doi: 10.1098/rspb.2012.1664, 4694-4698 first published online 3 October 2012279 2012 Proc. R. Soc. B

SääksjärviAnu Veijalainen, Niklas Wahlberg, Gavin R. Broad, Terry L. Erwin, John T. Longino and Ilari E. tropical forestsUnprecedented ichneumonid parasitoid wasp diversity in

Supplementary data

tml http://rspb.royalsocietypublishing.org/content/suppl/2012/10/01/rspb.2012.1664.DC1.h

"Data Supplement"

Referenceshttp://rspb.royalsocietypublishing.org/content/279/1748/4694.full.html#ref-list-1

This article cites 31 articles, 3 of which can be accessed free

Subject collections

(151 articles)taxonomy and systematics � (115 articles)molecular biology �

(1194 articles)ecology � Articles on similar topics can be found in the following collections

Email alerting service hereright-hand corner of the article or click Receive free email alerts when new articles cite this article - sign up in the box at the top

http://rspb.royalsocietypublishing.org/subscriptions go to: Proc. R. Soc. BTo subscribe to

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from

Unprecedented ichneumonid parasitoid

wasp diversity in tropical forestsAnu Veijalainen1,2,*, Niklas Wahlberg1, Gavin R. Broad3,

Terry L. Erwin4, John T. Longino5 and Ilari E. Saaksjarvi1

1Department of Biology, University of Turku, 20014 Turku, Finland

2Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA 02138, USA

3Department of Life Sciences, Natural History Museum, Cromwell Road, London SW7 5BD, UK

4Department of Entomology, National Museum of Natural History, Smithsonian Institution,

Washington, DC 20013-7012, USA5Department of Biology, University of Utah, Salt Lake City, UT 84112, USA

The megadiverse parasitoid wasp family Ichneumonidae (Hymenoptera) is classically considered an

exception to the extensively studied latitudinal diversity gradient: the majority of ichneumonid species

are described from temperate regions. The gradient has been hypothesized to be dependent on the

biology of the wasps, but recently questions of sampling and description biases have been raised. Here,

we show with primary data that the species richness of Ichneumonidae is markedly underestimated in tro-

pical areas and that latitudinal diversity patterns in the family remain uncharacterized. We discovered a

startling 177 likely undescribed orthocentrine species with relatively low sampling effort in the forests

of Central America and Amazonian Ecuador, over three times the previously known orthocentrine diver-

sity in the world’s tropics. Species accumulation curves reveal that we are just beginning to unveil the true

extent of tropical orthocentrine diversity. We also found evidence for cryptic species; our DNA analysis

revealed additional species not easily distinguishable using morphological characteristics. The difficulty

in establishing species richness patterns of Ichneumonidae probably follows from the relative lack of

taxonomic expertise and the low density of ichneumonid species throughout the landscape.

Keywords: cryptic species; DNA barcoding; latitudinal diversity gradient; Neotropics; Orthocentrinae

1. INTRODUCTION

Explaining large-scale latitudinal gradients of species rich-

ness contributes to a better understanding of ecological and

evolutionary factors that foster global biodiversity patterns.

For well over a century, ecologists have recognized that

species richness increases with decreasing latitude in most

taxa [1,2]; however, the mechanisms underlying this pat-

tern are still contentious [3–6]. One notable exception to

the common trend has been the parasitoid wasp family

Ichneumonidae (Hymenoptera)—possibly the world’s lar-

gest animal family—which has repeatedly been shown to

be more species-rich in north temperate latitudes than in

tropical areas [7–11]. The vast tropical species richness

of another major parasitoid taxon, the Chalcidoidea, is

well established [12], which has meant that the supposedly

lower tropical species richness of Ichneumonidae is all the

more anomalous and must be intrinsically associated with

the ichneumonid way of life [13].

That Ichneumonidae are supposed to be more species-

poor in lower latitudes has been ascribed to limitations

emerging from host predation, location and utilization

[14]. This is thought to be the case especially for ichneumo-

nid koinobiont groups (i.e. parasitoids that allow the host to

grow and develop but finally kill the host prior to or during

pupation; [15,16]), while it has become apparent that the

gradient does not hold for some well-sampled idiobiont

groups (i.e. parasitoids that arrest their hosts’ development

at oviposition; [15]). Nevertheless, the view that this anom-

alous latitudinal species richness gradient applies to large

components of the Ichneumonidae is persistent [17].

