386 Rhoj 1.747E-‐03 up 3.29 51.85 170.86 48.57 ras homolog gene family, member J
17497076 Chst15|Gm105841.747E-‐03 up 2.63 82.69 217.88 76.45 carbohydrate (N-‐acetylgalactosamine 4-‐sulfate 6-‐O) sulfotransferase 15 | predicted gene 10584
17544816 Esx1 1.751E-‐03 up 1.63 43.80 71.49 45.23 extraembryonic, spermatogenesis, homeobox 1
17366359 Fam171a1 1.808E-‐03 up 1.67 52.08 87.03 54.13 family with sequence similarity 171, member A1
17492826 Homer2 1.812E-‐03 up 2.44 93.44 227.93 89.09 homer homolog 2 (Drosophila)
17300030 1.817E-‐03 up 1.66 52.17 86.77 52.0517251816 Ybx2 1.838E-‐03 up 1.56 47.29 73.99 47.11 Y box protein 2
17270222 Itga2b 1.864E-‐03 up 1.67 268.04 447.50 274.01 integrin alpha 2b
17340177 Prkce 1.894E-‐03 up 1.78 133.61 237.52 134.76 protein kinase C, epsilon
17272877 Tbc1d16 1.922E-‐03 up 1.84 104.27 192.32 98.97 TBC1 domain family, member 16
17548987 2810025M15Rik1.945E-‐03 up 3.93 119.74 471.15 100.57 RIKEN cDNA 2810025M15 gene
17535607 Slc6a8 1.945E-‐03 up 3.12 133.00 415.01 150.27 solute carrier family 6 (neurotransmitter transporter, creatine), member 8
17272770 Timp2 1.945E-‐03 up 2.79 232.51 649.17 232.94 tissue inhibitor of metalloproteinase 2
17363572 Tjp2 1.945E-‐03 up 1.70 134.11 227.51 117.64 tight junction protein 2
17502994 Lphn1 2.025E-‐03 up 2.82 134.84 379.90 129.88 latrophilin 1
17301697 Tnfrsf10b 2.049E-‐03 up 1.84 111.45 204.84 107.04 tumor necrosis factor receptor superfamily, member 10b
17431612 C1qc 2.049E-‐03 up 1.71 41.92 71.81 44.91 complement component 1, q subcomponent, C chain
17229974 Fcer1a 2.101E-‐03 up 4.39 29.17 127.94 30.59 Fc receptor, IgE, high affinity I, alpha polypeptide
17378359 Acss2 2.116E-‐03 up 1.82 520.35 946.94 489.27 acyl-‐CoA synthetase short-‐chain family member 2
17514853 Slc36a4 2.119E-‐03 up 5.04 51.69 260.60 49.50 solute carrier family 36 (proton/amino acid symporter), member 4
17291787 Slc22a23 2.127E-‐03 up 2.64 45.12 118.96 55.13 solute carrier family 22, member 23
17229988 Cadm3 2.127E-‐03 up 1.63 41.67 67.90 40.27 cell adhesion molecule 3
17276020 Frmd6 2.127E-‐03 up 1.61 87.54 140.74 91.23 FERM domain containing 6
17470616 C3ar1 2.222E-‐03 up 3.61 69.00 249.08 74.85 complement component 3a receptor 1
17459014 Abcg2 2.222E-‐03 up 2.11 25.57 53.98 25.71 ATP-‐binding cassette, sub-‐family G (WHITE), member 2
17458911 Fkbp9 2.233E-‐03 up 1.76 31.07 54.64 29.83 FK506 binding protein 9
17544734 Bex1 2.233E-‐03 up 1.72 29.70 51.01 29.13 brain expressed gene 1
17349304 Tslp 2.273E-‐03 up 1.59 39.74 63.24 40.55 thymic stromal lymphopoietin
17249542 septin 8 2.289E-‐03 up 1.73 105.91 183.29 110.34 septin 8
17500453 Tex15 2.289E-‐03 up 1.70 35.72 60.75 36.80 testis expressed gene 15
17316826 Tmem74 2.289E-‐03 up 1.63 41.10 67.14 45.75 transmembrane protein 74
17373283 Lrp4 2.348E-‐03 up 1.92 55.34 106.11 49.72 low density lipoprotein receptor-‐related protein 4
17403463 Syde2 2.348E-‐03 up 1.88 63.64 119.44 59.30 synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
17519533 Lysmd2 2.348E-‐03 up 1.83 45.79 83.83 42.03 LysM, putative peptidoglycan-‐binding, domain containing 2
17413221 Unc13b 2.348E-‐03 up 1.62 40.77 66.04 39.30 unc-‐13 homolog B (C. elegans)
17257903 2.411E-‐03 up 2.02 42.77 86.57 40.5317282216 Zfp36l1 2.446E-‐03 up 2.83 96.15 271.85 99.14 zinc finger protein 36, C3H type-‐like 1
17444372 Cyth3 2.447E-‐03 up 1.59 215.35 343.34 235.46 cytohesin 3
17221193 2.453E-‐03 up 1.89 45.00 85.07 41.3017357971 Gna14 2.490E-‐03 up 2.21 48.93 107.99 46.22 guanine nucleotide binding protein, alpha 14
17361304 Lrfn4 2.529E-‐03 up 1.61 94.95 152.75 96.29 leucine rich repeat and fibronectin type III domain containing 4
17441396 Vsig10 2.529E-‐03 up 1.53 44.39 67.89 46.09 V-‐set and immunoglobulin domain containing 10
17265229 Alox15 2.531E-‐03 up 2.15 37.09 79.85 40.21 arachidonate 15-‐lipoxygenase
17472517 Ldhb 2.547E-‐03 up 2.70 63.04 170.15 50.95 lactate dehydrogenase B
17545839 Reps2 2.641E-‐03 up 1.73 76.66 132.27 92.52 RALBP1 associated Eps domain containing protein 2
17312716 Csf2rb 2.692E-‐03 up 1.61 166.96 269.28 181.40 colony stimulating factor 2 receptor, beta, low-‐affinity (granulocyte-‐macrophage)
17415396 2.705E-‐03 up 1.87 50.38 94.08 55.7917461942 Pparg 2.774E-‐03 up 2.28 53.24 121.52 52.37 peroxisome proliferator activated receptor gamma
17426497 Megf9 2.774E-‐03 up 1.83 442.27 809.10 392.56 multiple EGF-‐like-‐domains 9
17238848 Syne1 2.785E-‐03 up 2.56 63.81 163.05 43.55 synaptic nuclear envelope 1
17482110 Xylt1 2.785E-‐03 up 1.60 1457.54 2326.80 1303.98 xylosyltransferase 1
17222777 Slc40a1 2.842E-‐03 up 3.03 43.30 131.10 49.10 solute carrier family 40 (iron-‐regulated transporter), member 1
17422996 Plag1 2.922E-‐03 up 2.20 66.87 147.12 62.69 pleiomorphic adenoma gene 1
17382203 Hnmt 2.940E-‐03 up 2.80 51.41 143.73 45.17 histamine N-‐methyltransferase
17529398 Me1 2.969E-‐03 up 2.02 40.54 81.93 44.28 malic enzyme 1, NADP(+)-‐dependent, cytosolic
17335017 2.999E-‐03 up 2.46 45.17 111.27 53.6917429057 Ptprf 3.015E-‐03 up 1.78 56.88 101.16 54.76 protein tyrosine phosphatase, receptor type, F
17404180 Car1 3.039E-‐03 up 3.44 75.58 259.84 101.94 carbonic anhydrase 1
17404601 Gnb4 3.039E-‐03 up 2.69 61.64 165.96 73.70 guanine nucleotide binding protein (G protein), beta 4
17541856 Mtap7d3 3.039E-‐03 up 2.11 31.07 65.59 32.19 MAP7 domain containing 3
17227089 Btg2 3.039E-‐03 up 1.99 167.58 334.21 179.36 B cell translocation gene 2, anti-‐proliferative
17519738 Cd109 3.039E-‐03 up 1.87 25.00 46.86 25.71 CD109 antigen
17305221 5730469M10Rik3.057E-‐03 up 1.98 192.14 381.33 177.33 RIKEN cDNA 5730469M10 gene
17267471 Ppm1e 3.082E-‐03 up 3.11 83.49 259.68 78.54 protein phosphatase 1E (PP2C domain containing)
17212211 Il1rl1 3.086E-‐03 up 3.67 66.59 244.06 67.54 interleukin 1 receptor-‐like 1
17228751 Rabgap1l 3.097E-‐03 up 1.89 113.38 214.58 110.12 RAB GTPase activating protein 1-‐like
17334666 Tpsb2 3.141E-‐03 up 1.91 25.43 48.54 27.04 tryptase beta 2
17462705 Foxj2 3.146E-‐03 up 1.62 377.64 612.78 420.50 forkhead box J2
17416616 Echdc2 3.157E-‐03 up 1.98 143.72 284.13 137.08 enoyl Coenzyme A hydratase domain containing 2
17394297 Pltp 3.318E-‐03 up 4.17 85.21 354.99 84.86 phospholipid transfer protein
17362986 Ms4a2 3.332E-‐03 up 5.41 78.92 426.79 90.23 membrane-‐spanning 4-‐domains, subfamily A, member 2
17241013 Ccdc109a 3.338E-‐03 up 1.55 698.33 1081.39 641.85 coiled-‐coil domain containing 109A
17292333 Ptpdc1 3.381E-‐03 up 1.86 41.72 77.66 36.04 protein tyrosine phosphatase domain containing 1
17248288 Sh3pxd2b 3.427E-‐03 up 3.64 92.19 335.10 104.73 SH3 and PX domains 2B
17255663 Copz2 3.427E-‐03 up 2.34 79.11 184.92 78.52 coatomer protein complex, subunit zeta 2
17512221 Cmtm4 3.427E-‐03 up 1.83 127.33 233.44 124.82 CKLF-‐like MARVEL transmembrane domain containing 4
