(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)

(19) World Intellectual PropertyOrganization

International Bureau(10) International Publication Number

(43) International Publication Date WO 2015/171741 Al12 November 2015 (12.11.2015) P O P C T

(51) International Patent Classification: (81) Designated States (unless otherwise indicated, for everyA61K 38/00 (2006.01) C12Q 1/68 (2006.01) kind of national protection available): AE, AG, AL, AM,

AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY,(21) International Application Number: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM,

PCT/US2015/029439 DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT,

(22) International Filing Date: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR,

6 May 2015 (06.05.2015) KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG,MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM,

(25) Filing Language: English PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC,

(26) Publication Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN,TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.

(30) Priority Data:61/989,037 6 May 2014 (06.05.2014) (84) Designated States (unless otherwise indicated, for every

kind of regional protection available): ARIPO (BW, GH,(71) Applicant: DANA-FARBER CANCER INSTITUTE, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ,

INC. [US/US]; 450 Brookline Avenue, Boston, MA TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU,0221 5-5450 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE,

DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU,(72) Inventors: BITTINGER, Mark; 23 Bretton Road, Dover,LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK,

MA 02030 (US). ENGLISH, Jessie, M.; c/o Dana-FarberSM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ,

Cancer Institute, Inc., 450 Brookline Avenue, Boston, MAGW, KM, ML, MR, NE, SN, TD, TG).

0221 5-5450 (US). WONG, Kwok-Kin; 49 ColumbiaRoad, Arlington, MA 02476 (US). ZACHAREK, Sima; Published:32 Parkton Rd #2, Jamaica Plain, MA 02130 (ZA).

— with international search report (Art. 21(3))(74) Agents: SMITH, DeAnn, F. et al; Foley Hoag LLP, Sea — before the expiration of the time limit for amending the

port West, 155 Seaport Blvd., Boston, MA 02210-2600 claims and to be republished in the event of receipt of(US). amendments (Rule 48.2(h))

(54) Title: COMPOSITIONS AND METHODS FOR IDENTIFICATION ASSESSSMENT, PREVENTION, AND TREATMENTOF CANCER USING NFS1 BIOMARKERS AND MODULATORS

cDNA

T £ l l s X s i c l s N S

* - . ' , .'· ;- DOX ~

1 : . - - mm.

+ DOX

© (57) Abstract: The present invention is based, in part, on the identification, of novel mitochondrial iron-sulfur (Fe-S) cluster biosyn-thesis pathway biomarkers and modulators, and methods of use thereof, for identifying, assessing, preventing, and treating cancer.

COMPOSITIONS AND METHODS FOR IDENTIFICATION,

ASSESSMENT, PREVENTION, AND TREATMENT O F CANCER USING

NFSl IO AR ER AND MODULATORS

Cross-Referenee Related Applications

This application claims the benefit of U.S. Provisional Application No, 61/989,037,

filed on 6 May 20 !4; the entire contents of said application are incorporated herein in their

entirety fay this reference.

Background of the n i u

Despite advances in understanding the etiology of cancer and effective methods for

treating cancer, malignant neoplasms represent the second most frequent cause of death

worldwide surpassed only by heart diseases. Although effective anti-cancer treatments

exist for many malignancies, such treatments are directed against well-known targets that

do not fully control such malignancies. Accordingly, there is a great need to identify new

cancer-related targets and bioniarkers useful for the identification, assessment, prevention,

and treatment of cancer.

u of the Invention

The present invention is based, at least in part, on the disco very that the iron-sulfur

cluster biosynthesis pathway plays a significant role in driving hyperproiiferative el

growth and that modulating the pathway (e .g., inhibiting the function of one or more iron-

sulfur cluster biosynthesis pathway members) can inhibit such hyperproiiferative cell

growth. n addition, btomarkers related to th iron-sulfur cluster biosynthesis pathway have

been identified that are useful for identifying and assessing modulation of such

hyperproiiferative ceil growth.

one aspect, a method of treating a subject afflicted w h a cancer comprising

administering to the subject an agent that inhibits the copy number, amount, and'or activity

of at least one biomarker listed in Table , thereby treating the subject afflicted with the

cancer, is provided. In one embodiment, the age is administered in a pharmaceutically

acceptable formulation n another embodiment, the agent directly binds the at least one

biomarker listed in Table . n still another embodiment, the at least one biomarker listed

in Table 1 is human NFS 1 or an ortholog thereof. In yet another embodiment, the method

further comprises administering o e or more additional anti-cancer agents, optionally

comprising mitochondrial cefaclor therapy.

in another aspect:, a method of inhibiting hyperproiiferaiive growth of a cancer c ll

or cells, the method comprising contacting the cancer cell or cells with an agent that inhibits

the copy number, amount, and/or activity of at least one biomarker listed in Table 1,

thereby inhibiting hyperproiiferaiive growth of the cancer cell or ceils, is provided i one

embodiment, the step of contacting occurs in vivo., ex vivo, or i vitro. In another

embodiment, the agent is administered in a pharmaceutically acceptable formulation. n

still another embodiment, the agent directly binds the at least: one biomarker listed in Table

. in yet another embodiment, the at least one biomarker listed in Table is human NFS!

or an ortholog thereof n another embodiment, the method further comprises administering

o e or more additional anti-cancer agents, optionally comprising mitochondrial cofactor

therapy.

In still another aspect, method of determining whether subject afflicted with a

cancer or at risk for developing a cancer would benefit from iron-sulfur cluster (ISC)

biosynthesis pathway inhibitor therapy, the method comprising: a) obtaining a biological

sample from the subject; b) determining the copy number, amount, and/or activity of at

least o e biomarker listed in Table 1 i a subject sample; c) determining the copy number,

amount, and/or activity of the at least one biomarker in a control; and d) comparing the

copy number, amount, and/or activity of the at least one biomarker detected in steps b) and

c); wherein a significant increase in the copy number, amount, and/or activity of the at least

one biomarker in the subject sample relative to the control copy number, amount, and/or

activity of the at least one biomarker indicates that the subject afflicted with the cancer or at

ris for developing the cancer would benefit from ISC biosynthesis pathway inhibitor

therapy, is provided in one embodiment, the method further comprises recommending,

prescribing, or administering ISC biosynthesis pathway inhibitor therapy if the cancer is

determined to benefit from ISC biosynthesis pathway inhibitor therapy. In another

embodiment, the method further comprises recommending, prescribing, or administering

anti-cancer therapy other than ISC biosynthesis pathway inhibitor therapy if the cancer is

determined to not benefit from ISC biosynthesis pathway inhibitor therapy still another

embodiment, the anti-cancer therapy is selected from the group consisting of targeted

therapy, chemotherapy, radiation therapy, and/or hormonal therapy in yet another

emb odiment, the control sample is determined from a cancerous or non-cancerous sample

from either the patient or a member of the same species to which the patient belongs. n

another embodiment, the control sample comprises ceils. In still another embodiment, the

method further comprises determining responsiveness to SC biosynthesis pathway

inhibitor therapy measured by at least one criteria selected from the group consisting of

clinical benefit rate, survival until mortality, pathological complete response, semi¬

quantitative measures of pathologic response, clinical complete remission, clinical partial

remission, clinical stable disease, recurrence-free survival, metastasis free survival, disease

free survival, circulating tumor cell decrease, circulating marker response, and EC ST

criteria.

n et another aspect, a method of assessing the efficacy of an agent for treating a

cancer n a subject, comprising: a) detecting n a first subject sample an maintained in the

presence of the agent the copy number, amount or activity of at least one biomarker listed

in Table ; b) detecting the copy number, amount, and/or activity of the at least one

biomarker listed in Table 1 in a second subject sample and maintained in the absence of the

test compound; and c) comparing the copy number, amount, and/or activity of the at least

one biomarker listed in Table from steps a) and b), wherein a significantly increased copy

number, amount, and/or activity of the at least one biomarker listed in Table in the first

subject sample relative to the second subject sample, indicates that the agent treats the

cancer in the subject, is provided.

n another aspect, a method of monitoring the progression of a cancer in a subject,

comprising; a) detecting in a subject sample at a first point in time the copy number,

amount, and/or activity of at least one biomarker listed in Table 1; b) repeating step a)

during at least one subsequent point in time after administration of a therapeutic agent; and

c) comparing the copy number, amount, and/or activity detected in steps a) and b), wherein

a significantly increased copy number, amount, and/or activity of the at least one biomarker

listed in Table in th first subject sample relative to at least one subsequent subject

sample, indicates that the agent treats the cancer in the subject, is provided n on

embodiment, the subject has undergone treatment, completed treatment, and/or is in

remission for the cancer in between the first point in time and the subsequent point in time,

n another embodiment, the subject has undergone ISC biosynthesis pathway inhibitor

therapy in between the first point in time an the subsequent point in time n still another

embodiment, the first and/or at least one subsequent sample is selected fr om the group

consisting of ex vivo and in v vo samples. n yet another embodiment, the irst and/or at

least one subsequent sample is obtained fro an animal model of the cancer in another

embodiment, the first and/or at least one subsequent sample is a portion of a single sample

or pooled samples obtained from the subject

n still another aspect, a cell-based method for identifying an agent which inhibits a

cancer, the method comprising: a) contacting a cell expressing at least one biomarker listed

in Table 1 with a . test agent; and b) determining the effect of the test agent on the copy

number, level of expression, or level of activity of the at least one biomarker listed in Table

1 to thereby identify an agent that inhibits the cancer, is provided n one embodiment, the

cells are isolated from an animal model of a cancer. n another embodiment, the cells are

from a subject afflicted with a cancer, n sti!i another embodiment, the cells are

unresponsive to SC biosynthesis pathway inhibitor therapy in yet another embodiment,

the step of contacting occurs in viva, ex vivo, or in vitro n another embodiment, the

method further coinpn scs determining the ability of the test agent to bind to the at least one

biomarker listed in Table 1 before or after determining the effect of the test agent on the

copy number, level of expression, or level of activity of the at least one biomarker listed in

Table 1 In another aspect, the sample comprises ceils, cell lines, histological slides,

paraffin embedded tissue, fresh frozen tissue, fresh tissue, biopsies, blood, plasma, serum,

buccal scrape, saliva, cerebrospinal fluid, urine, stool, mucus, or bone marrow, obtained

from the subject.

n yet another aspect, a cell-free method for identifying a compound which inhibits

a cancer, method comprising: a) determining the effect of a test compound on the

amount or activity of at least one biomarker listed in Table 1 contacted with a test

compound; b) determining the amount or activity of the at least one biomarker listed in

Table 1 maintained in the absence of the test compound; and c) comparing the amount

and/or activity of the at least one biomarker sted in Table 1 from steps a) and b), wherein a

significantly increased amount, and or activity of the at least one biomarker listed in Table

in step a) relative to step b , identifies a compound which inhibits the cancer, is provided.

n one embodiment, the method further comprises determining the ability of the test

compound to bind to the at least one biomarker listed in Table 1 before or after determining

the effect of the test compound on the amount or activity of the at least one biomarker . n

another embodiment, the steps a) and b) are selected from the group consisting of a

methylene blue assay, a ?-azido-4-tneihylcoumarin (A M C. assay, an alanine assay, and a

mass spectrometry assay. In still another embodiment, the blue assay compr es

i) reacting the at least one biomarker listed i Table 1 i a buffer comprising a) cysteine, b

a pyridoxal phosphate cofactor, and c) optionally the test compound; ii) stopping the

reaction by adding N,N-dimethyi-p-phenyienedi amine and iron chloride (F C ) in

hydrogen chloride (HQ) solution, and in) determining the production of methylene blue v a

absorhance of light having a wavelength of 670 t . n yet another embodiment, the AxMC

assay comprises i) reacting the at least one biomarker listed in Table 1 in a buffer

comprising a) cysteine, b) a pyridoxal phosphate cofactor, e) glutathione as reducing agent,

d) bovine serum albumin, e) 7-azido-4-raetaykoumarin, and f) optionally, the test

compound; and ii) fiuorometricaily onitorin the reaction product, 7-amino-4-

methylcoumarin. n another embodiment, the alanine assay comprises i) reacting the at

least one biomarker listed n Table in a buffer comprising a) cysteine, b) a pyridoxal

phosphate cofactor, e) DTT as reducing agent, and d) optionally, the test compound; ii)

performing a . secondary reaction to measure alanine production in a buffer containing a)

NAD (nicotinamide adenine dinucleoride) and b) alanine dehydrogenase enzyme; and n)

fiuorometricaiiy measuring the reaction product, NADH. in still another embodiment, the

mass spectrometry assay comprises ) reacting the at least one biomarker listed in Table 1 in

a buffer comprising a) cysteine, b) a pyridoxal phosphate cofactor, an c) optionally the test

compound; and ii) determining the production of alanine using mass spectrometry.

Other embodiments of the present invention are applicable to any of the methods,

compositions, assays, and the like presented herein. For example, in one embodiment, the

copy number is assessed by mieroarray, quantitative PCR (qPCR), high-throughput

sequencing, comparative genomic hybridization (CGH), or fluorescent in hybridization

(FISH). In another embodiment, the amount of th at least one biomarker is assessed by

detecting the presence in the samples of a polynucleotide molecule encoding the biomarker

or a portion of said polynucleotide molecule. still another embodiment, the

polynucleotide molecule is a mR A, cDNA, or functional variants or fragments thereof, i

yet another embodiment, the step of detecting further comprises amplifying the

polynucleotide molecule, in another embodiment, the amount of the at least one biomarker

is assessed b annealing a nucleic acid probe with the sample of the polynucleotide

encoding the one or more biomarkers or a portion of said polynucleotide molecule under

stringent hybridization conditio s n still another embodiment, the amount of the at least

one biomarker is assessed b detecting the presence a polypepti de of the at least one

biomarker. n yet another embodiment, fits presence of a polypeptide is detected using a

reagent which specifically bi ds with the polypeptide (e.g., a reagent selected from the

group consisting of a antibody, an antibody derivative, and an antibody fragment). n

another embodiment, the act ity of the at least one biomarker s assessed by determining

the magnitude of modulation of at least one NFS pharmacodynamic biomarker listed in

Table . In still another embodiment, the activity of the at least one biomarker is assessed

by determining the magnitude of modulation of the activity or expression level of at least

one downstream target of the at least one biomarker. ye another embodiment, the ISC

biosynthesis pathway inhibitor agent or test compound modulates a biomarker selected

from the group consisting of human NFS I , human LY M4, hu an SC human FXN,

human N F , human GLRX5, human BOLA3, human HSCB, human SPA9, human

SC , huma 1SCA2, human ίΒΑ.57. human NUBPL, human SLC2SA28, human PDXR,

human FDX2, and ort oiog of said biomarkers thereof. In another embodiment, the ISC

biosynthesis pathway inhibitor agent or test compound is an inhibitor selected from th

group consisting of a small molecule, antisense nucleic acid, interfering RNA, shR A,

siRNA , aptamer, ribozyme, dominant-negative protein binding partner, and combinations

thereof. In another embodiment, the at least on biomarker is selected .from the group

consisting of 2, 3, 4, 5, 6, 7, 8, 9, , or more biomarkers. i still another embodiment:, the

t least one biomarker is selected from the group of ISC biosynthesis pathway biomarkers

listed in Table In yet another embodiment the ISC biosynthesis pathway biomarkers

listed in Table 1 are selected from the group consisting of human NFS human LYRM4,

human ISCU, human FX , human U , human G RX5 human B A 3 hitman HSCB,

human HSPA9, human ISC , human ISCA2, human IBA57, human NUBPL, human

SLC25A28, human FDXR, human FDX2, and orthoiogs of said biomarkers thereof. In

another embodiment, the at least one biomarker is selected from the group of NFS 1

pharmacodynamic biomarkers listed n Table . n stil l another embodiment, the NFS

pharmacodynamic biomarkers listed in Table 1 are selected from the group consisting of

human aconitase, human succinate dehydrogenase, human ferritin, human transferrin-

reeeptor, human if alpha human PTGS2, and lipid reactive oxygen species ( OS). n yet

another embodiment, the cancer is selected from the group consisting of paragangliomas,

colorectal cancer, cervical cancer, ung adenocarcinoma, ovarian cancer, and myeloid

cancer within a hypoxic tumor microenvvronment. In another embodiment, the subject is a

mammal, such as an animal model of cancer or a human.

Brief Description Drawings

Figure 1 shows a schematic diagram of the iron-sulfur cluster biogenesis pathway

as adapted from Lira et l. (2 ) Htm. M Genet. 22:4460-4473.

Figure 2 shows the results of NFS I amplification assessed across available TCGA

(The Cancer Genome Atlas) datasets using the cBioPortal for Cancer Genomics (available

on the World W ! Web at cbioportai.org/pubh c-porta ) . The inset shows the correlation

between copy-number alterations (x- xis as determined by GISTIC) and mRNA expression

(y-axis, by RNASeq) rom a representative dataset (colorectal cancer). All histograms

shown represent: amplifications.

Figure 3 shows the results of collective alterations of NFS! , LYR 4/ISD , SCU,

and FXN evaluated across available TCGA datasets using the cBioPortal for Cancer

Genomics (available on the World Wide Web at cbioportal.org/public-portal/). Top bar of

histogram: amplification; middle bar of histogram: deletion; bottom bar of histogram:

imitation; gray: multiple alterations. The tipper inset shows the distribution of alterations

between NFS1, LYRM4, ISCU, and FXN in ovarian cancers. The lower insets show the

correlation between copy-number alterations (x-axis, as determined y GISTIC) and

mRNA expression (y-axis, by RNASeq) for NFS (left) and LYRM4 (right) from a

representative dataset.

Figure 4 shows the results of mutation analyses of solute carrier family 25

mitochondrial iron transporter, member 28 (SLC25A28), a mediator of iron uptake,

assessed across TCGA samples using datasets from the cBioPortal for Cancer Genomics

(available on the World Wide Web at cbioportai.org/pablic-portai/) an the Memorial

Sloan-Ketterlng Cancer Center (MSKCC). All markers shown represent raissense

mutations, except for the seventh market fro the left located at the -terminus of the

Mito_carr domain, which represents a ra eshi deletion.

Figure 5 shows that inducible knockdown of NFS using siiRNAs causes

clonogenic growth inhibition in M N74 cells.

Figure 6 shows the results o DNA rescue experiments confirming on-target

activity of NFS shRNAs.

Figure 7 shows the results of NFS .1 knockdown and resulting cell growth effects

across a panel of cell lines.

Figure shows the results of NFS s shut-off experiments confirming

restoration of clonogenic growth following derepression of NFS 1 function.

Figure 9 shows th results of aconitase activity and SDH activity measured i

lysates of mitochondria isolated m GAL-NFS ί cells harboring p as id- me copies of

WT NFSl, fl i LM/AA, or vector without insert, as indicated, and grown for 40 hours in

glucose-containing medium. Enzymatic activities were measured and plotted relative to the

non-iron-sulfur cluster protein, malate dehydrogenase. Th figure is adapted from

Majewska et . (20 ) J. Biol. C e . 288:2 4-29 42.

Figure 10 shows thai transient knockdown of NFS ! n ia ce!is shows alterations

in mitochondrial structure and significantly decreased activity of iron-sulfur-dependent

enzymes, including aconitase a d SDH. The figure is adapted from Biederbick el a l

(2006) Μ ί Ce l Biol 26 56 5-568 .

Figure shows a schematic diagram illustrating an iron-dependent form of n u-

apoptotic cell death known as ferroptosis. The. figure is adapted from. Dixon i al (2 )

Cell 149:4060-1072.

Figure 12 includes 2 panels, identified as panels A a B, which show data adapted

from Yang t al. (2 4) Cell 156:3 7-3 indicating that upregu atio of PTGS2

expression occurs upon crastin and {1S 3 )- S 3 treatment (panel A) and further showing

that PTGS2 expression is induced y PE (panel B). The oncogenic RAS-seieciive lethal

small molecule erasfin. triggers ferroptosis, which is dependent upon intracellular iron, but

not other metals, and is morphologically, biochemically, and genetically distinct from

apoptosis, necrosis, and autophagy. Erastin, like gluta ate inhibits cysteine uptake by the

cysteine/glutairiate antiporter (syst xc- ) creating; a void in the antioxidant defenses of

the eel! and ultimately leading to iron-dependent, oxidative death.

Figure 1 shows that RP~ represses H F2a translation and acti vity. The figure is

adapted from Zimmer e al. (2008) Cell 32:838-848.

Figure 14 shows dat confirming that candidate biomarkers for iran-suifur cluster

biosynthesis pathway modulation and iron-dependent cell death (ferroptosis) correlate with

NFSl inhibition.

Figure 1 includes 5 panels, identified as panels A, C, D, and E, which

demonstrate modulation of biomarkers of SC biosynthesis pathway modulation and iron-

dependent cell-death (ferroptosis) associated with NF knockdown. Panel A shows

decreases in ferritin protein le vels and increases in TFRC protein le vels. Panels B a d C

shows decreases in aconitase activity. Panel F. shows decreases in succinate dehydrogenase

activity. Panel F confirms knockdown of NFS i protein levels i the samples analyzed in

panels E and F.