However, recent evidence from a database and catalogue

of Ichneumonoidea [18] and Western Hemisphere sub-

family abundance studies suggest that the assumption of

low tropical ichneumonid diversity may follow from

sampling and description biases, and particularly that the

small-bodied koinobiont species might be overlooked or

undersampled in the tropics [11,14,19,20]. Sufficient

primary species-level data on tropical small-bodied koino-

biont ichneumonids have thus far been lacking. Because

parasitoids play key roles inmultitrophic interactions, under-

estimated tropical ichneumonid diversity would not only

bring into question any conclusions drawn about the family’s

latitudinal trends but also the level of impact that ichneumo-

nid species have on tropical ecosystem dynamics. Given that

(i) most ichneumonids remain undescribed, (ii) this is

especially true of tropical faunas, and (iii) there is limited

revisionary taxonomic work ongoing, we will need to

employ methods beyond mining catalogues and taxonomic

monographs if we are to gain a better understanding of the

size and composition of tropical ichneumonid faunas.

Here, we hypothesized that additional sampling in

Neotropical forests could reveal reservoirs of unknown

ichneumonid species diversity. We examined whether

the small-bodied koinobiont subfamily Orthocentrinae—

cosmopolitan and with all reliable host records from larval

* Author for correspondence (anu.veijalainen@utu.fi).

Electronic supplementary material is available at http://dx.doi.org/10.1098/rspb.2012.1664 or via http://rspb.royalsocietypublishing.org.

Proc. R. Soc. B (2012) 279, 4694–4698

doi:10.1098/rspb.2012.1664

Published online 3 October 2012

Received 18 July 2012Accepted 12 September 2012 4694 This journal is q 2012 The Royal Society

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from

fungus gnats (Diptera: Sciaroidea)—is more species-rich in

the tropics than indicated by the current totals of descri-

bed species (48 tropical species of a total of 463 described

species) [18,21]. We further employed integrative morpho-

logical and molecular species identification methods to

search for complexes of cryptic species. Molecular identifi-

cation methods may greatly advance species delimitation

in parasitoids and other organisms and reveal complexes

of morphologically similar species (bearing in mind the

limitations of the procedures; [19,22,23]).

2. MATERIAL AND METHODS

We collected orthocentrines with relatively low sampling effort

from the Amazonian lowland rain forest canopy in Ecuador

(using canopy fogging methods; [24]) and from various alti-

tudes and vegetation types in Central America (using

Malaise traps; electronic supplementary material, table S1).

We sorted the specimens into morphologically similar groups

representing the minimum number of morphospecies, and

independently studied the differences in the mitochondrial

gene cytochrome oxidase c subunit I of selected individuals to

estimate the cryptic species diversity in the sample.

(a) Field sampling

The Central American specimens were collected by the

LLAMA project (J. T. Longino) with ground-level Malaise

traps at 25 study sites ranging from 30 to 2625 m.a.s.l. in

Guatemala, Honduras and Nicaragua in May–July 2009,

2010 and 2011, respectively. Traps were generally located

on forest edges or in small clearings. Sampling took place

during the transition from dry season to wet season. Total

sample size was 313 Malaise trap days, which collected a

total of 471 orthocentrine individuals (see the electronic

supplementary material, table S1).

The Western Amazonian canopy fogging samples were

collected in eastern Ecuadorean non-inundated lowland rain

forest sites near Yasunı National Park at Onkone Gare

(0839025.68500 S, 76827010.81300 W) and Tiputini Biological

Station (0837055.39700 S, 76808039.20400 W), Orellana Pro-

vince, adjacent to the Yasunı National Park, 21 km from

each other and approximately 220 m.a.s.l. Both sites were

1 ha in size: a 100 � 1000 m area divided into 10 transects

of 10 � 100 m where 10 randomly positioned collecting

stations (sheets each 9 m2) were placed on each sampling

occasion in February, June–July and September–October of

1994–1996, 1998–1999 and 2005 [20,24]. The vegetation

at the sites is old and diverse, primary lowland terra firme

rain forest, and the climate is somewhat aseasonal (least rain

falling in February and most in the June–July field season).

