The involvement of human-nuc gene in polyploidization of K562 cell line
Giuliana Cavalloni
a
, Alessandra Danè
a
, Wanda Piacibello
a
,Stefania Bruno
a
, Eugenia Lamas
b
, Christian Bréchot
b
, and Massimo Aglietta
a
a
Department of Biomedical Sciences and Human Oncology, Hematology/Oncology Section, University of Torino, Torino, Italy and Institutefor Cancer Research and Treatment (IRCC) Candiolo, Torino, Italy;
b
INSERM U370, University of Paris Necker Enfants-Malades, Paris, France
(Received 8 March 2000; revised 8 August 2000; accepted 21 August 2000)
Objective.
During megakaryocyte differentiation, the immature megakaryocyte increases itsploidy to a 2
x
DNA content by a process called endomitosis. This leads to the formation of a gi-ant cell, the mature megakaryocyte, which gives rise to platelets. We investigated the role ofhuman-nuc (h-nuc), a gene involved in septum formation in karyokynesis in yeast, duringmegakaryocytic polyploidization.
Materials and Methods.
Nocodazole and 12-O-tetradecanoylphorbol-13-acetate (TPA) wereused to induce megakaryocytic differentiation in K562 cell line. The ploidy distribution andCD41 expression of treated K562 cells were evaluated by flow cytometry. Using quantitativereverse transcriptase polymerase chain reaction (RT-PCR), we analyzed the h-nuc mRNA ex-pression on treated K562 cells.
Results.
Mature megakaryocyte-like polyploid cells were detected at day 5–7 of treatmentwith nocodazole. TPA also had a similar effect on K562 cells, but it was much weaker thanthat of nocodazole. The analysis of ploidy of nocodazole-treated K562 cells showed that no-codazole preferentially induced polyploidization of K562 cell line with a pronounced increaseof the cells 8N at day 7 of culture. Expression of CD41, a differentiation-related phenotype,was significantly induced by TPA after 7 days of treatment, showing that functional matura-tion was mainly induced by TPA. In contrast, there was no significant increase in CD41 ex-pression in nocodazole-treated K562 cells, suggesting that polyploidization and functionalmaturation are separately regulated during megakaryocytopoiesis. RT-PCR analysis indi-cated that h-nuc mRNA increased after 72 hours in the presence of nocodazole, preceding theinduction of polyploidization.
Megakaryocytic differentiation is a complex process char-acterized by an increase of promegakaryoblast ploidy andcell size, synthesis of specific proteins, such as platelet fac-tor 4, and
b
-thromboglobulin, and surface expression ofCD41, CD42, and CD61. This leads to the formation of gi-ant cells that give rise to platelets, anucleated blood ele-ments formed by fragmentation of mature megakaryocytes
[1,2]. Polyploidization is due to endomitosis, a process thatconsists of repeated nuclear replications in the absence ofcytokinesis and karyokinesis [3]. It has been shown that en-domitosis is a major cause of megakaryocyte polyploidiza-tion, although the underlying mechanism is poorly charac-terized [4]. Normal mitosis is controlled by a group ofproteins (cyclins, cyclin-dependent kinases [CDKs], and cy-clin-dependent kinase inhibitors). Among them, alterationsin the maturation promoting factor and in cyclins D and B,cdk1, and p21 have been reported in endomitotic cycle [5–8]. At the end of normal mitosis, the cytoplasmic separation(cytokinesis), preceded by septum formation, occurs, lead-ing to the formation of two cells, but in the megakaryocytecell cycle, megakaryoblastic cells escape mitosis, bypassing
Offprint requests to: Wanda Piacibello, M.D., Ph.D., Department of Bio-medical Sciences and Human Oncology, Hematology/Oncology Section,University of Torino and Institute for Cancer Research and Treatment(IRCC) Str. Provinciale 142 Km 3.95, 10060 Candiolo, Torino, Italy; E-mail:[email protected]
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
1433
cytoplasmic separation and entering into a new cycle ofDNA replication. The regulation of the events, which oc-curs at the end of the cell cycle, such as reorganization ofcytoskeleton and initiation of cell separation, is poorly un-derstood. Recently, several proteins involved in differentphases of mitosis were characterized. Among them a mem-ber of tetratricopeptide repeat (TPR) family [9], nuc-2, is anovel cell cycle regulator essential for exit from mitosis.Previous works established that nuc-2 is required for mitoticchromosome disjunction in Schizosaccharomyces pombe.Its mutation arrests mitosis at metaphase [10]. In addition,nuc-2 plays a role in G1 arrest and also in septation and cy-tokinesis. Ectopic expression of nuc-2 gene has demon-strated that the overproduced nuc-2 protein acts as a potentinhibitor of septum formation [11].
