The Transforming Growth Factor- Superfamily Member Growth-Differentiation Factor-15 Protects the...

The Transforming Growth Factor-� Superfamily MemberGrowth-Differentiation Factor-15 Protects the Heart From

Ischemia/Reperfusion InjuryTibor Kempf, Matthias Eden, Jens Strelau, Marian Naguib, Christian Willenbockel, Jorn Tongers,

Jorg Heineke, Daniel Kotlarz, Jian Xu, Jeffery D. Molkentin, Hans W. Niessen,Helmut Drexler, Kai C. Wollert

Abstract—Data from the Women’s Health Study show that serum levels of growth-differentiation factor-15 (GDF-15), adistant member of the transforming growth factor-� superfamily, are an independent risk indicator for adversecardiovascular events. However, the cellular sources, upstream regulators, and functional effects of GDF-15 in thecardiovascular system have not been elucidated. We have identified GDF-15 by cDNA expression array analysis as agene that is strongly upregulated by nitrosative stress in cultured cardiomyocytes isolated from 1- to 3-day-old rats.GDF-15 mRNA and pro-peptide expression levels were also induced in cardiomyocytes subjected to simulatedischemia/reperfusion (I/R) via NO–peroxynitrite-dependent signaling pathways. GDF-15 was actively secreted into theculture supernatant, suggesting that it might exert autocrine/paracrine effects during I/R. To explore the in vivorelevance of these findings, mice were subjected to transient or permanent coronary artery ligation. Myocardial GDF-15mRNA and pro-peptide abundance rapidly increased in the area-at-risk after ischemic injury. Similarly, patients with anacute myocardial infarction had enhanced myocardial GDF-15 pro-peptide expression levels. As shown by immuno-histochemistry, cardiomyocytes in the ischemic area contributed significantly to the induction of GDF-15 in theinfarcted human heart. To delineate the function of GDF-15 during I/R, Gdf-15 gene-targeted mice were subjected totransient coronary artery ligation for 1 hour followed by reperfusion for 24 hours. Gdf-15–deficient mice developedgreater infarct sizes and displayed more cardiomyocyte apoptosis in the infarct border zone after I/R compared withwild-type littermates, indicating that endogenous GDF-15 limits myocardial tissue damage in vivo. Moreover, treatmentwith recombinant GDF-15 protected cultured cardiomyocytes from apoptosis during simulated I/R as shown by histoneELISA, TUNEL/Hoechst staining, and annexin V/propidium iodide fluorescence-activated cell sorting (FACS) analysis.Mechanistically, the prosurvival effects of GDF-15 in cultured cardiomyocytes were abolished by phosphoinositide3-OH kinase inhibitors and adenoviral expression of dominant-negative Akt1 (K179M mutation). In conclusion, ourstudy identifies induction of GDF-15 in the heart as a novel defense mechanism that protects from I/R injury. (Circ Res.2006;98:351-360.)

Key Words: growth-differentiation factor-15 � ischemia/reperfusion � apoptosis � PI3K � Akt

Coronary reperfusion is the primary therapeutic goal inpatients with acute myocardial infarction (AMI). Al-

though reperfusion is essential for myocardial salvage, it mayat first exacerbate cellular damage sustained during theischemic period, a phenomenon known as reperfusion injury.1

There is growing evidence that the myocardium adapts toischemia/reperfusion (I/R) by synthesizing and responding toa variety of stress-induced growth factors and cytokines, andthat identification of these endogenous homeostatic mecha-nisms may open new avenues to limit I/R injury.2,3

Transforming growth factor-�s (TGF-�s) constitute a su-perfamily of cytokines that exert prominent functions in adulttissue homeostasis and adaptation by regulating cell survival,proliferation, and differentiation. Increases or decreases in theproduction of TGF-�s have been linked to a number ofdisease states, including neurodegenerative disorders andatherosclerosis.4 Growth-differentiation factor-15 (GDF-15),which is identical to macrophage-inhibitory cytokine-1, pla-cental bone morphogenetic protein, placental transforminggrowth factor-�, and nonsteroidal antiinflammatory drug-ac-

Original received March 4, 2005; first resubmission received August 18, 2005; revised resubmission received November 22, 2005; accepted December21, 2005.

From the Department of Cardiology and Angiology, Hannover Medical School, Hannover, Germany (T.K., M.E., M.N., C.W., J.T., J.H., D.K., H.D.,K.C.W.); Department of Neuroanatomy, University of Heidelberg, Germany (J.S.); Division of Molecular Cardiovascular Biology, University ofCincinnati, Ohio (J.X., J.D.M.); and Department of Pathology, University Medical Center, Amsterdam, The Netherlands (H.W.N.).

Correspondence to Priv-Doz Dr Kai C. Wollert, Abt. Kardiologie und Angiologie, Medizinische Hochschule Hannover, Carl-Neuberg Str.1, 30625Hannover, Germany. E-mail [email protected]

© 2006 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/01.RES.0000202805.73038.48

351 by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/








tivated gene-1, is a distant member of the TGF-� superfam-ily.5–7 GDF-15 is produced as an �40-kDa pro-peptidemonomer, which is processed to a mature �30-kDa secretedpeptide.5 Cell culture experiments suggest that GDF-15 canact as a neuronal survival factor.8 Conversely, GDF-15promotes cell death in a number of tumor cell lines,9,10

indicating a role for GDF-15 in the execution of cell death orcell survival programs. Data from the Women’s Health Studyshow that GDF-15 serum levels are an independent riskindicator for adverse cardiovascular events, including strokeand AMI.11 However, the cellular sources, upstream regula-tors, and functional effects of GDF-15 in the cardiovascularsystem have not been elucidated. In fact, no study has everassigned a specific in vivo function to GDF-15.

We have identified GDF-15 by cDNA expression arrayanalysis as a gene that is massively upregulated by nitrosativestress in cardiomyocytes subjected to simulated I/R. In vivo,we found GDF-15 to be strongly induced in the infarctedmurine myocardium and in left ventricular (LV) tissuesamples obtained from patients who had died after an AMI.Using Gdf-15 gene-targeted mice,7 we demonstrate thatendogenous GDF-15 protects the heart from I/R injury. In cellculture, recombinant GDF-15 protects cardiomyocytes fromischemic injury via phosphoinositide 3-OH kinase (PI3K) andAkt-dependent signaling pathways. Our results identifyGDF-15 as a novel cardioprotective cytokine.

Materials and MethodsFor an extended Materials and Methods section, please refer to theonline data supplement, available at http://circres.ahajournals.org.

MaterialsHuman GDF-15, rat leukemia inhibitory factor (LIF), interleukin-1�(IL-1�), and interferon-� (IFN-�) were purchased from R&D Sys-tems, S-nitroso-N-acetyl-D,L-penicillamine (SNAP), 2-amino-5,6-dihydro-6-methyl-4H-1,3-thiazide (AMT), N(G)-nitro-L-argininemethyl-ester (L-NAME), and tetramethylammonium-peroxynitritefrom Alexis, Mn(III)tetrakis(4-benzoic acid)porphyrin (MnTBAP)from Calbiochem, and 8-para-chlorophenylthio-cGMP (8-pCPT-cGMP) from Biolog.