Orthocentrines were found in 599 of the 1079 canopy fogging

samples available for this study [20]. Of a total of 2731 indivi-

duals, 1078 were assigned to morphospecies (see below).

(b) DNA barcoding and mini-barcoding

A total of 226 randomly chosen specimenswere studied geneti-

cally. We used the DNA barcoding method for the Honduran

(ca 600 bp; DNA barcoding) and the Guatemalan and

Ecuadorean (ca 300 bp; DNA mini-barcoding) specimens to

find differences in the mitochondrial gene cytochrome oxidase

c subunit I (COI) sequences. First, we removed three legs of

one side from each specimen and extracted their DNA using

the DNeasy Blood & Tissue Kit (QIAGEN). We followed

the standard bench protocol for animal tissue in DNeasy

Blood & Tissue Handbook 07/2006 with additional

incubation at 708 C for 10 min after adding the Buffer AL

and vortexing. Next, we amplified the fragments of the

50 end of the COI by PCR (20 ml volume; 1 ml of DNA extract

and 19 ml of master mix: 12.5 ml dH2O, 2.0 ml 10 � PCR

Gold Buffer, 2.0 ml MgCl2 solution, 2 � 1.0 ml primer,

0.4 ml dNTP, 0.1 ml Ampli Taq Gold). We used the primers

LCO (50 GGTCAACAAATCATAAAGATATTGG 30) and

HCO (50 TAAACTTCAGGGTGACCAAAAAATCA 30)

[25] in DNA barcoding and K698 (50 TACAATTTATCGCC

TAAACTTCAGCC 30) and K699 (50 WGGGGGGTAAAC

TGTTCATCC 30) [26] in DNA mini-barcoding. The PCRs

were run for 40 cycles with an annealing temperature of

508C. Macrogen (South Korea) cleaned and sequenced

the successful PCRs before we edited and aligned the

sequences. Finally, we constructed the neighbour-joining

tree, based on the Maximum Composite Likelihood using

MEGA v. 4 [27]. The sequences are found under accession

numbers JX657848–JX658074 in GenBank.

(c) Morphological identification

We identified 1549 specimens to genera according toBroad [21]

and Townes [28] after first excluding 464 Ecuadorean speci-

mens that were in a condition that prevented their confident

identification, and thenexcluding1189non-barcodedEcuador-

ean Orthocentrus genus group males. Matching the sexes of an

ichneumonid species may be challenging; thus we excluded

the non-barcoded Ecuadorean Orthocentrus genus group males

to minimize the chance of incorrectly classifying the two

sexes of one species as two distinct ones. We compared the

morphospecies to type material or photos of type material

of the described Neotropical species (Chilocyrtus carinatus

Townes, Megastylus panamensis Wahl, Orthocentrus insularis

Ashmead, Stenomacrus variabilis (Ashmead)) and Nearctic

species found in the southern US (Stenomacrus californicus

(Ashmead), Stenomacrus hastatus Davis, Stenomacrus premitus

(Davis), Stenomacrus ulmicola (Ashmead), Plectiscus suffuscus

(Davis),Orthocentrus decoratusTownes,Orthocentrus tetrazonatus

(Ashmead)), and ran the Helictes genus group specimens

through the key in [29], concluding that all the morphospecies

are likely undescribed.

3. RESULTS

We examined 1549 individuals (1078 from Ecuador and

471 from Central America) that included a minimum of

177 morphospecies (figure 1 and table 1), which is over

three times the number of currently described tropical

orthocentrine species.We applied non-parametricmethods

(ACE, Chao1 and Jack2) for species richness estimation

[30]. The morphospecies numbers were shown to be

underestimates of the true species richness of both areas

(figure 2 and table 1; calculated by using ESTIMATES

v. 8.2.0). All morphospecies appear to represent unde-

scribed species. All genera except two (Apoclima,

Catastenus) that have been reported from the Neotropics

were represented in the samples (figure 1). The numbers

of morphospecies of the orthocentrine genera Chilocyrtus,

Gnathochorisis, Orthocentrus and Megastylus were close to

or higher than their global described species numbers

(figure 1). The voucher specimens are currently on loan

to the Zoological Museum, University of Turku (ZMUT)

and later to be deposited in the collaborative institutions

of the LLAMA project and National Museum of Natural

History, Smithsonian Institution.