Figure 6 shows that NFS 1 knockdown i the C2BBE1 colorectal cel

correlates w th down-regulation of HlF2a protein. The asterisk (*) indicates treatment for

24 hours w h cobalt chloride, a hypoxia-mimieking agent.

Figure 7 includes 2 panels, identified as panels A and which demonstrate that

NFS ! is essential in MK 74, an NPS- amplified cell line. Panel A shows that NFS is

amplified in the MKN74 gastric cell line. Panel B shows the results of cDNA rescue of

M N74 stable inducible NFS 1 shRNA lines with either wild type NFS or a dominani-

negative NFS! mutant.

Figure shows that cDNA scue with WT FS similar to that described in

Figure 7 restores the NFS -sh5~dependent effect ooaconiiase activity.

Figure 9 shows that WT NFS but »ot NFSl°* i , rescues th NFSl-shS-

dependetit inhibition of FTH1 protein levels and the p-reg ation of Tfi c prot n levels.

Figure 20 shows that the NFS i catalytic mutant causes a decrease in aeonitase

activity and ferritin levels comparable to that with NFS !-s or NF sh5

Figure 21 shows representative sulfide-based (e.g., methylene blue assays or

flurogenic sulfide probes, such as AzMC to AMC detection or alanine-based (e.g., alanine

dehydrogenase activity) detection methods for analyzing NFS. activity.

Figure 2 includes 2 panels, identified as panels A and B, which provide a

representative methylene blue assay suitable for high-through put formats (panel A) a d

representative sulfide detection range analyses (panel B). A value of > 0.5 is preferred

for enzymatic assays and Z was calculated as equaling 1 [ 3 (SD of signal + SD of

background) / (Mean of signal - Mean of background) ).

Figure 2 shows the loss of sulfide f om solution in a methylene blue assay over

time.

Figure 24 includes 3 panels, identified as panels A, B, and C, which provide a

representative AzMC assay suitable for high-through put formats (panel A) and

representative sulfide detection range analyses (panel B). values were calculated as

equaling 1 3 (SD of signal ·*· SD of background) (Mean of signal Mean of

background)). Panel C shows the enzyme kinetics of IscC using a AzMC assay optimized

for high-throughput analyses.

Figure 25 inc des 3 panels, identified as panels A , .8, a d C, which provide a

representati ve alanine assay suitable for high-through put formats (panel A) and

representative sulfide detection range analyses (panel B). Z* values were calculated as

equaling 1 [ 3 (SD of signal SD of background) / (Mean of signal - Mean of

background)]. Panel shows the enzyme kinetics of IscC using an alanine assa optimized

for high-throughput analyses.

Figure 26 shows exemplary reporter constructs useful for screening for NFS i

inhibitors and/or inhibitors of the iron-sulfur cluster biosynthesis pathway. The asterisks

(*) represent the use of luciferase, GFP, and RFP containing destabilizing sequences from

mouse ornithine decarboxylase at their C-terminus.

Note that for every figure containing a histogram, the bars from left to right for each

discreet measurement correspond to the figure boxes from top to bottom in the figure

legend as indicated.

Detailed Description of Invention

Iron-sulfur cluster biogenesis s necessary for th generation of iron-sulfur

containing proteins. t lias been determined herein that the presence, absence, amount (e.g.,

copy number or evel of expression), and/or activity of iron-sulfur cluster biogenesis

pathway members are biomarkers for the diagnosis, prognosis and treatment of cancers A

variety of cancers can be so analyzed and treated, such as those having overexpression of

N S and/or those having activating mutations n th HIF2a pathway.

L Definitions

The articles Y and "an" are used herein to refer to one or to more than one (i.e. to

at least one) of the grammatical object of the article. By way of example, "an element"

means on element or more than one element.

The term: "altered amount" or "altered level" refers to increased or decreased copy

number (e.g. , gcrmline somatic) of a biomarker nucleic acid, e.g., increased or

decreased expression level in a cancer sample, as compared to the expression level or copy

number of the biomarker nucleic acid in a control sample. The term "altered amount" of a

biomarker also includes a increased or decreased protein level of a biomarker protein in a

sample, e.g., a cancer sample, as compared to the. corresponding protein level in a normal,

control sample. Furthermore, an altered amount of a biomarker protein may be determined

by detecting posttraiislatKraai modificatioii such as methylatioii status of th marker, which

may affect the expression or activity of the biomarker protein.

The amount of a biomarker in a subject is "significantly" higher or lower than the

normal amount of the biomarker, if the amount of the biomarker is greater or less,

respectively, than the normal level by an amount greater than the standard error of the assay

employed to assess amount, and preferably at least 20¾, 30%, 40%, 50¾, 60%, 70%, 80¾,

90%, 0%, 0%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 000%

or tha that amount. Alternatively, the amount of the biomarker in the subject can be

considered "significantly" higher or lower tha the normal amount if the amount is at least

about two, and preferably at ieast about three, four, or five times, higher or lower,

respectively, than the normal amount of the biomarker.

The term "altered level of expression" of a biomarker refers to an expression level

or copy number of the biomarker in a test sample, e.g., a sample derived from a patient

suffering from cancer, that is greater or less than the standard error of the assay employed

to assess expression or copy number, and is preferably at least twice, and more preferably

three, .four, five or ten or more times the expression level or copy number of the biomarker

in a control sample (e.g... sample from a healthy subjects not having the associated disease)

and preferably, the average expression level or copy number of the biomarker in several

control samples. The altered level of expression is greater or less than the standard error o

the assa employed to assess expression or copy number, and is preferably at least twice,

and more preferably three, four, five or ten or more times the expression level or copy

number of the biomarker in a control sample (e.g., sample fr a healthy subjects not

having the associated disease) and preferably, the average expression level or copy number

of the biomarker in several control samples.

The term "altered activity" of a biomarker refers to an activity of the biomarker

which is increased or decreased i disease state, e.g., in a cancer sample, as compared to

the activity of the biomarker in a normal, control sample. Altered activity of the biomarker

may be the result of for example, altered expression of the biomarker, altered protein level

of the biomarker, altered structure of the biomarker, or, e.g., an altered interaction with

other proteins involved in the same or different pathway as the biomarker or altered

interaction with transcriptional activators or inhibitors.

The term "altered structure" of a biomarker refers to the presence of mutations or

allelic variants within a biomarker nucleic acid or protein, e.g., mutations which affect

expression or activity of the biomarker nucleic acid or protein, as compared to the normal

or wild-type ge e or protein. For example, mutations include, but are not limited to

substitutions, deletions, or addition mutations Mutations ay be present in the coding or

non-coding region of the biomarker nucleic acid.

Unless otherwise specified here within, the terms "antibody" and "antibodies"

broadly encompass naturally-occurring forms of antibodies (e.g. IgG, igA, g , IgE) and

recombinant antibodies such as single-chain antibodies, chimeric and humanized antibodies

and multi-specific antibodies, as well as fragments and derivatives of all of the foregoing,

which fr agme s a d derivatives have at least a antigenic binding s e Antibody

derivatives may comprise a protein or chemical moiety conjugated to an antibody.

The term "antibody" as used herei also includes an "antigen-binding portion" of an

antibody (or simply "antibody portion"). The term "antigen-binding portion", as used

herein, refers to one or more fragments of a antibody that retain the ability to specifically

bind to an antigen (e.g. , a biomarker polypeptide or fragment thereof). It has been shown

that the antigen-binding function of an antibody can be performed by fragments of a full-

length antibody. Examples of binding fragments encompassed within the ter "antigen-

binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment

consisting of the VL, VH, L and CH domains; (i ) a F ab ) fragment, a bivalent

fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region;

(iii) a Fd fragment consisting of the V H and CHI domains; (iv) a Fv fragment consisting of

the VL and VH domains of a single ar of an antibody, (v) a dAb fragment (Ward et al,

(1989) Nature 34 :544-546), which consists of a V domain; an (vi) an isolated

complementarity determining region (CDR). Furthermore, although the two domains of the

Fv fragment, VL and V , are coded for by separate genes, they can b joined, using

recombinant methods, by a synthetic linker that enables them to be made as a single protein

chain in which the VL and VH regions pair to form monovalent polypeptides (known as

single chai Fv (scFv); s e e.g.. Bird et al ( 88) Science 242:423-426; and Huston ei al

( 88) Prac. Natl Acad Sci. USA 85:5879-5883; and Osbourn e 1998, Nature

Biotechnology 6: 778). Such single chain antibodies are also intended to be encompassed

within the term "antigen-binding portion" of an antibody. Any VH and VL sequences of

specific seFv can be linked to human immunoglobulin constant region cD or genomic

sequences, in order to generate expression vectors encoding complete gG polypeptides or

oilier isotypes. VH and VL can also be used in the generation of Fab, Fv or other fragments

of immunoglobulins using either protein chemistry or recombinant DMA technology. Other

forms of single chain antibodies, such a diabodies are also encompassed. Diabodies are

bivalent, bispecific antibodies in which V and VL domains are expressed on a single

polypeptide chain, but using a linker that is too short to allow for pairing between the two

domains on the same chain, thereby forcing the domains to pair with complementary

domains of another chain and creating two antigen binding s es (see &g. Hoiliger et !.

(1993) Pr . Ν ί ί Acad. S t. U.S.A. 90:6444-6448; Poljak etal. 1994 Structure 2: 2 1-

123).

Still further, antibody or an tigen-binding portion thereof may be part of larger

immunoadbesion polypeptides, formed by ovalent or noncovalent association of the

antibody or antibody portion with one or more other proteins or peptides. Examples of such

immunoadhesion polypeptides include use of the streptavidin core region to make a

tctramcric scFv polypeptide (Kipriyanov etal. ( 95) Human Antibodies and Hy r d as

6:93-1 1) and use of cysteine residue, biomarker peptide and a C-terminal polyhistidmc

tag to make bivalent and biotinylated scFv polypeptides (Kipriyanov et l. (1994) Mol.

Immunol :1047-1058). Antibody portions, such as Fab and F(ab')2 fragments, can be

prepared from whole antibodies using conventional techniques, such as papain or pepsin

digestion, respectively, of whole antibodies. Moreover, antibodies, antibody portions and

immunoadbesion polypeptides can be obtained using standard recombinant NA

techniques, as described herein.

Antibodies ay be polyclonal or monoclonal; xenogeneic, allogeneic, or syngeneic;

or modified forms thereof (e.g. humanized, chimeric, etc.). Antibodies may also be fully

human. Preferably, antibodies of the invention bind specifically or substantially

specifically to a biomarker polypeptide or fragment thereof The terms "monoclonal

antibodies" an "monoclonal antibody composition", as used herein, refer to a population

of antibody polypeptides that contain only one species of an antigen binding site capable of

imniunoreaeting with a particular epitope of an an tigen, whereas the term "polyclonal

antibodies" and "polyclonal antibody composition" refer to a population of antibody

polypeptides that contain multiple species of antigen binding sites capable of interacting

with a particular antigen. A monoclonal antibody composition typically displays a single

binding affinity for a particular antigen with which it immunoreacts.

Antibodies may also be "humanized," which is intended to include antibodies made

by a non-human celi having variable and constant regions which have been altered to more

closely resemble antibodies that would be made by a human ceil. For example, by altering

the non-human antibody amino acid sequence o incorporate amino acids found in human

germlme i noglob sl sequences. The humanized antibodies of the invention may

include amino acid residues ot encoded by human germlme immunoglobulin sequences

.g., mutations introduced by random or site-specific mutagenesis in vitro or b somatic

imitation in vivo), for example in the CD s. The term "humanized antibody", used

herein, also includes antibodies in which CD sequences derived from the germ in of

another mammalian species, such as a mouse, have been grafted onto human framework

sequences.

The term "assigned score" refers to the numerical value designated for each of the

biomarkers after being measured in a patient sample. The assigned score correlates to the

absence, presence or inferred amount of the biomarker in the sample. The assigned score

can be generated manually (e.g., by visual inspection) or with th aid of instrumentation for

image acquisition and analysis. n certain embodiments, the assigned score is determined

by qualitative assessment, for example, detection of a fluorescent readout on a graded

scale, or quantitative assessment:. In one embodiment, an "aggregate score," which refers to

the combination of assigned scores from a plurality of measured biomarkers, is determined,

in one embodiment the aggregate score is a summa tion of assigned scores. n another

embodiment, combination of assigned scores involves performing mathematical operations

on the assigned scores before combining them into an aggregate score. In certain,

embodiments, the aggregate score is also referred to herein as the predictive score."

The term "biomarker" refers to a measurable entity of the present invention that has

been determined to be predictive of anti-cancer therapy ., iron-sulfur cluster

biosynthesis pathway inhibitory therapy) effects on a cancer. Biomarkers can include,

without limitation nucleic acids (e.g. , genomic nucleic acids and or transcribed nucleic

acids) and proteins, particularly those involved shown in Table . Many biomarkers listed

in Table are also useful as therapeutic targets h one embodiment, such targets are the

iron-sulfur cluster biosynthesis pathway members shown in section A of Table .

A "blocking" antibody or an antibody "antagonist" is one which inhibits or reduces

at least one biological activity of the antigen(s) it binds in certain embodiments, the

blocking antibodies or antagonist antibodies or fragments thereof described herein

substantially or completely inhibit given biological activit of the antigen(s).

The term " fluid" refers to fluid that are excreted or secreted from the bod as

well as fluid that are normally not (e.g. amniotic fluid, aqueous humor, bi e blood and

blood plasma, cerebrospinal fluid, c men and earwax, c per's fluid or pre-e ac at ry

fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph,

menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat,

synovial fluid, tears, urine, vaginal lubrication, vitreous humor, and vomit).

The terms "cancer" or "tumor" or "hyperprolifeTath¾' refer to the presence of cells

possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation,

immortality, metastatic potential, rapid growth and proliferation rate, and certain

characteristic morphological features. n some embodiments, such cells exhibit such

characteristics in pastor i full due to the expression and activity of oncogenes, such as e-

MY Cancer cells are often in the form of a tumor, but such cells may exist alone within

a animal, or may be a non-htmorigenie cancer ceil, such as a leukemia cell. As used

herein, the term "cancer" includes premalignant as well as malignant cancers. Cancers

include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's

macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease,

gamma chain disease, a d chain disease, benign monoclonal gamniopathy, and

im noey ic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer,

colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer,

urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system

cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral

cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small

bowel or appendix cancer, sal ary gland cancer, thyroid gland cancer, adrenal gland

cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like. Other

non-limiting examples of types of cancers applicable to the methods encompassed by the

present invention include human sarcomas and carcinomas, e.g., fibrosarcoma,

myxosarcoma, liposarcoma, chondrosarcoma,, osteogenic sarcoma, chordoma,

angiosarcoma, endotheliosareoma, lymphangiosarcotna, lymphaagioendomcitosarcoraa,

synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon

carcinoma, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate

cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland

carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas,

cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,

hepatoma, bile du t carcinoma, liver cancer, choriocarcinoma, seminoma, embryonal

carcinoma, Wilms' tumor, cervical cancer, bone cancer, brain iiimor, testicular cancer, lung

carcinoma, small ce l lung carcinoma, bladder carcinoma, epithelial carcinoma,, glioma,

astrocytoma, medullobSastoma, craniopharyngioma, ependymoma, pineaSoma,

hemangiobiastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma,

neuroblastoma retinoblastoma; le ke n as, e.g., acute lymphocytic leukemia and acute

myelocytic leukemia (myelo !as ic, promyelocyte, myelomonocytie, monocytic and

erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and

chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkirfs disease a d

non-Hodgkin's disease), multiple myeloma, Waldenstrom's roacrogiobu!inemia, and heavy

chain disease. n some embodiments, cancers are ep th elial in nature and include but are

not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic

cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer,

ova an cancer, pancreatic cancer, prostate cancer, or skin cancer. In other embodiments,

the cancer is breast cancer, prostate cancer, ng cancer, or colon cancer- still other

embodiments, the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell

carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or

breast carcinoma. The epithelial cancers may be characterized n various other ways

including, but not limited to, serous, endometrioid, mucinous, clear ceil, Brenner, or

undifferentiated.

Th term "coding region" refers to regions of a nucleotide sequence comprising

eodons which are translated into amino acid residues, whereas the term "non-coding

region" refers to regions of a nucleotide sequence that are not translated into amino acids

(e.g., 5' and 3' untranslated regions).

The term "complementary" refers to the broa concept of sequence

complementarity between regions of two nucleic acid strands or between two regions of the

same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region

ts capable of forming specific hydrogen bonds ("base pairing") with residue of a second

nucleic acid region which is antiparallel to the first region if the residue is thymine or

uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable

of base pairing with a residue of a second nucleic acid strand which is antiparallel to the

first strand if the residue is guanine. A first region of a nucleic a id is complementary to a

second region of the same or a different nucleic acid if, when the two regions are arranged

in an antiparaliel fashion, at least one nucleotide residue of the first region is capable of

base pairing with a residue of the second region. Preferably, the first region comprises a

first portion and the second region comprises a second portion, whereby, when the first: and

second portions are arranged in an antiparaliel fashion, at least about 0%, and preferably at

least about 75%, at least about 90%, or at least about 95% o the nucleotide residues o the

first portion are capable of base pairing with nucleotide residues n die second portion.

More preferably, all nucleotide residues of the first portion are capable of base pairing w th

nucleotide residues in the second portion.

The term "control" refers to any reference standard suitable to provide a comparison

to the expression products in the test sample, n on embodiment, the control comprises

obtaining a "control sample" from which expression product levels are detected and

compared to the expression product levels from th test sample. Such a control sample may

comprise any suitable sample, including but not limited to a sample from a control cancer

patient (can be stored sample or previous sample measurement) with a known outcome;

normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient,

cultured primary cells/tissues isolated from a subject s ch as a normal subject or the cancer

patient, adjacent norma! cells/tissues obtained from the sa e organ or body location of the

cancer patient, a tissue or cell sample isolated from a normal subject, or a primary

cells/tissues obtained from a depository. n another preferred embodiment, th control may

comprise a reference standard expression product level fro any suitable source, including

but ot limited to housekeeping genes, an expression product level range from normal

tissue (or other previously analy e control sample), a previously determined expression

product level range within a test sample fr o a group of patients, or a set of patients with a

certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a

certain treatment (for example, standard of care cancer therapy). t will be understood by

those of skill in the art that such control samples and reference standard expression product

levels can be used in combination as controls in the methods o the present invention. n

one embodiment, the control may comprise normal or non-cancerous cell/tissue sample in

another preferred embodiment, the control may comprise an expression level for a se of

patients, such as a set of cancer patients, or for a se of cancer patients receiving a certain

treatment, or for a se of patients with one outcome versus another outcome. In the former

case, the specific expression product leve! of each patient can be assigned to a percentile

level of expression, or expressed as either higher or lower than the mean or average of the

reference standard expression level n another preferred embodiment, th control ay

comprise norma! cells, cells from patients treated with combination chemotherapy , and

cells from patie s having benign cancer. another embodiment, the control may a!s

comprise measured value for example, average ievel of expression of a particular gene n

a population compared to the level of expression of a housekeeping gene in the same

population. Such a population may comprise normal subjects, cancer patients who have not

undergone any treatment (i.e. , treatment naive), cancer patients undergoing standard of care

therapy, or patients having benign ca cer n another preferred embodiment, the control

comprises a ratio transformation of expression product levels, including but not limited to

determining a ratio of expression product levels of two genes in the test sample and

comparing it to any suitable ratio of the same two genes n a reference standard;

determining expression product levels of the w or more genes in the test sample and

determining a difference in expression product levels any suitable control; and

determining expression product levels of the two or more genes in the test sample,

normalizing their expression to expression of housekeeping genes in the test sample, and

comparing to any suitable control. n particularly preferred embodiments, the con trol

comprises a control sample which is of the same lineage and/or type as the tes sample. n

another embodiment, the control may comprise expression product levels grouped as

percentiles within or based on a set of patient samples, such as a l patients with cancer. n

one embodiment a control expression product level is established wherein higher or lower

levels of expression product relative to, for instance, a particular percentile, are used as the

basis for predicting outcome. In another preferred embodiment, a control expression

product level is established using expression product levels from cancer control patients

with a known outcome, and th expression product levels from the test sample are

compared to the control expression product level as the basts for predicting outcome. A s

demonstrated by th data below, the methods of the invention are not limited to use o a

specific cu -point in comparing the level of expression product in the test sample to the

control.

The "copy number" of btomarker nucleic acid refers to the number of D MA

sequences in a cell (e.g., germline and/or somatic) encoding a particular gene product.