17457504 Rab19 3.465E-‐03 up 1.65 76.61 126.34 89.32 RAB19, member RAS oncogene family
17376541 Prnp|Prnd 3.539E-‐03 up 1.87 53.27 99.80 65.67 prion protein | prion protein dublet
17374880 Tyro3 3.539E-‐03 up 1.51 58.85 88.70 54.13 TYRO3 protein tyrosine kinase 3
17548315 LOC1008621323.642E-‐03 up 2.37 52.25 123.70 52.7817318083 Ly6a 3.642E-‐03 up 1.53 89.30 136.87 105.43 lymphocyte antigen 6 complex, locus A
17231477 Myct1 3.642E-‐03 up 1.81 68.71 124.48 58.80 myc target 1
17229259 Mpzl1 3.709E-‐03 up 1.62 304.41 492.44 348.10 myelin protein zero-‐like 1
17326405 Dcbld2 3.717E-‐03 up 1.63 44.24 72.19 45.52 discoidin, CUB and LCCL domain containing 2
17526707 Zbtb16 3.717E-‐03 up 1.54 587.87 903.65 539.91 zinc finger and BTB domain containing 16
17348840 Rnf125 3.804E-‐03 up 1.51 1176.03 1774.94 1007.32 ring finger protein 125
17300998 Shisa2 3.863E-‐03 up 1.85 112.98 209.29 111.77 shisa homolog 2 (Xenopus laevis)
17470988 Ptms 3.863E-‐03 up 1.53 106.32 162.75 117.73 parathymosin
17539966 Gata1 3.868E-‐03 up 2.42 108.71 262.59 111.21 GATA binding protein 1
17295130 F2r 3.922E-‐03 up 1.62 125.18 203.03 118.35 coagulation factor II (thrombin) receptor
17260668 Grb10 4.026E-‐03 up 2.71 116.48 315.66 77.02 growth factor receptor bound protein 10
17500662 Zdhhc2 4.034E-‐03 up 1.68 206.75 347.10 213.93 zinc finger, DHHC domain containing 2
17339013 Emr1 4.291E-‐03 up 2.00 261.16 521.07 333.90 EGF-‐like module containing, mucin-‐like, hormone receptor-‐like sequence 1
17503841 Lpcat2 4.296E-‐03 up 1.57 43.82 68.90 44.46 lysophosphatidylcholine acyltransferase 2
17504572 Ces2g 4.298E-‐03 up 3.97 63.17 250.96 66.77 carboxylesterase 2G
17239142 Samd5 4.392E-‐03 up 1.51 42.67 64.57 40.84 sterile alpha motif domain containing 5
17264792 Atp1b2 4.406E-‐03 up 2.68 62.06 166.62 67.75 ATPase, Na+/K+ transporting, beta 2 polypeptide
17459870 Loxl3 4.406E-‐03 up 1.59 64.35 102.50 76.20 lysyl oxidase-‐like 3
17350824 Slc12a2 4.429E-‐03 up 2.55 96.87 246.64 97.94 solute carrier family 12, member 2
17372670 Prg3 4.553E-‐03 up 6.44 108.03 695.87 82.84 proteoglycan 3
17411751 Trp53inp1 4.553E-‐03 up 1.74 239.32 416.22 291.99 transformation related protein 53 inducible nuclear protein 1
17388353 Gyltl1b 4.751E-‐03 up 1.65 50.60 83.68 52.24 glycosyltransferase-‐like 1B
17380915 Col20a1 4.795E-‐03 up 1.55 84.47 131.19 88.00 collagen, type XX, alpha 1
17355189 Spire1 4.822E-‐03 up 1.93 148.23 285.46 146.29 spire homolog 1 (Drosophila)
17409963 Fnbp1l 4.847E-‐03 up 1.72 30.18 51.76 26.97 formin binding protein 1-‐like
17217247 Pik3c2b 4.847E-‐03 up 1.94 76.46 148.46 74.30 phosphoinositide-‐3-‐kinase, class 2, beta polypeptide
17457876 Gstk1 4.847E-‐03 up 1.66 742.10 1228.70 677.29 glutathione S-‐transferase kappa 1
17423577 Atp6v0d2 4.893E-‐03 up 3.63 42.24 153.40 41.43 ATPase, H+ transporting, lysosomal V0 subunit D2
17228624 Rasal2 4.904E-‐03 up 1.95 42.83 83.52 42.48 RAS protein activator like 2
17238878 Syne1 4.942E-‐03 up 2.95 56.23 166.13 35.07 synaptic nuclear envelope 1
17514678 Maml2 4.942E-‐03 up 1.86 158.32 294.62 176.82 mastermind like 2 (Drosophila)
17337706 Rhag 4.942E-‐03 up 1.80 48.91 88.02 54.60 Rhesus blood group-‐associated A glycoprotein
17238844 Syne1 4.976E-‐03 up 1.92 40.28 77.38 34.42 synaptic nuclear envelope 1
17299101 Ear2|Ear12|Ear34.985E-‐03 up 3.57 37.29 133.10 36.61 eosinophil-‐associated, ribonuclease A family, member 2 | eosinophil-‐associated, ribonuclease A family, member 12 | eosinophil-‐associated, ribonuclease A family, member 3
17360823 Slc18a2 5.046E-‐03 up 5.53 136.18 752.71 158.44 solute carrier family 18 (vesicular monoamine), member 2
17525263 Aplp2 5.109E-‐03 up 1.68 940.97 1580.64 909.63 amyloid beta (A4) precursor-‐like protein 2
17413852 Galnt12 5.157E-‐03 up 2.19 64.71 141.55 70.26 UDP-‐N-‐acetyl-‐alpha-‐D-‐galactosamine:polypeptide N-‐acetylgalactosaminyltransferase 12
17515819 Ets1 5.232E-‐03 up 2.63 68.21 179.42 58.05 E26 avian leukemia oncogene 1, 5' domain
17375327 Casc4 5.232E-‐03 up 2.35 98.14 231.03 88.08 cancer susceptibility candidate 4
17411262 St6galnac3 5.232E-‐03 up 2.06 53.34 109.69 59.47 ST6 (alpha-‐N-‐acetyl-‐neuraminyl-‐2,3-‐beta-‐galactosyl-‐1,3)-‐N-‐acetylgalactosaminide alpha-‐2,6-‐sialyltransferase 3
17337796 Pla2g7 5.232E-‐03 up 1.75 47.15 82.34 44.80 phospholipase A2, group VII (platelet-‐activating factor acetylhydrolase, plasma)
17300961 Rcbtb1 5.232E-‐03 up 1.69 144.02 243.39 178.27 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
17355722 Sall3 5.232E-‐03 up 1.67 34.52 57.67 35.35 sal-‐like 3 (Drosophila)
17217035 Ctse 5.232E-‐03 up 1.57 2899.40 4550.77 2466.20 cathepsin E
17466360 Kel 5.232E-‐03 up 1.56 33.43 52.18 33.5717238834 Syne1 5.233E-‐03 up 2.49 55.00 136.69 43.66 synaptic nuclear envelope 1
17239546 D10Bwg1379e5.366E-‐03 up 2.11 114.72 242.34 133.18 DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed
17524847 Epor 5.474E-‐03 up 1.80 74.99 134.82 72.49 erythropoietin receptor
17533269 Tspan7 5.480E-‐03 up 1.99 32.55 64.92 39.93 tetraspanin 7
17283155 Eml5 5.526E-‐03 up 3.78 92.84 350.49 93.97 echinoderm microtubule associated protein like 5
17466060 Parp12 5.526E-‐03 up 1.87 319.33 597.42 397.02 poly (ADP-‐ribose) polymerase family, member 12
17413403 Npr2 5.537E-‐03 up 2.62 42.64 111.65 41.36 natriuretic peptide receptor 2
17356526 Ltbp3 5.539E-‐03 up 1.56 49.27 76.81 51.11 latent transforming growth factor beta binding protein 3
17415570 Hook1 5.605E-‐03 up 1.61 120.14 193.82 118.45 hook homolog 1 (Drosophila)
17373930 0610012H03Rik5.737E-‐03 up 1.53 79.16 121.41 76.08 RIKEN cDNA 0610012H03 gene
17403514 Ssx2ip 6.169E-‐03 up 1.52 208.94 318.01 223.29 synovial sarcoma, X breakpoint 2 interacting protein
17417138 Tal1 6.257E-‐03 up 1.54 121.90 187.50 119.64 T cell acute lymphocytic leukemia 1
17252081 Pld2 6.369E-‐03 up 1.58 87.06 137.48 102.85 phospholipase D2
17500832 Fat1 6.457E-‐03 up 1.52 33.18 50.52 32.52 FAT tumor suppressor homolog 1 (Drosophila)
17315245 Krt18 6.552E-‐03 up 1.83 33.45 61.08 32.14 keratin 18
17502816 Inpp4b 6.569E-‐03 up 1.90 51.80 98.47 48.61 inositol polyphosphate-‐4-‐phosphatase, type II
17329636 Gp5 6.574E-‐03 up 1.93 33.02 63.89 33.27 glycoprotein 5 (platelet)
17328742 Slc7a4 6.574E-‐03 up 1.78 39.03 69.42 36.11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
17264984 Nlgn2 6.584E-‐03 up 1.81 257.07 464.47 249.03 neuroligin 2
17512732 Nqo1 6.655E-‐03 up 1.80 62.01 111.35 68.30 NAD(P)H dehydrogenase, quinone 1
17320486 Odf3b 6.686E-‐03 up 1.78 53.86 95.60 53.03 outer dense fiber of sperm tails 3B
17414009 5730528L13Rik6.813E-‐03 up 3.72 58.82 218.94 54.01 RIKEN cDNA 5730528L13 gene
17530406 Acpp 6.813E-‐03 up 2.93 62.35 182.90 57.16 acid phosphatase, prostate
17371969 Sp9 6.894E-‐03 up 2.60 51.92 134.81 55.71 trans-‐acting transcription factor 9
17304523 Stab1 6.971E-‐03 up 1.57 56.62 88.65 72.95 stabilin 1