Cardiomyocyte CultureVentricular cardiomyocytes were isolated from 1- to 3-day-oldSprague-Dawley rats (Charles River, Germany) and exposed tosimulated ischemia or I/R.12 Cell death was assessed by lactatedehydrogenase (LDH) release, histone ELISA, in situ TUNEL/Hoechst 33258 staining, and annexin V/propidium iodide (PI)staining and FACS analysis. Where shown, cardiomyocytes wereinfected with a replication-deficient adenovirus encoding dominant-negative Akt1 (K179M mutation, Ad.dnAkt1, kindly provided by DrRichard Patten, Tufts-New England Medical Center, Boston,Mass).13

Surgical ProceduresEight- to 12-week-old male C57BL/6 mice were subjected topermanent or transient left anterior descending coronary artery(LAD) ligation or a sham operation. Gdf-15 gene-targeted mice were

Figure 1. GDF-15 is induced by nitrosa-tive stress in cardiomyocytes. Cardiomy-ocytes were cultured for 24 hours in theabsence or presence of SNAP(250 �mol/L), MnTBAP (100 �mol/L),peroxynitrite (100 �mol/L), 8-pCPT-cGMP (500 �mol/L), IL-1� (10 ng/mL),IFN-� (50 ng/mL), or AMT (100 �mol/L).GDF-15 mRNA and 18S rRNA expres-sion levels were quantified by Northernblot (A, D, and E). Cell lysates and cul-ture supernatants (1 mL per condition)were processed for GDF-15 and�-actinin immunoblotting analysis (B andC). A time course is shown (C). Datafrom n�3 to 6 experiments are present-ed (D and E); *P�0.05, **P�0.01 vs con-trol; #P�0.01 vs SNAP or IL-1�/IFN-�alone.

352 Circulation Research February 17, 2006

by guest on November 5, 2015http://circres.ahajournals.org/Downloaded from


kindly provided by Dr Se-Jin Lee (Johns Hopkins University,Baltimore, Md) and maintained on a C57BL/6/129/SvJ background.7

Eight- to 16-week-old male and female Gdf-15–deficient mice andtheir wild-type (WT) littermates underwent transient LAD ligation.Area at risk and infarct sizes were determined by Evans blue and2,3,5-triphenyltetrazolium chloride (TTC) staining. Apoptotic car-diomyocytes in the infarct border zone were detected by TUNEL/Hoechst staining and anti–�-actinin immunostaining. Heart rate,mean arterial blood pressure, and maximal LV pressure weredetermined in a closed chest preparation using a 1.4 F Millar catheteradvanced via the right carotid artery into the ascending aorta and leftventricle.

Human Myocardial TissueLV tissue samples were collected at autopsy from 17 patients whohad died from an AMI (10 males; mean age 66�3 years) and from5 patients who had died from noncardiac causes (2 males; mean age59�9 years). Viable and irreversibly damaged (jeopardized) myo-cardial areas were discriminated by anti-complement C3d staining.14

Statistical AnalysisData are presented as means�SEM. Differences between groupswere analyzed by one-way ANOVA followed by Student-Newman–Keuls post hoc test. A two-tailed P value �0.05 was considered toindicate statistical significance.

ResultsIdentification of GDF-15 as an NO-RegulatedGene in CardiomyocytesExpanding on our previous efforts to identify NO-regulatedgenes in cardiomyocytes that are functionally important,15,16

we performed cDNA expression array analyses in cardiomyo-cytes cultured for 24 hours in the presence or absence of theNO donor SNAP (250 �mol/L). Although this is still asublethal concentration, higher concentrations of SNAP (eg,1 mmol/L) promote overt cell death in our system.17 In twoexperiments, we found GDF-15 to be the gene that wasinduced most strongly by SNAP among 3906 genes repre-sented on the Atlas Plastic Rat 4K Microarray (17-fold and28-fold induction, respectively). This finding was confirmedby Northern blot analysis (Figure 1A). Increased mRNAlevels were translated into increased GDF-15 pro-peptidelevels and resulted in the release of the mature GDF-15peptide into the culture supernatant (Figure 1B). Induction ofGDF-15 by SNAP was evident within 4 hours, expressionlevels remained high after 12 to 24 hours, and returned tobaseline after 48 hours (Figure 1C).

In general, NO can alter gene expression via cGMP-dependent and cGMP-independent signaling pathways. Oneimportant cGMP-independent pathway involves the reactionof NO with superoxide to form peroxynitrite.18 The effects ofSNAP on GDF-15 mRNA abundance were reversed by thesuperoxide dismutase mimetic MnTBAP; conversely, per-oxynitrite, when directly added to the cells, significantlyincreased GDF-15 expression levels (Figure 1D). In contrast,the cell-permeable cGMP analog 8-pCPT-cGMP did notinduce GDF-15 expression in cardiomyocytes (Figure 1D).Together, induction of GDF-15 by NO appears to be medi-ated via superoxide/peroxynitrite-dependent but cGMP-independent pathways.

GDF-15 was also induced in cardiomyocytes treated withIL-1�/IFN-� (Figure 1E), cytokines known to enhance ex-

Figure 2. Cardiomyocytes express and secrete GDF-15 after simu-lated ischemia and I/R. Cardiomyocytes were subjected to simulatedischemia (A) or simulated I/R (B) for various time intervals. GDF-15pro-peptide and �-actinin levels were determined in cell lysates (n�3to 5 experiments); typical immunoblots and a bar graph summarizingthese data are shown (A and B). The secreted form of GDF-15 wasdetected in cell culture supernatants; representative immunoblots fromn�2 experiments are shown (A and B). Cells in C underwent simu-lated ischemia for 3 hours followed by reperfusion for 24 hours in thepresence or absence of L-NAME, AMT, or MnTBAP (100 �mol/Leach). GDF-15 pro-peptide and �-actinin levels in cell lysates weredetermined by immunoblotting. Treatment with L-NAME, AMT, orMnTBAP alone had no significant impact on GDF-15 expression (datanot shown). Data from n�3 to 5 experiments are shown (C); *P�0.05,**P�0.01 vs control; #P�0.01 vs I/R alone.

Kempf et al GDF-15 in the Infarcted Heart 353



pression of inducible NO synthase (NOS2) in cultured car-diomyocytes.19 Coincubation with the NOS2 inhibitor AMTor MnTBAP partially reversed the effects of IL-1�/IFN-� onGDF-15 abundance, indicating that IL-1�/IFN-� induceGDF-15 via endogenous NOS2 and generation of nitrosativestress (Figure 1E).

Cardiomyocytes Express and Secrete GDF-15After Simulated Ischemia and I/RConsidering that NOS2 is activated and that NO and per-oxynitrite are produced in the heart after ischemic injury,20

we explored whether GDF-15 is induced in cardiomyocytessubjected to simulated ischemia or I/R in vitro. As shown inFigure 2A, GDF-15 pro-peptide levels gradually increasedduring simulated ischemia, reaching maximum levels after 6hours and returning toward baseline after 12 hours (later timepoints could not be studied because of severe cell damage); atthe same time, mature GDF-15 was secreted and accumulatedin the culture supernatant (Figure 2A). GDF-15 pro-peptidelevels also increased after simulated I/R (Figure 2B). Acertain period of ischemia appeared to be required forGDF-15 expression and secretion during reperfusion (eg,GDF-15 was not induced by 1 hour of ischemia followed by5 hours of reperfusion but strongly expressed after 3 hours ofischemia followed by 3 hours of reperfusion). Cardiomyo-cytes that were reperfused after a 3-hour episode of simulatedischemia continued to express and secrete GDF-15 for up to24 hours (Figure 2B). Treatment of cardiomyocytes with theNOS inhibitor L-NAME, AMT, or MnTBAP blunted the

induction of GDF-15 during simulated I/R, indicating thatNOS2-NO-peroxynitrite–dependent signaling pathways areinvolved (Figure 2C).