Generally, for a given gene, a mammal has two copies of each gene. The cop number can

be increased, however, by gene amplification or duplication, or reduced b deletion. For

example, germline copy number changes include changes at one or more genomic loci,

wherein said o e or more genomic loci are ot accounted for by the number of copies in the

normal complement of gernrline copies in a control (e.g. , the normal copy number in

ge n DNA for the sa e species as tha from which the speci fic g r l e DNA and

corresponding copy number were determined). Somatic copy number changes inc de

changes at one or ore genomic loci, wherein said one or ore genomic loci are not

accounted for by the number of copies in germline DNA of a control (¾·., cop number in

ger line DNA for the same subject as that from which the somatic DNA and corresponding

copy number were determined).

The ''normal" cop number (e.g. , germline and/or somatic ) of a biomarker nucleic

acid or "normal" level of expression of a biomarker nucle aci , or protein is the

activity/level of expression or copy number in a biological sample, e.g., a sample

containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid,

urine, stool, and bone marrow, from a subject, e.g., a . human, not afflicted with cancer, or

from a corresponding non-cancerous tissue n the same subject who as cancer.

The term "determining a suitable treatment regimen for the subject" is taken to

mea the determination of a treatment regimen e , a single therapy or a combination of

different therapies that are used for the prevention and/or treatment of the cancer in the

subject) for a subject that is started, modified and/or ended based or essentially based or at

least partially based on d e results of the analysis according to present invention. One

example is determining whether to provide targeted therapy against a cancer to provide

antt-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy).

Another example starting an adj van therapy after surgery whose purpose is to decrease

the risk of recurrence, another would be to modify d e dosage of a particular chemotherapy.

The determination can, in addition to the results of the analysis according to the present

invention, be based on personal characteristics of the subject to be treated. In most eases,

the aciual determination of the su able treatment regimen for the subject will be performed

by the attending physician or doctor.

The term "expression signature" or "signature" refers to a group of two or more

coordinate!;-- expressed biomarkers. For example, the genes, proteins, and the like making

up this signature may be expressed i a specific cell lineage, stage of differentiation, or

during a particular biological response. The biomarkers can reflect biological aspects of the

tumors in which they are expressed, such as the cell of origin of the cancer, the nature of the

non-malignant ce ls in the biopsy, and the oncogenic mechanisms responsible for the

cancer. Expression data and ge e expression levels can be stored o computer readable

media, e.g., the computer readable medium used in conjunction w th a rnkroarray or chip

reading device. Such expression data can be manipulated to generate expression signatures

molecule is "fixed" or "affixed" to a substrate if it is eovalently or nort-eovalently

5 associated with the substrate such that the substrate cart be rinsed with a fluid (e.g. standard

saline citrate, pH 7.4) without a substantial fraction of the molecule dissociating from the

substrate.

The term "highly structured 5' untranslated region (5' UTR) * refers to the region of

an mRNA directly upstream from the initiation codon, which ) begins at the transcription

) start site and ends one nucleotide (nt) before the initiation codes) (usua y AUG) of the

coding region and 2) contains a hairpin loop or other secondary structures. Such secondary

structures are usually predicted by modeling but there are experimental means to define

them more quantitatively, such as fay measuring the resistance o the structure to nucleases

which do not attack double stranded regions or performing physical techniques, such as

measuring the optical density at 260 n as function of temperature. n one embodiment,

the highly structured 5 ' TR renders the mRNA a -relatively poor substrate for translation.

mRNAs encoding proteins necessary for cell growth and survival typically contain a

complex, highly structured 5 ' UTR in order to limit the availability of the protein.

Structured 5' T Rs prevent CAP-dependent initiation of translation. Regulation of

20 translation by structured 5' TRs typically occurs due to long 5' TRs and stable

secondary structures and sequence segments which comprise high proportion of guanine

and cytosine bases since, when present in the 5 UTR of an mRNA, very efficiently inhibit

the CAP-dependent initiation of protein biosynthesis according to th ribosome scanning

model. I vitro investigations have shown that a hairpin structure in the 5' UTR of an

25 mRNA having a free energy of 30-70 k a /mo or less is able to inhibit translation

effectively. Thus, it has been possible to show tha mRNAs coding for a particular protein

and having a 5' TR exhibiting such a structure are translated only very weakly, whereas

mRNAs coding for the same protein and having a shorter 5" UTR with a weaker structure

are translated considerably more efficiently. Non-limiting, representative examples of

0 NAs with a highly structured 5 ' UTR include transferrin, transferrin receptor, c-. YC, X-

tirrked inhibitor of apoptosis protein X AP) an ornithine decarboxylase (ODCT).

The term "homologous" refers to nucleotide sequence similarity between two

regions of the same nucleic acid strand or between regions of two different nucleic acid

strands. When a nucleotide residue position in both region is occupied b the same

nucleotide residue, he the regions are homologous at that position. A first region is

homologous to a second region if at least one nucleotide residue position of ad region is

occupied by the same residue. Homology between two regions is expressed i terms of the

proportion of nucleotide residue positions of the two regions that are occupied by the same

nucleotide residue. By way of example, a region having the nucleotide sequence 5 -

ATTGCC-3* d a region having the nucleotide sequence -TA GGC- share 50%

homology. Preferably, the first regio comprises a first portion an the second regio

comprises a second portion, whereby, at least about 50%, and preferably at least about 75%,

at least about 90%, or at least about 95% of the nucleotide residue positions of each of the

portions are occupied by the sa e nucleotide residue. More preferably, all nucleotide

residue positions of each of the portions are occupied by the same nucleotide residue.

The term "inhibit" includes the decrease, limitation, or blockage, of, for example a

particular action, function, or interaction. n so e embodiments, cancer is nhibited" f at

least one symptom of the cancer is alleviated, terminated, slowed, or prevented. As used

herein, ca cer is also "inhibited' ' if recurrence o metastasis of the cancer is reduced,

slowed, delayed, or prevented.

The term "interaction", when referring to an interaction between two molecules,

refers to the physical contact e ., binding) of the molecules with one another. Generally,

such an interaction results in an activity (which produces a biological effect) of one or both

of said molecules.

The "iron-su ur cluster biogenesis pathway" refers to the full set, or relevant

subsets thereof, of proteins required for generating iron-sulfur (Fe-S) clusters composed of

iron and inorganic sulfur for itse as cofactors n generating Fe-S proteins (see, for example,

Li et l. (2012) Bi Bi p hy . Acta 23: 49 1- 08; Lill and MuSenhoff (2005)

Trends Bi em. Set 30:133-141; Renault (201 2) Dm. Mode! Meek 5:155-164, Ye and

Touault (2010) Biochem. 49:4945-4956, and Rouauh and Tong (2005) Nat. Rev. Mo . Ce !

Biol. 6:345-35 , roi -su fur clusters are critical for the production of a subset of enzymes

involved in critical cellular processes, such as oxidative phosphorylation, th citric acid

cycle, heme biosynthesis, iron homeostasis, and DNA repair. Figure 1 shows an exemplary

schematic diagram of the pathway. Members of the pathway, including terminology,

sequences, and function, are well known in the art.

For example, "NFSl" refers to th nitrogen fixation i homolog cysteine desulfitrase

member of the class- family o y doxal phosphate-dependent aminotransferase family

an is alternatively known as s ," , and "HUSSY-OB.' N F , whose structure-

function relationship is known, supplies inorganic sulfur to iron-sulfur clusters by removing

the sulfur from cysteine thereby creating alanine in the process (Fartian et ai (2 ) Mol.

Genet. G n . Med. 2:73-80; Kurihara el ai. (2003) Biochim. Biophys. Acta 1647:303-309;

Cupp- Viekery et . (2 3) . Mol. Biol. 330:1049-1059). The NF S gene uses alternate in-

frame translation initiation sites to generate mitochondrial forms and eytopiasmie/nuelear

forms. Selection of the alternative initiation sites is determined b the cytosolic pH. n one

embodiment, mitochondrial forms are itsed according to the present invention n another

embodiment, cytoplasmic/nuciear forms are used according to the present invention. A

least two splice variants encoding two distinct hitman mitochondrial SF isoforms exist

and sequences ar publicly available o th GcnBank database maintained by the U.S.

National Center for Biotechnology Information. For example, human NSFI transcript

variant (NMJ)21 . 00 4) encodes the long human NSF isoform .1 ( PJ )66923.3).

Human NS transcript variant (NM 0 8989. ) lacks an i -frame exo in the 5

coding region compared to variant resulting in an isoform (NP 0 5 18. that is

shorter compared to isoform 1. Nucleic acid and polypeptide sequences of NFS orfhologs

in species other than humans are also well known and include, for example, monkey NFS 1

XM )0 0976989.2, XPJ 0 1097699.1, XMJ 097983.2, and XPJ MM097983. dog

NFS! (XM 534405.4, XP 534405.2, XMJ 4332 .2, and XPJ 034332 . ), cow

NFS1 (NMJ)01099001 . 1 and NPJ 1.09247 . ), mouse NFS! (NM .2 and

NPJB504L2), and rat NFSl (NM 53462 2 and N 45 4.2). Representative

sequences of NFSl orfhologs are presented belo in Table 1, Anti-NFS 1 agents, including

antibodies, nucleic acids, an the like are well-known in the art an include, for example,

iron, L-alanine, L-cysteine, pyridoxal 5 '-phosphate and derivatives. t is to be note tha

the term can further be used to refer to arty combination o features described herein

regarding NFS molecules. For example, an combination of sequence composition,

percentage identify, sequence length, domain structure, functional acti vity, etc. can be used

to describe an NFS 1 molecule of the present invention.

As used herein, LYR 4 refers to the LYR motif containing 4 and is alternatively

known as "homolog of yeast sd " and "mitochondrial matrix Nfsl interacting protein,"

The LYRM4 gene encodes the S I protein that forms a stable complex in vim with the

human cysteine des l trase SCS to generate the inorganic sulfur needed for iron- u ur

protein biogenesis (Shi et l. (2009) Hum. Mai, Genet . :3 4-3025). At least three splice

variants encoding thr e distinct human LYR 4 is form exis and sequences are publicly

available on the GenBank database maintained by the U.S. National Center for

Biotechnology Information. For example, human LYRM4 transcript variant i

(NM 020408.5) encodes the short human LYRM4 isoform 1 (NP 06514 .3), Human

LYR 4 transcript variant 2 (NM J ) 164840.2) contains an alternate 3 t r inal exon to

create a different 3 coding region and 3' UTR compared to variant 1 and to thereby encode

an isoform (NP 00 1583.12.1) having a distinct C-terminiis and a longer sequence than that

of isoform . Human LYRM4 transcript variant 3 (NM 00 6484 .2) includes an

additional exon that results in an altemate 3' coding region and ' UTR compared to variant

1 to thereby encoded an isoform fN 1 . ) having a distin C-terminus and a

longer sequence than that of isoform . Each of the isoforms is functional. Nucleic acid

and polypeptide sequences of LYR 4 orthologs n species other than huma s are also well

known and include, for example, monkey LYRM4 (X _ . 9599 .2 and

XP . 00iO95995.2X dog LYRM4 ( M .005640 157.1 and XP.. 0056402 4 .1) ow LYRM4

(NM .. 001076306.1 a d NP. 0 069774.1), mouse LYR 4 (NM ...201358.2 and

NP_958746.l), and chicken LYRM4 (NM 0 198888.1 and NPJK) 85 7. )

Representative sequences of LYRM4 orthologs are presented below in Table . Anti-

LYRM4 agents, including antibodies, nucleic acids, and the like are well-known in the art

and include, for example, dominant-negative binding proteins such as versions of NFS 1

without a catalytic do ain it is to be noted that the term can further be used to refer to any

combination of features described herein regarding LYRM4 molecules. For example, any

combination of sequence composition, percentage identify, sequence length, domain

structure, functional activity, etc. can be used to describe an LYRM4 molecule of the

present invention.

As used herein, "ISCU" refers to the iron-sulfur cluster assembly enzyme and is

alternatively known as iS 2 "N FU, and N FUN. The ISCU gene encodes two

isomeric forms, ISCU I and ISCU2, of the iron-sulfur cluster scaffold protein and the

structures of the proteins in complex with other iron-sulfur cluster assembly proteins is

io n (see, for example, a ews a era (2 13) J Biol Chem. 288 29 34-291 2). In one

embodiment, ISC l is used according to the present invention. In another embodiment,

ISC 2 is used according to the present invention. n still another embodiment, both ISC

and ISC 2 are used combination according to the present invention. At least two splice

variants encoding the two distinct human ISO.) iso om s exist and sequences are publicly

available on the GenBank database maintained by the U.S. National Center for

Biotechnology Information. For example, human SC transcript variant 1

( M 143 .3) contains an alternate segment in the 5' coding region and uses a

downstream start codon compared to variant 2 such that the ISCU 1 isoform (MP 0 5 . )

has a shorter and distinct N-t r inus compared to the 1SCU2 isoform. The ISCU i isoform

is found i the y toso and nucleus. Human SC transcript variant 2 (N 13595.2)

encodes the longer IS U2 isoform (NP 998760. 1) which is found i m ochondr a

Nucleic acid and polypeptide sequences of NFS orthologs species other than humans are

also well known and. include, for example, monkey ISCU (NM 00 6 474 . and

N PJ 248403.1), cow ISCU (NM 001.075683.2 and N P X 06 5 . 1) mouse ISCU

(NM 025526.4 a d NP 079802, , rat ISCU ( M 00 105936.1 and NP 1099406,1),

and chicken ISCU X JV J303642 !82.2 and XP X 642230 2) Representative sequences of

SCU orthoiogs are presented below in Tab e . Anti-ISCU agents, including antibodies,

nucleic acids, and the like ar well-k ow in the ar and include, for example, iro and

derivati ves thereof. It is to be noted that the term can further be used to refer to any

combination of features described herein regarding ISCU molecules. For example, any

combination of sequence composition, percentage identify, sequence length, domain

structure, functional activity, etc. can be used to describe an ISCU molecule of th present

invention.

As used herein, "FXN" refers to frataxin and is alternatively known as CyaY and

"FA RR The FXN gene encodes the mitochondrial frataxin protein that functions in

regulating mitochondrial iron transport and respiration (Stemmler i al. (2010) J. Biol.

e . 285: 26737-26743; Gentry ei al. (20 . ) i m. 52:6085-6096; Abruzzo al

(2013) i . Intl. 2 , article ID 276808; and Pastore and Puccio (2 }J.

c em. 26 43-52 . At least three splice variants encoding three distinct hu an FXN

isofomis exist and sequences are publicly available on the GenBank database maintained by

the U.S. National Center for Biotechnology Information. For example, human FXN

transcript variant (NM OO. 4 .4) encodes the long human FXN isoform

(NP 00 5.2). The mature peptide s represented by residues 56- 0 and the proprotein is

represented by residues 42-210, Human FXN transcript variant 2 (NM 18 425.2) uses an

alternate splice site in the 3 ' coding region compared to variant 1 resulting in a frameshift

and encodes isoform 2 (NPJ$52090.l) that is shorter and has a distinct C-terminus

compared to tha of isoform . . The mature peptide is represented by residues 56- 6 and

the proprotcirt is represented by residues 42- 6. Human FXN transcript variant 3

_00 . 6 706. ) uses a alternate exon in the 3' coding region co pare to variant 1

tha results ir a .frame-shift and encodes isoform 3 (NP 00 5 78 ) that i shorter and has

a distinct C-tertninus compared to that of isoform 1. The mature peptide is represented by

residues 56-171 and the proprot n is represented by residues 42- 7 , Each of the isoforms

is functional. Nucleic acid and polypeptide sequences of FXN orthologs in species other

than humans are also we l known and include, for example, chimpanzee FXN

(X 00 137864.2 and X . 00 137864.2), monkey FX (NM 001260741.1 and

NP 00 247670. ), dog FXN (NM 001 109958. and NP 00 103428. ) cow FXN

NM X 080727.1 and 00 074 6 1) , mouse FXN M 008044.2 and P 03207Q.1),

rat FXN (MM 00 1 52. and NP 0 1 88 .1), and chicken FXN (XM 424827.4 and

XP 424827.3). Representative sequences of FXN orthologs are presented below in Table

1. Anti-FXN agents, including antibodies, nucleic acids, and the like are well-known irt the

ar and include, for example, iron and hem t is to b noted that the term can further be

used to refer to any combination of features described herein -regarding FXN molecules.

For example, any combination of sequence composition, percentage identify, sequence

length, domain structure, functional activity, etc. can be used to describe an FXN molecule

o the present invention.

Other members of he iron-sulfur cluster b synthetic pathway are well-known. For

example, NFX encodes a protein that is localized to mitochondria and plays a critical role

in iron-sulfur cluster biogenesis (Li et ah (2013) i chem 52:4904-491 3). The encoded

protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate

dehydrogenase and ipoic acid synthase. Nucleic acid and polypeptide sequences o 1

orthologs in species including humans are also well known and include, for example,

human NFU (NM 700 3 NPJ>56S!5.2 N 002755.2 NPJX)l002755.i (mature

peptide represented b residues 10-254), NM .IO 002756.2, and NP 00 1002756, , all of

which isoforms are t t onal. , cow NFUl (NM 0 046566. and 00 0400 1.1),

mouse NFU 1 (NM ) 1 7059 , NP_ 1 64062. , NM_020045.3, and NP_064429.2), rat

NFUl (NM . 001 106606.2 and NP 0 00076,2), and chicken NFUl (NM 00 06305.2

and NP OOl 006305.2).

GL X 5 encodes a mitochondrial protein, whose crystal structure- function

relationship is known, that i involved the biogenesis of iron-sulfur clusters and is

required for normal homeostasis (Ye ei al. (2010) J Clin. Invest 0 ;1749- and

Johansson et al. (20 ) Biochem J. 433:303-3 ) . Nucleic acid an polypeptide sequences

of GLRX5 orthologs in species including humans ar also well known and include, for

example, human GLRX5 (NM 016417.2 a d NP . 057501 .2 (mature peptide represented by

residues 32- 157)}, chimpanzee GLRX5 ΧΜ 0 54482. 1 and X OO !54482. ), monkey

GLRX5 ( X 65635.2 and NP 0 1252564. ) , co X (NM )O 100303.1 and

NP..001093773J ), mouse GLRX5 <NM )2 4 .2 and NP 082695.1), rat GLRX5

(NM . 001 108722.1 a d NP 00 102192.1), and chicken GLR (NM . 0 1008472.1 and

NP ) 008472.1).

BOLA3 encodes a protein, for which the stru ur -fun n relationship is known,

that plays an ssential role in the production of iron-sulfur (Fc-S) clusters for the normal

maturation of itpoate-containing 2-oxoacid dehydrogenases, a d for the assembly of the

mitochondrial respirators' chain complexes (Cameron et al (20 1) Am. . Hum. Genet.

89:486-495; Zhou et al. (2008) Afo/. Ceil. Biochem. 317:61-68; and asai et (2004)

Protein Set 13:545-548), Two alternatively spliced transcript variants encoding different

isoforms with distinct subcellular localization are known. Isoform 1 NM 2 552.2 and

NP_9977 . .2) are mitochondrial, whereas isoform 2 (NM 0 0 5505 . and

NP 0 030582 l ) are cytoplasmic. Nucleic acid and polypeptide sequences of B LA3

orthologs in species other than humans are also well known and include, for example,

chimpanzee BOLA3 (X ) 53666.2, XP_00? 53666. , X _5 5554.2, and

XP 15554.1), monkey BOLA3 (NM 126565 . and NP.00 1252580.1), cow B A3

(NM 0 3 452.2 and NP 001030529,1), mouse BOLA3 (NM. 75277.4 and

NP 780486.5), and rat BOLA3 ( O 1 66 .1 and NP_ 00i 100071.5).

HSCB, also known as the HscB iron-sulfur cluster co-ehaperone ho o og, encodes

a protein, for which the structure-function relationship is known, that is an integral

component of the human iron-sulfur cluster biosynthetic machinery (Uhrigshardt et al.

(20 0) Hum. Mol Genet. 19:3816-3834 and Bitto et al (2008) ,/. Biol. he . 283:30184-

30 92 . Nucleic acid and polypeptide sequences of HSCB orthologs in species including

humans are also wel known and include, for example, human HSCB (NM 172002.3 a d

NP ..74 9 .3 (mature peptide represented b residues 30-235)), chimpanzee HSCB

(XM„ 515052 .3, XP_515052.2, XMJX6953858.1, an P >03953907J ). monkey HSCB

( O 194228.1 and NP 8 1 7. ), dog HSCB (XM.J34725.4and XPJ34725.2),

cow HSCB ( M O l 102340.1 and NP OO 10958 1.0.1), mouse HSCB (K 5357 1.2 and

P . 705799,2), ra HSCB (NM 00 0834 and P .00 101810. ) , and chicken BSCB

(XM_003 642207. 2 artel XPJ)03642255J).