Based on recent data showing the involvement of nuc-2genes on yeast polyploid cell formation, we focused ourstudies on the role of the human homologue of yeast nuc-2(h-nuc) gene [12] in megakaryocytic polyploidization. Toinvestigate the involvement of h-nuc in the induction ofmegakaryocyte polyploidization, we treated K562 cells withnocodazole and 12-O-tetradecanoylphorbol-13-acetate (TPA)and examined their morphology, ploidy, expression of dif-ferentiation-related phenotypes (CD41), and h-nuc mRNAexpression. In this report, we present the evidence that h-nuc gene might be involved in megakaryocytic polyp-loidization via inhibition of septum formation.
Materials and methods
Cells and cell cultures
Human leukemic cell line K562 was routinely maintained in RPMI1640 medium with 10% heat-inactivated fetal calf serum (FCS;Life Technologies Inc, Grand Island, NY, USA). For induction ofmegakaryocytic differentiation, K562 cells were cultured in thepresence of 100 ng/mL nocodazole or 100 nM TPA. K562 cellswere also treated with 0.1% dimethylsulfoxide (DMSO), whichwas used as a solvent for nocodazole and TPA. For erythroid dif-ferentiation K562 were cultured in the presence of 50 U/mL eryth-ropoietin (Eprex, Cilag, Milan, Italy). Viable cell counts were per-formed by trypan blue dye exclusion. Polyploid cells wereobserved at light microscope on May Grunwald-Giemsa stainedcytospin slides and the percentage of polyploid cells was deter-mined by cytofluorimetric analysis.
Reagents
Nocodazole was purchased from Sigma Chemical Co. (St. Louis,MO, USA), diluted at 50
m
g/mL in dimethylsulfoxide (DMSO) andstored at
2
20
8
C until use. 12-O-tetradecanoylphorbol-13-acetate(TPA) was purchased from Sigma Chemical.
Immunolabeling for flow cytometric analysis
Cultured cells were washed in phosphate-buffered saline (PBS)before fixation in 80% ethanol. Cells were maintained for at least24 hours at
2
20
8
C, washed in PBS containing 1% bovine serumalbumin (BSA), and labeled with fluorescein-isothiocyanate-con-jugated (FITC) anti GP-IIb-IIIa (CD41) (Dako A/S, Glostrup,
Denmark). Thereafter, the cells were incubated for 1 hour at 4
8
Cwith propidium iodide (1
m
g/mL) to stain the DNA in a solutioncontaining RNase (200
m
g/mL) and 0.1% Tween 20. Cell sampleswere analyzed on a FACScan (Becton-Dickinson, San Jose, CA,USA) equipped with an argon ion laser. CellFIT program (Becton-Dickinson) was used to analyze the CD41 expression, and ModFitprogram (Becton-Dickinson) was used to calculate percentage ofpolyploid and apoptotic cells.