Induction of GDF-15 in the Murine Heart AfterIschemia and I/RTo investigate whether GDF-15 is induced by ischemia or I/R invivo, mice were subjected to permanent or transient LADligation (Figure 3A through 3C). Permanent coronary arteryligation resulted in a rapid induction of GDF-15 expression inthe ischemic area; mRNA levels were upregulated within 1 hour(Figure 3A) and pro-peptide levels within 5 hours (Figure 3C).With time, GDF-15 mRNA and pro-peptide expression contin-ued to increase in the ischemic area and remained elevated for atleast 7 days. Similarly, coronary reperfusion after a 1-hourperiod of ischemia resulted in a progressive increase of GDF-15mRNA and pro-peptide expression in the area at risk (Figure 3Aand 3C). The magnitude and kinetics of GDF-15 induction afterischemia or I/R were roughly comparable (eg, 5 or 24 hours ofischemia resulted in similar GDF-15 expression levels comparedwith 1 hour of ischemia followed by reperfusion for 4 or 24hours, respectively). GDF-15 mRNA levels also increased in theremote left ventricle during permanent ischemia; however, thiseffect was less pronounced and transient (Figure 3A).

Increased Myocardial GDF-15 Expression Levelsin Patients With AMIGDF-15 pro-peptide expression levels were significantlyincreased in tissue samples obtained from the infarcted

Figure 3. Upregulation of GDF-15 in themurine heart after ischemia and I/R. Miceunderwent permanent LAD ligation forvarious time intervals or transient LADligation for 1 hour followed by reperfu-sion for various time intervals. GDF-15and GAPDH mRNA expression levelswere quantified by real-time polymerasechain reaction (A). GDF-15 and �-actininprotein levels were determined by immu-noblotting. Representative blots (B) indi-cate that GDF-15 is detected primarily asthe �40-kDa pro-peptide (in each case,protein extracts from two control animalsand two animals subjected to LAD liga-tion were loaded). Data from n�3 to 5mice per group are presented (A and C);*P�0.05, **P�0.01 vs sham-operatedcontrols.




myocardium of patients who had died after an AMI (Figure4A). GDF-15 expression increased within 12 hours ofsymptom onset and remained upregulated for at least 2weeks (Figure 4B and 4C). Patients who had or had notreceived reperfusion therapy displayed similar GDF-15expression levels (Figure 4B). As shown by immunohis-tochemistry, cardiomyocytes within irreversibly damagedmyocardial areas strongly expressed GDF-15 (Figure4Da). Irreversibly damaged and viable myocardial areaswere distinguished by anti-complement C3d staining of aparallel section (Figure 4Db).14 No GDF-15 staining wasdetected when the GDF-15 primary antibody was omittedfrom the reaction (Figure 4Dc). GDF-15 was barelydetectable in viable myocardial areas (compare Figure 4Daand 4Db) or in myocardial sections obtained from controlpatients (Figure 4Dd). The specificity of the anti-humanGDF-15 antibody used during these studies was confirmedby immunoblotting of human LV myocardial proteinextracts (Figure 4A).

Endogenous GDF-15 Protects the Heart FromI/R InjuryTo explore the functional effects associated with GDF-15induction in the infarcted heart, Gdf-15 gene-targeted miceand their WT littermates were subjected to transient LADligation for 1 hour followed by reperfusion for 24 hours.

Gdf-15– deficient (knockout [KO]) mice did not differfrom WT mice with regard to their baseline heart weight-to-body weight ratio,21 heart rate (WT 387�36 minutes�1;KO 366�25 minutes�1), mean arterial pressure (WT81�9 mm Hg; KO 75�5 mm Hg), and maximal LVpressure (WT 99�8 mm Hg; KO 101�5 mm Hg); hemo-dynamic data were obtained in n�3 WT mice and n�5 KOmice. As shown in Figure 5A, Gdf-15– deficient mice didnot express GDF-15 in the myocardium. The size of thearea-at-risk during coronary occlusion was comparable inWT and Gdf-15– deficient mice; however, myocardialinfarct sizes after reperfusion were significantly larger inGdf-15– deficient mice (Figure 5B and 5C). Notably,virtually identical results were obtained in male and femalemice (supplemental Figure I). Greater infarct sizes inGdf-15– deficient mice were associated with an enhancedoccurrence of TUNELpos cardiomyocytes in the infarctborder zone (Figure 5D and 5E). Under baseline condi-tions, the rate of TUNELpos cardiomyocytes was very low(�0.1%) in Gdf-15– deficient and WT mice (n�2 each).

GDF-15 Protects Cultured Cardiomyocytes DuringSimulated Ischemia and I/RLDH release, a biochemical marker of necrotic cell death,was significantly increased after 3 hours of simulatedischemia (Figure 6A). The same treatment did not increase

Figure 4. Enhanced GDF-15 expressionin the infarcted human heart. Tissuesamples were obtained from theinfarcted LV myocardium of patients witha fatal myocardial infarction (MI). Control(Con) LV tissue specimen were takenfrom patients who had died from noncar-diac causes. GDF-15 and �-actininexpression levels were determined byimmunoblotting. The representative blot(A) indicates that GDF-15 is detectedprimarily as the �40-kDa pro-peptide(protein extracts from one control andtwo MI patients were loaded on the left,recombinant human GDF-15 was loadedon the right). Data from n�17 infarct vic-tims and n�5 controls are presented (B);data were stratified according to timefrom symptom onset to death (�12hours, n�6; 12 hours to 3 days, n�6; 3to 14 days, n�5) or reperfusion therapy(yes, n�5; no, n�12); *P�0.05 vs con-trol. A representative blot is shown (C).Parallel LV myocardial tissue sectionsfrom an infarct victim were immuno-stained against GDF-15 (Da) and com-plement C3d (Db). Cardiomyocytes in thecomplement C3d-positive (ie, irreversiblydamaged [jeopardized, J]) area stronglyexpress GDF-15. GDF-15 is barelydetectable in the noninfarcted (N) myo-cardium (Da) or in a tissue section from acontrol patient (Dd). No GDF-15 stainingwas detected when the primary antibodywas omitted from the reaction (Dc).




apoptotic cell death in our culture model, as indicated byFACS analysis (number of annexin Vpos/ PIneg cells),histone ELISA, and TUNEL/Hoechst staining (data notshown). However, simulated ischemia for 3 hours followedby reperfusion for 1 hour strongly induced cardiomyocyteapoptosis, as shown by these three assays (Figure 6Bthrough 6F). In contrast, no further LDH release wasdetected, indicating that necrosis does not contributesignificantly to cell death during reperfusion (data notshown). Pretreatment of cardiomyocytes with recombinantGDF-15 diminished LDH release during a subsequent3-hour episode of simulated ischemia (Figure 6A). Simi-larly, GDF-15 reduced the number of annexin Vpos/ PIneg

cells (Figure 6B and 6C), the formation of histone-associated DNA fragments (Figure 3D), and the number ofTUNELpos cells after 3 hours of simulated ischemia fol-lowed by 1 hour of reperfusion (Figure 6E and 6F). Thecytoprotective effects of GDF-15 were comparable to theeffects of LIF (Figure 6A and 6D), an IL-6 –relatedcytokine that has previously been shown to protect fromI/R injury.22

GDF-15 Protects Cardiomyocytes Via PI3K- andAkt-Dependent MechanismsA number of growth factors and cytokines protect the heartfrom I/R injury via the PI3K–Akt signaling pathway.23 Wetherefore explored whether this pathway is important forthe cardioprotective effects of GDF-15. As shown inFigure 6, the cytoprotective effects of GDF-15 duringsimulated ischemia or I/R were abolished by the PI3Kinhibitors LY294002 and wortmannin, indicating thatPI3K is required for the prosurvival effects of GDF-15.