HSPA9, also known as morta encodes a member of the hea shock protein 70

ge e family. The encoded protein, for which the structure-function relationship is known,

is primarily locaiized to the mitochondria but is also found in the endoplasmic reticulum,

plasma membrane and cytoplasmic vesicles (L o el a (2010) Protein. Exp r Purif. 72:75-

and Craig and Marszalek (2002) Cell Mol Life Sc 59; 1 - 665) . Nucleic acid and

polypeptide sequences of HSPA9 orthologs in species including humans ar also we!i

known and include, for example, human HSPA9 (NM 004134.6 and P 0041 25.3 (mature

peptide represented by residues 47-679)), chimpanzee HSPA9 XM X 7 426 .3 and

XP 0 171426 .2), dog HSPA9 (XM 5 923.4 and XPJ31923.2), cow HSPA9

(NM 00 03452 2 and N 029696. ), mouse HSPA9 (NMJ)i048i.2 and

NP 4 1 .2), rat HSPA9 M 0 06 .2 and N )01 94 . 8.2), and chicken HSPA9

(NM 0 00 . a d NP . 0 0 47. }.

ISCA , also known as iron-sulfur cluster assembly , encodes a mitochondrial

protein involved in the biogenesis and assembly of iron-sulfur clusters, which play a role in

electron-transfer reactions. The encoded protein for which the structure-func tion

relationship is known, is primarily localized to the mitochondria but is also found in the

endoplasmic reticulum, plasma membrane and cytoplasmic vesicles (Cozar-Casteliano el

al. (2004) Bi i . i p ys. Acta. 1700:179-188; e l. (2010) Bl che . J . 428:1 25-

131; and Song ei al. (2009) J. Biol. Chem. 284:35297-35307). Nucleic acid and

polypeptide sequences of ISCA 1 orthologs in species including humans are a so well

known and include, for example, huma SCA 1 M _030940 .3 and N1 12202.2 (mature

peptide represented by residues 3- 29», chimpanzee S 1 (NM 2426 2 . and

NP„ 00 229541.1), dog ISCA1 (XMJS44342.3 and XTJ49435.2), cow ISCA1

( M 034470 2 and N )( 1029642.1), mouse 1SCA1 (NM..026921.4 and

NP i 197.1), rat ! C {NM 1626.3 and NP .853657.1), and chicken ISCAi

(N M )0 2 1936. and NPJXH 258865. 1) .

ISCA2, also known as iron-sulfur cluster assembly 2, encodes an A-type iron-sulfur

cluster mitochondrial protein in volved in the maturation of mitochondrial iron-sul for

proteins (Sheftel el al (201 ) Mol. Biol Cell. 23: 157-1166 and Hendrickson e al (2010)

P S 5:el2862). Two alternatively spliced human transcript variants encoding different

iso or s are known Isoform .1 M 4279.3 and N . 2 55.2 (mature peptide

represented by residues 9-154)) represents the longer isoform and isoform 2

( MJ ) 272007. i and NP OO 58936 (mature peptide represented by residues 9-60)) is

encoded y a nucleic acid that lacks an alternate coding exon compared to transcript variant.

1 resulting in a fram es and a . shorter isoform having a distinct C-termtnus relative to

isoform 1. Each isoform is functional. Nucleic acid and polypeptide sequences of ISCA2

orthologs in species other than humans are also we l k own and include, for example,

chimpanzee SCA2 (XM .. 0 . 43075.3 and XP...001 143075.2), monkey SCA 2

(NM ...0 Ϊ 007. and NP 00 2547936. Ϊ ) dog 1SCA2 (XM ...547905.4 and

XP 47 05 .3) , cow JSCA2 (NM 001038683.2 and NP 0 1033772. ), mouse ISCA2

(NMJ>28863.1 and N P 8 39. ), and rat S A2 ( ) l 109278.2 and

ΝΡ_0Ο 102748.1).

IBA57, also known as MMDS 3, encodes a protein involved in iron-stiifur protein

biosynthesis and normal heme biosynthesis (BoJar al. (20 3) Hum. M Genet. 22:2590-

2602; S l etai (2012) MoL Bioi. Ceil 23: 57- 166; and N sson etai. (2009) Ceil

ei i 10 : 19-130). Nucleic acid and polypeptide sequences of SCA 1 ortlioiogs

species including humans are also well known and include, for example, human iSCA 1

(NM_00.1 010867.2 and P 0 . 867. ; the mature peptide is represented by residues 40-

356 since residues -39 represent a transit peptide), chimpanzee ΪΒΑ 57 (XM 14253.3 and

X P_5 14253.2), monkey 1BA57 (XM 001083460.2 and XP 0 083460. ) , co 1BA57

(NM 0120S580J an 001 192509.1), mouse 1BA57 (NMJ 73785.6, NP_77614f>.1,

N M 0 2707 . , arid NP 001257720.1), rat 1BA57 (KM X 1.08827.. and

NP 0 102297.1), and chicken 1BA57 (NM. 001030958.2 and N P 0 02 29.2).

NUBPL, also known as N and H ULND , encodes a member of the Mrp/NBP35

ATP-binding proteins family. The encoded protein is required for the assembly of the

respirators' chain NA.DH dehydrogenase (complex I) an oligomeric enzymatic complex

located in the inner mitochondrial membrane. The respiratory complex 1 consists of 45

subunits and 8 iron-stilfur (Fe/S) clusters. This protein is an Fe/S protein that plays a

critical role in the assembly of .respiratory comple i , likely by transferring Fe/S into the

Fe/S-con ta i n complex 1 subuniis (Sheftel e i (2009) MoL Bioi Cell. 29:6059-6073;

Calvo e i. (2010) Nat. Genet. 42:851-858; and Kcveiam et i (2013) Neurol 80:1577-

1583). Three alternatively spliced human transcript variants encoding different isoforms

are known. Isoform i ( M 2 52.2 and N .P )79428.2 (mature peptide represented by

residues 39-319)) represents the longest isoform, whereas isoform 2 ( M 2 0 . 573.1 and

N ...0 8502 ) is encoded by a -nucleic acid that lacks two exo from the ' nd and

has an alternate 5 ' exon resulting in an isoform having a shorter N - e um s as compared to

isoform 1 and isoform: 3 M 2 74 .1 and. NP O. 188503.1) is encoded b a nucleic

acid that lacks several exo s from the 5 ' e d and has alternate 5 exo resulting in a

isoform having a uch shorter N-terminus compared to isoform . Nucleic aci and

polypeptide sequences of NUB PL orthologs in species other than humans are also wel

known and include, for example, monkey NUBPL (XM 0 1 8 45,2 and

XP . 00 08 45.2), cow NUBPL (NM . 3042. and N P 001 99 . ), mouse

NUBPL (NM. 029760.2 and N P 084036.2). and rat NUBPL (NM 0 185025.1 and

N P 00 71954.1).

SLC2 A28 also known as solute carrier family 25 (mitochondrial iron transporter)

member 28 and mitofe.rr.m2 and RS3/4, encodes a mitochondrial iron transporter that

mediates iron uptake and is required for heme synthesis of hemoproteins and Fe-S cluster

assemb l in on-e y t iroid ceils. The iro delivered into the mitochondria, presumably as

Fe(2+), is then delivered to ferroeheiatase to catalyze Fe(2+) incorporation into

protoprophyrin IX to make heme (Li et al. (20 ) FEES Lett. 4 9 :79-84; Pal ie i (2 )

Mol Aspects Med 34:465-484; and Hung et al (201 ) J. Biol. Che . 288:677-686).

Nucleic ac d and polypeptide sequences of SLC25A28 orthologs in species including

humans arc also well known and include, for example, human SLC25A2S (NM 031212,3

and NP 12489.3), monkey SLC25A28 M 001 265757 . and NP_00! 252686. ), dog

SLC25A28 (XM 846248.3 and X P . 8 34 .2), cow SLC25A28 (NM. 001205552.1 and

NP. 00 192481.1 mouse SLC25A28 (NM . 14 56.1 and N P .660 8. ), rat SLC25A28

(NM i l 09 15.1 and NP OI 102985.1), and chicken SLC25A28 (XM_42 1702.3 and

XM_421702.3).

F D X , also known as ferrodoxin reductase, encodes a mitochondrial flavoprotein

that initiates electron transport for cytochromes P450 receiving electrons fron AD R

(Sl t et al (2012) Bi chi . Bi p y . Acta 823:484-492; Lin et al (1990) Pro Natl. Acad.

Set. U.S.A. 87:8516-8520; and Liu and Chen (2002) Oncogene 195-7204) ... Seven

alternatively spliced human transcript variants encoding seven different isoforms are known

(NM .0244 17 3, N P 077728.2 (mature peptide represented b residues 33-4 ),

NM 04 10.4, P I O .2 (mature peptide represented by residues 30-493),

NMJK) 1258 .2 NPJMM244941.1 (mature peptide represented by residues 33-534),

NMJXU258013.2, N PJ X 1244942. , NMJK) 125801 .2, NPJX) 1244943.1 (mature peptide

repre sented by residues 33-483), M 0 258 .2, N P 0 244944. i (mature peptide

represented by residues 33-4 ), NMJK) 1258 6.2 and NPJX) 1244945.1), each of which

is functional. Nucleic acid and polypeptide sequences of FDXR orthologs in species other

than humans are also well known and include, for example, chimpanzee FDXR

£XM _5 1666.4 arid XP 1666,3), monkey FDXR (XMJ ) 09 2 .2 arid

X 00 0 1261 .2), ow FDXR (NMJ 74691. and NP 7 i 6 . ), mouse FDXR

( M X 7.1 NP 032023.1 >, and rat FDXR (N )24 53 and NPJ)77067.i).

FDX2, also known as ferrodoxin 1 like, encodes a mitochondrial fe rodox

required for iron-sulfur protein biogenesis and cellular iron homeostasis as F.D.X2

deficiency leads to increased cellular iron uptake, iron accumulation in mitochondria, and

impaired Fe/S protein biogenesis ( he el et i (2010) P . Nail. Acad S t. U.S.A.

107:1 775- 1780 and ef i. (2013) Da n . 42:3088-3091 ) . Nucleic acid and

polypeptide sequences of FDX2 orthologs in species including humans are well known and

include, for example, human FDX2 (NM 0 0 34.2 and NP 0 1026904. (mature

peptide represented by residues 53-183)), chimpanzee FDX2 (XM. 512366.4 and

XP_5 12366.3), monkey FDX2 (XMJ Oi 105309.2 and XPJX ) 105309.2), dog FDX2

(XMJ42073.4 and XPJ42073.1), cow FDX2 (NMJK) 1080226.2 and NPJ 0 073695.1),

mouse FDX2 (NMJK) 039824.2 and NPJK) 1034 3. 1), and rat FDX2 (NMJ ) 0 . 108002.

and NP 001 101472.1),

An isolated protein" refers to a protein that is substantially free of other proteins,

cellular material, separation medium, and culture medium: when isolated from cell or

produced by recombinant DNA techniques, or chemical precitrsors or other chemicals when

chemically synthesized. An "isolated" or "purified" protein or biologically active portion

thereof is substantially free of cellular material or other contaminating proteins from th

cell or tissue source fro which the antibody, polypeptide, peptide or fusion protein i

derived, or substantially free from chemical precursors or other chemicals when chemically

synthesized. The language "substantially free of cellular material" includes preparations of

a biomarker polypeptide or fragment thereof in which the protein is separated from cellular

components of the cells from which it is isolated or recombinantly produced. n one

embodiment, the language "substantially free of cellular material" includes preparations of

a biomarker protein or fragment thereof, having less than about 30% (by dry weight) of

non-biomarker protein (also referred to her in as a "contaminating protein"), more

preferably less tha about 20 of non-biomarker protein, sti ! ore preferably less than

abo t % of non-biomarker protein, and most preferably less than about 5% non-

biomarker protein. When antibody, polypeptide, peptide or fusion protein or fragment

thereof, e ., a biologically active fragment thereof, is recombinantly produced, it is also

preferably substantially free of culture medium, i.e., culture medium represents less tha

about 20%, more preferably less than about % and most preferably less than about 5% of

the volume of the protein preparation.

A "kit" is a y manufacture (e.g. a package or container) comprising at least one

reagent, e.g. a probe or small molecule, for specifically detec ting and/or affecting the

expression of a marker of the invention. The kit may be promoted, distributed, or sold as a

unit for performing the methods of the present invention. The kit may comprise one or

more reagents necessary to express a composition useful in the methods of th present

invention, n certain embodiments, the kit may further comprise a reference standard, e.g.,

a nucleic acid encoding a protein that does not affect or regulate signaling pathways

controlling cell growth, division, migration, survival or apoptosis. One skilled in the art ca

envision many such control proteins, including, but o limited to, common molecular tags

{e.g., green fluorescent protein and eta-gaia t sidase , proteins not classified in any of

pathway encompassing cell growth, division, migration, survival or apoptosis by

GeneOntology reference, or ubiquitous housekeeping proteins. Reagents in the kit may b

provided in individual containers or as mixtures of two or more reagents in a single

container. In addition, instructional materials which describe the use of the compositions

within the kit can be included.

The term "neoadjuvant therapy" refers to a treatment given before the primary

treatment. Examples of neoadjuvant fherapy can include chemotherapy, radiation therapy,

and hormone therapy. For example, in treating breast cancer, neoadjuvant therapy can

allows patients with large breast cancer to undergo breast-conserving surgery.

The term "NFS! pharmacodynamic biomarkers" refers to biomarkers and related

assays whose modulation is correlated with that of NFS 1 such that they can be used as

surrogates, combinations, or other readouts associated with N S modulation.

Representative examples include, without limitation 1) decreased conversion of cysteine to

alanine or methylene blue; 2) induction and/or promotion of mitochondrial dysfunction,

such ∑s a) a decrease in aconitase copy number, amount, and/or activity and/or b) a

decrease in succinate dehydrogenase copy umber, amount-, and/or activity; 3} induction

and/or promotion of iron regulatory protein dysfunction, such as a) a decrease in ferritin

copy number, amount, and/or activity and/or b an increase in ransf r a-r c p r copy

number, amount, and/or activity and/or c) a decrease in Hif2alpha copy number amount,

and/or activity; and 4) induction and/or promotion of ferroptosis, such as a) an increase

and/or accumulation o lipid reactive oxygen species (ROS) and/or ) art increase in PTGS2

(COX2) copy number, amount, and/or activity.

Molecules an reagents useful as NFS pharmacodynamic biomarkers are we l

known in the art.

For exa np e , "aeonitases ar iron-sulfur proteins that function to catalyze the

conversion of citrate to isoeitrate. W en cellular iron levels are low, the protein binds to

iro -responsive elements Es), which are stem-loop structures found in the 5' UT R of

ferritin mRNA, and in the 3' UTR of transferrin receptor mRNA. When the protein binds to

IRE, it resul ts in repression of translation of ferritin mRNA, and inhibition of degradation

of the otherwise rapidly degraded transferrin receptor mRNA. There are two forms of

aconitascs in mammalian cells, including a cytoplasmic aconitase encoded by Acol a a

mitochondrial aconitase encoded by Aco2. n certain embodiments, the term "aconiiase"

encompasses the combination of nucleic acids and/or proteins of Acol and Aco2. n other

embodiments, the term aconitase encompasses the nucleic acids and/or proteins of Acol

alone or of Aco2 alone.

Ac encodes a bi nctiona , cytosolic protein that functions as an essential enzyme

in the TCA cycle and interacts with mRNA to control the levels of iron inside cells. When

cellular iron levels are high, this protein binds to a 4Fe-4S cluster and functions as an

aco ' se (Phi p tt et al. ( 94) Fr . Nail Acad. Set. U.S.A. 91:7321-7325; Bra- o o o et

al (1999) . Biol. Chem. 274:21 625-21630; aptai et al. ( 99 1) Pr c. Natl Acad. Set

U.S.A. 88:10109-101 3; and Li l. (2006) J. Biol Chem. 28 1: 2344-12351). Two

alternatively spliced human transcript variants encoding the same sofor s are known.

Transcript variant 1 (NM 001278352. ) represents the longer transcript and transcript

variant 2 (NM 00 1 7 2) differs from transcript variant 1 b having a different 5' UTR

despite the fact that both transcript variants encode the same protein (NP_002 l88. l and

NP 00i 26528 . ). Nucleic acid and polypeptide sequences of Aco 1 o ho ogs in species

other than humans are also well known and include, for example, chimpanzee Ac

(XM OO 56102.3 and PJ 0 I56102.1), monkey Acol ( M X 2 5786S.J and

N P ) 1244794. , dog Acol (XM„ 538698.4 and XPJ38698.2), cow Aco

(NM 1 7559 1 and NP X 069059.1), mouse Acol ( M 07386 2 and

N P 031412.2), rat Acol (NM.. 017321.1 and N 059017.1), and chicken Acol

MJ 5030536. i and MP X J025707.1).

Aco2 encodes a Afunctional, mitochondrial protein that catalyzes the

intereonversion of citrate to isocttrate via cis-aconitate in the second step of the TCA cycle.

This protein is encoded in the nucleus and functions in the mitochondrion (Mire! et

(1998) Gene 213:205-218; Kkusner and o aul (1.993) Mol. B o . (¾//4:5-5: and G e et

( 97) Trends Biochem. S i 22:3-6). Nucleic acid and polypeptide sequences of Aco2

rtho gs in species including humans ar well known and include, for example, human

Aco2 (NM 001098.2 and NP 001089. (mature peptide represented by residues 28-780)),

monkey Aco2 (NMJ 26 64.2 and P OO 1248093.1), dog Aco2 (XMJJ44073.3 and

XP 84 66.1), cow Aco2 (NM 7397 .3 and NP 776402.1), mouse Aco2 NM >80633.2

and NP 42364. ), rat Aeo2 ( M 024398.2 and NP 077374.2), chicken Aco2

(NM_204188.2 and NP_989559.1), and zebrafish Aco2 (N _ 98908.1 and NP_9445 0.1) .

"Succinate dehydrogenase," a so known as SDH, succinate-coenzyme Q

reductase (SQ ), a d respiratory Complex 11, is a well-known enzyme complex that exists

in. bound form on the inner mitochondrial membrane of mammalian mitochondria

(Yankovskaya (2003 Science 299:700-704; Cheng t (2008 Biochem i y 47:

6107). n the citric acid cycle, SDH catalyzes the oxidation of succinate to mara e with

the reduction of ubiquinone to ubiquinol. Mammalian and mitochondrial SDH are

composed of four subunits: two hydrophilic and two hydrophobic. The first two sub mi s

a avoprotein (SdhA) and an iron-sulfur protein (SdhB), are hydrophilic. SdhA contains a

covalentiy attached flavin adenine dinu leo de (FAD) cofaeior and the succinate binding

site and Sd B contains three iron-sulfur clusters: [2Fe-2S], 4Fe 4S , and j.3Fe-4S j. The

second two subunits are hydrophobic membrane anchor subunits, SdhC and SdhD. Human

mitochondria contain two distinct i oform of SdhA (Fp subunits type I and type II). The

subunits form a membrane-bound cytochrome b complex with six transmembrane helices

containing one heme b group and a ubiquinone-btnding site. Two phospholipid molecules,

one cardiolipin and one phosphatidylethanolamine, are also found in the SdhC and SdhD

subunits and serve to occupy the hydrophobic space below the heme. There ar two distinct

classes of inhibitors of complex H : those that bind i the succinate pocket and those that

bind in the ubiquinone pocket. UBQ inhibitors include carboxin and the

noytaifiuoroacetone. Succinate-analogue inhibitors include the synthetic

compound malonate as well as the TCA cycle intermediates, a ate and oxaloaeetate.

indeed, oxaloacetate is on of th mos potent inhibitors of Complex 1 . n addition, assays

for analyzing SDH activity are well known in the art and include, for example,

specirophotometric analysis of enzyme reactions, analysis of reduction of artificial electron

acceptors such as 2,6 dichlorophenolindophenoi (DCJP) (see, for example, Jones l.

(2013) Anal Biochem. 442:19-23).

"Ferritin" refers to a well-known intracellular protein that stores and releases iron

and exists as a globular protein complex consisting of 12 or 24 protein subunits wherein the

submits associate to form a spherical nanocage. Ferritin that is not combined with iron is

referred to "apoferritin." A "ferritin protein subunif is defined as one of the 2 or 24

polypeptide subunits that make up a ferritin protein. The numbering system used herein for

the identification of amino acids within ferritin sobitriiis is based on the original sequence of

horse spleen L ferritin (Swiss Protein Database Accession Number P027 ) The horse

spleen numbering system can be easily converted to a numbering system based on the

human sequence (Swiss Protein Database accession number P02794; the human

sequence accession number is P02792), which has four additional amino acids at the

term n s. The human H sequence numbering therefore adds 4 to the corresponding amino

acid number in horse spleen ferritin. For example, L 34 by horse spleen numbering

corresponds to L i 38 by hu an sequence numbering. Alignments o ferritin s bur it

sequences can be found, e.g., in Theil, E. , in Handbook of Metalloproieins,

(Messerschmidt, A. et al, eds.), John Wiley & Sons. Chichester, UK, pp. 771 -81. 00 ;

Waldo, G. S. and Theil, E. €., in Comprehensive S pra olee lar Chemistry, Vol. 5, (K. S.