Isolation of total RNA and cDNA synthesis
Trizol (Gibco BRL Life Technologies, Gaithersburg, MD, USA)was used to extract total RNA from cultured cells. Cells werewashed with PBS and 1 mL of trizol/10
6
cells was added. The cellswere lyzed by passing through the pipette a few times. One-tenthv/v chloroform was added, and the sample was capped, shakenvigorously, and incubated for 5 minutes in ice. The suspension wascentrifuged at 12,000
g
at 4
8
C for 15 minutes. The RNA in theaqueous phase was transferred to a clean tube. The RNA was pre-cipitated with an equal volume of isopropanol, stored for 15 min-utes at 4
8
C, and pelleted by centrifugation at 8000
g
for 8 minutesat 4
8
C. The RNA pellet was washed twice with 75% ethanol, airdried, and resuspended in DEPC-treated water.
Contaminating chromosomal DNA was digested with DNase I(Boehringer Mannheim, Mannheim, Germany) according to themanufacturer’s instructions. Samples were then tested for Bax pro-moter to detect residual DNA. 200 ng of RNA were subjected to a50
m
L PCR buffer reaction containing a final concentration of 1XPCR buffer, supplemented with MgCl
2
, 200
m
M dNTPs, 20 pmolBax forward amplification primer (5
9
-AGCGCTTTGGAAG-GCTGA-3
9
) and 20 pmol Bax reverse amplification primer(5
9
-AGCGCAGAAGGAATTAGC-3
9
) and 0.5 units of Taq DNApolymerase (Gibco BRL). Reactions were heated to 95
8
C for 2minutes and then subjected to 35 cycles of 94
8
C for 15 seconds,62
8
C for 45 seconds. PCR products were analyzed on 2% agarosegel. Total RNA was used as a template for synthesis of oligodT-primed double stranded cDNA, in 1X RT buffer (Gibco BRL) sup-plemented with 0.01 M dithiotreitol (DTT), 200 units of clonedMoloney murine leukemia virus reverse transcriptase (GibcoBRL), 1 mM of each dNTP (Gibco BRL), and 200 units of RNaseinhibitor (Boehringer Mannheim) in a final volume of 25
m
L incu-bated at 42
8
C for 45 minutes.
Real-time quantitative RT-PCR
Quantitation of h-nuc mRNA expression and GAPDH mRNA ascontrol was obtained by real-time quantitative reverse transcriptasepolymerase chain reaction (RT-PCR). PCR was carried out in 50
m
L of master mix containing 10 mM Tris-HCl pH 8.3, 50 mMKCl, 1.5 mM MgCl
2
, dNTPs at 0.2 mM, forward and reverse prim-ers at 15 pmol, and Taq polymerase at 5 U/100
m
L. The h-nuc genewas amplified with h-nuc forward primer 5
9
GTCCCAGGCTGC-TATATGG3
9
and h-nuc reverse primer 5
9
AAAGGCGTTCTG-CGAGG; the human GAPDH gene was amplified with GAPDHforward primer 5
9
GAAGGTGAAGGTCGGAGTC3
9
and GAPDHreverse primer 5
9
GAAGATGGTGATGGGATTTC3
9
. The reac-tions also contained one of the following detection probes (200mM each): h-nuc-probe FAM-5
9
CACTAAACCACTATGCTTA-CCGAGATGCGGTTT3
9
-TAMRA and GAPDH-probe JOE-5
9
CAAGCTTCCCGTTCTCAGCC3
9
-TAMRA (Perkin Elmer, Fos-ter City, CA, USA). Probes and primers were designed using theOligo 4.0 software, following guidelines suggested in the Model
1434
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
7700 Sequence Detector instrument manual. All PCR reactionswere performed in triplicate in special optical tubes in a 96-wellmicrotiter plate format on an ABI PRISM 7700 Sequence DetectorSystem (Perkin Elmer). The thermal cycling conditions included 2minutes at 50
8
C and 10 minutes at 95
8
C. Thermal cycling pro-ceeded with 40 cycles at 95
8
C for 0.5 minutes and 60
8
C for 2 min-utes. All reactions were performed in the Model 7700 SequenceDetector (PE Applied Biosystems, Foster City, CA), which con-tains a Gene-Amp PCR System 9600. Reaction conditions wereprogrammed on a Power Macintosh 7100 (Apple Computer, SantaClara, CA, USA) linked directly to the Model 7700 sequence De-tector. Analysis of data was also performed on the Macintosh com-puter. Collection and analysis software was developed at PE Ap-plied Biosystems.