Unprecedented parasitoid diversity A. Veijalainen et al. 4695

Proc. R. Soc. B (2012)

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from

DNA sequence data were obtained for 226 individuals

of 57 morphospecies. For 43 morphospecies (124 indi-

viduals, of which 28 were singletons), genetic clusters

corresponded to morphospecies. For 14 morphospecies

(102 individuals), there were deep genetic divergences,

with individuals of single morphospecies clustering in

two or three groups. The 14 morphospecies contained

31 potential cryptic species not easily distinguishable using

morphological features (see the electronic supplementary

material, figure S1).

4. DISCUSSION

The high species richness that we discovered demon-

strates that tropical ichneumonids have been vastly

underestimated when considering latitudinal diversity

gradients. When the minimum number of Neotropical

orthocentrine species is considered to be 177 rather

than the currently described 14, and is compared with

the 151 known species for all of the Nearctic ([18];

Nearctic fauna revised in large part by Dasch [29]), the

need to examine the true ichneumonid species richness

at different latitudes becomes apparent. Additional

research is almost certain to substantially increase the

species number for at least three reasons: (i) our sampling

covered only a tiny fraction of the spatial and temporal tro-

pical habitat complexity, (ii) the integrated identification

results pointed to the presence of species complexes that

are difficult to separate using morphological characters

(e.g. Chilocyrtus sp. 12 and Orthocentrus sp. 10), and

(iii) the species number estimations indicated clearly

higher-than-observed total local diversity in both study

areas. The Central American data presumably consist of

species specialized to a variety of environmental conditions,

as the specimens were collected from 25 ecologically and

altitudinally distinct study sites across Guatemala,

Honduras and Nicaragua. The specimens from Ecuador

came from two sites at the same altitude and only 21 km

apart, yet showing high beta-diversity ([24]; e.g. the two

transects have 75% different tree species: [31]).

Most described Neotropical orthocentrines are from

Central America and the Caribbean [18,32]; here we

reveal that the subfamily is species-rich also in Western

Amazonia. The 95 Ecuadorean morphospecies were col-

lected from only two hectares of rain forest canopy

[20,24], which prompts the question of how many more

unknown ichneumonid species does the entire Amazonia

harbour? We also expect Orthocentrinae to be diverse in

the tropics of other continents; for example, no species

have been described from southeast Asia [18] although

Orthocentrinae is one of the most abundant ichneumonid

subfamilies in that region’s rain forests [33].

Reliable host records for Orthocentrinae are all from

Sciaroidea (Diptera), the larvae of which are fungivores

or root eaters (or sometimes predatory, e.g. Keroplatidae)

and rarely reared in the tropics to look for parasitoids.

This is thus a very large sector of parasitoid diversity that

has been mostly overlooked in the Neotropics (and other

tropical regions). There is also the intriguing problem

that species richness of some orthocentrine genera has

potentially been massively underestimated in the north

temperate and subarctic zones too [34], further obscuring

any latitudinal gradients in species-richness. Given that

the Orthocentrinae comprises a great many species in

many biomes, and that a large proportion of the genera

are essentially cosmopolitan in distribution, the subfamily

would repay large-scale quantitative sampling efforts at

different latitudes.

100

80no. sp

ecie

s

60

40

20

0

Aperileptus

Chilocyrtu

s

Eusterin

x

Gnathochoris

is

Helictes

Megasty

lus

Orthocentru

s

Panthisarth

rus

Plectiscidea

Plectiscus

Proclitus

Sphingozona

Stenomacrus

Symplecis

other genera

Figure 1. Number of morphospecies in the total dataset (grey bars), and described orthocentrine species in the Neotropics

(black bars) and the world (white bars) (after [18,21]).