GDF-15 promoted a rapid and transient Ser473 phosphory-lation (activation) of Akt in cardiomyocytes (Figure 7A).Enhanced Ser473 phosphorylation of Akt was paralleled byan increase in Ser136 phosphorylation (inactivation) of theAkt downstream target Bad, a Bcl family member knownto inhibit Bcl survival proteins (Figure 7B). To assesswhether Akt activation is required for the protective effectsof GDF-15, cardiomyocytes were infected with areplication-deficient adenovirus encoding a dominant-negative, kinase-inactive mutant of Akt1. Adenoviral ex-pression of dnAkt1 abolished the protective effects ofGDF-15 during a subsequent episode of simulated I/R asassessed by TUNEL/Hoechst staining (Figure 7C and 7D)and histone ELISA (Figure 7E). Infection with a controlvirus had no effects (Figure 7C through 6E).

DiscussionThe present study identifies the TGF-� superfamily memberGDF-15 as a cytokine that is strongly induced in the myo-cardium after ischemic injury, and that provides endogenousprotection against I/R-induced cardiomyocyte apoptosis, pos-sibly via PI3K–Akt-dependent signaling pathways. Togetherwith the report by Xu et al,21 our study is the first todemonstrate that GDF-15 has a functional role in the cardio-vascular system and, in fact, the first study that assigns an invivo function to GDF-15.

Two mouse models were used in our study (permanentcoronary artery ligation and transient ligation followed byreperfusion) to simulate the distinct clinical scenarios inpatients with AMI not receiving or receiving reperfusiontherapy. Permanent ischemia and transient ischemia fol-lowed by reperfusion both led to a robust induction of

Figure 5. Gdf-15–deficient mice developgreater infarct sizes after I/R. Gdf-15gene-targeted mice (KO) and their WTlittermates underwent transient LAD liga-tion for 1 hour followed by reperfusionfor 24 hours. GDF-15 and �-actininexpression levels were determined byimmunoblotting in the area-at-risk (AAR)in WT and Gdf-15 KO mice (A). AAR andinfarct sizes were determined by Evansblue and TTC staining. Representativecross-sections are shown (B). The areaof the myocardium not stained withEvans blue represents the AAR, infarctedareas appear pallid (highlighted with reddots), and viable myocardium appearspink (highlighted with green stripes). Datafrom n�17 Gdf-15 KO mice and n�20WT littermates are summarized (C). TheAAR and infarcted area (MI) wereexpressed as percentage of LV cross-sectional area (LV); MI was also calcu-lated as percentage of AAR. Apoptoticcardiomyocytes in the infarct borderzone were detected by TUNEL/Hoechststaining and anti–�-actinin immunostain-ing. Typical sections are shown (D):TUNEL (left panels), Hoechst (middle),TUNEL/Hoechst/�-actinin overlay (right).Data from n�7 WT and n�8 Gdf-15 KOanimals are shown (E). *P�0.05 vs WT.




GDF-15 mRNA and pro-peptide expression levels in themyocardium at risk. GDF-15 expression in the remotemyocardium was induced only transiently and to a lesserextent, suggesting that the ischemic insult per se ratherthan early neurohormonal activation or increases in ven-tricular wall stress promotes GDF-15 expression in theinjured myocardium. Emphasizing the potential clinicalrelevance of our findings, GDF-15 pro-peptide levels werealso upregulated in autopsy samples obtained from patientswith a fatal AMI (regardless of reperfusion therapy). At thecellular level, cardiomyocytes within irreversibly damagedmyocardial areas robustly expressed GDF-15 in AMIpatients.

Supporting the conclusion that cardiomyocytes are amajor source of GDF-15 expression after ischemic injury,isolated rat cardiomyocytes, when exposed to simulatedischemia or I/R, strongly expressed GDF-15. InducibleNOS2, which may contribute to I/R injury by enhancingnitrosative stress,24 appeared to be involved in the upregu-lation of GDF-15 in cardiomyocytes after I/R via NO–peroxynitrite-dependent signaling pathways. Along thisline, IL-1�/IFN-� enhanced GDF-15 expression in cardio-myocytes via induction of endogenous NOS2 and nitrosa-tive stress. Notably, GDF-15 expression in tumor cell lines

has been shown to involve the redox-sensitive transcrip-tion factors p53 and Egr-1,9,25 both of which are alsoactivated by I/R in cardiomyocytes.26 Because previousstudies have shown that GDF-15 is upregulated in corticalneurons after cryoinjury,27 and in hepatocytes after toxicliver injury,7 it appears that induction of GDF-15 might bea generic response to external stressors.

We detected mostly the pro-peptide of GDF-15 in cardio-myocyte extracts and in cardiac tissue samples, suggestingthat the mature peptide is efficiently secreted. Indeed, condi-tioned supernatants obtained from cardiomyocytes treatedwith NO or subjected to simulated ischemia or I/R containedpredominantly the mature GDF-15 peptide. This is in goodagreement with data obtained in cultured human kidney cellsshowing that mature GDF-15 is not stored but rapidlysecreted.5

The phenotype of Gdf-15 gene-targeted mice under-scores the in vivo functional significance of these findings.Gdf-15– deficient mice have virtually normal hearts undernonstressed, baseline conditions.21 Moreover, baselineheart rate, blood pressure, and maximal LV pressure werecomparable in Gdf-15– deficient and WT mice. However,Gdf-15– deficient mice developed greater infarct sizes andmore cardiomyocyte apoptosis in the infarct border zone

Figure 6. GDF-15 inhibits I/R-induced cardio-myocyte death via PI3K. LDH release wasdetermined in cardiomyocytes subjected to 3hours of ischemia or cultured under controlconditions (A). GDF-15 (20 ng/mL), LIF (1nmol/L), or LY294002 (10 �mol/L) were added1 hour before ischemia. Data from n�3 to 5experiments are presented (A); *P�0.01 vsischemia alone; #P�0.01 vs ischemia plusGDF-15. Annexin V/PI FACS analysis (B andC), histone ELISA (D), and TUNEL/Hoechststaining (E and F) were used to quantify car-diomyocyte apoptosis after 3 hours of ische-mia followed by 1 hour of reperfusion in thepresence or absence of GDF-15 (20 ng/mL),LIF (1 nmol/L), LY294002 (10 �mol/L), or wort-mannin (0.2 �mol/L), added 1 hour before I/R.Treatment of control cells with LY294002 orwortmannin had no significant impact on celldeath (data not shown). Exemplary FACSscans are shown (C); annexin Vpos/PIneg cellsare highlighted in red. Approximately 1000Hoechstpos nuclei per experiment and condi-tion were analyzed for TUNEL positivity (E).Exemplary images are shown (F). Data fromn�3 to 5 experiments are presented (B, D,and E); *P�0.01 vs I/R alone; #P�0.05 vs I/Rplus GDF-15.