Analysis and expression of data
Real-time RT-PCR is based on the use of the 5
9
nuclease activityof Taq polymerase to cleave a nonextendible hybridization probeduring the extension phase of a PCR. A target specific probe, inthis case h-nuc, labeled with a reporter fluorescent dye, FAM (6-carboxyfluorescein), at the 5
9
end and a fluorescence dyequencher, TAMRA (6-carboxy-tetramethyl-rhodamine), at the 3
9
end, hybridized to the target. During the extension phase of thePCR, the nucleolytic activity of the Taq DNA polymerase cleavesthe probe from the target, and releases the reporter fluorescent dyefrom the vicinity of the fluorescence dye quencher. This processresults in augmentation of a specific FAM fluorescence signal. Foreach sample, the ABI-Prism 7700 software provided an amplifica-tion curve constructed by relating the fluorescence signal intensity(
D
Rn) to the cycle number. The
D
Rn value corresponds to the vari-
ation in the reporter fluorescence intensity before and after PCR,normalized to the fluorescence of an internal passive reference.For the amplification curve it is possible to determine the parame-ter Ct (threshold cycle), defined as that PCR cycle at which the re-porter fluorescence dye, cleaved from the h-nuc probe, generates atarget-specific detection signal (
D
Rn) that passes the thresholdabove the baseline. The larger the starting copy number of h-nuccDNA, the sooner the specific signal is detected and the lower isthe Ct value.
The amount of target, normalized to an endogenous referenceand relative to a calibrator, is given by 2
2DD
Ct
.
Results
Morphology and ploidy distributionin nocodazole and TPA-treated K562 cells
In this study, two different types of pharmacologic cell cy-cle modulators (nocodazole and TPA) were used to investi-gate the mechanism of megakaryocytic differentiation. No-codazole arrests cells at M phase by inhibition of actinpolymerization. TPA is a well-known inducer of differentia-tion, thereby arresting cells in G
1
phase. K562 cells wereseeded at an initial concentration of 5
3
10
5
mL in the ab-sence or presence of either nocodazole (100 ng/mL) or TPA(100 nM). Cell counts and morphologic changes were ob-served over a 7-day period. Figure 1 shows morphology ofK562 cells in absence (A and B) or presence (C and D) ofnocodazole observed at day 7 of treatment. Control cultures
Figure 1. May Grunwald-Giemsa staining of K562 cell line. K562 cells were cultured in the absence (A and B) or presence (C and D) of nocodazole (100 ng/mL) for 7 days. (Original magnification 403: A and C; 1003: B and D).
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
1435
of K562 cells, which kept growing, contained predomi-nantly mononuclear cells. In contrast, cell counts and mor-phology of K562 cells changed considerably after exposureto nocodazole. Cells stopped growing and became largerand appeared polyploid. TPA also had a similar effect onK562 cells but it was much weaker than that of nocodazole(data not shown). The ploidy distribution of K562 cells withor without nocodazole was evaluated by flow cytometry af-ter DNA staining with propidium iodide. Figures 2A and Bshow a representative ploidy distribution of K562 cells in-cubated in the absence or presence of nocodazole for 7 days.In control conditions, cells were primarily 2N. The analysisof ploidy of viable K562-treated cells showed that 48 hoursafter nocodazole treatment a large population of cells was
4N (
.
80%) and only a small fraction of 8N cells was de-tected. After 72 hours 70% of cells were 4N and a signifi-cant population of 8N was observed (15%), while the frac-tion of 8N cells was higher after 7 days of treatment (43%)concomitant with the decrease of 4N cells. Under these con-ditions we also analyzed apoptosis induction in K562 cul-ture after exposure to nocodazole. Number of apoptoticcells was evaluated on PI stained K562 cells and calculatedby using ModFit program, by the percentage of cells in thesub-2N peak (Fig. 2A). The percentage of apoptotic cellsobtained after nocodazole treatment is in agreement withthose obtained by Casenghi et al. [13] and Verdoodt et al.[14], which demonstrate that long-term treatment (72 hours)of K562 cells with nocodazole essentially induces poly-
Figure 2. (A) Changes in the ploidy distribution and apoptosis in K562 cells induced by nocodazole. Histograms of propidium iodide–stained K562 cells cul-tured in absence or presence of 100 ng/mL nocodazole for 7 days. Flow cytometric analysis at 48 hours, 72 hours, and 7 days of culture. (B) Quantitative anal-ysis of apoptotic cells and viable cells with different DNA content after nocodazole exposure. ModFit program was used to calculate the percentage of viablepolyploid cells and apoptotic cells.