17239113 Sash1 7.021E-‐03 up 1.75 58.30 102.00 57.44 SAM and SH3 domain containing 1
17266038 Fam101b 7.522E-‐03 up 2.27 235.24 533.44 180.21 family with sequence similarity 101, member B
17279509 Crip1 7.522E-‐03 up 1.91 630.46 1207.17 628.37 cysteine-‐rich protein 1 (intestinal)
17501633 Lpl 7.604E-‐03 up 2.61 36.10 94.18 33.37 lipoprotein lipase
17479099 Igf1r 7.612E-‐03 up 1.89 883.85 1666.16 738.72 insulin-‐like growth factor I receptor
17383467 Ntng2 7.630E-‐03 up 1.66 236.41 393.22 206.79 netrin G2
17340050 Plekhh2 7.746E-‐03 up 1.79 205.95 368.00 170.94 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
17417407 Pik3r3 7.864E-‐03 up 2.00 56.32 112.84 75.21 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55)
17545785 Cdkl5 7.864E-‐03 up 1.81 33.86 61.15 32.46 cyclin-‐dependent kinase-‐like 5
17498188 Ascl2 7.864E-‐03 up 1.67 53.36 89.28 45.58 achaete-‐scute complex homolog 2 (Drosophila)
17238916 Syne1 7.954E-‐03 up 3.32 91.09 302.31 55.24 synaptic nuclear envelope 1
17238932 Syne1 8.004E-‐03 up 2.85 126.86 361.60 85.36 synaptic nuclear envelope 1
17238912 Syne1 8.004E-‐03 up 2.81 81.48 229.27 50.99 synaptic nuclear envelope 1
17238938 Syne1 8.004E-‐03 up 2.75 67.99 187.16 46.33 synaptic nuclear envelope 1
17238908 Syne1 8.004E-‐03 up 1.70 41.23 69.99 37.04 synaptic nuclear envelope 1
17399266 Pklr 8.004E-‐03 up 1.52 57.63 87.50 60.52 pyruvate kinase liver and red blood cell
17217666 Tmem9 8.042E-‐03 up 1.90 220.57 419.51 209.93 transmembrane protein 9
17238850 Syne1 8.054E-‐03 up 2.44 46.15 112.74 35.69 synaptic nuclear envelope 1
17543870 Zdhhc15 8.054E-‐03 up 1.54 38.42 59.23 34.49 zinc finger, DHHC domain containing 15
17398406 Fam198b 8.072E-‐03 up 1.53 40.77 62.50 45.91 family with sequence similarity 198, member B
17502330 Zfp709 8.085E-‐03 up 1.87 57.94 108.37 59.13 zinc finger protein 709
17496150 Lat 8.141E-‐03 up 1.82 100.82 183.06 107.47 linker for activation of T cells
17464588 Sgce 8.155E-‐03 up 1.65 26.39 43.56 26.22 sarcoglycan, epsilon
17372662 Prg2 8.158E-‐03 up 9.77 221.52 2164.20 111.85 proteoglycan 2, bone marrow
17257235 Itgb3 8.158E-‐03 up 1.55 291.31 452.14 310.76 integrin beta 3
17480030 Rab38 8.158E-‐03 up 1.52 500.51 762.46 469.20 RAB38, member of RAS oncogene family
17485389 Shank2 8.190E-‐03 up 1.64 55.17 90.50 53.78 SH3/ankyrin domain gene 2
17228234 Npl 8.237E-‐03 up 3.26 465.07 1515.84 492.87 N-‐acetylneuraminate pyruvate lyase
17392748 Ninl 8.237E-‐03 up 1.69 58.30 98.66 63.06 ninein-‐like
17343088 Mdga1 8.468E-‐03 up 2.14 66.27 141.77 67.48 MAM domain containing glycosylphosphatidylinositol anchor 1
17325892 Cd200r3 8.540E-‐03 up 1.75 62.89 110.21 58.96 CD200 receptor 3
17445715 Cd36 8.603E-‐03 up 3.55 24.24 85.97 24.55 CD36 antigen
17215820 Gpc1 8.603E-‐03 up 2.15 698.54 1503.77 701.43 glypican 1
17375997 Mertk 8.736E-‐03 up 1.83 58.28 106.91 74.14 c-‐mer proto-‐oncogene tyrosine kinase
17502729 Zfp827 8.876E-‐03 up 2.61 27.55 71.93 27.14 zinc finger protein 827
17238934 Syne1 9.067E-‐03 up 4.79 94.94 455.13 50.44 synaptic nuclear envelope 1
17238862 Syne1 9.097E-‐03 up 2.24 33.54 75.19 25.20 synaptic nuclear envelope 1
17391915 Erv3 9.108E-‐03 up 2.07 32.77 67.85 33.64 endogenous retroviral sequence 3
17310872 Sdc2 9.190E-‐03 up 2.18 36.25 78.89 38.61 syndecan 2
17356216 Pcx 9.244E-‐03 up 1.55 165.56 257.06 143.42 pyruvate carboxylase
17238928 Syne1 9.413E-‐03 up 2.82 112.46 317.49 82.53 synaptic nuclear envelope 1
17436907 Afap1 9.452E-‐03 up 2.64 115.03 303.37 97.78 actin filament associated protein 1
17340197 Epas1 9.608E-‐03 up 1.61 62.34 100.24 61.39 endothelial PAS domain protein 1
17404337 Cpa3 9.874E-‐03 up 5.90 1037.10 6117.65 1049.43 carboxypeptidase A3, mast cell
17238868 Syne1 9.874E-‐03 up 2.97 55.62 164.97 39.42 synaptic nuclear envelope 1
17268714 Stac2 9.874E-‐03 up 2.17 53.01 114.82 58.42 SH3 and cysteine rich domain 2
17401710 Psrc1 9.874E-‐03 up 1.88 123.17 231.80 112.74 proline/serine-‐rich coiled-‐coil 1
17287984 Dapk1 9.874E-‐03 up 1.66 46.22 76.55 44.70 death associated protein kinase 1
17518109 Uaca 9.874E-‐03 up 1.63 29.41 48.00 31.32 uveal autoantigen with coiled-‐coil domains and ankyrin repeats
17466075 Jhdm1d 9.874E-‐03 up 1.55 177.81 274.86 227.39 jumonji C domain-‐containing histone demethylase 1 homolog D (S. cerevisiae)
17238826 Syne1 9.993E-‐03 up 1.71 45.50 77.80 39.07 synaptic nuclear envelope 1
Transcripts Cluster Id
Gene Symbol
p value (Corrected)
Regulation
Fold change (FC)
Average Expression -‐shEED [n=3]
Average Expression -‐shRenilla [n=3] Gene description
17260625 3.380E-‐07 up 13.10 462.49 35.3217325324 Stfa2l1 7.390E-‐07 up 11.48 378.10 32.94 stefin A2 like 117372662 Prg2 5.000E-‐05 up 10.68 823.31 77.05 proteoglycan 2, bone marrow17267520 Epx 7.970E-‐05 up 8.96 466.73 52.11 eosinophil peroxidase17404337 Cpa3 8.080E-‐05 up 8.13 3352.91 412.58 carboxypeptidase A3, mast cell17504572 Ces2g 3.130E-‐05 up 6.92 488.88 70.65 carboxylesterase 2G17404180 Car1 3.340E-‐04 up 6.88 320.97 46.62 carbonic anhydrase 117248276 Hba-‐a2|Hba-‐a16.809E-‐03 up 6.41 358.34 55.87 hemoglobin alpha, adult chain 2 | hemoglobin alpha, adult chain 117231477 Myct1 2.740E-‐05 up 5.35 271.70 50.82 myc target 117365098 Scd1 1.130E-‐04 up 5.14 931.20 181.29 stearoyl-‐Coenzyme A desaturase 117294458 Rhobtb3 1.732E-‐03 up 4.80 144.58 30.14 Rho-‐related BTB domain containing 317456721 Smo 2.380E-‐04 up 4.63 951.85 205.69 smoothened homolog (Drosophila)17360823 Slc18a2 1.569E-‐03 up 4.57 345.02 75.44 solute carrier family 18 (vesicular monoamine), member 217453874 A630081J09Rik8.756E-‐03 up 4.32 266.89 61.76 RIKEN cDNA A630081J09 gene17294694 4.560E-‐05 up 3.99 228.91 57.3617492431 Anpep 3.850E-‐04 up 3.97 279.73 70.38 alanyl (membrane) aminopeptidase17231844 Perp 7.080E-‐05 up 3.82 452.76 118.46 PERP, TP53 apoptosis effector17485430 Fgf3 6.570E-‐04 up 3.80 219.24 57.69 fibroblast growth factor 317233347 Gja1 3.510E-‐04 up 3.54 208.84 59.01 gap junction protein, alpha 117375327 Casc4 1.200E-‐04 up 3.42 148.94 43.59 cancer susceptibility candidate 417539966 Gata1 5.550E-‐04 up 3.40 205.97 60.65 GATA binding protein 117325347 Stfa1 1.390E-‐04 up 3.29 87.05 26.46 stefin A117427494 Dock7 2.640E-‐04 up 3.29 287.31 87.44 dedicator of cytokinesis 717305520 Ear1 1.832E-‐03 up 3.26 75.19 23.03 eosinophil-‐associated, ribonuclease A family, member 117517831 Cyp11a1 4.913E-‐03 up 3.25 120.85 37.24 cytochrome P450, family 11, subfamily a, polypeptide 117337706 Rhag 6.520E-‐04 up 3.23 116.38 36.04 Rhesus blood group-‐associated A glycoprotein
Supplemental Table S3. List of the differentially expressed transcripts in an MLL-‐AF9-‐transformed leukemia progenitor line (MLL-‐AF9-‐puro) following induction of shRNA against EED or Renilla for 6 days, as detected by microarray analysis with a cut-‐off of >1.5-‐fold and p<0.01.