after I/R injury compared with WT littermates, indicatingthat endogenous GDF-15 limits myocardial tissue damagein vivo. To gain mechanistic insight into the cardioprotec-tive effects of GDF-15, we set up a cell culture model ofsimulated I/R. Consistent with previous investigations,28

simulated ischemia was related to an increased rate ofnecrosis, whereas reperfusion led to accelerated apoptosisin our cell culture model. However, it should be pointedout that the mode of cell death contributing to I/R injurydepends, to some extent, on experimental conditions, andthat necrosis and apoptosis represent only the extremes ofa continuum of various modes of cell death.1 Using fourcomplementary techniques to assess cell death duringsimulated I/R, our data indicate that GDF-15, when added1 hour before the ischemic event, suppresses necrosisduring ischemia and apoptosis during subsequent reperfu-sion. GDF-15 was used at a concentration of 20 ng/mLduring these cell culture studies, a dose that is probablypathophysiologically relevant: normal human sera contain�0.5 ng/mL of GDF-15.11,29,30 However, up to 30-foldhigher GDF-15 serum levels have been reported in specificsituations (eg, during pregnancy or in patients with certaintypes of cancer).29,30 Preliminary data from our laboratory,obtained with a recently established immunoradiometric

assay, indicate that GDF-15 serum levels increase up to 6to 10 ng/mL in AMI patients presenting for primaryangioplasty. Given that the infarcted human myocardiumappears to be a major site of GDF-15 production, evenhigher concentrations are probably achieved at the tissuelevel.

The pro-survival effects of GDF-15 in cultured cardio-myocytes subjected to simulated I/R were associated witha rapid activation of the serine–threonine kinase Akt. Moreimportant, from a mechanistic standpoint, the protectiveeffects of GDF-15 were abolished by PI3K inhibitors andby adenoviral expression of a dominant-negative Akt1mutant, pointing toward a critical involvement of thePI3K–Akt signaling pathway in the cytoprotective effectsof GDF-15. It is noteworthy in this regard that GDF-15also promotes Akt activation in cardiomyocytes whenadded at the time of reperfusion (data not shown), suggest-ing that GDF-15 may have therapeutic potential for thetreatment of myocardial I/R-injury, a hypothesis thatshould be tested in future studies.

Our data indicate that Bad may be a target of GDF-15–activated Akt in cardiomyocytes; however, the precisedownstream effectors mediating the prosurvival effects ofGDF-15 remain to be established.31 It should be mentioned

Figure 7. GDF-15 protects cardiomyo-cytes from I/R-induced apoptosis viaAkt. Cardiomyocytes were stimulatedwith GDF-15 (20 ng/mL) for 15 to 240minutes. Akt, Ser473-phospho-Akt, Bad,and Ser136–phospho-Bad levels weredetermined by immunoblotting. Datafrom n�3 to 5 experiments and exem-plary blots are presented (A and B);*P�0.05 vs control. Cardiomyocytes in(C, D, and E) were infected with Ad.lacZor Ad.dnAkt1, as indicated. Cells werethen subjected to 3 hours of simulatedischemia followed by 1 hour of reperfu-sion in the presence or absence ofGDF-15 (20 ng/mL), which was added 1hour before I/R. Cardiomyocyte apopto-sis was determined by TUNEL/Hoechststaining (C and D) and histone ELISA (E).Exemplary images are shown (D). Datafrom n�3 to 5 experiments are present-ed (C and D). Approximately 1000Hoechstpos nuclei per experiment andcondition were analyzed for TUNEL posi-tivity; *P�0.05 vs same virus control;#P�0.05 vs same virus I/R.




in this context that PI3K can protect the heart from I/Rinjury also via Akt-independent pathways.32 Moreover,PI3K–Akt-independent pathways might be involved in theprotective effects of GDF-15; as shown Xu et al, GDF-15activates extracellular signal-regulated kinases in culturedcardiomyocytes,21 which have been suggested to exertantiapoptotic effects in the myocardium.33 In any case, ourobservations are consistent with the concept that distinctcell survival signals converge at the PI3K–Akt signalingpathway in cardiomyocytes.13,34 –37 Finally, consideringthat GDF-15 expression is induced in lesioned corticalneurons and that GDF-15 acts as a neuronal survival factorin vitro via PI3K–Akt,8,27 our data lend support to theemerging paradigm that cell fate decisions in heart andbrain are controlled by common survival factors andoverlapping signaling pathways.37– 40

AcknowledgmentsThis work was supported by grants from the Deutsche Forschungs-gemeinschaft to K.C.W. (Wo 552/2-2 and 2-3) and an early careergrant from Hannover Medical School to T.K. (HiLF Program). Wegratefully acknowledge Susann Busch and Christian Widera forexpert technical assistance.

References1. Eefting F, Rensing B, Wigman J, Pannekoek WJ, Liu WM, Cramer MJ,

Lips DJ, Doevendans PA. Role of apoptosis in reperfusion injury. Car-diovasc Res. 2004;61:414–426.

2. Jeremias I, Kupatt C, Martin-Villalba A, Habazettl H, Schenkel J,Boekstegers P, Debatin KM. Involvement of CD95/Apo1/Fas in celldeath after myocardial ischemia. Circulation. 2000;102:915–920.

3. Kurrelmeyer KM, Michael LH, Baumgarten G, Taffet GE, Peschon JJ,Sivasubramanian N, Entman ML, Mann DL. Endogenous tumor necrosisfactor protects the adult cardiac myocyte against ischemic-induced apo-ptosis in a murine model of acute myocardial infarction. Proc Natl AcadSci U S A. 2000;97:5456–5461.

4. Blobe GC, Schiemann WP, Lodish HF. Role of transforming growthfactor beta in human disease. N Engl J Med. 2000;342:1350–1358.

5. Bootcov MR, Bauskin AR, Valenzuela SM, Moore AG, Bansal M, HeXY, Zhang HP, Donnellan M, Mahler S, Pryor K, Walsh BJ, NicholsonRC, Fairlie WD, Por SB, Robbins JM, Breit SN. MIC-1, a novel macro-phage inhibitory cytokine, is a divergent member of the TGF-beta super-family. Proc Natl Acad Sci U S A. 1997;94:11514–11519.

6. Bottner M, Laaff M, Schechinger B, Rappold G, Unsicker K, Suter-Crazzolara C. Characterization of the rat, mouse, and human genes ofgrowth/differentiation factor-15/macrophage inhibiting cytokine-1 (GDF-15/MIC-1). Gene. 1999;237:105–111.

7. Hsiao EC, Koniaris LG, Zimmers-Koniaris T, Sebald SM, Huynh TV,Lee SJ. Characterization of growth-differentiation factor 15, a trans-forming growth factor beta superfamily member induced following liverinjury. Mol Cell Biol. 2000;20:3742–3751.

8. Subramaniam S, Strelau J, Unsicker K. Growth differentiation factor-15prevents low potassium-induced cell death of cerebellar granule neuronsby differential regulation of Akt and ERK pathways. J Biol Chem.2003;278:8904–8912.

9. Tan M, Wang Y, Guan K, Sun Y. PTGF-beta, a type beta transforminggrowth factor (TGF-beta) superfamily member, is a p53 target gene thatinhibits tumor cell growth via TGF-beta signaling pathway. Proc NatlAcad Sci U S A. 2000;97:109–114.

10. Graichen R, Liu D, Sun Y, Lee KO, Lobie PE. Autocrine human growthhormone inhibits placental transforming growth factor-beta gene tran-scription to prevent apoptosis and allow cell cycle progression of humanmammary carcinoma cells. J Biol Chem. 2002;277:26662–26672.