Susli ed,), Pergamon Press, Oxford, UK, pp. 65-89, 96; Orino Koichi et al, Veterinary

Biochem. 42:7-1 i (2005); Accession number: 06A.006486; and U.S. Paf. Pubis. 2013-

026704! and 20 .1 -0287033. In vertebrates, the subunits are both the fight (L) an

the heavy (H) type with an apparent molecular weight o 19 kDa or 2 kDa respectively.

Some ferritin complexes in vertebrates are hete.t -oitgomers of two highly related gene

products with slightly different physiological properties. The ratio of the two homologous

proteins in the comple depends on he relative expression levels of the two genes. Assays

for analyzing ferritin present, amount, and activity are well known in the art as described

above.

'Transferrin receptors" are carrier proteins for transferrin. When cellular iron levels

are ce ls increase the level of transferrin receptor produced in order to increase iron

intake a d this process is regulated by iron via iron response/regulatory element binding

protein (IRE-BP or RP) that binds to the hairpin structure of the iron response element

located in the 3' TR of the transferrin receptor-encoding gene. When the protein binds to

IRE, t results in repression of translation of ferritin R A and inhibition of degradation

of the otherwise rapidly degraded transferrin receptor . There are two forms of

transferrin receptor in a malia cells, TFR i and TPR2. certain embodiments, the term

"transferrin receptor" encompasses the combination of nucleic acids and/or proteins of

TF 1 and TFR2. n other embodiments, the term "transferrin receptor" encompasses the

nucleic acids and/or proteins o F ! alone or of TFR2 alone.

FR " also known as CD I, encodes a type- receptor that resides on the outer

cell membrane and cycles into acidic autosomes into the cell n a . cl hri /d min-

dependent n (Worthen and Eons 20 14) Fro t Pharmacol. 5:34; Frazer and

Anderson (2 ) Bi f cl n 40:206-2 ; Darnels el al (2 ) Biochim. Bi p ys A a

20:2 -3 7). Two alternatively spliced human transcript variants encoding the same

isoforms are known. Transcript: variant 1 (NM 003234.2) represents the longer transcript

and transcript variant 2 ( _0 48.1) differs from transcript variant by having a

different 5 TR despite the fact that both transcript variants encode the same protein

( P )03225.2 and P X 620. ; mature peptide represented by residues 101-760)).

Nucleic acid and polypeptide sequences of TFR orthologs species other than humans

are also wel known and include, for example, monkey TFR 1 ( _00 257303. and

NPJM) 24423 2.i dog TFR 1 (NM 0 0 . and NPJM) 0 . ), co TFR 1

(NM 001206577.1 and NP 0 193506.1), mouse TFR1 (NM_01 1638.4 and

NPJ 576 . ), and chicken TFR 1 M_20525 and P 99 S87. 1).

TFR2 encodes a transferrin receptor thai is highly homologous to TFR! that

mediate cellular uptake of t ansfe n-bo tnd iron but whose expression is largely restricted

to hepatocytes (Daniels ei al. (2006) Gin. Immunol. 1:144-1 58 and Zhao ei al. (20 )

c . 52:33 0-33 9) . Two alternatively spliced human transcript variants encoding

different isoforms are known. isoform 1 (NM_003227 3 and Ν ί 03 18.2) represents the

longer isofomi and iso r 2 ( M 00 06855. and NP ..001 93784 1) i encoded by a

nucleic acid that differs at the 5 ' end compared to variant 1 and initiates translation from an

in-frame downstream AUG resulting in an isoform with a shorter N- terminus and lacking

the transmembrane domain relati ve to isoform . Each isoform is functional. Nucleic acid

and polypeptide sequences of TFR2 orthoiogs in species other tha hu a s are also well

known and include, for example, chimpanzee TFR2 (X 0033 650. and

XPJ )03 . 8698. ), monkey T.FR2 (XMJ )0 I . 5 .2 an P l 3 1.!}, cow TF 2

( J X 774 . an NP 2 2.1), mouse TFR2 N . 00 89507. ,

NP 001276436.1, NM X)1289509,1, NM 0 28951 ,1 , NM 0 5799.4, and

NPJ}56614.3), rat TFR2 (NM 1059 .1 and NP O 0993S6 1), a d ze a sh TFR2

( M 00 9 16 and P O 099 . }.

f2a, also known as endothelial PAS domain protein , encodes a transcription

factor inv v d in the induction of genes regulated by oxygen, which is induced as ox en

levels fal (Mastrogiannaki et at (201 } Blood 22:885-892 and Haase (20 ) Am. J.

Physiol Renal. Physiol. 299;Fi -P 1 ) . The encoded protein contains a basic-helix-loop-

helix domain protein d meriza iot domain as well as a domain found in proteins in signal

transduction pathways which respond to oxygen levels. Nucleic acid and polypeptide

sequences of .i a orthoiogs in species including humans ar well known and include, for

example, human i 2a (NM. 001430.4 and NP . 001421.2), chimpanzee Flifia

(XM...001 4 72 19.3 and XP . Q01 147219.1), monkey f2a (XM .. 001 112947.2 and

XP_00I 2947.2), dog if2a (XM_005626080. 1 and XP_ 005626i37.i), cow Hif2a

(NM_1.74725.2 and N P 777 50.1), mouse Hif2a (NMJ)i0137.3 and NP_034267.3), rat

Hif2a (NMJ!23090. and NP 75578. ) and chicken Hif2a (NM „ 204807. and

NP_990 138.1).

P GS2 refers to a specific isozyme of the prostaglandin-endoperoxicle synthase

(PTGS), also known as cyciooxygenase-2, which is the key enzyme in prostaglandin

biosynthesis and acts as both a dioxygenase and as a peroxidase. There are two isozymes

of PTGS: a consti tut e PTGS 1 and an inducible PT 2, which differ in their regulation of

expression an tissue distribution. PTGS2 encodes th inducible isozymes and is regulated

by specific stimulatory events, indicating that it is responsible for the prostanoid

biosynthesis tnvoived in infl ammation and mi og n sis (Percy t . (1998) Analyst 123:41-

50), Nucleic a id and polypeptide sequences of PTGS2 orthoiogs in species including

humans are well known and include, for example, human PTGS2 ( M_ )00963.3 and

NP 000954.1 (signal peptide sequence represents residues 1-23), chimpanzee PTGS2

(XM 24999 4 and X 524999.3), monke PTGS2 (XM OI 107538.2 and

XPJ ) 107538.2), do TGS2 (NM X> 003354.1 andNPJX)1003354..l), cow PTGS

( 74445.2 and NP 77687G. ) mouse PTGS2 (NM >1. 198.3 and P 3532 .2), and

rat PTGS2 (N J ) 7232.3 and NP_058928.3).

"Lipid reactive oxygen species (ROS)' refer to lipids that can participate in

reactions that give r se to free radicals to thereby cause oxidative damage. Lipids are prone

5 to oxidative damage since ROS species can act o unsaturated lipids to yield reactive

unsaturated aldehydes. These unsaturated aldehydes can react with other cellular

components, such as membrane-bound or associated proteins and nucleic acids, thereby

erossiinkmg them to the lipid. Oxidized lipids may be identified by presence of lipid

peroxides. Exemplary ROS include hydroxy! radicals (OH,), superoxide radical (02.-),

i t) nitric oxide (NO.), thyi (RS ), peroxyi (R02.), and lipid peroxyi (LOO,). Lipids can form

lipid ROS when present n conditions of oxidative challenge or stress, wherein lipids are

vulnerable to oxidative damage. An oxidative challenge can involve the introduction of

free radicals, ROS, or reacti ve nitrogen species, such as to RBC or lysed RBC, for example

in an assay of antioxidant activity. The oxidative challenge may be created by adding a free

1.5 radical generator, such as hydrogen peroxide or AAPH. Assays for detection of lipid ROS

are well known in the ar (see, for example, U.S. Pat Pubis. 2014-0017341 and 2013-

0260418 and Dixo e al (2 2) CHI 149:1060-1072).

The "norma!" level of expression of a biomarker is the level of expression of the

biomarker in cells of a subj ect e.g , a human patient, not afflicted with a cancer. An "over-

20 expression" or "significantly higher level of expression" of a biomarker refers to an

expression level in a test sample that s greater tha the standard error of the assay

employed to assess expression, and is preferably at least twice, and more preferably 2 . ,

2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7 5, 8, 8.5, 9, 9.5, UK 10 5,

, 12, , 14, , 16, 17, , 19, 20 times or more higher than the expression activity or

25 level of the biomarker in a control sample (e.g. , sample from a healthy subject not having

the biomarker associated disease) and preferably, the average expression level of th

biomarker in several control samples. A "significantly lower level of expression" of a

biomarker refers to an expression level in a test sample that is at least twice, and more

preferably 2.1, 2,2, 2,3, 2,4, 2,5, 2,6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6,5, 7, 7.5, 8, 8.5,

0 9, 9.5, 10, 10.5, .1 1, 12, 13, 14, 5, 16, 17 , 18, 19, 20 times o more lower than th

expression level of the biomarker in a control sample (e.g. , sample from a healthy subject

not having the biomarker associated disease) and preferably, the average expression level of

the biomarker in several control samples. Such "significance" levels can also be applied to

an other measured parameter described herein, such as for expression, inhibition,

cytotoxicity, ceil growth, and the like.

The term "predictive"' includes the use of a biomarker nucleic a id and/ r protein

status, e.g., over- or under- activity, emergence, expression, growth, remission, recurrence

or resistance of tumors before, during or after therapy, for determining the likelihood of

response of a cancer to anti-cancer therapy, such as iron-sulfur cluster biosynthesis pathway

inhibitor treatment (e.g., NFS inhibitors). Such predictive use of the biomarker may be

confirmed by, e.g., ( ) increased or decreased copy number {e.g., by FISH, SH plus SKY,

single-molecule sequencing, e.g.. as described in the ar at least at J . otechno , 86:289-

30 i , or qPCR), overexpression or underexpression of a biomarker nucleic acid (e.g., by

S , Northern Blot, or qPCR), increased or decreased biomarker protein (e.g., by !HC)

and/or biomarker target, or increased or decreased activity, e.g., in more than about 5%,

6%, 7%, 8%, 9%, 0%, , 12%, 13%, 4%, 15%, 20%, 25%, 3 %, 0%, 50%, 60 ,

70%, 80%, 90%, 95%, 100%, or more of assayed human cancers types or cancer samples;

(2) s absolute or relatively modulated presence or absence in a biological sample, e.g., a

sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal

fluid, urine, stool or bone marrow, .f om a subject, e.g. a human, afflicted with cancer; (3)

its absolute or relatively modulated presence or absence in clinical subset of patients with

cancer (e.g., those responding to a particular anti-cancer therapy (e.g. , iron-sulfur cluster

biosynthesis pathway inhibitory therapy) or those developing resistance thereto).

Th terms "prevent," "preventing," "prevention," "prophylactic treatment," and the

like refer to reducing the probability of developing a disease, disorder, or condition in a

subject, who does not have, but is at risk of or susceptible to developing a disease, disorder,

or condition.

The term "probe" refers to any molecule which is capable of selectively binding to a

specifically intended target molecule, for example, a nucleotide transcript or protein

encoded by or corresponding to a biomarker nucleic acid. Probes can be either synthesized

by one skilled in the art, or derived from appropriate biological preparations. For purposes

of detection of the target molecule, probes may be specifically designed to be labeled, as

described herein. Examples of molecules that can be utilized as probes include, but are not

limited to, R A, D A, proteins, antibodies, and organic molecules.

The term "prognosis" includes a prediction of the probable course and outcome of

cancer or the likelihood of recovery fro the disease in some embodiments, the use of

statistical algorithms provides a prognosis of ca cer in an individual. For example, the

prognosis can be surgery, development of a clinical subtype of ca cer (e.g., solid tumors,

such as lung cancer, melanoma, and renal cell carcinoma), development of one or more

clinical factors, development of intestinal cancer, or recovery from the disease.

The m:"response to anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis

pathway inhibitory therapy)" relates to any response o the hyp rpr ferat ve disorder (e.g.,

cancer) to an anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory

therapy), such as anti-NFS 1 inhibitor therapy), preferably to a change in tumor mass and/or

volume after initiation of neoadjuvant or adjuvant chemotherapy. Hyperproliferative

disorder response ay he assessed , for example for efficacy or in a neoadju vant or

adjuvant situation, where the size of a tumor after systemic intervention can be compared to

the initial size and dimensions a measured by CT, PET, mammogram:, ultrasound or

palpation. Responses may also be assessed by caliper measurement or pathological

i of the tumor after biopsy or surgical resection. Response may be recorded in a

quantitative fashion like percentage change in tumor volume or in a qualitative fashion like

"pathological complete response" pCR "clinical complete remission' (eCR), "clinical

partial remission' (cPR), "clinical stable disease" (cSD), "clinical progressive disease"

(cPD) or other qualitative criteria. Assessment of hyperproHferative disorder response may

be done early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours,

days, weeks or preferably after a few months. A typical endpoint for response assessment

s upo termination of neoadjuvant chemotherapy or upon surgical removal of residual

tumor cells and/or the tumor bed. This is typically three months after initiation of

neoadjuvant therapy. In some embodiments, clinical efficacy of the therapeutic treatments

described herein may be determined by measuring the clinical benefit rate (CBR). The

clinical benefit rate is measured by determining the sum of the percentage of patients who

are in complete remission (CR), the number of patients who are in partial remission (PR)

and the number of patients having stable disease (SD) at a ti e point at least 6 months out

from the end of therapy. The shorthand for this formula is R R PR over 6

months. n some embodiments, the CBR for a particular cancer therapeutic regimen is at

least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or more.

Additional criteria for evaluating the response to cancer therapies are related to "survival,"

which includes all of the following: sitrviva! until mortality, also known as overall survival

(wherein said mortality may be either irrespective of cause or tumor related); "recurrence-

free survival" (wherein the terra recurrence shall include both localized and distant

recurrence); metastasis free survival; disease free survival (wherein the terra disease shall

include cancer and diseases associated therewith). The length of said survival may be

calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment)

and end point (e.g., death, recurrence or metastasis). In addition, criteria for efficacy of

treatment can be expanded to include response to chemotherapy, probability of survival,

probability of metastasis within a given time period, and probability of tumor recurrence,

for example, in order to determine appropriate threshold values, a particular cancer

therapeutic regimen can be administered to a population of subjects and the outcome can be

correlated to biomarker measurements that were determined prior to administration of any

cancer therapy. The outcome measurement may be pathologic response to therapy g en in

the neoadjuvant setting. Alternatively, outcome measures, such as overall survival and

disease- re survival can be monitored over a period of time for subjects following cancer

therapy for whom biomarker measurement values are known. n certain embodiments, the

doses administered are standard doses known in the art for cancer therapeutic agents. The

period of time for which subjects are monitored can vary. For example, subjects may be

monitored or at least 2, 4, 6, 10, 12, 4 , 6 , 18, 20, 25 30, 35, 0, 45, 50, 51 or 60

months. Biomarker measurement threshold values that con-elate to outcome of a cancer

therapy can be determined using we -known methods in the art, such as those described in

the Examples section.

The term "resistance" refers to an acquired or natural resistance of a cancer sample

or mammal to a cancer therapy ( i.e., being nonresponsive to or having reduced or limited

response to the therapeutic treatment), such as having a reduced response to a therapeutic

treatment by 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2-

foid, 3-fold, 4-foSd, 5-fold, -fold, 15-fold, 20-fold or more. The reduction in response

can he measured by comparing with the same cancer sample or mammal before the

resistance is acquired, or by comparing with a different cancer sample or a mammal who is

known to have no resistance to the therapeutic treatment. A typical acquired resistance to

chemotherapy s called "multidrug resistance." The multidrug resistance can be mediated

by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a .mammal

is infected with a -drug-resistant microorganism or a combination of microorganisms.

The determination of resistance to a therapeutic treatment s routine in the art and within the

skill of an ordinarily skilled clinician, for example, can be measured y cell proliferative

assays and ceil death assays as described herein as "sensitizing." In some embodiments,,

term "reverses resistance' " mea s that the use of a second agent in combination with a

primary cancer therapy ., chemotherapeutic or radiation therapy) is ab e to produce a

significant decrease in tumor volume at a level of statistical significance (e.g., p< . 5)

when compared to tumor volume of untreated tumor In the circumstance where the primary

cancer therapy g. chemotherapeutic or radiation therapy) alone s unable to produce a

statistically significant decrease in tumor volume compared to tumor volume of untreated

tumor. This generally applies to tumor volume measurements made at a ti when the

untreated tu or is growing log rhythmically.

The terms "response" or "responsiveness" refers to an anti-cancer response, e.g. in

the sense of reduction of tumor size or inhibiting tumor growth. The terms ca also refer to

an improved prognosis, for example, as reflected by art increased time to recurrence, which

s the period to first recurrence censoring for second primary cancer as a first event or death

without evidence of recurrence, or an increased overall survival, which s the period from

treatment to death from any cause. To respond or to have a response means there is a .

beneficial endpoint attained when exposed to a stimulus. Alternatively, a negati ve or

detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. I

wi l be appreciated that evaluating the likelihood that a tumor or subject will exhibit a

favorable response is equivalent to evaluating the likelihood that the tumor or subject will

not exhibit favorable response {i.e. , will exhibit a lack of response or be iion-responsi ve).

An "R interfering agent" as used herein, is defined as any agent which interferes

with or inhibits expression of a target biomarker gene by RNA interference (RNAi). Such

RNA interfering agents include, but are not limited to, nucleic acid molecules including

RNA molecules which are homologous to the target biomarker gene of the invention, or a

fragment thereof, short interfering R (siR A), and small molecules which interfere with

or inhibit expression of target biomarker nucleic acid by RNA interference (RNAi).

"RNA interference (RNAi)" is an evolutionally conserved process whereby th

expression or introduction of RNA of a sequence that is identical or highly similar to a

target biomarker nucleic aci results in the sequence specific degradation or specific post-

t nscriptio a! gene silencing (PIGS) of messenger RN (mRNA) transcribed from that

targeted gene (see Cobnrn, G. and lle , B. (2002) Vi l gy 76(18):9225), thereby

inhibiting expression of the target biomarker nucleic acid n o e embodiment, the RNA is

double stranded RNA fdsRNA). This process as been described in plants, invertebrates,

and mammalian cells. In nature, RNAi is initiated by th dsRNA speci endonac!ease

Dicer, which promotes processive cleavage of long dsRNA into double-stranded fragments

termed siRNAs. siRNAs are incorporated into a protein complex that recognizes and

cleaves target mRNAs. RNAi can also be initiated by introducing nucleic a i molecules,

e.g., synthetic siRNAs, s s or other RNA interfering agents, to inhibit or silence the

expression of target faiomarker nucleic acids. As used herein, "inhibition of target

biomarker nucleic acid expression" or "inhibition of marker gene expression" includes a y

decrease in expression or protein activity or level of the target biomarker nucleic acid or

protein encoded by the target biomarker nucleic acid. The decrease may be of at least 30%,

40%, 50%, 60%, 7 %, 80%, 90%, 95% or 99% or more as compared to the expression of a

target biomarker nucleic acid or the activity or level of the protein encoded by a target

biomarker nucleic acid which has not been targeted b an RNA interfering agent.

The term "sample" used for detecting or determining the presence or level o at least

one biomarker is typically whole blood, plasma, scrum, saliva, urine, stool (e.g., feces),

tears, and any other bodily fluid (e.g., as described above under the definition o "body

fluids"), or a tissue sample (e.g., biopsy) such as a small intestine, colon sample, or surgical

resection tissue n certain instances, the method of th present invention further comprises

obtaining the sample from the individual prior to detecting or determining the presence or

level of a least one marker in the sample.

The term "sensitize' " means to alter cancer cells or tumor cells in a way that allows

for more effective treatment of the associated cancer with a . cancer therapy (e.g., iron-sulfur

cluste biosynthesis pathway inhibitor, chemotherapeutic, and/or radiation therapy). n

some embodiments, normal cells ar not affected to an extent that causes the normal cells to

be unduly injured by t e anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway

inhibitory therapy). An increased sensitivity or a reduced sensitivity to a therapeutic

treatment is measured according to a known method in the art for the particular treatment

and methods described herein below, including, but not limited to, cell proliferative assays

(Tanigawa , Kern D H, Kikasa Y Morton L, Cancer Res 82; 42: 2 9-2 4), ceil

death assays (Weisenthal L M Shoemaker R H, Marsden J A, Dil P L Baker j A, Moran E

, Cancer Res 984; 94: 161 - 1 3; Weisenthal L M , Lippman M E, Cancer Treat Rep 985;

69: 615-632; Weisenthal , in Kaspers J L, Pie e s R, T e an P R, Weisenthal L

M, Veerman A J P eds. Drug Resistance in Leukemia and Lymphoma, Langhorne, P A :

ar ood Academic Publishers, 1993: 415-432; Weisenthal L M, Contrib Gynecol Obstet

1 94: 9 : 82-90 The sensitivity or resistance may also be measured in a imal by

measuring the tumor size reduction over a period of time,, for example, 6 month for human

a d 4-6 weeks for mouse. A composition or a method sensitizes response to a therapeutic

treatment if the increase in treatment sensitivity or the reduction in resistance is 25% or

more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to -fold, 3-fold, 4-fold, 5

fc d, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance

the absence of such composition or method. The determination of sensitivity or resistance

to a therapeutic treatment is routine in the art and within the skill of ordinarily skilled

clinician ft is to be understood that any method described herein for enhancing the efficacy

of a cancer therapy can be equally applied to methods for sensitizing hyperprohferative or

otherwise cancerous cells (e.g., resistant cells) to the cancer therapy.