17283155 Eml5 1.314E-‐03 up 3.22 162.89 50.55 echinoderm microtubule associated protein like 517276386 Rhoj 7.080E-‐05 up 3.20 183.18 57.29 ras homolog gene family, member J17372670 Prg3 9.870E-‐05 up 3.18 220.57 69.37 proteoglycan 317217136 Slc45a3 4.990E-‐03 up 3.12 126.22 40.42 solute carrier family 45, member 317354378 Ppic 1.190E-‐04 up 3.11 215.85 69.49 peptidylprolyl isomerase C17372621 Slc43a1 5.370E-‐06 up 3.10 270.43 87.15 solute carrier family 43, member 117228164 Lamc1 1.200E-‐04 up 3.07 253.56 82.48 laminin, gamma 117362986 Ms4a2 1.506E-‐03 up 3.06 136.20 44.51 membrane-‐spanning 4-‐domains, subfamily A, member 217368550 Rxra 4.460E-‐05 up 3.04 232.62 76.56 retinoid X receptor alpha17286641 Dsp 1.091E-‐03 up 2.89 835.74 289.14 desmoplakin17422996 Plag1 2.970E-‐04 up 2.89 197.35 68.31 pleiomorphic adenoma gene 117293103 Gkap1 5.120E-‐05 up 2.87 282.42 98.57 G kinase anchoring protein 117299101 Ear2|Ear12|Ear37.080E-‐05 up 2.86 74.72 26.10 eosinophil-‐associated, ribonuclease A family, member 2 | eosinophil-‐associated, ribonuclease A family, member 12 | eosinophil-‐associated, ribonuclease A family, member 3
17418035 Cited4 5.048E-‐03 up 2.86 114.31 40.02 Cbp/p300-‐interacting transactivator, with Glu/Asp-‐rich carboxy-‐terminal domain, 417458734 Plekha8 5.550E-‐04 up 2.82 153.19 54.37 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 817340817 Slc22a3 6.250E-‐03 up 2.74 402.27 147.03 solute carrier family 22 (organic cation transporter), member 317396143 Car13 1.150E-‐04 up 2.72 130.30 47.92 carbonic anhydrase 1317270222 Itga2b 2.717E-‐03 up 2.67 463.65 173.63 integrin alpha 2b17306147 Ndrg2 7.970E-‐05 up 2.67 118.64 44.44 N-‐myc downstream regulated gene 217430645 Nkain1 7.596E-‐03 up 2.67 203.25 76.20 Na+/K+ transporting ATPase interacting 117220059 Cdc42bpa 1.482E-‐03 up 2.63 71.30 27.07 CDC42 binding protein kinase alpha17524847 Epor 6.660E-‐04 up 2.63 116.32 44.22 erythropoietin receptor17248621 Ccnjl 8.080E-‐05 up 2.60 148.62 57.06 cyclin J-‐like17307738 Fzd3 5.630E-‐05 up 2.60 132.59 51.09 frizzled homolog 3 (Drosophila)17449084 Igfbp7 1.514E-‐03 up 2.57 1908.19 742.51 insulin-‐like growth factor binding protein 717352549 Mpp7 1.986E-‐03 up 2.53 131.00 51.73 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)17256975 Fzd2 1.482E-‐03 up 2.52 104.71 41.48 frizzled homolog 2 (Drosophila)17276674 Gphn 3.520E-‐05 up 2.51 1084.49 432.58 gephyrin17428509 Faah 1.130E-‐04 up 2.46 141.20 57.32 fatty acid amide hydrolase17232358 Ptprk 3.320E-‐04 up 2.46 294.74 119.89 protein tyrosine phosphatase, receptor type, K17312054 Khdrbs3 7.957E-‐03 up 2.46 127.35 51.83 KH domain containing, RNA binding, signal transduction associated 317314190 Shank3 1.920E-‐04 up 2.43 163.72 67.31 SH3/ankyrin domain gene 317226203 Epb4.1l5 8.080E-‐05 up 2.43 130.99 53.86 erythrocyte protein band 4.1-‐like 5
17502994 Lphn1 3.320E-‐04 up 2.43 402.96 166.02 latrophilin 117540059 Porcn 2.950E-‐04 up 2.41 87.64 36.40 porcupine homolog (Drosophila)17301926 Htr2a 6.640E-‐05 up 2.40 114.30 47.56 5-‐hydroxytryptamine (serotonin) receptor 2A17328958 Gp1bb|Sept52.591E-‐03 up 2.40 116.86 48.79 glycoprotein Ib, beta polypeptide | septin 517224771 Serpine2 3.804E-‐03 up 2.39 340.91 142.59 serine (or cysteine) peptidase inhibitor, clade E, member 217321263 Adcy6 7.080E-‐05 up 2.39 91.48 38.27 adenylate cyclase 617404585 Zmat3 9.470E-‐04 up 2.39 234.78 98.26 zinc finger matrin type 317356288 Ctsf 2.044E-‐03 up 2.39 88.24 36.95 cathepsin F17430373 Zbtb8a 6.070E-‐04 up 2.37 173.74 73.28 zinc finger and BTB domain containing 8a17497980 Muc6 4.111E-‐03 up 2.37 111.75 47.23 mucin 6, gastric17249898 Galnt10 1.340E-‐05 up 2.35 256.43 108.92 UDP-‐N-‐acetyl-‐alpha-‐D-‐galactosamine:polypeptide N-‐acetylgalactosaminyltransferase 1017221197 Tcf24 9.709E-‐03 up 2.34 94.37 40.24 transcription factor 2417468828 Plxna1 2.830E-‐04 up 2.34 172.45 73.77 plexin A117267471 Ppm1e 2.188E-‐03 up 2.33 94.68 40.59 protein phosphatase 1E (PP2C domain containing)17503254 Klf1 1.033E-‐03 up 2.33 113.54 48.72 Kruppel-‐like factor 1 (erythroid)17247852 Bcl11a 6.772E-‐03 up 2.32 372.53 160.75 B cell CLL/lymphoma 11A (zinc finger protein)17367163 Cacnb2 6.070E-‐04 up 2.30 163.70 71.08 calcium channel, voltage-‐dependent, beta 2 subunit17508691 Rbpms 1.770E-‐04 up 2.30 112.82 49.03 RNA binding protein gene with multiple splicing17538628 Fgd1 1.314E-‐03 up 2.24 91.35 40.71 FYVE, RhoGEF and PH domain containing 117411961 Tmem64 1.710E-‐04 up 2.23 300.33 134.93 transmembrane protein 6417345728 Mdfi 7.480E-‐04 up 2.22 200.78 90.35 MyoD family inhibitor17325892 Cd200r3 4.561E-‐03 up 2.22 128.60 58.00 CD200 receptor 317248288 Sh3pxd2b 9.540E-‐04 up 2.21 111.51 50.36 SH3 and PX domains 2B17313705 Parvb 3.683E-‐03 up 2.19 162.38 74.20 parvin, beta17548468 Rbpms2|Gm34708.890E-‐04 up 2.18 1032.58 472.62 RNA binding protein with multiple splicing 2 | predicted gene 347017310912 Laptm4b 1.380E-‐04 up 2.18 788.10 361.37 lysosomal-‐associated protein transmembrane 4B17223985 Ikzf2 1.395E-‐03 up 2.18 856.15 393.03 IKAROS family zinc finger 217377144 Slc24a3 2.810E-‐04 up 2.18 186.35 85.58 solute carrier family 24 (sodium/potassium/calcium exchanger), member 317348138 9430020K01Rik1.373E-‐03 up 2.15 271.12 125.89 RIKEN cDNA 9430020K01 gene17301365 Fbxo16 4.740E-‐04 up 2.15 217.18 100.88 F-‐box protein 1617502789 Gypa 2.965E-‐03 up 2.15 49.83 23.17 glycophorin A17355189 Spire1 3.514E-‐03 up 2.14 179.69 83.80 spire homolog 1 (Drosophila)17429191 Mpl 7.370E-‐05 up 2.13 106.78 50.02 myeloproliferative leukemia virus oncogene