Table 1. Morphospecies numbers per study area showing numbers of morphospecies, including females or distinguished

based only on males (see §2). The estimated numbers of species (ACE, Chao1 and Jack2) were calculated based on the

number of species in ‘All material’ (i.e. Ecuador: 95, Central America: 88).

morphospecies only females or both sexes only males all material ACE Chao1 Jack2

Ecuador 73 16 89 118 111 134

Central America 68 14 82 139 134 157

common to both sites 6 0 6

total 147 30 177

4696 A. Veijalainen et al. Unprecedented parasitoid diversity

Proc. R. Soc. B (2012)

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from

This study made use of ‘residual’ material from bio-

diversity inventories directed at other taxa. It impressively

demonstrates how such residual material can be used to

facilitate the discovery of tropical arthropod diversity. Our

Ecuadorean Amazonian morphospecies alone would

account for about 78 per cent of the total number of new

aquatic and terrestrial plant and vertebrate species

described on average per year from the entire Amazon

biome (1220 species in 1999–2009; [35]). It is no surprise

that laboriously identifiable species from remote environ-

ments with unknown socio-economic potential have not

yet caught much scientific attention, yet their systematic

underestimation biases our understanding of multi-trophic

tropical interactions and determination of large-scale bio-

diversity patterns. Increasing anthropogenic pressure on

natural tropical environments should encourage us to

promptly address the true extent of tropical ichneumonid

diversity [36].

We conclude with primary data that tropical sampling

and description has indeed been inadequate to draw any

conclusions about the species richness patterns in Ichneu-

monidae. We revealed very high undescribed diversity in

Orthocentrinae, a group of koinobiont ichneumonid para-

sitoid wasps, in tropical America, where the group had

previously been rarely reported. The results are significant

because Ichneumonidae is a very large family and a classic

example of a group with an atypical latitudinal diversity

gradient. This study demonstrates that our understanding

of the latitudinal diversity gradient of Ichneumonidae is

incomplete, and additional sampling will likely require

us to redefine the current understanding of large-scale

diversity patterns in the family.

We thank Ecuambiente Consulting Group, S. A., Quito,Ecuador for field work and the Smithsonian Institution fortravel and field assistants in Ecuador. Project LLAMA wassupported by National Science Foundation grant DEB-0640015. Laboratory work was funded by The Academy ofFinland grant no. 129811 (N.W.) and Kone Foundation grantBiodiversity and multiple trophic interactions (I.E.S.). TheFinnish Society of Forest Science, Jenny and Antti WihuriFoundation, Smithsonian Institution Graduate StudentFellowship, and SYNTHESYS provided personal funding toA.V. We also thank Matthew Buffington and Michael Sharkeyfor arranging the LLAMA samples, TEGLab staff (Universityof Turku) for assistance with the DNA work, Carol Castillofor data processing, Jukka Salmela for comments on thespecies estimations, and Karolyn Darrow, David Wahl andJason Weintraub for sending images of type specimens. Twoanonymous referees provided valuable comments on themanuscript.

REFERENCES

1 Wallace, A. R. 1878 Tropical nature and other essays.

New York, NY: Macmillan.

2 Gaston, K. J. 2000 Global patterns in biodiversity. Nature

405, 220–227. (doi:10.1038/35012228)

160(a)

(b)

120

80

40

0 10 20 30 40

no. sp

ecie

s

50 60 70

160

120

80

40

0 100 200 300 400 500 600 700 800 900 1000

no. sp

ecie

s

no. foggings

no. traps

Figure 2. Selected species richness estimators as the function of increased sampling effort. (a) Central America, (b) Ecuador;

observed (black line), the observed species accumulation curve; singletons (red line), species collected once in the study; doubletons

(blue line), species collected twice in the study; ACE (orange line), abundance-based coverage estimator of species richness; Chao1

(purple line), abundance-based estimator of species richness; Jack2 (green line), second-order jack-knife richness estimator.

Unprecedented parasitoid diversity A. Veijalainen et al. 4697

Proc. R. Soc. B (2012)

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from

3 Willig,M.R.,Kaufman,D.M.&Stevens, R.D. 2003Lati-

tudinal gradients of biodiversity: pattern, process, scale

and synthesis. Annu. Rev. Ecol. Evol. Syst. 34, 273–309.

(doi:10.1146/annurev.ecolsys.34.012103.144032)

4 Hillebrand, H. 2004 On the generality of the latitudinal

diversity gradient. Am. Nat. 163, 192–211. (doi:10.