The m:"synergistic effect" refers to the combined effect- of two or more iron-

sulfur cluster biosynthesis pathway inhibitor agents can be greater than the sum o th

separate effects of the anticancer agents alone,

"Short interfering RNA (siRNA), also referred to herein as "small interfering

RNA" is defined as an agent: which functions to inhibit expression of a target bio ar er

nucleic acid, e.g. , by RNAi. An siRNA may be chemically synthesized, ma be produced

by in vitro transcription, or may be produced within a host cell. n one embodiment, siR

is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length,

preferably about 5 to about 28 nucleotides, more preferably about to about 25

nucleotides in length, and more preferably about , 20, 2 , or 22 nucleotides in length,

and may contain a 3' and/or 5' overhang on each strand having a length of about 0, , 2, 3,

4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e.,

the length of the overhang on one strand is not dependent on the length of the overhang on

the second strand. Preferably the siRN A is capable of promoti ng RNA interfere nce through

degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger

RNA ( RNA).

In another embodiment, an siRNA is a small hairpin (also called stem loop) RNA

(shRNA). In one embodiment, these shRNAs are composed of a short (e.g., 19-25

nucleotide) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense

strand. Alternatively, the sense strand may precede the nucleotide loop structure and the

antisense strand ay follow. These shRNAs may be contained in pl s ds, retroviruses,

and lentiviruses and expressed from, for example, the p l I U6 promoter, or another

promoter (see, e.g., Stewart, ei ai. (2003) RNA Apr;9(4):493-501 incorporated fay reference

herein).

RNA interfering agents, e.g.. iR A molecules, may be administered to a patient

having or at risk for having cancer, to inhibit expression of a bio ar er gene which is

overexpressed in cancer and thereby treat, prevent, or inhibit cancer in the subject.

The term "subject" refers to any healthy animal, mammal or human, or a y animal,

mammal or human afflicted with a cancer, e.g., lung, ovarian, pancreatic, liver, breast,

prostate, and colon carcinomas, as well as melanoma and multiple myeloma. The term

"subject" is interchangeable with "patient."

The ton "survival" includes all of the following: survi val until mortality, also

known as overall survival (wherein said mortality may be either irrespective of cause or

tumor related); "recurrence-free survival" (wherein the term recurrence shall include both

localized and distant recurrence); metastasis free survival; disease free survival (wherein

the term disease shall include cancer and diseases associated therewith). The length of said

survival may be calculated by reference to a defined start point (e.g. time of diagnosis or

start of treatment) a d end point (e.g. death, recurrence or metastasis), n addition, criteria

for efficacy of treatment ca t be expanded to include response to chemotherapy, probability

of survival, probability of metastasis within a given time period, and probability of tumor

recurrence.

The term: "therapeutic effect" refers to a local or systemic effect in animals,

particularly mammals, and more particularly humans, caused by a pharmacologically active

substance. The term thus means any substance intended for use in the diagnosis, cure,

mitigation, treatment or prevention of disease or in the enhancement of desirable physical

or e tal development and conditions in an animal or human. The phrase "therapeutical y-

effeefive amount" means that amount of such a substance that produces some desired local

or systemic effect at reasonable benefit/risk ratio applicable to any treatment. In certain

embodiments, a therapeutically effective amount o a compound will depend on its

therapeutic index, solubility, and the like. For example, certain compounds discovered by

the methods of the present invention may be administered in a sufficient amount to proditce

a reasonable benefit/risk ratio applicable to such treatment.

The tons "therapeutically-efJfective amount" and "effective amount" as used herein

means that amount of a compound, material, or composition comprising a compound of the

present invention which s effective for producing so e desired therapeutic effect n at ieast

a sub-population of ceils in an animal at a reasonable benefit/risk ratio applicable to any

medical treatment. Toxicity and therapeutic efficacy of subject compounds may be

determined by standard pharmaceutical procedures in cel cultures or experimental animals,

£?.g., for determining the and the Compositions that exhibit large therapeutic

indices are preferred. In some embodiments, the L¾> (lethal dosage) can be measured and

can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%,

200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more reduced for the

agent relative to no administration of the agent. Similarly, the E ¾>(i.e., the concentration

which achieves a half-maximal inhibition of symptoms) can be measured and can be, for

example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%,

400%, 500%, 600%, 700%, 800%, 900%, 000% or more increased for the agent relative to

no administration of the agent. Also, Similarly, the C (i.e., the concentration which

achieves haif-maximaJ cytotoxic or cytostatic effect on cancer cells) ca be measured a d

can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%,

200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the

agent relative to no administration of the agent n some embodiments, cancer ceil growth

in an assay can he inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,

50%, 55%, 60%,, 65%, 70%, 75%,, 80%, 85%, 90%,, 95%, or even 00% . to another

embodiment, at least about a 1.0% , %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,

60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 1.00% decrease in a solid malignancy

can. be achieved.

A "transcribed polynucleotide" or "nucleotide transcript" is a polynucleotide (e.g.

an R , hn A, a cDNA, or an analog of such RNA o cDNA) which is complementary

to or homologous with all or a portion of a mature mRNA made by transcription of a

bio-marker nucleic acid an normal post-rranscriprional processing (e.g. splicing), if any, of

the RNA transcript, and reverse transcription of the RNA transcript.

There is a known and definite correspondence between the amino acid sequence of a

particular protein and the nucleotide sequences that can code for the protein, as defined by

the genetic code (shown below). Likewise, there is a known and definite correspondence

between the nucleotide sequence o a particular nucleic acid and the amino acid sequenee

encoded by tha nucleic acid, as defined by the genetic code.

GENETIC C DE

Alanine (Ala, A) GCA. GCC, GCG, GCT

A g e (Arg, R) AGA, AC CGA, CGC, CGG, CGT

Asparagine (Asn, ) AAC, AAT

Aspartic acid (Asp, D) GAC, GAT

Cysteine (Cys, C) TGC, TGT

Glutamic ac d (Q , E) GAA, GAG

G a ine (Gin, ) CAA, CAG

j n - ,

Mistidine (His, H) CAC, CAT

Isoleucine (lie, I) ATA ATC, ATT

Leucine (Leu, L) CTA, CTC, CTG CTT, TTA, TTG

Lysine (Lys, ) AAA, AAG

·iVi n O C i l ί vj

Phenylalanine ί Phe, ¥) TTC, ΤΓΤ

Proline (Pro, P) CCA, CGC, CCG, CCT

Se e (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT

i f i »nr, ft ί ft∆ , A∆ C L , .rt ' j , A l "l\"

Tryptophan (Trp, W) TGG

Tyrosine (Tyr, Y) TA , TAT

V a f ί ' ' i T

Tennination signal (end) TAA, TAG, TGA

An important and well known feature of the genetic code is its redundancy,

whereby, for most of he amino acids used to make proteins, more than one coding

nucleotide triplet may be employed (illustrated above). Therefore, a number of different

nucleotide sequences may code or a given amino acid sequence. Such nucleotide

sequences ar considered functionally equivalent since they result n he production of the

same amino acid sequence in all organisms (although certain organisms may translate some

sequences more efficiently than they do others). Moreover, occasionally a methylated

variant of a pur e or pyr dine m y be found a given nucleotide sequence. Such

methylations do not affect the coding relationship between the trinucleotide codon and the

corresponding amino acid.

ii view of the foregoing, the nucleotide sequence of a D A or R A encoding a

biomarker nucleic acid (or any portion thereof) ca be used to derive the polypeptide amino

acid sequence, using the genetic code to translate the DNA or RNA into an amino acid

sequence. Likewise, for polypeptide amino ac d sequence, corresponding nucleotide

sequences that can encode the polypeptide can be deduced fro the genetic code (which,

because of its redundancy, w ll produce multiple nucleic acid sequences for any given

amino acid sequence). Thus, description and/or disclosure herein of a nucleotide sequence

which encodes a polypeptide should be considered to also include description anc or

disclosure of the a ino acid sequence encoded by the nucleotide sequence. Similarly,

description and/or disclosure of a polypeptide amino acid sequence herein should be

considered to also include description and/or disclosure of all possible nucleotide sequences

that can encode the amino acid sequence.

Finally, nucleic acid and amino acid sequence information for th loci and

b o arkers of the present invention and related biomarkcrs (e.g. biomarkcrs listed i Table

1) are well known in the art and readily available on publicly available databases, such as

the National Center for Biotechnology information (NCBl). For example, exemplary

nucleic acid and amino acid sequences derived from publicly available sequence databases

are provided below.

Representative sequences of the biomarkers described above are presented below in

Table . It i to be noted that the terms described above can further b used to refer to any

combination of features described herein regarding the biomarkers. For example, any

combination of sequence composition, percentage identify, sequence length, domain

structure, functional activity, etc. can b used to describe a biomarker of the present

invention.

Table

a) ISC Biosynthesis Pathway Biomarkers

SE D NO:J an NFS 1 c A seqp e (transcript y aria 1¾

atg gctcc gag g ttg gaggegggeg g ag ggcgg ga ag gg tccagggccg

6 aagcccgcgg g cc ctcg gggg tg g ctgcgcgttg g g c gtg tcctcagt

2 gcggttcccg aga cag cgctgccccg gaggtggggc c gtg gcg acctct ta8 avggat .g aagc a sa v tgg c ggg tg tg c t c t a

24 c atcaa actatgggaa cccacactcc gg cacatg c atggc g ggagagtgag

3 1 g cc gg aa g gct g cag a g a g a t e t ga gga c ga ccetcgtgag361 a tag ggtgc actga cc aac acata caa aaggg ggtgg cg

421 ctacag t ca gga aa gc ct ga c accacccaga c gaa ac a481 gactcctgcc gttcactgga agctgagggc tt c ggtca c c t c c c c ag g agaag

641 agtggga c ttgacctaaa ggaactagag gc ctatcc q agata tagcctggtg

0 c gtca g tg g a aa gagat ga g tga g agc ctattgcaqa aa qggcgg

66 a ttg ag t ccagaaagg^ atatt^ccat a gatg a cccaggctgt gg a aa c

721 ccactxgatg t aa ga a , a aa.f, - a atgagca ttag ggt a caaaatetac

78 ggtc aaag gggttggtga cat ta atc cg cgcegg cc g g gcg tgtggaggac

84 c gcagag g gaggggggca ggagcggggt a gcggtc g ggacagtgcc

901 gtggtggggc tggggg tg gtgtgaggtg gca ag aag agatggagta gacea aag

961 cgaatc~caa agtvt-gteaga gcggc~gata eagaatataa tgaagagcct "ccagatgxg

021 gtga g atg gggac g a attat cgg t t tct ctttg a t1001 gtggaagggg aaag ctg , g atgg a tg aaggacgtcg c ttar.- c agggagtgcc

1141 tg a c ctg a cc tgga g tctt.at gcgcttagag caatcggcac g tgaggat

1201 tt.ag g act t.at ag gtttggaatt ggccgcttca ctacagagga gga.agtggac

1261 t ca agtgg agaaa t a tcaqcatgtq aag gt tc gaqaaatgag ccct ctgg

1221 aga qqttc agqatgqeat tga t aaq a at aaqt gqacccaaca tag

SE I NO; 2 l a NFS amino ac (is r )

1 l r avavtaapgp kpaaptrgir rvgd r avpadtaaap vgpv rp y

61 fiidvqattpid p rvld py q rt ayqw se a arqqv asiiqa pr

21 ii sgaa riai g ar r rk ii ttq k v d rs a¾g tqv lpvq181 ag iidl i a iqp v tvnn ig vkqpiaeigr rkv h tdaaqavg.ki

241 p idv fe id I si g kiy gpkgvgaiyi rirprvrvea iqagggqerg mrsgtvptpi

301 glgaac v a ge yd k risklserii qni k s p v vn g p y p cir s ay

361 ft i g ctsa p ssy vlraigtd a ir gi gr tt¾® d

421 kx r a sp i v dgid lk ikv tq h.

SEQ ID NO: 3 Human NFS! cDNA sequence (transcript variant 2)

1 atgctgctcc gagccgc g gaggcgggcg gcag-cggcgg tgacagcggq tccagggccg

S g c g gg cg ca g ggggctgcgc c g gcg g gag ccg g tccccagtct

121 gcggfctcccg ca ata agc g c cg g gg tg gg cag gctg g t fcc t

161 atggatgtgc aagctacaac tc tgga ccccgggtgc - gct cc a

taa -caa " aotatgggaa cccacactcc gga a atg c v -at gg c g ggagagtgag

301 g ag catgg aacgt.gci:cg tcag aag a gcat ga ggag a t c

3 1 a ca tttta tagtg g ta gaatc aacaacatag aa taagga actagaggct

421. e a ccagc agata -ag c ggtgtca gt a ga tg gaacaa ga gatcggagtg

4 1 aag ag ta - g agaaat agggcgga"" g ~a.g , ca gaaaggta a tttccatact

541 ga g ag agg tg i:gg aaaaa a cttga g a a ;ga gaa aa ga :

601 atg g a t gtggtcacaa aa cta gg c aaagggg tgg g t .a tc

661 cg g ccce gtg g gtgt gg ggccc cagagtggag gggggcagga ¾ g

" 21 gg tggga cagtgcccac a cct ag g gtggggctgg gggctgcgtg tgaggtggca.

" 1 ag aagaga ggag "a ga ccacaagcga atctcaaagt "g -cagag g g tga -acag

841 aatataafcga agagccitcc agatgtggtq atgaaigggg c taagca ccatlatccc

901 ggcigtafcca acctctcctt t.gcatatgtg gaaggqgaaa gi tg gat ggcactgaag

961 gacgttqcct tatcctcagq gagtg g acctctgca". c ctgqag c ". t.g g

1021 c gagcaa ttggcactga g ggat gcgcactctt ctatcaggtt tgg gg

1081 cgcttcacta cagaggsgga agtggactac acagtggaga gcat ca gcatgtgaag

1141 cgtct^cgag a a g gcc ctct ggag ggttc gg atgg a ga c caagagc

1201 atcaagagga g

SEP I NO; 4 i ii NFS i m ac ii ot nn 2)

1 tf r r a avavtaapgp kpaaptrglr l.t:vgdrapqs a p aaap vgp lrpl

1 dv attp ld p rv dai lp y i y gnp s thayg s a r rqqv a iqadp re

121 ii tagat i aigpdtslvs v tv neigv kgpia¾igri cssxkv t

8 a q avg ip vr l i sisg i g pkgvgaiyir rrp rvrv qsgggq g

2 4 r gPv tp iv yg a c va qq¾ d kr i i r iq ni k p vv ng p k yp

3 clrl v age ili al dv al ac t i v raig d q l a sslr g ig

3 6 1 ftt y t c kc q vk rvqdgid ks k tq

SE NO: 5 Human LYRM4 cDNA sequence (transcript variant ¾)

1 atggcagcct ccagtcgcgc aag vgtta t ctgta ggg ga gct g gag a a

6 1 gcg -;c g cc acaa t aca t a c gt ca ggagga ag ag t g ct2 1 ag aaaat a aa g aaa gg tc t.gt gaaa aa cc tag g a aa g caag

1 8 1 g g ac tg gag ttc tcg a agg c ac tgg c aactg tc a c g a aag

2 4 1 c gatca - g agaatcgaga catgeccagg acctag

SEQ NO: 6 Human LYRM4 amino acid sequence soforro i )

1 «« raq i r s kr y r yavrrirdaf r n nv k pv iqt v ka k

6 1 rdlgvirrqv gq ystd liie rd p r t

SEQ ID : 7 Human YRM cDNA se enc (transcript variant 2

1 tgg gc ccagtcgcgc ca tg ca t ct cc gggcgatgcc gagag«g sg

£ 1 a g gtPt a gcgcctacaa ttacaqaaca catgctgcca ggaggataag -agatgcctPc

1 2 agagaaaata aaaatgtaaa gga cc g ta g a ttca a cc gtgaa a agcc g

1 3 1 agagaccttg gagtaa cg tcgacagatg g a t cact ctgtcgecca ggctggagtg

2 4 . ca t ggaa g a ct agctc ac acaa c ctgectccct ggttcaagca attc cctg .

3 0 1 t agcctc gagtag g gga atagg cgcacgccac a gcctgg aa cc gt

3 1 a c tagta g g atg g t t ca t gta tag

SEQ NO Huma M amino acid s uenc isotb r

1 rr a s s a qv l slyr lr k.t:fsaycyrt yavrrlrdaf r kn kdpv eiqtlvakak

6 1 dshsvaqagv v d s qp lp v; kq f lp svdyr tpp rla c

1 2 1 iliisrdvisly

SEQ . D ; Human c

1 atggcagcct ccagtcgcgc acaagtgtta tcte g ac gggcgatgct gagagagagc

1 aagcgtttca gcgcctacaa ttacagaaca atge g a ggaggataag agatgectte

1 2 1 agagaaaata aaaatgcaaa gga cc g ta gaaatccaaa ccctagtgaa taaagccaag

1 8 1 agagaccttg gagta tcg t gacagg t g tg gcaag g acag gc caggsggaag

2 4 1 t ggggaa g ag ggag gggga g ccctgcscaa g tgg g a

SEP P NQ: 1 H n X YEM a m ac s

1 re a sr qv a kr £ s .y r; r t av rrir a r v dp v iqt v k

rdlgvirrqv aeqgtaarrk sgnssrslgk p p

SEP IP NO: i t Huma IS c A sequence (transcript variant )

1 atggttctca ttgacatgag tgtagacctt tctactcagg ttgttgatca ctatgaaaat

6 1 cctagasacg t gggtc c r ga a gaca tckaaaaacg ttggasctgg actggtgggg

1 2 1 gctccagcat gtgg ga gt aatgaaatta cagattcaag tggatgaaaa ggggaagatt

tgga gcta gg .aaaac attt gct t gg c g aa ttg c ccag ctcattagcc

2 4 1 actg ggg tg a gg g gg gg g gaagccttga ct tc a cac g t

0 1 gecaaggage t gcctt t ccg ga a gc ctg t ccatgctggc ga gatg a

3 6 1 ateaaggecg ggctg a aaa g aaacaagaac ccaaaaaagg agaggcagag

4 2 1 aagaaatga

SEQ I NO: 2 sequence ls fo r i)

d stq vdh r p vgsld k ap cgdv k qiqvdekgki

Si dar t gc gsaiaaasia t v k ktv akeiclppvk i ar da

121 ikaaladykl kq p kkg a kk

S NO: 3 Human SC cDNA sequence (transcript variant 2)

1 a ggcgg gg ctggggct ccg tc g g cg gc gc cggc c gct g gcggagc

6 ccccgcctgc ccgcccggga gcpgtcggcc ccggcccgac tctatcacaa gaaggttgtt.