17248263 Hba-‐a2|Hba-‐a11.569E-‐03 up 2.13 69.93 32.81 hemoglobin alpha, adult chain 2 | hemoglobin alpha, adult chain 117376728 Plcb4 6.370E-‐04 up 2.12 237.61 112.21 phospholipase C, beta 417249542 8-‐Sep 2.566E-‐03 up 2.12 245.79 116.14 septin 817522958 Ctdspl 1.530E-‐04 up 2.12 638.37 301.66 CTD (carboxy-‐terminal domain, RNA polymerase II, polypeptide A) small phosphatase-‐like17334638 Prss34 3.186E-‐03 up 2.11 90.28 42.71 protease, serine, 3417388999 Prrg4 5.770E-‐04 up 2.11 234.55 111.06 proline rich Gla (G-‐carboxyglutamic acid) 4 (transmembrane)17227348 Nav1 3.330E-‐04 up 2.11 351.89 166.88 neuron navigator 117464455 Far2 3.109E-‐03 up 2.10 1221.21 582.56 fatty acyl CoA reductase 217212211 Il1rl1 6.809E-‐03 up 2.09 55.47 26.53 interleukin 1 receptor-‐like 117462373 Cecr2 2.869E-‐03 up 2.09 175.55 84.06 cat eye syndrome chromosome region, candidate 217369368 Ncs1 8.230E-‐04 up 2.09 373.90 179.07 neuronal calcium sensor 117228751 Rabgap1l 1.380E-‐03 up 2.08 123.59 59.47 RAB GTPase activating protein 1-‐like17468298 Exoc6b 1.360E-‐05 up 2.07 330.15 159.35 exocyst complex component 6B17384021 Stxbp1 1.320E-‐04 up 2.05 342.15 166.63 syntaxin binding protein 117414212 Fsd1l 6.460E-‐04 up 2.05 83.84 40.92 fibronectin type III and SPRY domain containing 1-‐like17329636 Gp5 1.320E-‐04 up 2.05 62.00 30.32 glycoprotein 5 (platelet)17429206 Tie1 1.466E-‐03 up 2.04 97.92 47.94 tyrosine kinase with immunoglobulin-‐like and EGF-‐like domains 117271168 Prkca 1.757E-‐03 up 2.04 257.32 126.28 protein kinase C, alpha17518616 Rbpms2|Gm34704.070E-‐04 up 2.03 393.24 193.57 RNA binding protein with multiple splicing 2 | predicted gene 347017416616 Echdc2 1.060E-‐04 up 2.01 204.96 101.75 enoyl Coenzyme A hydratase domain containing 217367852 Nrarp 3.320E-‐04 up 2.01 207.06 102.93 Notch-‐regulated ankyrin repeat protein17512221 Cmtm4 2.950E-‐04 up 2.01 220.88 110.03 CKLF-‐like MARVEL transmembrane domain containing 417305221 5730469M10Rik8.250E-‐03 up 2.00 196.53 98.13 RIKEN cDNA 5730469M10 gene17543870 Zdhhc15 1.302E-‐03 up 2.00 57.45 28.75 zinc finger, DHHC domain containing 1517338136 Cul7 3.614E-‐03 up 1.99 183.93 92.30 cullin 717271281 Fam20a 1.986E-‐03 up 1.99 150.77 75.68 family with sequence similarity 20, member A17467171 Vopp1 2.186E-‐03 up 1.99 219.02 109.99 vesicular, overexpressed in cancer, prosurvival protein 117399266 Pklr 3.302E-‐03 up 1.98 123.23 62.19 pyruvate kinase liver and red blood cell17396162 Car2 1.020E-‐04 up 1.97 297.08 150.44 carbonic anhydrase 217411103 Lphn2 2.869E-‐03 up 1.97 65.25 33.11 latrophilin 217276020 Frmd6 2.293E-‐03 up 1.97 139.61 70.91 FERM domain containing 617310872 Sdc2 6.050E-‐04 up 1.97 85.67 43.55 syndecan 217217666 Tmem9 3.600E-‐04 up 1.96 373.35 190.49 transmembrane protein 9
17303722 Kcnk5 1.314E-‐03 up 1.95 62.80 32.15 potassium channel, subfamily K, member 517396492 Eif5a2 3.784E-‐03 up 1.95 244.37 125.14 eukaryotic translation initiation factor 5A217254948 Cuedc1 8.275E-‐03 up 1.94 658.66 339.81 CUE domain containing 117487759 Cd177 1.395E-‐03 up 1.93 180.19 93.24 CD177 antigen17302092 Tsc22d1|Gm195974.070E-‐04 up 1.93 82.48 42.71 TSC22 domain family, member 1 | predicted gene, 1959717349926 Pcdhb17 1.302E-‐03 up 1.93 63.17 32.74 protocadherin beta 1717236623 Usp44 4.560E-‐05 up 1.93 139.69 72.49 ubiquitin specific peptidase 4417366953 Prkcq 1.569E-‐03 up 1.93 60.45 31.38 protein kinase C, theta17543691 Phka1 1.986E-‐03 up 1.92 63.57 33.04 phosphorylase kinase alpha 117443539 Ephb4 4.900E-‐04 up 1.92 101.61 52.94 Eph receptor B417492196 Slco3a1 6.630E-‐04 up 1.90 195.92 103.29 solute carrier organic anion transporter family, member 3a117526776 Ncam1 7.236E-‐03 up 1.90 965.58 509.14 neural cell adhesion molecule 117290865 Epdr1 8.438E-‐03 up 1.89 67.56 35.71 ependymin related protein 1 (zebrafish)17351027 Pdgfrb 2.597E-‐03 up 1.88 146.88 77.99 platelet derived growth factor receptor, beta polypeptide17408414 Fam46c 4.084E-‐03 up 1.88 64.22 34.23 family with sequence similarity 46, member C17450618 Tgfbr3 2.740E-‐05 up 1.88 74.50 39.73 transforming growth factor, beta receptor III17425248 Tmem246 9.316E-‐03 up 1.87 81.71 43.74 transmembrane protein 24617427033 Mllt3 5.000E-‐05 up 1.87 208.53 111.66 myeloid/lymphoid or mixed-‐lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
17417146 Pdzk1ip1 8.300E-‐04 up 1.86 107.64 57.74 PDZK1 interacting protein 117374098 Lgr4 3.320E-‐04 up 1.86 71.85 38.67 leucine-‐rich repeat-‐containing G protein-‐coupled receptor 417339973 Pkdcc 7.310E-‐04 up 1.86 81.02 43.67 protein kinase domain containing, cytoplasmic17363025 Stx3 1.022E-‐03 up 1.85 105.70 57.08 syntaxin 317241512 Tet1 5.584E-‐03 up 1.85 162.88 88.03 tet methylcytosine dioxygenase 117427147 Cdkn2a 2.487E-‐03 up 1.84 161.93 87.89 cyclin-‐dependent kinase inhibitor 2A17235243 Efna2 6.101E-‐03 up 1.84 122.30 66.41 ephrin A217456710 Tspan33 5.550E-‐04 up 1.83 79.31 43.24 tetraspanin 3317548458 1.270E-‐04 up 1.83 57.37 31.4117255335 Samd14 5.550E-‐04 up 1.82 72.20 39.58 sterile alpha motif domain containing 1417318312 Nrbp2 4.876E-‐03 up 1.82 62.76 34.42 nuclear receptor binding protein 217457694 Trbv13-‐2 4.449E-‐03 up 1.82 52.05 28.55 T cell receptor beta, variable 13-‐217509758 Csgalnact1 2.346E-‐03 up 1.82 78.15 42.97 chondroitin sulfate N-‐acetylgalactosaminyltransferase 117379606 Mmp9 5.048E-‐03 up 1.82 71.47 39.33 matrix metallopeptidase 917311179 Fzd6 5.000E-‐05 up 1.81 54.00 29.81 frizzled homolog 6 (Drosophila)
17214053 Xrcc5 1.580E-‐04 up 1.81 143.01 78.96 X-‐ray repair complementing defective repair in Chinese hamster cells 517470930 Leprel2 3.130E-‐04 up 1.80 157.73 87.41 leprecan-‐like 217338617 Emr4 1.405E-‐03 up 1.80 78.46 43.59 EGF-‐like module containing, mucin-‐like, hormone receptor-‐like sequence 417358375 Smarca2 9.530E-‐05 up 1.80 493.24 274.02 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
17512732 Nqo1 1.326E-‐03 up 1.80 82.99 46.20 NAD(P)H dehydrogenase, quinone 117430894 Smpdl3b 8.890E-‐04 up 1.80 140.99 78.50 sphingomyelin phosphodiesterase, acid-‐like 3B17397740 Mab21l1 2.232E-‐03 up 1.79 75.04 41.86 mab-‐21-‐like 1 (C. elegans)17466921 Jazf1 1.460E-‐03 up 1.79 73.37 41.01 JAZF zinc finger 117498897 Tnfsf13b 3.320E-‐04 up 1.79 107.06 59.86 tumor necrosis factor (ligand) superfamily, member 13b17522971 Vill 1.302E-‐03 up 1.79 58.11 32.53 villin-‐like17391094 Hdc 9.991E-‐03 up 1.78 1113.18 624.21 histidine decarboxylase17284065 Cdc42bpb 2.330E-‐04 up 1.78 261.50 146.68 CDC42 binding protein kinase beta17325159 Mylk 8.550E-‐04 up 1.78 117.34 65.83 myosin, light polypeptide kinase17349922 Pcdhb16 5.048E-‐03 up 1.78 57.64 32.37 protocadherin beta 1617302523 Slain1 3.486E-‐03 up 1.77 345.77 194.86 SLAIN motif family, member 117322525 Glis2 1.410E-‐04 up 1.77 486.45 275.05 GLIS family zinc finger 217299954 2.526E-‐03 up 1.77 203.97 115.3717299877 2.572E-‐03 up 1.77 203.85 115.4217425466 Ctnnal1 3.317E-‐03 up 1.76 103.61 58.82 catenin (cadherin associated protein), alpha-‐like 117255663 Copz2 3.717E-‐03 up 1.76 128.44 73.12 coatomer protein complex, subunit zeta 217234339 Adora2a 1.118E-‐03 up 1.76 184.93 105.30 adenosine A2a receptor17382203 Hnmt 2.107E-‐03 up 1.75 73.47 41.89 histamine N-‐methyltransferase17378359 Acss2 3.476E-‐03 up 1.75 571.24 326.50 acyl-‐CoA synthetase short-‐chain family member 217214476 Des 3.614E-‐03 up 1.75 108.36 61.96 desmin17264792 Atp1b2 1.314E-‐03 up 1.74 86.61 49.78 ATPase, Na+/K+ transporting, beta 2 polypeptide17368171 Bmyc 4.590E-‐04 up 1.74 2594.22 1490.96 brain expressed myelocytomatosis oncogene17396439 Tnik 2.693E-‐03 up 1.74 473.00 271.95 TRAF2 and NCK interacting kinase17402193 Arhgap29 1.920E-‐04 up 1.73 49.80 28.75 Rho GTPase activating protein 2917480030 Rab38 6.710E-‐04 up 1.73 745.17 430.34 RAB38, member of RAS oncogene family17293362 Ctla2a 3.830E-‐04 up 1.73 199.50 115.27 cytotoxic T lymphocyte-‐associated protein 2 alpha17342829 Tead3 6.460E-‐04 up 1.73 107.58 62.36 TEA domain family member 317464803 Ica1 5.190E-‐04 up 1.72 143.79 83.49 islet cell autoantigen 117228234 Npl 3.804E-‐03 up 1.72 852.65 495.80 N-‐acetylneuraminate pyruvate lyase