1436
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
ploidization of K562 cells, although a large population ofapoptotic cells was also found.
Effect of nocodazole and TPA on CD41 expression
The expression of differentiation-related phenotypes wasthen examined in K562 cells treated with DMSO, nocoda-zole, and TPA as described above. We used CD41 as a spe-cific marker for megakaryocytic differentiation measuredby direct immunofluorescence staining and flow cytometryanalysis. As shown in Figure 3, CD41 expression was sig-nificantly induced by TPA [15]; after 7 days of treatmentthe percentage of CD41
1
cells was about 40%. By contrast,
no significant increase in CD41 expression in nocodazole-treated K562 cells (2% of CD41
1
cells) was detectable.In DMSO-treated K562 cells no modification in CD41
expression and ploidy was observed (data not shown).Our data showed that polyploidization was preferentially
induced by nocodazole and functional maturation (i.e.,CD41 expression) was mainly induced by TPA, suggestingthat polyploidization and functional maturation are sepa-rately regulated during megakaryocytic differentiation.
h-nuc mRNA is implicated in polyploidization
We hypothesized that a mechanism for the acquisition of apolyploid DNA content may be inhibition of septum forma-tion by an increase of h-nuc mRNA expression. Its functionin yeast is required for exit from mitotic metaphase. In addi-tion, strong ectopic expression of nuc2 inhibits septum for-mation, producing long, multinucleated cells [11]. To deter-mine whether h-nuc is associated with polyploidization, weexamined h-nuc mRNA levels in K562 polyploid cells. To-tal cellular RNA was isolated from K562 cells cultured inthe absence or presence of either TPA (100 nM) or nocoda-zole (100 ng/mL), for 7 days and the h-nuc elevation in en-domitotic cells was determined by analysis of h-nuc mRNAlevels by quantitative RT-PCR (real-time). Table 1 shows arelative quantitation using comparative Ct methods of a rep-resentative experiment out of three. As shown in Figure 4A,h-nuc mRNA transcript, after an initial transient decrease,increased after 72 hours of culture with nocodazole when15% of cells are 8N. At day 7, when the highest percentageof 8N K562 cells (43%) was detected, a sevenfold increaseof h-nuc transcript was found. At day 10 of culture whenmost cells were apoptotic (
.
80%) and only 5% of viablecells were 8N, a dramatic decrease of h-nuc transcript wasobserved (data not shown). These results suggest that no-codazole treatment did not select an apoptosis-resistant pop-ulation because at day 10 of culture almost all cells weredead and an increase of h-nuc mRNA was associated withthe presence of the highest percentage of 8N cells. On theother hand, h-nuc mRNA induction by TPA was negligible(Fig. 4B). In addition, there was no increase of h-nucmRNA during erythroid differentiation of K562 (Fig. 4C).Decrease of h-nuc expression was also observed, in the first60 hours of TPA treatment and in all periods of culture inEpo-treated K562 cells. Figure 5 shows the representativeamplification curves of GAPDH and h-nuc gene in K562cells treated with and without nocodazole for 7 days. Thepattern of h-nuc induction by nocodazole treatment is wellcorrelated with its ability to induce polyploidization, sug-gesting that h-nuc might play a role in polyploidization dur-ing megakaryocytic differentiation.
Discussion
Blood platelets result from the fragmentation of polyploidmegakaryocyte cytoplasm [16]. Megakaryocyte polyploidiza-
Figure 3. Changes in CD41 expression in K562 cell line induced by TPAand nocodazole. K562 cells were cultured in absence (A) or presence ofeither TPA (B) or nocodazole (C). Cells were subjected to direct immuno-fluorescence staining and flow cytometry analysis for measurement ofCD41 expression.