1086/381004)

5 Mittelbach, G. G. et al. 2007 Evolution and the latitudi-

nal diversity gradient: speciation, extinction and

biogeography. Ecol. Lett. 10, 315–331. (doi:10.1111/j.

1461-0248.2007.01020.x)

6 Condamine, F. L., Sperling, F. A. H., Wahlberg, N.,

Rasplus, J.-Y. & Kergoat, G. J. 2012 What causes latitu-

dinal gradients in species diversity? Evolutionary

processes and ecological constraints on swallowtail

biodiversity. Ecol. Lett. 15, 267–277. (doi:10.1111/j.

1461-0248.2011.01737.x)

7 Owen, D. F. & Owen, J. 1974 Species diversity in temper-

ate and tropical Ichneumonidae. Nature 249, 583–584.

(doi:10.1038/249583a0)

8 Janzen, D. H. 1981 The peak in North American ichneu-

monid species richness lies between 388 and 428N.

Ecology 62, 532–537. (doi:10.2307/1937717)

9 Gauld, I. 1987 Some factors affecting the composition

of tropical ichneumonid faunas. Biol. J. Linn. Soc. 30,

299–312. (doi:10.1111/j.1095-8312.1987.tb00304.x)

10 Jones, O. R., Purvis, A. &Quicke,D. L. J. 2012 Latitudinal

gradients in taxonomic overdescription rate affect macroe-

cological inferences using species list data. Ecography 35,

333–340. (doi:10.1111/j.1600-0587.2011.06956.x)

11 Quicke, D. L. J. 2012 We know too little about parasitoid

wasp distributions to draw any conclusions about latitudi-

nal trends in species richness, body size and biology. PLoS

ONE 7, e32101. (doi:10.1371/journal.pone.0032101)

12 Noyes, J. S. 1989 The diversity of Hymenoptera in the

tropics with special reference to Parasitica in Sulawesi.

Ecol. Entomol. 14, 197–207. (doi:10.1111/j.1365-2311.

1989.tb00770.x)

13 Gauld, I. D., Gaston, K. J. & Janzen, D. H. 1992 Plant

allelochemicals, tritrophic interactions and the anoma-

lous diversity of tropical parasitoids: the ‘nasty’ host

hypothesis. Oikos 65, 353–357. (doi:10.2307/3545032)

14 Santos, A. M. C. & Quicke, D. L. J. 2011 Large-scale

diversity patterns of parasitoid insects. Entomol. Sci. 14,

371–382. (doi:10.1111/j.1479-8298.2011.00481.x)

15 Askew, R. R. & Shaw,M. R. 1986 Parasitoid communities:

their size, structure and development. In Insect parasitoids

(eds J. Waage & D. Greathead), pp. 225–264. London,

UK: Academic Press.

16 Gauld, I. D. 1986 Latitudinal gradients in ichneumonid

species richness in Australia. Ecol. Entomol. 11,

155–161. (doi:10.1111/j.1365-2311.1986.tb00290.x)

17 Kindlmann, P., Schodelbauerova, I. &Dixon, A. F. G. 2007

Inverse latitudinal gradients in species diversity. In Scaling

biodiversity (eds D. Storch, P. Marquet & J. Brown),

pp. 246–257.Cambridge,UK:CambridgeUniversityPress.

18 Yu, D. S., van Achterberg, K. & Horstmann, K. 2005

World Ichneumonoidea 2004. Taxonomy, biology, morphology

and distribution. Taxapad, CD: Vancouver.

19 Smith,M.A.,Rodriguez, J. J.,Whitfield, J. B.,Deans,A.R.,

Janzen, D. H., Hallwachs, W. & Hebert, P. D. N. 2008

Extreme diversity of tropical parasitoid wasps exposed by

iterative integration of natural history, DNA barcoding,

morphology, and collections. Proc. Natl Acad. Sci. USA

34, 12 359–12 364. (doi:10.1073/pnas.0805319105)

20 Veijalainen, A., Saaksjarvi, I. E., Erwin, T. L., Gomez,

I. C. & Longino, J. T. In press. Subfamily composition

of Ichneumonidae (Hymenoptera) from western

Amazonia: insights into diversity of tropical parasitoid

wasps. Insect Conserv. Diver. (doi:10.1111/j.1752-4598.