11. Brown DA, Breit SN, Buring J, Fairlie WD, Bauskin AR, Liu T, RidkerPM. Concentration in plasma of macrophage inhibitory cytokine-1 andrisk of cardiovascular events in women: a nested case-control study.Lancet. 2002;359:2159–2163.

12. Stephanou A, Brar BK, Scarabelli TM, Jonassen AK, Yellon DM, MarberMS, Knight RA, Latchman DS. Ischemia-induced STAT-1 expression

and activation play a critical role in cardiomyocyte apoptosis. J BiolChem. 2000;275:10002–10008.

13. Patten RD, Pourati I, Aronovitz MJ, Baur J, Celestin F, Chen X, MichaelA, Haq S, Nuedling S, Grohe C, Force T, Mendelsohn ME, Karas RH.17beta-estradiol reduces cardiomyocyte apoptosis in vivo and in vitro viaactivation of phospho-inositide-3 kinase/Akt signaling. Circ Res. 2004;95:692–699.

14. Lagrand WK, Niessen HW, Wolbink GJ, Jaspars LH, Visser CA,Verheugt FW, Meijer CJ, Hack CE. C-reactive protein colocalizes withcomplement in human hearts during acute myocardial infarction. Circu-lation. 1997;95:97–103.

15. Heineke J, Kempf T, Kraft T, Hilfiker A, Morawietz H, Scheubel RJ,Caroni P, Lohmann SM, Drexler H, Wollert KC. Downregulation ofcytoskeletal muscle LIM protein by nitric oxide: impact on cardiacmyocyte hypertrophy. Circulation. 2003;107:1424–1432.

16. Heineke J, Ruetten H, Willenbockel C, Gross SC, Naguib M, SchaeferA, Kempf T, Hilfiker-Kleiner D, Caroni P, Kraft T, Kaiser RA,Molkentin JD, Drexler H, Wollert KC. Attenuation of cardiacremodeling after myocardial infarction by muscle LIM protein-calcineurin signaling at the sarcomeric Z-disc. Proc Natl Acad SciU S A. 2005;102:1655–1660.

17. Wollert KC, Fiedler B, Gambaryan S, Smolenski A, Heineke J, Butt E,Trautwein C, Lohmann SM, Drexler H. Gene transfer of cGMP-dependent protein kinase I enhances the antihypertrophic effects of nitricoxide in cardiomyocytes. Hypertension. 2002;39:87–92.

18. Droge W. Free radicals in the physiological control of cell function.Physiol Rev. 2002;82:47–95.

19. Arstall MA, Sawyer DB, Fukazawa R, Kelly RA. Cytokine-mediatedapoptosis in cardiac myocytes: the role of inducible nitric oxide synthaseinduction and peroxynitrite generation. Circ Res. 1999;85:829–840.

20. Lalu MM, Wang W, Schulz R. Peroxynitrite in myocardial ischemia-reperfusion injury. Heart Fail Rev. 2002;7:359–369.

21. Xu J, Kimball TR, Lorenz JN, Klevitsky R, Hewett TE, Molkentin JD.GDF-15 functions as a protective and anti-hypertrophic factor releasedfrom the myocardium in association with SMAD protein activation. CircRes. In press.

22. Brar BK, Stephanou A, Liao Z, O’Leary RM, Pennica D, Yellon DM,Latchman DS. Cardiotrophin-1 can protect cardiac myocytes from injurywhen added both prior to simulated ischaemia and at reoxygenation.Cardiovasc Res. 2001;51:265–274.

23. Hausenloy DJ, Yellon DM. New directions for protecting the heartagainst ischemia-reperfusion injury: targeting the Reperfusion InjurySalvage Kinase (RISK)-pathway. Cardiovasc Res. 2004;61:448–460.

24. Andreka P, Tran T, Webster KA, Bishopric NH. Nitric oxide and pro-motion of cardiac myocyte apoptosis. Mol Cell Biochem. 2004;263:35–53.

25. Baek SJ, Kim JS, Nixon JB, DiAugustine RP, Eling TE. Expression ofNAG-1, a transforming growth factor-beta superfamily member, by tro-glitazone requires the early growth response gene EGR-1. J Biol Chem.2004;279:6883–6892.

26. Maulik N, Sasaki H, Addya S, Das DK. Regulation of cardiomyocyteapoptosis by redox-sensitive transcription factors. FEBS Lett. 2000;485:7–12.

27. Schober A, Bottner M, Strelau J, Kinscherf R, Bonaterra GA, Barth M,Schilling L, Fairlie WD, Breit SN, Unsicker K. Expression of growthdifferentiation factor-15/ macrophage inhibitory cytokine-1 (GDF-15/MIC-1) in the perinatal, adult, and injured rat brain. J Comp Neurol.2001;439:32–45.

28. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reper-fusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest.1994;94:1621–1628.

29. Moore AG, Brown DA, Fairlie WD, Bauskin AR, Brown PK, MunierML, Russell PK, Salamonsen LA, Wallace EM, Breit SN. The trans-forming growth factor-beta superfamily cytokine macrophage inhibitorycytokine-1 is present in high concentrations in the serum of pregnantwomen. J Clin Endocrinol Metab. 2000;85:4781–4788.

30. Koopmann J, Buckhaults P, Brown DA, Zahurak ML, Sato N, FukushimaN, Sokoll LJ, Chan DW, Yeo CJ, Hruban RH, Breit SN, Kinzler KW,Vogelstein B, Goggins M. Serum macrophage inhibitory cytokine 1 as amarker of pancreatic and other periampullary cancers. Clin Cancer Res.2004;10:2386–2392.

31. Brazil DP, Yang ZZ, Hemmings BA. Advances in protein kinase Bsignaling: AKTion on multiple fronts. Trends Biochem Sci. 2004;29:233–242.




32. Nagoshi T, Matsui T, Aoyama T, Leri A, Anversa P, Li L, Ogawa W, DelMonte F, Gwathmey JK, Grazette L, Hemmings B, Kass DA, ChampionHC, Rosenzweig A. PI3K rescues the detrimental effects of chronic Aktactivation in the heart during ischemia/reperfusion injury. J Clin Invest.2005;115:2128–2138.

33. Baines CP, Molkentin JD. Stress signaling pathways that modulatecardiac myocyte apoptosis. J Mol Cell Cardiol. 2005;38:47–62.

34. Fujio Y, Nguyen T, Wencker D, Kitsis RN, Walsh K. Akt promotessurvival of cardiomyocytes in vitro and protects against ischemia-reperfusion injury in mouse heart. Circulation. 2000;101:660–667.

35. Yamashita K, Kajstura J, Discher DJ, Wasserlauf BJ, Bishopric NH,Anversa P, Webster KA. Reperfusion-activated Akt kinase prevents apo-ptosis in transgenic mouse hearts overexpressing insulin-like growthfactor-1. Circ Res. 2001;88:609–614.

36. Gao F, Gao E, Yue TL, Ohlstein EH, Lopez BL, Christopher TA, Ma XL.Nitric oxide mediates the antiapoptotic effect of insulin in myocardial

ischemia-reperfusion: the roles of PI3-kinase, Akt, and endothelial nitricoxide synthase phosphorylation. Circulation. 2002;105:1497–1502.

37. Cai Z, Semenza GL. Phosphatidylinositol-3-kinase signaling is requiredfor erythropoietin-mediated acute protection against myocardial ische-mia/reperfusion injury. Circulation. 2004;109:2050–2053.

38. Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, SegalRA, Kaplan DR, Greenberg ME. Regulation of neuronal survival by theserine-threonine protein kinase Akt. Science. 1997;275:661–665.

39. Siren AL, Fratelli M, Brines M, Goemans C, Casagrande S, Lewczuk P,Keenan S, Gleiter C, Pasquali C, Capobianco A, Mennini T, Heumann R,Cerami A, Ehrenreich H, Ghezzi P. Erythropoietin prevents neuronalapoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad SciU S A. 2001;98:4044–4049.

40. Parsa CJ, Matsumoto A, Kim J, Riel RU, Pascal LS, Walton GB,Thompson RB, Petrofski JA, Annex BH, Stamler JS, Koch WJ. A novelprotective effect of erythropoietin in the infarcted heart. J Clin Invest.2003;112:999–1007.




Online Data Supplement Kempf et al.

1

MATERIALS AND METHODS

Materials. Human GDF-15, rat leukemia inhibitory factor (LIF), interleukin (IL)-1β, and

interferon (IFN)-γ were purchased from R&D Systems, S-nitroso-N-acetyl-D,L-penicillamine

(SNAP), 2-amino-5,6-dihydro-6-methyl-4H-1,3-thiazide (AMT), N(G)-nitro-l-arginine

methyl-ester (L-NAME), and tetramethylammonium-peroxynitrite from Alexis,

Mn(III)tetrakis(4-benzoic acid)porphyrin (MnTBAP) from Calbiochem, and 8-para-

chlorophenylthio-cGMP (8-pCPT-cGMP) from Biolog.

Cardiomyocyte culture and recombinant adenoviruses. Ventricular cardiomyocytes were

isolated from 1- to 3-day-old Sprague-Dawley rats.1 Cells were plated in gelatin-coated

culture dishes in DMEM/medium 199 (4:1), supplemented with 10% horse serum, 5% FCS,

glutamine, and antibiotics. The next morning, cells were switched to DMEM/medium 199

supplemented only with glutamine and antibiotics (maintenance medium). The replication-

deficient adenovirus encoding dominant-negative Akt1 (K179M mutation, Ad.dnAkt1) was

kindly provided by Dr. Richard Patten (Tufts University).2 Cells were infected for 2h in

maintenance medium (MOI=50), washed and kept in maintenance medium supplemented

with 5% FCS for 24h, and finally switched to maintenance medium without serum.

Northern blot and real-time PCR. Total RNA was isolated by the TriFast reagent (PeqLab).

GDF-15 mRNA expression in cultured cardiomyocytes was determined by Northern blot

using a 520 bp rat GDF-15 cDNA probe generated by PCR cloning (forward:

TGCTGAGCCGACTGCATGC, reverse: CATGCTCAGTTGCAGCTGAC).3 GDF-15

mRNA expression in mouse hearts was determined by real-time PCR. Following reverse

transcription (Superscript II, Invitrogen), real-time PCR was performed using the Brilliant

SYBR Green Mastermix-Kit and the MX4000 multiplex QPCR System from Stratagene

(1 min denaturation at 95°, 1 min annealing at 57°C, 1 min elongation at 72°; 40 cycles). PCR

primers were designed based on the murine GDF-15 cDNA sequence (forward:

ACGAGCTACGGGGTCGC, reverse: CCCAATCTCACCTCTGGACTG).4 Data were

acquired at 80°C to avoid measurement of non-specific products. PCR-efficiency was >95%

as revealed by standard curve slope calculation. Melting curve analysis showed no non-

specific amplification products or primer dimers. GDF-15 mRNA expression was normalized

against 18S rRNA or GAPDH mRNA expression quantified by Northern blot or real-time

PCR, respectively.


2

Immunoblotting. GDF-15 protein levels in rat cardiomyocytes and culture supernatants, and

in mouse hearts were quantified by immunoblotting using a polyclonal antibody raised against

a peptide sequence (HRTDSGVSLQTYDDL) from the C-terminus of rat GDF-15; this

antibody recognizes both the pro-peptide and the secreted peptide of rat and mouse GDF-15,

but could not be used to detect GDF-15 in human myocardium (generation of this antibody is

described in Ref. 3). Culture supernatants were concentrated by Amicon Ultra-4 MWCO 5000

filter devices (Millipore) prior to immunoblotting. A polyclonal goat anti-human GDF-15 IgG

antibody from R&D Systems (Catalog No. AF957) was used to determine GDF-15 expression

levels in human myocardium (this antibody could not be used to detect rat or mouse GDF-15).

Antibodies against α-actinin, Akt, Ser473-phospho-Akt, Bad, and Ser136-phospho-Bad

expression levels were obtained from Sigma (α-actinin) or New England Biolabs (all other).

Simulated ischemia and I/R in vitro. Cardiomyocytes were exposed to simulated ischemia

or I/R as described.5 In brief, cells were switched from maintenance medium to a buffer

containing (in mmol/L) 137 NaCl, 12 KCl, 0.5 MgCl2, 0.9 CaCl2, 4 HEPES, 10 2-deoxy-

glucose, and 20 sodium-lactate (pH 6.2), and were incubated at 37°C in a hypoxia chamber

(Modular Incubator Chamber-101, Billups-Rothenberg) flushed with 5% CO2 and 95% N2

(simulated ischemia). Control cells were cultured in a buffer containing (in mmol/L) 137

NaCl, 3.8 KCl, 0.5 MgCl2, 0.9 CaCl2, 4 HEPES, 10 glucose, and 20 pyruvate (pH 7.4), and

incubated at 37°C in an atmosphere containing 5% CO2 and 95% room air. After various time

intervals, cells were switched back to maintenance medium and kept in 5% CO2 and 95%

room air at 37°C (simulated reperfusion).

Assessment of cell death after simulated ischemia and I/R in vitro. Lactate dehydrogenase

(LDH) release was measured by a cytotoxicity detection kit (Roche). Formation of histone-

associated DNA fragments was quantified by Cell Death Detection ELISA (Roche). DNA

fragmentation was determined by in situ TdT-mediated dUTP nick end-labeling (TUNEL)

using the ApopTag fluorescein apoptosis detection kit (Serologicals Corporation). After

nuclear counter-staining with Hoechst 33258, the number of TUNELpos nuclei with condensed

nuclear chromatin was determined by fluorescence microscopy and expressed as the

percentage of all Hoechstpos nuclei. Moreover, cardiomyocytes were labeled with annexin V

and propidium iodide (PI) and analyzed by flow cytometry (FACSCalibur, BD Biosciences).


3

Surgical procedures. All animal procedures were approved by our local state authorities.