17475801 Eid2 7.380E-‐03 up 1.72 76.72 44.64 EP300 interacting inhibitor of differentiation 217506356 Zfpm1 4.913E-‐03 up 1.72 993.16 578.26 zinc finger protein, multitype 117429057 Ptprf 8.890E-‐04 up 1.71 80.00 46.71 protein tyrosine phosphatase, receptor type, F17403514 Ssx2ip 2.615E-‐03 up 1.71 239.75 140.27 synovial sarcoma, X breakpoint 2 interacting protein17257361 Mrc2 3.943E-‐03 up 1.70 59.47 34.92 mannose receptor, C type 217516462 Thy1 6.421E-‐03 up 1.70 68.89 40.52 thymus cell antigen 1, theta17239546 D10Bwg1379e2.274E-‐03 up 1.70 143.90 84.74 DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed17371873 Rapgef4 3.292E-‐03 up 1.69 70.64 41.75 Rap guanine nucleotide exchange factor (GEF) 417239113 Sash1 6.070E-‐04 up 1.69 82.47 48.78 SAM and SH3 domain containing 117527520 Scamp5 4.990E-‐03 up 1.69 225.45 133.36 secretory carrier membrane protein 517253478 Rab34 1.520E-‐03 up 1.69 153.27 90.67 RAB34, member of RAS oncogene family17417138 Tal1 1.033E-‐03 up 1.69 186.92 110.65 T cell acute lymphocytic leukemia 117443613 Tfr2 6.570E-‐04 up 1.69 511.32 302.94 transferrin receptor 217281971 Sgpp1 1.320E-‐04 up 1.69 1012.56 599.94 sphingosine-‐1-‐phosphate phosphatase 117228588 Ralgps2 1.130E-‐04 up 1.69 68.11 40.36 Ral GEF with PH domain and SH3 binding motif 217235990 1500009L16Rik1.341E-‐03 up 1.69 156.07 92.54 RIKEN cDNA 1500009L16 gene17499117 Atp11a 1.090E-‐03 up 1.68 479.15 284.74 ATPase, class VI, type 11A17306477 Slc7a8 1.825E-‐03 up 1.68 3876.29 2311.11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 817215576 Agap1 2.010E-‐04 up 1.67 539.81 322.31 ArfGAP with GTPase domain, ankyrin repeat and PH domain 117460634 Gata2 6.421E-‐03 up 1.67 2724.11 1627.01 GATA binding protein 217300064 2.237E-‐03 up 1.67 205.23 122.6817325329 Gm5483 4.579E-‐03 up 1.67 36.74 21.97 predicted gene 548317285097 Dip2c 7.810E-‐04 up 1.67 57.61 34.47 DIP2 disco-‐interacting protein 2 homolog C (Drosophila)17398274 Ppm1l 1.380E-‐04 up 1.67 115.31 69.06 protein phosphatase 1 (formerly 2C)-‐like17308361 Bmp1 7.550E-‐05 up 1.67 79.61 47.79 bone morphogenetic protein 117353032 Fam59a 3.130E-‐04 up 1.66 86.61 52.08 family with sequence similarity 59, member A17450338 Klhl8 1.986E-‐03 up 1.66 59.01 35.61 kelch-‐like 8 (Drosophila)17268120 Pdk2 4.860E-‐04 up 1.65 173.40 104.79 pyruvate dehydrogenase kinase, isoenzyme 217364474 Pdlim1 8.150E-‐04 up 1.65 1758.84 1063.09 PDZ and LIM domain 1 (elfin)17441396 Vsig10 3.490E-‐04 up 1.65 95.75 57.88 V-‐set and immunoglobulin domain containing 1017339801 Crim1 4.449E-‐03 up 1.65 155.52 94.20 cysteine rich transmembrane BMP regulator 1 (chordin like)17526102 Oaf 7.580E-‐04 up 1.65 77.38 46.91 OAF homolog (Drosophila)17456001 Glcci1 4.560E-‐05 up 1.65 407.28 247.04 glucocorticoid induced transcript 1
17246284 Suox 1.656E-‐03 up 1.65 300.04 182.03 sulfite oxidase17495373 Plekha7 1.302E-‐03 up 1.65 86.91 52.78 pleckstrin homology domain containing, family A member 717323675 Arvcf 9.920E-‐04 up 1.65 122.33 74.31 armadillo repeat gene deleted in velo-‐cardio-‐facial syndrome17329236 Tmem41a 2.237E-‐03 up 1.64 1242.74 758.88 transmembrane protein 41a17306968 Mcpt8 3.044E-‐03 up 1.64 1372.90 838.56 mast cell protease 817279562 Vipr2 3.850E-‐04 up 1.63 56.78 34.73 vasoactive intestinal peptide receptor 217479183 Fam174b 1.144E-‐03 up 1.63 310.73 190.11 family with sequence similarity 174, member B17319823 1700001L05Rik1.278E-‐03 up 1.63 109.53 67.09 RIKEN cDNA 1700001L05 gene17307354 Atp8a2 1.302E-‐03 up 1.63 65.58 40.31 ATPase, aminophospholipid transporter-‐like, class I, type 8A, member 217371019 Tanc1 8.550E-‐04 up 1.63 97.40 59.88 tetratricopeptide repeat, ankyrin repeat and coiled-‐coil containing 117414009 5730528L13Rik3.320E-‐04 up 1.62 65.18 40.29 RIKEN cDNA 5730528L13 gene17373930 0610012H03Rik5.151E-‐03 up 1.61 134.12 83.13 RIKEN cDNA 0610012H03 gene17544078 Itm2a 6.574E-‐03 up 1.61 111.92 69.41 integral membrane protein 2A17272770 Timp2 2.869E-‐03 up 1.61 457.64 283.93 tissue inhibitor of metalloproteinase 217278188 Otub2 8.890E-‐04 up 1.61 113.55 70.52 OTU domain, ubiquitin aldehyde binding 217535607 Slc6a8 1.432E-‐03 up 1.61 113.29 70.50 solute carrier family 6 (neurotransmitter transporter, creatine), member 817385574 Ly75 2.214E-‐03 up 1.61 114.44 71.23 lymphocyte antigen 7517363572 Tjp2 3.302E-‐03 up 1.60 237.89 148.31 tight junction protein 217442834 Gpr133 6.591E-‐03 up 1.60 89.17 55.64 G protein-‐coupled receptor 13317433055 Kif1b 1.190E-‐04 up 1.60 242.41 151.27 kinesin family member 1B17467742 Vamp5 1.390E-‐04 up 1.60 1354.63 845.76 vesicle-‐associated membrane protein 517366670 Itih5 2.717E-‐03 up 1.60 632.89 395.89 inter-‐alpha (globulin) inhibitor H517381330 Optn 6.410E-‐03 up 1.60 199.17 124.60 optineurin17539004 Klf8 2.725E-‐03 up 1.60 154.96 96.95 Kruppel-‐like factor 817218349 Glul 1.860E-‐03 up 1.60 485.16 303.57 glutamate-‐ammonia ligase (glutamine synthetase)17470540 Phc1 3.364E-‐03 up 1.60 322.86 202.17 polyhomeotic-‐like 1 (Drosophila)17501633 Lpl 6.497E-‐03 up 1.60 53.26 33.37 lipoprotein lipase17217500 Kdm5b 5.343E-‐03 up 1.59 509.72 319.76 lysine (K)-‐specific demethylase 5B17457876 Gstk1 6.460E-‐04 up 1.59 1630.14 1025.91 glutathione S-‐transferase kappa 117430680 Ptpru 2.021E-‐03 up 1.59 122.30 77.12 protein tyrosine phosphatase, receptor type, U17355463 Ctif|Gm105323.136E-‐03 up 1.59 177.06 111.68 CBP80/20-‐dependent translation initiation factor | predicted gene 1053217445525 Rundc3b 2.395E-‐03 up 1.58 95.29 60.17 RUN domain containing 3B17390823 Slc30a4 6.542E-‐03 up 1.58 49.74 31.44 solute carrier family 30 (zinc transporter), member 4