2012.00185.x)

21 Broad, G. R. 2010 Status of Batakomacrus Kolarov

(Hymenoptera: Ichneumonidae: Orthocentrinae), with

new generic combinations and description of a new

species. Zootaxa 2394, 51–68.

22 Smith, M. A., Fernandez-Triana, J., Roughley, R. &

Hebert, P. D. N. 2009 DNA barcode accumulation

curves for understudied taxa and areas. Mol. Ecol. Resour.

9, 208–216. (doi:10.1111/j.1755-0998.2009.02646.x)

23 Taylor, H. R. & Harris, W. E. 2012 An emergent science

on the brink of irrelevance: a review of the past 8 years of

DNA barcoding. Mol. Ecol. Resour. 12, 377–388.

(doi:10.1111/j.1755-0998.2012.03119.x)

24 Erwin, T. L., Pimienta, M. C., Murillo, O. E. & Aschero,

V. 2005 Mapping patterns of ß-diversity for beetles across

the Western Amazon Basin: a preliminary case for

improving inventory methods and conservation strat-

egies. Proc. Natl Acad. Sci. USA 56, 72–85.

25 Folmer, O., Black, M. B., Hoch, W., Lutz, R. A. &

Vrijehock, R. C. 1994 DNA primers for amplification

of mitochondrial cytochrome c oxidase subunit I from

diverse metazoan invertebrates. Mol. Mar. Bio. Biotech.

3, 294–299.

26 Caterino, M. S. & Sperling, F. A. H. 1999 Papilio phylo-

geny based on mitochondrial cytochrome oxidase I and II

genes. Mol. Phylogenet. Evol. 11, 122–137. (doi:10.

1006/mpev.1998.0549)

27 Kumar, S., Tamura, K. & Nei, M. 2004 MEGA3: inte-

grated software for Molecular Evolutionary Genetics

Analysis and sequence alignment. Brief Bioinform. 5,

150–163. (doi:10.1093/bib/5.2.150)

28 Townes, H. 1971 Genera of Ichneumonidae 4. Mem.

Am. Entomol. Inst. 17, 1–372.

29 Dasch, C. E. 1992 The Ichneumon-flies of America

north of Mexico: Part 12. Subfamilies Microleptinae,

Helictinae, Cylloceriinae and Oxytorinae (Hymenoptera:

Ichneumonidae). Mem. Am. Entomol. Inst. 52, 1–470.

30 Colwell, R. K. & Coddington, J. A. 1994 Estimating terres-

trial biodiversity through extrapolation. Phil. Trans. R. Soc.

Lond. B 345, 101–118. (doi:10.1098/rstb.1994.0091)

31 Pitman, N. C. A. et al. 2008 Tree community change

across 700 km of lowland Amazonian forest from the

Andean foothills to Brazil. Biotropica 40, 525–535.

(doi:10.1111/j.1744-7429.2008.00424.x)

32 Wahl, D. B. & Gauld, I. D. 1998 The cladistics and

higher classification of the Pimpliformes (Hymenoptera:

Ichneumonidae). Syst. Entomol. 23, 265–298. (doi:10.

1046/j.1365-3113.1998.00057.x)

33 Horstmann, K., Floren, A. & Linsenmair, K. E. 1999

High species richness of Ichneumonidae (Hymenoptera)

from the canopy of a Malaysian rain forest. Ecotropica 5,

1–12.

34 Fernandez-Triana, J., Smith, M. A., Boudreault, C.,

Goulet, H., Hebert, P. D. N., Smith, A. C. & Roughley,

R. 2011 A poorly known high-latitude parasitoid wasp

community: unexpected diversity and dramatic changes

through time. PLoS ONE 6, e23719. (doi:10.1371/

journal.pone.0023719)

35 World Wild Fund. 2010 Amazon Alive! A decade of discov-

ery 1999–2009. See http://www.wwf.se/source.php/

1310817/Amazon%20Alive_2010.pdf.

36 Barnosky, A. D. et al. 2011 Has the Earth’s sixth mass

extinction already arrived? Nature 471, 51–57. (doi:10.

1038/nature09678)

4698 A. Veijalainen et al. Unprecedented parasitoid diversity

Proc. R. Soc. B (2012)

on October 29, 2012rspb.royalsocietypublishing.orgDownloaded from