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
1437
tion is due to a process named endomitosis, resulting fromthe lack of cytoplasmic separation while the nucleus keepsdividing [17]. A normal cell cycle in most eukaryotic cellsconsists of a regulated sequence of phases including DNAsynthesis (S) followed by a gap (G
2
), mitosis (M), and a gap(G
1
). Two families of proteins make up the protein-kinasecomplexes involved in the biochemical control of the cellcycle. The cell division kinases, also referred to as cyclin-dependent kinases (CDKs), are the catalytic subunits ofthese complexes, whereas cyclins function as the regulatorysubunits [18–20]. In the past few years much progress hasbeen made in understanding the role of CDKs and cyclinprotein in megakaryocyte endomitosis. Two main hypothe-ses have been proposed to explain megakaryocyte poly-ploidization by endomitosis. First, megakaryocyte cell cycleis abnormal with the absence of mitosis and consists of al-ternating resting phase (G1
1
G2) and S phase up to the 2
x
Nploidy level. Several recent reports on cell cycle regulationduring polyploidization demonstrated an alteration in cdk1kinase activity, which is necessary for entry into mitosis[5,7,21,22]. Second, it is possible that endomitosis may cor-respond to an abortive mitosis. Recent studies showed thatpolyploidization in megakaryocytic cell lines is associatedwith reduced levels of cyclin B1 protein, but not of cyclinB1 mRNA, as compared with the levels in diploid cells[23]. Synthesis of cyclin B1 is important for G2/M transi-tion, but low levels of cyclin B1 may also be needed for Sphase. In addition, cyclin B1 half-life in polyploidizing cellsis decreased. This suggests that a reduced level of cyclin B1during endomitosis reflects an enhanced ability in abrogatemitosis [6]. Recent investigations showed that p21 mRNA(a recently identified universal inhibitor of cyclin-depen-
dent kinases that is capable of inducing cell cycle arrest)was induced before polyploidization of megakaryocytes,suggesting that p21 is implicated in this process by sup-pressing cdk1 activity [8].
Recently, a novel relationship was found among a groupof mitotic genes that include budding yeast CDC16,CDC23, fission yeast nuc2, and filamentous fungi BimA[24]. These genes belong to the TPR (tetratricopeptide)family. The product of this family contains multiple copiesof a 34-amino acid motif that are presumed to form helix-turn structures, each with a “knob” and “hole,” acting as he-lix-associating domains [9]. CDC16 and CDC23 mutationsinduce arrest before entry into mitosis (G2/M) after DNAreplication [25,26]. The Schizosaccaromyces pombe nuc2gene is required for mitotic chromosome disjunction andvarious nucleoskeletal functions [10]. Its mutations arrestmitosis in metaphase. In addition, nuc2 is also needed inregulation formation of the division septum. Furthermore,strong ectopic expression of nuc2 inhibits septum forma-tion, producing long, multinucleated cells [11]. Recently thefull-length cDNA of human homologue of yeast nuc2(h-nuc), which interacts with the retinoblastoma protein in aspecific manner through TPR motifs, was characterized. Itwas postulated that the interaction between Rb and h-nucmay play a role in regulating metaphase progression [12].
We hypothesized that the endomitotic process might bethe consequence of alteration in h-nuc mRNA expression,which results in inhibition of septum formation, cytokinesis,and subsequent entry into DNA reduplication cycles. The invitro differentiation of K562 cells induced by TPA and no-codazole has been used as a model for studying the molecu-lar events associated with megakaryocyte polyploidization.
Table 1.
Relative quantitation of h-nuc using the comparative Ct methods
The DCt value is determined by subtracting the average GAPDH Ct value from the average h-nuc Ct value.The calculation of DDCt involves subtraction by the DCt calibrator value (K562 T0).The range given for h-nuc relative to K562 T0 is determined by evaluating the expression 22DDCt.