17403463 Syde2 1.130E-‐04 up 1.58 68.45 43.27 synapse defective 1, Rho GTPase, homolog 2 (C. elegans)17438969 Pf4 3.420E-‐03 up 1.58 103.40 65.37 platelet factor 417323649 Rtn4r 4.327E-‐03 up 1.58 386.26 244.29 reticulon 4 receptor17506991 Nrp1 5.048E-‐03 up 1.58 133.32 84.42 neuropilin 117500535 Dusp4 6.118E-‐03 up 1.57 565.41 359.20 dual specificity phosphatase 417404601 Gnb4 4.979E-‐03 up 1.57 78.63 50.04 guanine nucleotide binding protein (G protein), beta 417404835 Bbs7 6.070E-‐04 up 1.57 63.21 40.26 Bardet-‐Biedl syndrome 7 (human)17327720 Adcy9 3.660E-‐04 up 1.57 224.55 143.08 adenylate cyclase 917356216 Pcx 6.460E-‐04 up 1.57 252.48 160.94 pyruvate carboxylase17392937 Sox12 8.713E-‐03 up 1.57 63.77 40.69 SRY-‐box containing gene 1217537936 Tceal1 2.738E-‐03 up 1.56 51.12 32.67 transcription elongation factor A (SII)-‐like 117451297 Adrbk2 3.053E-‐03 up 1.56 268.63 171.79 adrenergic receptor kinase, beta 217537895 Ngfrap1 6.460E-‐04 up 1.56 1861.55 1193.08 nerve growth factor receptor (TNFRSF16) associated protein 117260618 2.738E-‐03 up 1.56 41.82 26.8217480880 Pde2a 8.410E-‐04 up 1.56 376.29 241.36 phosphodiesterase 2A, cGMP-‐stimulated17311533 Deptor 3.136E-‐03 up 1.56 215.27 138.15 DEP domain containing MTOR-‐interacting protein17274415 Asap2 3.850E-‐04 up 1.56 95.96 61.70 ArfGAP with SH3 domain, ankyrin repeat and PH domain 217438963 Ppbp 6.530E-‐04 up 1.55 80.49 51.92 pro-‐platelet basic protein17292871 Dbn1 2.777E-‐03 up 1.55 352.14 227.37 drebrin 117377464 Cst7 1.072E-‐03 up 1.55 1948.45 1260.79 cystatin F (leukocystatin)17500716 Slc7a2 7.693E-‐03 up 1.54 46.66 30.23 solute carrier family 7 (cationic amino acid transporter, y+ system), member 217296084 Zswim6 2.293E-‐03 up 1.54 574.96 372.79 zinc finger, SWIM domain containing 617467806 Tcf7l1 1.460E-‐03 up 1.54 74.57 48.39 transcription factor 7 like 1 (T cell specific, HMG box)17463973 Plekha5 4.111E-‐03 up 1.54 225.37 146.40 pleckstrin homology domain containing, family A member 517228349 Ier5 3.850E-‐04 up 1.54 136.15 88.46 immediate early response 517519481 Gnb5 2.359E-‐03 up 1.54 143.30 93.29 guanine nucleotide binding protein (G protein), beta 517369613 Aif1l 8.756E-‐03 up 1.53 83.70 54.54 allograft inflammatory factor 1-‐like17215097 B3gnt7 4.617E-‐03 up 1.53 177.10 115.56 UDP-‐GlcNAc:betaGal beta-‐1,3-‐N-‐acetylglucosaminyltransferase 717374880 Tyro3 1.238E-‐03 up 1.53 75.29 49.14 TYRO3 protein tyrosine kinase 317287536 Tspan17 8.030E-‐04 up 1.53 381.96 249.27 tetraspanin 1717510994 Il27ra 2.235E-‐03 up 1.53 121.14 79.06 interleukin 27 receptor, alpha17547877 Deptor 3.660E-‐04 up 1.53 140.94 92.14 DEP domain containing MTOR-‐interacting protein17272877 Tbc1d16 7.613E-‐03 up 1.53 187.88 122.97 TBC1 domain family, member 16
17273984 Wdr35 2.274E-‐03 up 1.53 116.35 76.23 WD repeat domain 3517543264 Maged1 1.569E-‐03 up 1.53 46.09 30.20 melanoma antigen, family D, 117360942 Gal 3.859E-‐03 up 1.52 50.62 33.22 galanin17447979 Gpr125 7.236E-‐03 up 1.52 644.86 423.29 G protein-‐coupled receptor 12517458403 3.364E-‐03 up 1.52 157.64 103.6617345475 Ptk7 8.890E-‐04 up 1.52 76.55 50.36 PTK7 protein tyrosine kinase 717341589 Paqr4 1.118E-‐03 up 1.52 466.74 307.33 progestin and adipoQ receptor family member IV17213446 Abi2 1.610E-‐03 up 1.52 528.72 348.76 abl-‐interactor 217422659 B930041F14Rik3.610E-‐04 up 1.51 351.63 232.51 RIKEN cDNA B930041F14 gene17248304 Ubtd2 2.021E-‐03 up 1.51 895.12 592.50 ubiquitin domain containing 217354810 Afap1l1 9.540E-‐04 up 1.51 479.49 317.40 actin filament associated protein 1-‐like 117300686 Nynrin 8.520E-‐04 up 1.50 356.45 236.86 NYN domain and retroviral integrase containing17313000 Kdelr3 4.913E-‐03 up 1.50 77.57 51.55 KDEL (Lys-‐Asp-‐Glu-‐Leu) endoplasmic reticulum protein retention receptor 317264984 Nlgn2 9.479E-‐03 up 1.50 445.41 296.15 neuroligin 217349304 Tslp 2.253E-‐03 up 1.50 50.45 33.57 thymic stromal lymphopoietin17357072 Pla2g16 7.700E-‐03 up 1.50 65.31 43.51 phospholipase A2, group XVI
Transcripts Cluster Id
Gene Symbol
p value (Corrected)
Regulation
Fold change (FC)
Average Expression -‐DMSO
Average Expression -‐UNC1999
Average Expression -‐UNC2400 Gene description
17233273 Dcbld1 5.550E-‐04 up 2.731 45.93 125.46 46.22 discoidin, CUB and LCCL domain containing 117293103 Gkap1 5.550E-‐04 up 3.048 131.72 401.45 117.88 G kinase anchoring protein 117427147 Cdkn2a 5.550E-‐04 up 3.088 67.46 208.34 70.00 cyclin-‐dependent kinase inhibitor 2A17276674 Gphn 5.990E-‐04 up 1.579 717.49 1132.89 712.85 gephyrin17356288 Ctsf 5.990E-‐04 up 2.578 44.70 115.25 46.18 cathepsin F17415606 Nfia 5.990E-‐04 up 1.830 76.96 140.80 79.47 nuclear factor I/A17215576 Agap1 8.040E-‐04 up 2.193 224.26 491.87 194.58 ArfGAP with GTPase domain, ankyrin repeat and PH domain 117223283 Satb2 9.420E-‐04 up 2.059 176.97 364.46 185.34 special AT-‐rich sequence binding protein 217310912 Laptm4b 1.381E-‐03 up 2.737 266.56 729.69 272.39 lysosomal-‐associated protein transmembrane 4B17290420 Zmynd11 2.368E-‐03 up 1.521 515.00 783.08 535.94 zinc finger, MYND domain containing 1117240226 Marcks 2.416E-‐03 up 2.478 48.54 120.30 55.72 myristoylated alanine rich protein kinase C substrate17218349 Glul 2.733E-‐03 up 1.716 350.97 602.40 396.75 glutamate-‐ammonia ligase (glutamine synthetase)17277170 Acot6 2.733E-‐03 up 1.714 46.74 80.13 44.77 acyl-‐CoA thioesterase 617422659 B930041F14Rik2.733E-‐03 up 2.286 164.15 375.29 178.04 RIKEN cDNA B930041F14 gene17220059 Cdc42bpa 3.076E-‐03 up 3.038 30.14 91.58 30.03 CDC42 binding protein kinase alpha17236288 Igf1 3.874E-‐03 up 3.994 44.67 178.40 48.27 insulin-‐like growth factor 117520886 Ryk 3.874E-‐03 up 3.527 79.64 280.92 62.06 receptor-‐like tyrosine kinase17257405 Tanc2 3.910E-‐03 up 2.394 36.60 87.60 37.69 tetratricopeptide repeat, ankyrin repeat and coiled-‐coil containing 217249542 septin 8 4.579E-‐03 up 1.645 104.84 172.45 110.20 septin 817397497 Foxo1 4.710E-‐03 up 1.546 108.14 167.17 112.88 forkhead box O117228751 Rabgap1l 4.976E-‐03 up 1.773 114.45 202.98 109.62 RAB GTPase activating protein 1-‐like17363025 Stx3 4.976E-‐03 up 2.755 92.91 255.97 102.57 syntaxin 317404585 Zmat3 5.126E-‐03 up 2.858 119.13 340.46 134.30 zinc finger matrin type 317433977 Agrn 5.235E-‐03 up 1.748 97.53 170.43 97.25 agrin17235243 Efna2 5.463E-‐03 up 1.532 56.08 85.91 58.06 ephrin A217318950 Csf2rb2 5.463E-‐03 up 1.925 1029.97 1982.32 1131.06 colony stimulating factor 2 receptor, beta 2, low-‐affinity (granulocyte-‐macrophage)
Supplemental Table S4. List of the transcripts found commonly up regulated after combining the studies done in Supplemental Table S2 with new treatment studies (an additional MLL-‐ENL line treated with 3uM of compounds for 4-‐5 days and the MLL-‐AF9-‐GFP line treated with 2uM of
compounds for 3 days) in the microarray analysis, with a cut-‐off of >1.5-‐fold and p <0.01.