12 ' aaaatcctag aaacgcgggg t cc tga ag ac x aa aaatgttgga

181 t tg qggct c agcatg ggt gacg aatg aattacagat -ccaagtggat

gaaaagggga ag tg gg tgctaggttt aaaac t g gctg gg c cgcaa g c

301 fcccagcr,cat tagccactgs atggg;^gaaa ggaaagaogg tggaggaage c tga t

361 aaaaa ag &cgc ggag tgc cPcct g tgaa tgca gct

421 gg aag a caatcaa ggccgccctg gc gat aca aattgaaaca aqaacccaaa

481 aagga gg ca gaagaa g a

SE IB NO: 4 Human iSC ammo acid sequence (isofo 2)

1 tfsaaagafrlr raasaliirs p ip ral a parlyhkkvv pr g d kx skrtvg

£1. g l gapacg vsnk qv k i.v a k g g saia s a k gktveealti

121 k di ak l ffi aadaikaa ady kq pk

SE NO 15 Human FXN pDNA sequence (transcript variant

1 atg gga tc - gggcg cg g g agc gg ctg cg - ae c g c ag cag

g c ga c a cgggt c gcgg cg gcagag tgg ccccactctg cggc g cgt

121 g cc gcg a ga ga tg gac tg acg c gc gcg aa rc gaaccaacgt

1S1 ggc aa c agat c gaa tg^caaaaag cagag^qtct a tgatga tttgaggaaa

241 t t a tt ggg c c ggctct a ga gagac a cc atgaa g actagcagag

3 1 g a gctgg actct agc gagtttt gaagaccttg cagaca gc at ca gtt

361 g gga atgt tc t tgggagtggt g t ac g tcaaactggg tgga atc

421 ggaacctatg ga a caa gcagacgcca aacaagcaaa ggcta c tt cca ce

4 1 ag ga ta gcgt"a ga gga tggg aaaa.act.ggg g actecca cgacgg g g

£ 4 1 ccctcca g agctgcpggc cgcagagctc ac aaagcc taaaaaccaa act.ggacttg

01 c cct gg cctattccgg aaaagatgcp tga

SE ID NO Huma FXN ami o acid s que ce (is ¾)

t grra a g ila p ap qtl rvp p p l g rr glrvdldate tprraasriqr

61 gln v kk vyl nlrk s tl pg d tt r l sia dlad kp f

121 dydv gsg v i vklg di g t v ir tp x kqi ls p s sgp kryd t knwyahdgv

ISl liaa l ka kt ldi s la sgkda

SEQ ID NO; 7 Human F N cDNA sequ nc (transcript variant 2)

1 a gPggac c tcgggcgccg cgcagtagcc ggcctcctgg cgtcacccag cccagcccag

61 gcccagaccc tcacccgggt cccgcggccg gcagagttgg ccccac cP cggccgccgt

121 ggcctg g g a ga .gcg c .gc acgccccgcc g gcaag c ga cca v

1 1 ggc caa c agatttggaa tg aa aag cag g gtct tgatgaa tttgaggaaa

241 tggaa tt tggqccaccc ggct ta g g g a ca ccta^qaaag a t gc gag

3 1 gaaa g gg a ct tag agagt ttt gaaga c g agacaag c a acg -Cvt

361 g gg ac tg atg c cc tgggagtggt g t aa g tcaaaotggg ggag atc

421 ggaacctatg tgafccaacaa gcagacgcca aacaagcaaa tctggccaPc tfcctccatcc

48 agg atg ag tggacctaag cg t tgac ggactgggaa aa tggg g tac c ca g

341 acgg gtg c t c gag c g tggccg agagct a aa g c a a

I tlgrrava giiasp p aqtltrvpip a a grr glr di at tp r as nqr

1 g nqi rv : svy &n rk sgt g pg sl d tty rias t d la : d ad py

121 klggd g-c inkq -cp kqi i ps y d glgk gc pt

181 K ft qs p

SEP D NO: 1 Hitman FXN c-DNA sequence (transcript variant 3

1 a g ggac c t gggcgc g cgcag^agcc gg c c tgg gt. acc &g cag sg

61 gcccagaccc t acccg g cccgoggccg g agag gg ccc a tctg cggccg cg

121 ggcctgcgca gacat g gcgac gc a gccc g gcg a gtt gaaccaacgi:

181 ggcct acc ag tgga gt a aaag agagtg att g gaa t; gagg a

241 tggaa t tgggccaccc ggct ta g g ga ca ccta^gaaag actagcagag

3 1 gaaacgci;gg ac c tagc gagtv ttt gaag c cg cagacaagcc acg 'Cvt

36 gagg c atg gtctcc tggg g ggt g tta g t tggg gg.ag c a

42 gg.aa c atg tga c.aa a gcagacgcca aa a gcaa® t tgg t.at tctcc c

4 gg a gt g tcct ct t cat ga

SE ID NO: 20 Human FXN amino acid sequence (is for 3)

1 m l g Xasp p q ag trvp rp a ap l grr g lrtd d tprrassnqr

61 glrq ivnvk sv l lr g ghpg l dftt la e d ae d a p t

121 dy a tvk ggd g y i.n k p nkqi s p ΐ "ν;11«Ί h ρ

SE I : Human Ί cDNA sequence {transcript varu 1 )

1 atg gaaga cca acac a agaaa cag c gc g acaaagacca

6 t ttcc c a ctg ag ttt t ac cag gaga aca gtt a tcaaacacaa

21 g a ccc atcc ac g aaagt at cagg.a a c g ct tgagaca.agg

81 a a gga ttcccacccc ag g ag a t g c ctctggctag g ag a

aggattgaag gagtaaaaag t g ct t ct ggaccagatt c tcae cacaaaggaa

301 aa gaagaa aga qgaa t"~actgaaa ccaga~attt a~gcaa aa - catggacttc

36 tt. g atct.g g t acc ct gg t tg g gaaac t caggaga g agg tgaa

42 ga gatga g aag g gg g tta g gaattgttag a tag t acgg a t.

481 g aggaag atgqagggga gtaat a aaagg tq aagatggcat tq a agctg

5 aaa tc agg gttcttgtac cagctgccct agt eaat a ttactctgaa aaatggaatt

601 gaaca gc tg agttt a tatt ggag g agaagg g agaa gg atggatga

66 ga aga g a aaag ag a t acc taa

SEQ I NO: 22 Human NFUl amino ac d sequence (isof rm )

1 knpytikk gp q v rp p paa y pvrv iqtg dtpnpftslkf ipgkpv tr

£1 tffidiptpaaa rsp arqi ri gvk v i gpd itv k n e id i pdiyatiffidf

121 asg plvt psg ag dd vv a ii l dt irpt vq dggdv y kg dgivq

121 klqg cts p iitlk gi qn q ip dd sd k ansp

SEQ NO: 23 Human NFUl cDNA sequence (tramcript variaat 2 )

1 a gg ggcga cggccaggcg gggctgggga g g tg gccgg g g g agg

61 ggttc gt at gttgaa gaat ca ac accattaaga aacagcctct g t ag -Cvt

121 gtacaa g c ca t tcc cta g gc t tta acc ag gag

181 attcaaacac a ga c c a at aadc g .t a gt t ata c gg aaa c gt

24 c gagaca g acc gga t t cacc cagc g a c ttt gc ccctctgg

30 aggcagttat ttagg tga agga taa g gtcttc g a c ga t c tca

36 gtcacaaagg aaaatgaaga a tagac gg aa actg aaccagatat -

421 atcatg ct t g a gg ~t ,a c ggtta g aggaaa a - aggagaa

4S1 gcagga g aagaagatga gaag gtg gcaatgatt-a aggaa gtt agatactaga

541 atacggccaa ctg gcagga agatggaggg ga g at acaaaggctt ^.gaagatggc

a tgta agc tgaaactcca gggtt vtgt a ag tg ctagcr.-caat a t ~t ,g

1 aaa a ggaa tt ag a a , gctg ag tt ta -att gg aggtagaagg g agaa ag

21 gttaPggatg atgaateaga tgaaaaagaa g aaa . c aa

S P I NO: 2 Ni amino acid sequence {i o r 2)

1 a a - r rg g a vaag rr rfc p ik p g vq pX p pa f p t t6 iqi-gdtpnpn s k ipg kpv p paaarrspXa rq rX gv k v rgpd Xt

12 Xkpd iya i d a g lp p ag adds a i d r

12 irprvqadgg vi feg dg ivq Xqg t p iit kngiqnmlgf yipsvegvaq

v d sd k snsp

1 a gga r. t g at gg t a tg gt a gagg aaac aa a

61 gg at gaag aaga g tga ag g ggc a ga aagg a gr.- a a a t gaa

121 ggcc a tg tgcaggaaga tggagggga t g aat ca aaggctttga atgg

ISl gtacagctqa aactccaggg tt fc gt c ag tg ccta gt c tca ta t g

24 aatgqaa agaacatqct g aq t a attccgqagg taqaaggcgt agaacaggtt

301 atggatgatg a agatga a.a a a a aa tca c aa

SEP ID NO: 26 N .F . amino aci sequence fiso r 3)

1 s lp i v p sg g dd v ± dtri rp q dggd vi g dgi

61 vq l lqgs scp s i it ip v gv qv dd iid kea nsp

SE I NO: 27 Huma D A sequence

1 a gag gggt c cgg g agctgcggcg g ctg t gctgggggcg cggcgcgggc61 ggcgg^ggcc tt^ggggtcc gggcg^gcgg g gcggg cgggcgcggg gcgg ggc

121 tcggcggagc ag gga g gctggtgaag ggaca gg tggtggtctt cctcaagggg101 acgccggagc agc ccag g cggc agc gccg gg tgcagatcct gcggctgcac241 gg g gcg attscgcggc cta a cgtg -gga ga c ggag .g aca gg a t01 aaaga ra aac gg ca . ar.cc g aagtg a c aargg ga gtttgPaggg

36 gqctqtgaca ". ttctqca gatqcaccag aatqggqact tgqtggaaga a gaaaaa42 ctggggatcc a cg c tttagatgaa gaaag c aag c ccaa gtga

SE ID NO: 28 Human GLRX5 amino acid sequence

1 sg igraa alXrwgrgag ggglwgpgvr aagsgagggg qXda lv k kdkvvvfXkg

61 tp gpqcg vq h g yaa v ddp lrqg k y sn -pt ip qv l g vg

121 gcdiilqmhq gdlv lk igi sal ds kdqds

SE I D NO: 29 Human B A cD sequence (transcript a ia

1 atggctgca" gg g c ggc cgcggcagcg cctc cctc g ggg tc g cggg vtcea

61 c cacca c ggat tgc ctcagac gagqgggagc cagag ga cc attct

121 aaagaaaagt tt cacgag t.« g tat «a aagtca t dcatttcagg aggttgtggg

81 q ga g a g aaattaaaat gaa .agaa qaatttaagq agaagagaac tq aq ag

24 caccagatgg t taa c agg actaaaagaa gaaatcaaag ag atg a g g a g cgg a ta

30 t c tc g t cca aacg c g a

S . . . . .I a a piirgirgip I atq t g v q i kekrpratai kvtdisggcg

1 a fiy ik is s ks rtv qq vv q a k ik & iri ftsvpkr

IMI a g tg cat ggagcccggc cgcggcagcg c ct c tcc gcgggatccg cgggcttcca

6 c cac c gga g tttg ca ct ag ac gagggggagc cag ag g ac caa at t

121 aaagaaaagt ttccacgagc ta g at a a a g c a c .g acat^. ag a c aaa aga

181 gag t g ca g g g gg a c t gtc c s c g t g c a g

241 cctgg g c g a g r,g g t ag a gga ga a ct ctga a c a301 cctaa

SEQ I NO: 32 .Human BOLA3 aci (is f 2)

1 a a sp aa a piirgirgip a p g rv q ii f ra kvtdisgtkr

61. nq rda ia d y p q t p lh rc l i .i. p

SEQ D NO: 33 f ma SCB c NA sequence

1 a g gg gg g ggagagcegg ggctt^gctc ggg g tg gg g gacagggg^t

61 cccagaagga ga a g aa g c tg ga g t g g g ca gg egggaagcaa fcat c c

121 g tggaa c g gg cgg c c atggggcccc gggegggagg a cag g ctt c g ca cag

101 -g c gag g tg g g a tgaceccact g g acta c t ag t at gg c tg aa

241 g t t ~ , , a gag - g ta g gaag t ag a ag g accagcaact g g g t r.-

30 t ca c a a t t c g c aga t t ca a tga as agg tc t ag ag aag t

361 -cg c -g g tga g atg ctataagacc etcctggecc ccctgagcag aggactgeae

4 cttctaasgc tecstggaat ag aga c t gaaaggaeag t a g a a ggacaggesa

481 ttcctcatag aaata.atgga a.atcaatg.aa a a ct g ag aag g a.aag g a g c g

541 a tg .a g ag .a g a a a . tg t a ag t a a c g a g a att ctga a atg tg g c

601 ag tg tg aacaagatga ctttgaag.aa g a.agga aa ttttgac.aaa ga tg aga a

661 tt t a a t.a tagaagaaaa g.atcaagtta a ag aaga t c a.a

SE ID NO. 34 Human SCB ammo acid sequence

1 mwrgragali rv g wptgv prrrpiscda e ggp g g r d r f q

61 ra qap dp rdyf in d n vd t k q qq q r v p d q r s q t kd .s k

121 s v ia y t I ap ls rg y il g i ip r t d rq i ir i e kia ae aa

131 i iv a kq k a f qdd e ilt n ry fsr i ki kkipl

SEP I NO; 35 Human SPA e NA sequence

1 atgataagtg ccagccgagc tgcagcagcc gtct cg gg gcgscgcagc ctcccggggc

1 cctacgqccg cccgccaccs ggatagctgg a atg g ct a g tea qa gg ttttagaett

121 gtttcaaggc ggg at ta g atcagaagca a a aggg g cagttgttgg tattgatttg

1 1 gg ta ct a a a c c tg cg ggcagttatg gaaggtaaac aagcaaagga gctggagaat

41 g ga g g tg caga a c c c c ag g tgg c ta ag ga gg ga g g a tt

301 gttggaatgc cggccaagcg acaggctgtc ac a a ccaa a a at aca t tta tg a c

3 1 aa g g ct a tgg c g g - ¾ cctgaagtac a a gaca taaaaatgtt

421 cccvCtaaaa tgt c c atgg gatg ggg " g gg gaa a tg

43 t a - ccg a g cag a - gg a g t tg g ga g ga g ga ga g ag a t

541 ta ggggc acacagcaaa aaa g tg tcacagt c a ' caa^gactcg

0 cagagacagg ac aaaga t.g tggc g atacctggac gaatg gct tcgggtgatc

6 aa gag cca agc gctg t.c tg ct. gg c agaca aatcagaaga caaagt at

72 a g v aggtg ggaac ga attt c tcctggaaat i:.cagaaagga

5 g att g g tga at a aaatggggat a t ttag gtggggaaga vttga ag

841 qccttgatac ggaacattgx gaaggaqttc aagagagaga caggggttga gactaaa

1 ga a ca gg c t ga ggta g gaa gc g tg a gg caa tg -c t -c

961 -cat "g - c aga a a , caatttgccc ta -ctta a tgga tt g a aaq

1021 catttgsata tgaaqttgac cgtg aa t -gaaggg ttgt a tga ctaatea a

0 gga g ca g aaaagctatg casgatgcag aag g aa gag ga ra

1141 ggagaagt-ga tt vtgtggg tgg gact aggatg c aggt ag a g tgta ag

1201 gatctctttg g sgag ccc aagtasagct g caatc g atgaggctgt ggccattgga

1261 gctgccattc gggaggtg gttggccggc g tgtc gg atgtg tg t c ttg tg

1 21 act cctgt ctggg a tgaaactcta ggaggtqtct ttacca a attaa agg

13 1 aata ca ta ccaa aa gaaqagccag g att . a ctqccgctga tggtcaaacg

441 caagtggaaa aaagtq g t qggtgaa agagagatgg tqgaga aa a a t ett

1501 ggacagttta ttgat gg aatt ac a gcccctcgtg gagttcctca gattgaagtt

1561 aca t gaca ttgatg tgggatagta tgttt g ctaaagataa aggcacagga

1 21 cg g gc gattg cagt ttc ggtggafctaa g a g t a at

16S1 atg taa a atgcagaqaa a g tgaa gaagaccggc gaaagaagga cga tga

1 g a ctaata cggctga«gg aavcattcac gacacagaaa ccaagatgga

i¾01 gaccaattac c g tga ga gtgcaacaag ctgaaagaag agatttccaa aatgagggag

I S tccigg ta gaaaagacag cgaaacagga g aaata a gacaggcagc at ctc c t

i ag gg a" cactgaagct g aaa g gcatacaaaa ag gg a , tgagcgagaa

1 31 ggctt-ctggaa g t tggcac tggggaacaa aaggaagatc aaaaggagga aaaacagtaa

SEP D NO: 36 Human HSPA9 ami o acid sequence

1 ni s sr aa r vgaaa r pt ar q ng afr v rr a ikqavvgial

61 g tn cvav gkqakv s a ar p v va adg r vg pakrqav

121 krligrrydd q k r srtg a v a gki yspsqigafv i ft ks ta a i

181 ghtak a itvpayfnds qrqatkdaqq is rtv rvi rsaptaaalay gidk adk i

241 avyd gggt isil i kg vfevkstngd f gg fdq al r l k f kr tgvdl k

301 dx al qr r aaekakceis s vqt i x p ltn sgpk h n kitra egiv d ir

361 rtiap qka qda v kad gevilvggmt r pkv qtvq dlfgrapska vap ava g

421 aiqggv ag dv dv p g i t ggv tk rtti k q v taadggt

401 q v qg r agd kl1 gq t lgipp aprgvpqiev t dida giv i k

541 r q v lq ii gglskdd nsvk a k a drrkk rv ra aegiih dt tk vi fk

601 dql ad c k r llarkdsetg nirqa s q asik ykkraas r

661 g g sgtg q k gk skg

SEQ D NO: 37 Human SCA cDNA sequence

1 a gt ggc t t agt cg gg aa tgt cgggctgtga gcaagaggaa gc gcagc c

61 acccgggcag c c ct g ca fc ca gcagtaaaca agataaaaca acttcttaaa

121 qataagectg agcatgtagg tgtaaaagtt ggtgtccgaa ccaggggctg taatgg tt.

1 tottatactc tagaatatac aa ac aa gg g tctg atgaagaagt tattcaagat

241 ggagtcagag tattcatcga a gaaagc cagctaacac ttttaggaac agaaatggac

3 1 atg c ag acaaatta^c cagtgaqttt g q tcaa a acccaaacat aaagggac

361 gtgg gtg a aata v ga

SEQ I NO; 38 Human ISCA2 amino a i sequence

1 i!isasivratv ravsk k qp traaltltps av k kqllk dkp vgvk q i

£1 eytktk d gvrv i k a q ltl g id vedk yfnnpoikgt

121 g g i

SEQ I NO: 39 Human 1 C A2 NA sequence

atg tg g tggggg c g c taa g g g gacg gagag gg ca tc gg

Si c g g g a ggct c c c gg tcc g gga c gg cg g cggga g g cgtc

121 t cagcc g agg cggcg gggc g t cg t ac g a agt cg c gaggc t

1 1 ttggaaatea gaaggg c agaa c t agg tg aag tggagggagg ggatg c

241 gga aax aa a ^ggataca gtta^caacc cgacga ag ggtacctgaa.