Myocardial GDF-15 expression levels were determined in 8 to 12-week-old male C57BL/6

mice subjected to permanent or transient left anterior descending coronary artery (LAD)

ligation, as described previously.6,7 In brief, mice were anesthetized and ventilated with

isoflurane (1-2%). A left thoracotomy was performed, and the LAD was ligated with a

slipknot, which was left in place (permanent ischemia), or removed 1h later (I/R). Control

mice underwent a sham operation. At various time points, mice were sacrificed, left ventricles

(LVs) were removed, divided into the injured area (anteroapical wall, distal to the ligation

site) and remote myocardium (basal part of the interventricular septum), and snap-frozen in

liquid N2. Gdf-15 gene-targeted mice were kindly provided by Dr. Se-Jin Lee (Johns Hopkins

University) and maintained on a C57BL/6/129/SvJ background.8 Eight to 16-week-old male

and female Gdf-15 deficient mice and their wild-type littermates were subjected to transient

LAD ligation. Area-at-risk and infarct sizes were determined by Evans blue and TTC staining

and computerized planimetry. Apoptotic cardiomyocytes in the infarct border zone were

detected by TUNEL and Hoechst staining (cardiomyocytes were identified by anti-α-actinin

immunostaining).7 Heart rate, mean arterial blood pressure, and maximal left ventricular

pressure were determined in a closed chest preparation using a 1.4 F Millar catheter advanced

via the right carotid artery into the ascending aorta and LV, as described previously.9

Human myocardial tissue. Ethical approval was obtained from the Ethics Committee at the

University Medical Center in Amsterdam. LV myocardial tissue samples were collected at

autopsy from 17 patients who had died from an AMI (10 males, mean age 66±3 years) and

from 5 patients who had died from non-cardiac causes (2 males, mean age 59±9 years).

Autopsy was performed within 24h after death. Tissue samples were taken from the infarcted

myocardium (delineated by decreased LDH staining),10 and stored in liquid N2.

Immunohistochemistry. The expression pattern of GDF-15 in human myocardial tissue

samples was determined by immunohistochemistry using the anti-human GDF-15 antibody

from R&D Systems (1:250 dilution), and a secondary horseradish peroxidase-conjugated

rabbit anti-goat antibody from Dakopatts (1:25 dilution). Viable and irreversibly damaged

(jeopardized) myocardial areas were discriminated by anti-complement C3d staining using the

C3-15 monoclonal antibody, as described.10 Slides were finally washed and incubated in PBS


4

containing 3,3'-diamine-benzedrine-tetrahydrochloride (0.5 mg/mL) and 0.01% H2O2.

Statistical analysis. Data are presented as means±SEM. The number of experiments refers to

the number of mice, patients, or independent cardiomyocyte preparations. Differences

between groups were analyzed by one-way ANOVA followed by Student-Newman-Keuls

post hoc test. A two-tailed P value <0.05 was considered to indicate statistical significance.

REFERENCES

1. Heineke J, Kempf T, Kraft T, Hilfiker A, Morawietz H, Scheubel RJ, Caroni P,

Lohmann SM, Drexler H, Wollert KC. Downregulation of cytoskeletal muscle LIM

protein by nitric oxide: impact on cardiac myocyte hypertrophy. Circulation.

2003;107:1424-32.

2. Patten RD, Pourati I, Aronovitz MJ, Baur J, Celestin F, Chen X, Michael A, Haq S,

Nuedling S, Grohe C, Force T, Mendelsohn ME, Karas RH. 17beta-estradiol reduces

cardiomyocyte apoptosis in vivo and in vitro via activation of phospho-inositide-3

kinase/Akt signaling. Circ Res. 2004;95:692-9.

3. Strelau J, Sullivan A, Bottner M, Lingor P, Falkenstein E, Suter-Crazzolara C, Galter

D, Jaszai J, Krieglstein K, Unsicker K. Growth/differentiation factor-15/macrophage

inhibitory cytokine-1 is a novel trophic factor for midbrain dopaminergic neurons in

vivo. J Neurosci. 2000;20:8597-603.

4. Bottner M, Laaff M, Schechinger B, Rappold G, Unsicker K, Suter-Crazzolara C.

Characterization of the rat, mouse, and human genes of growth/differentiation factor-

15/macrophage inhibiting cytokine-1 (GDF-15/MIC-1). Gene. 1999;237:105-11.


5

5. Stephanou A, Brar BK, Scarabelli TM, Jonassen AK, Yellon DM, Marber MS, Knight

RA, Latchman DS. Ischemia-induced STAT-1 expression and activation play a critical

role in cardiomyocyte apoptosis. J Biol Chem. 2000;275:10002-8.

6. Fuchs M, Hilfiker A, Kaminski K, Hilfiker-Kleiner D, Guener Z, Klein G, Podewski

E, Schieffer B, Rose-John S, Drexler H. Role of interleukin-6 for LV remodeling and

survival after experimental myocardial infarction. Faseb J. 2003;17:2118-20.

7. Hilfiker-Kleiner D, Hilfiker A, Fuchs M, Kaminski K, Schaefer A, Schieffer B,

Hillmer A, Schmiedl A, Ding Z, Podewski E, Poli V, Schneider MD, Schulz R, Park

JK, Wollert KC, Drexler H. Signal transducer and activator of transcription 3 is

required for myocardial capillary growth, control of interstitial matrix deposition, and

heart protection from ischemic injury. Circ Res. 2004;95:187-95.

8. Hsiao EC, Koniaris LG, Zimmers-Koniaris T, Sebald SM, Huynh TV, Lee SJ.

Characterization of growth-differentiation factor 15, a transforming growth factor beta

superfamily member induced following liver injury. Mol Cell Biol. 2000;20:3742-51.

9. D'Angelo DD, Sakata Y, Lorenz JN, Boivin GP, Walsh RA, Liggett SB, Dorn GW,

2nd. Transgenic Galphaq overexpression induces cardiac contractile failure in mice.

Proc Natl Acad Sci U S A. 1997;94:8121-6.

10. Lagrand WK, Niessen HW, Wolbink GJ, Jaspars LH, Visser CA, Verheugt FW,

Meijer CJ, Hack CE. C-reactive protein colocalizes with complement in human hearts

during acute myocardial infarction. Circulation. 1997;95:97-103.

Kempf et al CIRCRESAHA/2005/115485/R2Supplemental Figure

0

20

40

60

80

100

AAR/LV MI/AAR MI/LV

[%]

P<0.05

P<0.05

P<0.05

P<0.05

WT maleWT femaleKO maleKO female

Area-at-risk and infarct sizes after ischemia/reperfusion in male and female wild-type and Gdf-15 gene-targeted mice. Gdf-15 gene-targeted mice (KO) and their wild-type (WT) littermates underwent transient left anterior descending coronary artery ligation for 1h followed by reperfusion for 24h. The area-at-risk (AAR) and infarct sizes were determined by Evan`s blue and TTC staining. The AAR and infarcted area (MI) were expressed as [%] of left ventricular cross-sectional area (LV); MI was also calculated as [%] of AAR. Data from 8 male and 9 female KO mice and 12 male and 8 female WT mice are presented.

Helmut Drexler and Kai C. WollertTongers, Jörg Heineke, Daniel Kotlarz, Jian Xu, Jeffery D. Molkentin, Hans W. Niessen, Tibor Kempf, Matthias Eden, Jens Strelau, Marian Naguib, Christian Willenbockel, Jörn

Factor-15 Protects the Heart From Ischemia/Reperfusion Injury Superfamily Member Growth-DifferentiationβThe Transforming Growth Factor-

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2006 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/01.RES.0000202805.73038.482006;98:351-360; originally published online January 5, 2006;Circ Res.

http://circres.ahajournals.org/content/98/3/351World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2006/01/05/01.RES.0000202805.73038.48.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


http://circres.ahajournals.org/content/98/3/351

http://circres.ahajournals.org/content/suppl/2006/01/05/01.RES.0000202805.73038.48.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


Date post:	16-Nov-2023
Category:	Documents
Upload:	independent
View:	0 times
Download:	0 times

The Transforming Growth Factor- Superfamily Member Growth-Differentiation Factor-15 Protects the...

Documents