17535607 Slc6a8 5.463E-‐03 up 2.520 133.44 336.31 156.05 solute carrier family 6 (neurotransmitter transporter, creatine), member 817545785 Cdkl5 7.182E-‐03 up 1.584 31.07 49.23 30.86 cyclin-‐dependent kinase-‐like 517371019 Tanc1 7.196E-‐03 up 1.834 68.18 125.04 55.10 tetratricopeptide repeat, ankyrin repeat and coiled-‐coil containing 117376541 Prnp|Prnd 7.196E-‐03 up 1.756 58.65 103.02 70.63 prion protein | prion protein dublet17417551 Zswim5 7.196E-‐03 up 2.913 53.39 155.52 58.47 zinc finger, SWIM domain containing 517529398 Me1 7.791E-‐03 up 1.870 36.58 68.40 40.91 malic enzyme 1, NADP(+)-‐dependent, cytosolic17294458 Rhobtb3 8.629E-‐03 up 3.662 66.08 242.03 67.51 Rho-‐related BTB domain containing 317402193 Arhgap29 8.629E-‐03 up 1.895 34.06 64.54 33.59 Rho GTPase activating protein 2917313000 Kdelr3 8.720E-‐03 up 2.170 87.84 190.61 92.00 KDEL (Lys-‐Asp-‐Glu-‐Leu) endoplasmic reticulum protein retention receptor 317224771 Serpine2 9.319E-‐03 up 3.880 64.49 250.24 60.37 serine (or cysteine) peptidase inhibitor, clade E, member 217308361 Bmp1 9.319E-‐03 up 1.609 38.59 62.12 42.13 bone morphogenetic protein 117355722 Sall3 9.319E-‐03 up 1.583 38.07 60.29 40.22 sal-‐like 3 (Drosophila)17414277 Zfp462 9.319E-‐03 up 1.775 60.33 107.11 55.38 zinc finger protein 46217540059 Porcn 9.408E-‐03 up 1.656 75.98 125.80 81.77 porcupine homolog (Drosophila)17548987 2810025M15Rik9.841E-‐03 up 2.561 105.75 270.79 90.46 RIKEN cDNA 2810025M15 gene17326510 Pros1 9.880E-‐03 up 2.011 44.74 89.97 54.09 protein S (alpha)17339013 Emr1 9.880E-‐03 up 1.943 256.73 498.79 337.20 EGF-‐like module containing, mucin-‐like, hormone receptor-‐like sequence 117370807 Fmnl2 9.880E-‐03 up 2.616 34.32 89.79 32.88 formin-‐like 217405746 Rarres1 9.880E-‐03 up 1.869 49.89 93.23 48.42 retinoic acid receptor responder (tazarotene induced) 1
Supplementary Table S5. Summary of ChIP-Seq reads that are uniquely aligned.
Cell treatmet Epitope Total Raw Reads
Uniquely aligned reads (by BWA)
Input 25,565,885 13,855,275Suz12 21,763,346 18,353,657
H3K27me3 35,999,158 21,671,310Input 45,104,771 34,519,509
UNC1999 H3K27me3 16,596,001 8,945,791Suz12 8,016,615 7,112,901H3K27ac 35,875,595 30,451,729Input 46,841,361 33,996,489
UNC2400 H3K27me3 27,155,935 21,597,799Suz12 13,710,323 12,033,327H3K27ac 35,987,395 29,501,658
Mock
Supplemental Table S6. Information of primers used in this study
Gene ID Forward primer Reverse primer Note/ReferenceRT-‐qPCR of murine genesp16Ink4a GTGTGCATGACGTGCGGG GCAGTTCGAATCTGCACCGTAG Agger K, et al Genes &Devp19Arf GCTCTGGCTTTCGTGAACATG TCGAATCTGCACCGTAGTTGAG Agger K, et al Genes &DevEgr1 CCTATGAGCACCTGACCACA TCGTTTGGCTGGGATAACTC Tanaka et al. Blood Ezh2 AGACGTCCAGCTCCTCTGAA ATCCTCAGTGGGAACAGGTG Hunkapiller, J. et al. PLoS genetics 8, e1002576 (2012).Suz12 GTGCACTCTGAACTGCCGTA CCGGTCCATTTCGACTAAAA Hunkapiller, J. et al. PLoS genetics 8, e1002576 (2012).HoxA9 ACAATGCCGAGAATGAGAGC CAGCGTCTGGTGTTTTGTGTKdm5b CATGATCGAGGACGAGAAAG ATACACTGCCGCTCATCATCBcl11a AACCCCAGCACTTAAGCAAA ACAGGTGAGAAGGTCGTGGTTet1 CCTCACAGGCACAGGTTACA ATTTGGGGCCATTTACTGGTGata1 CAGGTTCAACCCCAGTGTTCC CCCTCCATACTGTTGAGCAGTGGNFI-‐A TGGCATACTTTGTACATGCAGC ACCTGATGTGACAAAGCTGTCCβ-‐actin ACCAACTGGGACGACATGGA GGTCTCAAACATGATCTGGGTCATGapdh TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
ChIP-‐qPCR of murine genesChr8 intragenic AAGGGGCCTCTGCTTAAAAA AGAGCTCCATGGCAGGTAGA H3K27me3+; Wang et al 2009Actb tss TTGATAGTTCGCCATGGATGACGA ATCGATCCCCAAGAAAACCCCA H3K27me3-‐; Wang et al 2009Cdkn2a -‐ a AAAACCCTCTCTTGGAGTGGG GCAGGTTCTTGGTCACTGTGAG p19ARF TSS Tanaka et al. Blood Cdkn2a -‐ b CTTAGAGTTACAGAAAGGGCTGGA GAATTTCAAGGAAGTGCTACCCTA p19ARF_TSS_+2Kb Tanaka et al. Blood Cdkn2a -‐ d AACAGGGGAACGGAGAGTTT TCCAGACACACAAATGCACA p16Ink4a_TSS_-‐2KbCdkn2a -‐ e GATGGAGCCCGGACTACAGAAG CTGTTTCAACGCCCAGCTCTC p16Ink4a_TSS Tanaka et al. Blood Cdkn2a -‐ f AGGGAATACACTGTAAGCCTGTGT TTAACTACTCGGATCAGACATCCA near p16Ink4a_exon2 Tanaka et al. Blood Cdkn2a -‐ g GCCACATGCTAGACACGCTA AGAGCAGAGCTAAATCCGGC p16Ink4a_exon3Cdkn2a -‐ h AAGACCATATACCGGCTGGA CCTCTCCCATTGAGACCAGA p16Ink4a_TES_+2KbHoxA1_tss gactccctttggtcccagtg tgatggatcaccgtttcagtgHoxA7_tss AACCCTTCCCCTAAACGCCTC AAAAGGTCGCCAGTCTTCCAGHoxA9_tss ATCTGTATGCCTAGTCCCGCTCC TTGATGTTGACTGGCGATTTTCHoxA13_tss CTATGACAGCCTCCGTGCTC CCCCTTCCATGTTCTTGTTG