1438 G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
In this report we show that prolonged treatment with no-codazole induces polyploidization of K562 cells (43% of vi-able K562 cells are found to be 8N after 7 days of treat-ment), although a large population of cells was apoptotic, asdemonstrated by other authors [13,14]. In contrast, thiscompound is unable to induce an increase of specific mark-ers for megakaryocytic differentiation (i.e., CD41). On theother hand, TPA induced a dramatic increase of CD41 inK562 cells [15] but had a lesser ability to promote poly-ploidization. These data confirm the results obtained on UT-7 megakaryocytic cell line by Kikuchi et al., who demon-strated that two distinct processes, polyploidization and
functional maturation, may occur independently duringmegakaryocytic differentiation [8].
To clarify whether endomitosis in K562 cell line is ac-companied by modifications in h-nuc mRNA expression,h-nuc mRNA transcript changes were examined after expo-sure of K562 cells to nocodazole and TPA. QuantitativeRT-PCR analysis showed that when 43% of viable K562was 8N, a sevenfold increase of h-nuc mRNA was detect-able after an initial transient decrease from baseline levels.These data suggest that nocodazole increases ploidy andthat nocodazole-induced endomitosis is associated with anincrease of h-nuc transcript. It is worth noting that, while
Figure 4. Fold increase of h-nuc mRNA induced during polyploidization and erythroid differentiation of K562 cell line. K562 were cultured in absence (NT:no treated cells) or presence of 100 ng/mL nocodazole (A), 100 nM TPA (B), or 50 U/mL Epo (C) for 7 days. RNA was isolated at the given time points andsubjected to quantitative RT-PCR for h-nuc and GAPDH mRNA expression.
G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440 1439
the initial decrease in h-nuc expression was found in TPA-,Epo-, and nocodazole-treated K562 cells, the subsequentsevenfold increase was observed only in nocodazole-treatedcells and after long-term exposure, when the highest per-centage of 8N cells was obtained. Therefore we may hy-pothesize that this gene might be involved in megakaryo-cyte polyploidization, perhaps by inhibition of septumformation. Because our results were obtained using an im-mortalized cell line, the physiologic role of h-nuc in mega-karyocyte polyploidization should be confirmed using nor-mal human megakaryocytes. We currently focused ourstudies on analysis of h-nuc transcript level in a liquid cul-ture of cord blood CD341 cells. Preliminary results demon-strate that also in CD411 polyploid cells a low increase ofh-nuc mRNA levels could be detected, confirming the re-sults obtained with nocodazole-treated K562 cells (manu-script in preparation).
In summary, h-nuc might be a partly regulatory compo-nent in polyploidization.
AcknowledgmentsSupport of this work was provided by grants from AssociazioneItaliana per la Ricerca sul Cancro (AIRC; Milano, Italy) and fromthe Ministero dell’Università e della Ricerca Scientifica e Tecno-logica (MURST) to W. Piacibello and to M. Aglietta. A. Danè is arecipient of the FIRC grant; G. Cavalloni is a recipient of the “G.Ghirotti Foundation,” sez. Piemonte grants.
References1. Hoffman R (1989) Regulation of megakaryocytopoiesis. Blood 74:
11962. Avraham H (1993) Regulation of megakaryocytopoiesis. Stem Cells
11:4993. Odell TT, Jackson CW (1968) Polyploidization and maturation of rat
megakaryocytes. Blood 32:1024. Brodsky WY, Uryvaeva IV (1977) Cell polyploidy: its relation to tis-
sue growth and function. Int Rev Cytol 50:2755. Wang Z, Zhang Y, Kamen D, Lees E, Ravid K (1995) Cyclin D3 is es-
sential for megakaryocytopoiesis. Blood 86:37836. Vitrat N, Cohen-Solal K, Pique C, et al. (1998) Endomitosis of human
megakaryocytes is due to abortive mitosis. Blood 91:37117. Datta NS, Williams JL, Caldwell J, Curry AM, Ashcraft EK, Long
MW (1996) Novel alteration in CDK1/Cyclin B1 kinase complex for-mation during the acquisition of a polyploid DNA content. Mol BiolCell 7:209
8. Kikuchi J, Furukawa Y, Iwase S, et al. (1997) Polyploidization andfunctional maturation are two distinct processes during megakaryo-cytic differentiation: involvement of cycline-dependent kinase inhibi-tor p21 in polyploidization. Blood 89:3980
9. Goebel M, Yanagida M (1991) The TPR snap helix: a novel protein re-peat motif from mitosis to transcription. TIBS 16:173
10. Hirano T, Hiraoka Y, Yanagida M (1988) A temperature-sens mutationof the S. pombe gene nuc-21 that encodes a nuclear scaffold-proteinblocks spindle elongation in mitotic anaphase. J Cell Biol 106:1171
11. Kunada K, Su S, Yanagida M, Toda T (1995) Fission yeast TPR-fam-ily protein nuc-2 is required for G1-arrest upon nitrogen starvation andis an inhibitor of septum formation. J Cell Science 108:895
12. Chen PL, Ueng YC, Durfee T, Chen KC, Yang-Feng T, Lee WH(1995) Identification of a human homologue of yeast nuc-2 which in-teracts with the retinoblastoma protein in a specific manner. CellGrowth Differentiation 6:199
Figure 5. Representative amplification curves of GAPDH (control gene) and h-nuc (target gene) in K562 cells treated with or without nocodazole for 7 days.
1440 G. Cavalloni et al./Experimental Hematology 28 (2000) 1432–1440
13. Casenghi M, Mangiacasale R, Tuynder M, et al. (1999) p-53-indepen-dent apoptosis and p53-dependent block of DNA replication followingmitotic spindle inhibition in human cells. Exp Cell Res 250:339
14. Verdoodt B, Decordier I, Geleyns K, Cunha M, Cundari E, Kirsch-Volders M (1999) Induction of polyploidy and apoptosis after expo-sure to high concentrations of the spindle poison nocodazole. Mu-tagenesis 14:513
15. Alitalo R (1990) Induced differentiation of K562 leukemia cells: amodel for studies of gene expression in early megakaryoblasts. LeukRes 14:501
16. Wright JH (1910) The histogenesis of the blood platelets. J Morphol21:263
17. Japa J (1943) A study of the morphology and development of themegakaryocytes. Br J Exp Pathol 24:73
18. Draetta G, Beach D (1988) Activation of CDC2 protein kinase duringmitosis in human cells: cell-cycle-dependent phosphorylation and sub-unit rearrangement. Cell 54:17
19. Draetta G, Luca F, Westendorf Y, Brizulea L, Ruderman Y, Beach D(1989) CDC2 protein kinase is complexed with both cyclin A and B:evidence for proteolytic inactivation of MPF. Cell 56:829
20. Murray AW, Solomon MY, Kirschner MW (1989) The role of cyclinsynthesis and degradation in the control of maturation-promoting fac-tor activity. Nature 339:280
21. Garcia P, Calés C (1996) Endoreduplication in megakaryocytic celllines is accompanied by sustained expression of G1/S cyclins anddownregulation of cdc25C. Oncogene 13:695
22. Gu XF, Allain A, Li L, et al. (1993) Expression of cyclin B in megakary-ocytes and cells of other hematopoietic lines. C R Acad Sci 316:1438
23. Zhang Y, Wang Z, Ravid K (1996) The cell cycle in polyploid mega-karyocytes is associated with reduced activity of cyclin B1-dependentcdc2 kinase. J Biol Chem 271:4266
24. Sikorski RS, Boguski MS, Goeble M, Hieter P (1990) A repeatingamino acid motif in CDC23 defines a family of protein and a new rela-tionship among genes required for mitosis and RNA synthesis. Cell60:307
25. Simanis V (1995) The control of septum formation and cytokinesis infission yeast. Sem Cell Biol 6:79
26. Hartwell LH, Smith D (1985) Altered fidelity of mitotic chromosometransmission in cell cycle mutants of S. cerevisiae. Genetics 110:381