301 cagggtgggg aagag ggt gg~tgactc~ gatag r. gg c cgtgaa aggggcccag

3S1 gtggacttca gccaagaact ga^ccgaagc a tga ca c c -caagca

cagcaaggcT. g tc c gg g t c cta caaac -

SEP I NO: 40 Hu an SCA2 amino acid sequence {isofo rm i)

. :r;aaa¾gsslt aa^qravtpw prgr 1 a s l gpqarraass ssp ag g i ds vqrl

6 . l itagse l r qv ggg s g qyk sldt vi pddrv e qggar v dslafvkgaq

12 v i q iir q rtn qa qqgcscgasif sikl

SE D MO: 1 Human ISCA2 cDNA sequence (transcript va ant 2)

1 a gg tg g cctgggggtc gt;c;cctaacg gc g gacg agagag gg ca t;c; ctgg

SI c gagggg a ggct cac gg t c c gga ccagg cgcgtcggga gg g cg c

21 ag g agg gg ga agggcaga : ; : : ·: ·: ···:·;: agttg k c aggg t

1 1 tga

SE I NO: 42 Human SCA2 amino acid sequence {isoform 2)

. aa gsslt aa~qravtpw prgr a gpqarreass p a gqi r t vqg i

SE D NO 43 1BA57 cDNA s

1 atggcgaccg cggcgc^gct tcgaggcgcc actc g ggc gcggcggccc ggt ggcg

S tgg gg tg g g gg ce aa g g g tggc aca g -cctgcag t gg gg

221 ga a g ccggagcggc e gggc tgc t g gg a ggg g a c~tg .gcg

131 gtgcgtggcQ ccgacgcggc g tcc g ctaggg gc .gaccaa .ga actgccgctt

24 . gagtc tg g g ggg gg eg c gctgcgcgcg cgggctacgc c ac v - ctg

30 cg g gg gccggacgct atgacg c ct gtacg ggctccagg® c ggag

361 gtg tgg tcct c gga g g ga ag tcgg g agg gcgcgctgca g gcacct

421 gcgctataca gga gg g g gg g g gg gccg ccggag t g g gtg gg

481 q gg gt .gc ccaq t cc gagg gc ggqgctgca". cgctgcagga gagggcaggg

41 qctgccgcca tcc"catccg cgacccqcga acagcacgca tggggtggcg getcctcaec

50 c ggatg g gc c g cct ggtgx . gg ggccgqctcg ggg c .g g gg tta a

€61 cagcaccgat acctgcaagg g tcctg g gggg ccg g cttgc c tggg tggc

fZl c gc c gg a tcc ct ggccttcatg aacggcgtga gcttcaccaa aggc g tac

781 a gg cagg agcbgacggc ccgcacccac aca ggg g cat cgcaa g gcctc v

c gtc gg t - g g cc cctt cc ag ggcat a ccc gg gc cacggtgc g

90 actgcctcag g ag ctgt ggg a tc agggctggcc agggcaacgt g ggct g c

961 tg tg ggt cagagaaga^. caagggtcct C .gcacatca gag c tga ggg gc ag

1021 gtggccvCag tg gccagactgg tggcctacag ct aagta g

SE D NO; 44 Hu?¾a» I A 7 ac sequence

1 rsax a ga cpgrggpvwr w ia s c pgg d ga a rld rti

SI viigpciaapfl ig ltne p pspaaagapp aarag a l n rtl dv ilyg q s®

12 v gf iicd svgga gk a rirr v ephp av psspsa gaa iq r g

131 aaaiiirdpj: g gdegpalvpg grlgdi¾dya qhrylggvpe gv d ppgva

24 lpi¾snlafffi gvs kgcy ig tar gv irkrl : pvrfldpipt itpg tvi

30 a g tvgk ragqgnvgla ii s i gp I ir s gaq va asvpdw wp v sk

S .I Human N

I atggggattt ggcagcg c gctgcttttt ggtggggcgt cgctccgggc tggtggcggg

1 g a gc cgcttggggg aag gag g a gg tttg g ggcgccagtt gt tgg gc

121 gggagtgaga ccctaaaaca aagaagaaca caaa ca gt ccgaggac c aaagcag

1 1 aaa gata aaggtg~taa a aagtta a gttgcggctt c~ggaaaggg tggag . gga

241 aaa^ctacta cagcag^gaa g a ag ag a gt aaggc

301 a c gtttgc ^agatg^qga tgxgtatgga cctt aq c aaagatga a

3 1 ggaaat g aatta aca gag aa a atgagg t . gaa a tgg attgct

421 tg a -gt ta t gg r c gg v gaa aa agtgaa ag "agtttggag aggc - atg

4 gta tg gg ccattgagaa a gt agg cagg gatt gggg aa t gga ac a

541 g rgtaga a tg a agg aactggagar. gtgcag at agt tca s a att ct

SO ataaeaggtg ctg ga tgt c acgce cagga g cattgatgga tgcacscaag

€61 gg g tgaga "gtttcgcag g cca g g cc g ccttg gccttgtcca aaa.cat.gagt

" 21 gt t t ccag g caaaatg taaacacaaa ct atsttt " ggtg ga tggcgcaagg"'8 aaactagcac agacccttgg c tgaagt taggag ca tP cct ca cc aatata

4 agg aagc t aga agg ccagccaatt gtgttttcac g tga g tqatgaggcc

501 aaag tta gaggat g .g gga g gt ga gcca cc t . agaatg

SEP I NO; 46 Human N B L amino acid sequence is fo r

I gi qr qgvslraqgg atap igg a ssvcgrglsga gs k qi p k

6 kpiegvkqvi v sgkggvg sttavnla a i an s k® ig dvdvyg p svp va k

12 g p l q s l p ln gi csssmgflvee epvv ig l sa i k r qvd gq d

S vvdKppqtgd vqisvsqmp itgavivstp qdi l da k gaer rrv v pv glvqnns

24 v q p ck i gadgar klaq g igd pi iri reaadtgqpi v sqp ad a

30 a v v rrlpsp

S D NO: 47 Human NUBPL cDNA sequ c (transcript variant 2)

1 a g ccaagg gctag g g ga g gta g g c x vc gt ca aga g

6 a gaat fcg aagga atc ggaattatca cagagcaacc taatgaggcc tc c tgaa

121 ta ggtat g ..:. . ·,g gggc tgg ggaa ag tga c a gtttgg

181 agaggc ta tg aatg-c gg c v gag aaa gttga ggcaggtaga - ggggtcaa

2 gga r,a t tag g aga catgecacca ggaa ggag a gtg ag t a agt a

3 agaa a t c t aacagg gctg ga t g cca g cceaggacat cgcattga

gatg a aca agggtgctga gatgtr gc agagtceacg tg cg cct ggccttg

421 aaaa a ga g g tt a gtgt aaaa g aaa a a aaact;c;atat t; t g g g c;

481 gatgg-cgcaa ggaaactagc acagaccctt gg ttg ag ttctaggaga catt c c a

541 a ca ta aagggaag tt ag a gg ag a g g : a g ga

6 agtgatgagg c aa gct cttgaggatt gctgtggaag tggtaagaag attgccatca

661 ctte gaat a

SE ID NO: 48 Human NUBFL amino ac d {isoform 2s

1 ka igl dv p gn q n rp lin vg i cr r g v s v

61 a klXrqvdvigg d lvvdm p g dvg l v gnipitgavi v tp d ia lm

121 da kga vhvpv glv q n .sv pk ga dga r laq" g v gdip

1 ln i as gqpivfsqp¾ d ak y ri pse

SE D NO: 49 N BPL cDNA sequence (transcript variant- 3)

I a gc a cag g ac g aga g gca t tcagtctcac a ta tc ta gg

6 ctgtga g t tcc cgc ccaggacatc gca tgatg g a a a gggtgctgag

2 atgtttcqca gag".ccacgt c cgtcc t ggccttgtcc aaaacatgag tq ttccag

3 tg ccaaaa gtaaacacaa ctcata tttggtgctg a ggtg aag gaaactagca

241 cagacccttg tct gaagt Paggagac attcccttac accttaatat aagggaagct

3 1 ;caga^acag gccagccaa^ g caqcctgaaa gtga^gaggc aagct ac

361 ctgaggactg t cggaag ggtaagaaga cgccat ac cttcagaatg a

SEQ NO: 50 Human NUBPL amino acid sequence i r 3)

1 gd l vsqaip i g a vi tpqd i aiiiidahkgaa rrv vp i g q rr v fq

£ p k k kt q dgarkl d ip in a a qqpiv s qpeaae k y

12 Xri v vrr p

SEQ NO: 5 Human SLC25A28 cD sequence

1 a ggag gg aggqgcgggg g tggcggt g^qgeggggq ggccggcggc aqggcccggg

61 cggagccccg gggag gg g tg qga ggq ggctg ag gggg gt gqgccggggg

121 gccggcggcg gggaggcegg ggc tg agg ccggt ga a gatc ggact ggc

181 ccggactacg aggcg Pgc ggctggagcc c gtcacca cg at.ggt ggcagg g c

241 gg agqga -qgag a c g ::g :g a g a c a a g g aa ga egg v,g

301 caga c ac g ctga agctgcccgc ta - aa g tgttggaggc ctggagq

361 attataagaa ggaggg atggaggcce a gaggggg tgaa gt a agcaacaggc

421 g aggg ctg c cgcc ttatt rgcc tgctacgaaa agttaaaaaa gacattgagt

45 gatgtaat-cc a ggggg aatag at a x c aa g gtg gg cgg gcgtgtggca

541 acatta tc a gatg ag catgaaccct g ggaag gg t aag agag gatg aga g

601 tacaac ac cataccaccg ggtgacagac qtgta gqg cag g ggca aaatgaaggg

661 gccggggcct ttt c ctac ca c ag ga a gaa g tt ca c

21 attcacttca tgacctatga attc g ag gagcact a accoccagag aeggta aa

?S1 aag P c acgtcctctc tggagcttgc gqaggagctg tagctgccgc agccacaacc

84 ca tggacg g aaaac ctgc a a aggagt tt.ggcttt ga ctca

901 attacaggac a at a agg catqqctagt g tt agga gq ata t a agtagqtggg

961 gtgaccgcct a ccgagg ggtgoaggcc agagtaa t accagatccc ctccacagcc

1021 atcgcaPqgt c g g tatg g ttc aaa a taa a ctaaaaggca a aa ag gg

1 31 aggq gg a agtqa

S N . 2

1 grg gg v g paagpg r pge a il g lqrgvg aggg ga r ppvrqdpdaq

61 pdy*alpag« tvtthmvaga vag i cvn i v tx q s gpdpa r yrr i l r

121 iirP gi r rglrsv tg agpa aly y kik tls v i pggn s ia g ag va

181 i daarrnp a y q yrispyhrvtd vrav qa q agafyraytt qi rvp ga

241 i t q a f pqrryn p s vi gac a p dvc ti "cq lns

301 i .gh i g a r tvy gg v rgvqa xviyqip a y i krg¾361 ragk

SEQ ID NO: 53 Human FDXR cDNA sequence (transcript variant i )

1 atggctPcgc gcpg tgg g tgg gggg tggtcggcgt ggcctcggac gg g ct

S cccgccggga qcaccccqag t c a cacaggagaa gaccccccag

121 atcr.-gtgtgg "qgg ag -gg gctgg t ta a gg cccaacacce g taaa ca

1 1 c a g c acgtggacat ccacqagaaa cag c~g g cc ttg cc ggtgcgcttt

241 gg -g gg g gat a cc cgaggtgaag aatg a ca a acatt -a ccagacggcc

301 a .r.- t g g g tgtg tt gg g aa qtggaggtgg gcaqggacg" ga gg -qc g

36 gagctgcggg aggcc ca cgctgtggtg ctgagctacg gggcagagga ccatcgggcc

42 c ggaaa c tgg g gga gcpg agg g tg gct cg cccgggcctt cg ggg tgg

48 c acgggc ttcctgagaa ccagga c g ga ccaga c gag g ga acagc g g

1 a t tggggc agggg a g , gg t .f,gg a g ggc g a t ta g a tgag

01 cacctggaga gaa ggaca :. cacgaaggca g ctggg g tactgaggca gagtcgagxg

661 aagacag g gg gtgg gg gg cc gcaa tgg c t ac a aaggag

72 t gggag a tga - cag ac gggagc cg cccat tgga tgt ggatttc"~g

7 1 ggt t agg a aag at aa gg ggr.- c g cgagga ag gg g ggaa tg f,g

84 ct g cgg cagag g agggc g ge aagc cc gc agg a cg cc c

1 gtg r.-ggg q cq r, tt gaag ag agg tg tg ct a agatggg

9 cggcgggcsg caggtgtccg cctagcagtc ac gactgg agg gtcg "gaggccacc

02 gtg g gc c cgggag catggaagac t cc tgtg ggctggtgct cagcag t

10S1 ggta aaga gccg c g cga ccaag g cc a cca g ggg ca

114 cccaatgtgg agggccgqgt atqga g q ccagg c ct ac".gcagcqq ctggg".gaag

12 agaqqa a caggtgtcat sg ca asc atgsctqaca g t t a c gc agatg

126 ctg .g agg ac tgaa g tggqttgctc ccctctqgcc c agg ctgq ctacgcag

132 atccaggccc tgctcagcag ccgaggggtc ggccag ct ctt c caga c gggag g

13S1 ctgga gc g ggagg gg ggggc ag ggca g gga agcccaggga gaagckggtg

1441 ga cc cagg agatg cg cctgggc cactga

S E ID NO. 54 Human FDXR amino acid sequence (isoform I

1 a g wsa p r rlp p g st s c s q tpq icvvgsgpag v g l

61 pqa vd i k qp p g v gvapdhpevk avi:ntf sgr a g vevgrdvx^p

121 eir¾av'h≤vv h i ipg ipg vcsara V g ng p q spd scd av

181 iigggnvaid variii pp i¾ rtdi a lgv ir s ktvwlvgrrg plqv ti

2 Ireisiqlpga rp dpvdil g qdk k vp rprkr t l irt k gp a arqa a

301 a g r pq lpspdg rraagvrlav tr gvd a ravp gd d ip cglv s i.

361 gyk p dps vp d klg p v g v sdv pg g k rgptg at iaix i g

421 iiqdlkagii psgprpgyaa iqallssrgv . d k d g gkpr k v

481 dp q s l r g

SE I NO: 55 Human FDXR c A sequence nsc p variant 2 )

1 wg ¾ s¾ .» pag psf h stqek pq i vgsgpag ytag i k

61 pq diy k qpvpfgivrf gvapdhpavk nvin ta s ca gn v vg s vtvp

121 y ygaeahra ipg pg v r vg v g lp nq «pdlscdta<r

1 1 i qg va ari 1 « a ll q r dit a lgv 1rqsrv v¾ Ivgrrgplqv

241 a -i air iqipgarpil dpvdflglqd kik vp r rk rit ll r a iepgp aaa

301 rqasa«ra¾rg r r pqqv p pdgrra gvrXavtrie gvdaatravp tgdas i g

lssigy i r vdp svp d lgvip nv grvmdvpgly csgwvkrgpt. gv l .ffi t d

421 . t.gqsr:llqd g p sgp rpg a iqa s rgv v fsd evargqgtgk

481 p r vdpq lrlig

SEQ I NO: 56 FDXR acid sequence is f r 2 )

1 a iprtr p pagstpsfch s q ktpq i v gsgp g x aq k

61 pqahvdiyek pv fgivrf gvapd p v vint a hsgrc ga vevgrdvtvp

121 l a avv yga d r leipg¾elpg vcsaiaivgw y gip i epdlscdtav

ISi i gqqrva d varilltpps l ai q : vditkaaigv qsrvktv iv p i v

241 ® ftik ir« iqlpgarpil dpvdflglqd kik«vprprk rltelllrta t kpgpa

301 rqasasrawg r r pqqv Ipspdgrraa gvrlavfcrie gvd ravp tgd dip g

3 1 vls igyk dp yp d skigvipave grvi&d pgi s vv kxgp gvi d

421 gq i qd k glipsgp xpgv iqa s rgvrpv fadvaakldae va r gt k

0 p r lvdp ir lg

SE : 57 Human FDXR cDNA sequence tra sc pt variaiit 3)

atgg tcg gctg ggcg ctggtggggc tggtcggcgt ggcctcggac c ggc g ct

Si c cg cggga gcac ccg ctgcca c ttt tcca c gg g a ga c ccag

21 atctgtgtgg ggg ag gg c agctgg ta acgg c ca c c g taaag gg

S gtg aagc t tgtgttctca gcccagggtc c g actc c tg ctgt tggggaaggg

241 gaggacctgg gggcgtccca g c ctct ;; ctcgacccca cagc g ca c c t

301 cag agca c cccaggccca g ggaca.c tacgagaaac agcctgtgcc ctttggcctg

3S1 gtgcgctttg gtgtggcgcc tga ¾c c gaggtgaaga a tg cat aa caca cccagacggccc attctggccg c g c c tggggcaacg tggaggtggg cagggacgtg

431 acggtgccgg agctgcggga gg cta a gctgtggtgc cgagctacgg ggcagaggac

541 caccgggccc gaaat cc tggtgaggag ctgccaggtg tg ctccgc ccgggccttc

S O gtgg tgg scaacgggct t tgag cagg ctgg gccaga t g gtga

a c gtg ttctggggca gg gaa g tc g a g g c g t cta t acc

a ctg g ac gg gag a gga a a ga ggcag ctgg gt a tg gg ag" 31 agtcgagtga agacagtgtg gctagtgggc cggcgtggac ccctgcaagt ggccttcacc

S41 attaaggagc t ggg gat ga cagtt ccgggagccc ggcccatttt gg cctgtg

90 gatttcttgg gt cc gga c g tca g aggtc cc gc gagg a gcggctgacg

a tg gc tt ga ggc. ¾ a g a g ccagggccgq cggaagctgc ccgccaggca

021 t ggcct c gtgc gggg ct cg vtt ttc g agcc cccag ggt gc .gccct

108 ccagatgggc gg gggcag aggtgtccgc tagc gtca c aga gga gggtgt ga

114 gaggccaccc gtgcag gc c cgggag c tgg g cc tc ttgtgg gctggtgctc

1201 agcag a g ggtataagag ccgccc g c gacccaagcg gcc t ga ccaag t

261 ggggtcatcc c a gtgg gggc ggg t a tgg gtg caggc tc a ctgcagcggc

1321 ggtgaag g ggaccta aggtgtcata gccac a ca tga tgac g c cct a c

1381 ggccagakgc tgckgcagga cctgaaggct ggg gct c t fc g c caggcctggc

1441 cgcagcca tccaggccct gctcagcagc cgaggggtcc ggccagtctc tctcagac

1501 gggag ag tgga gccg ggaggtggcc cggggccagg gcacggggaa gcccagggag

1561 aagctgqkgg atcctcagga gatgctqcgc c t g c actqa

SEQ : 58 Human FDXR amino acid sequence fiso r 3

1 i w g w l pa stpsfc q k pq icvvgsgpag iytaqnllkr

SI v a ic qp xv i spa lsg g iigasqp ls idp t c pvp qq pqa vdi a p

121 vrxg ap hp vk in t q a grca grv vg r v tvp r -a avvlsygaed

131 ra i i.p g -e pgvc a ta g yng pe q p cd t lgqg aldvati.llt

241 pp i r di kaa g Irq k rrgpiqva.-lt i r iq l pgarpildpv

301 dflqlqdkik vprp r rl lr ts pgpasaarqa ra g lr frapqqvlpa

361 pdgrraagvr lavtrlegvd ravp tg p lv s g k rpv dp avp d k

421 rdvpg l c g wvkrgptgvi attmt-dsf t gqmllqdlka X p pzpg431 aa iqal a gvrpv a va rg g gkpr d g

SE I NO: 59 Hu an FDXR cDNA sequence (traaser¾pt variant 4)

1 a gg ~ , gc g r.g tgg g ctggtggggc tggtcgg g ggcctcggac ccggctgcct

61 cccgccggga gcaccccgac ctttgggggt tcagatgaag taagagaccc tgcaaatgcc

2 cc .g.¾ ¾ .¾ g g gg .g ggg g g ¾ . .

S ttc g tgg a ttca g gaa ac cc cdgatctgtg tg gggca tggcccagct

24 gg t a cggcccaacsi ctg a g caccc gg cccacqtgga catctacgag

301 aaacagcctg tgccctttgg cctggtgcgc tttggtgtgg cgc atca ccccgaggtg

3S1 a gaatgt a c a acat tacccagacg gc at ctg gccgctgtgc cttctggggc

421 aa g ggagg ggg aggga cgtgacggtg ccggagctgc gggagg ta cca gc gtg

43 gtg gag acggggcaga gg ccat gg gcc gg aa ttcctggtga ggagctgcca

541 gg tg g g t ccg cgggc cttcgtgggc tggtacaacg ggc tc tga gaaccaggag

0 c g agccag acc gag tg g cagcc gtgattctgg gg gggg a cg g tctg

6 gacgtggccc gcatcctact g c cacct gagc c tgg agagaaegqa ca c gaag

72 qcagccctgg gtgtactgag gcagag g¾ gcqaagacaq tgtggctagt gqg cgg g

7 1 ggaceccaqc aagaqgcc , a aaa ag ga tt ggg agatgattca ga ac ggga

841 cccggc ca ttctggatac gga t gggtct aggacaagat caaggaggee

1 ccccgcccga gga g g gaeggaactg ccqcttcgaa cggccacaga ga g caggg

961 gg ggaag tgc cg ca q a g t ccg g ca gggg g ca ttt cga

1021 agcc cca c aggaqctgcc t a a gggcggcggg g a t ccqcctagca

0 gt ac g t g gggtg ega g gge aac g g g g acggg ga a gg a

1141 gacctccctt gtgggctgga gctcagcagc ataqggtata agagccqccc g cga cca

120 agcgtgccct tgact as gct g ggtc aaccccaaag tggagggccg gg ta gga

1261 gtgccaggcc t actgcag cggctgggtg agagagga ct a igtgt g

1 21 accatgactg acagcttcct caccggccaq atg t c gc aqqacctgaa ggctqqgttq

1 I ctccectctg qccccagqcc tggc acg a gccatccagg ccctgctcaq cagecqaggg

1441 gtccqgccag ".ctctttctc agactgggag aagctgqatg ccqaggaggt ggcccqgggc

SO caggqcacgg qgaagcccag ggaqaagctg gtggatcctc agqagatget gcgcctcctg

1561 ggcc c ga

SE NO: 6 FDXR amino acid sequence is for 4)

1 - a p r p pagstptfgg s ev r cip n k nkr r r qvrv g q

6 liid iq qiewgsgpa g ryt g iik p a vdi kqpvpigivr gvapd p v

12 x intf qt a sgrc g xv grdvtv p lr y av viayga d r al ipg p

181 qvcsarafvg q lepdlscdta viig g va dvariiitpp i rtd ic

241 aalgvlrqsr vka lvgrr gp qv f ik i p arpiiapvdf igiqdkiksv

30 p rpr i i IIrtat*kpg p«¾ rqa «a s a gir r pqqv p pd grra gv a

361 ¾ « t avpt a i pcg l ig rp vdp ssvp id gv ip rv l

421 vpg s v krgptgviaa t td tg a qdlkag i p gp rpgya a q a r

4 1 rpv sdvaa k daq varg qgtgkp qk v pq r g

SEQ NO: 6 Human FDXR cDNA sequence (transcript ia 5)

1 atggcttcgc g tg ggcg gg ggggc ggtcgg gt ggcotcggac ceggcaqcct

il gccggga gca cgag c tg cac att c a aggagaa ga c ccag

121 at gt tgg ggg a g cccagctggc tctaca gg ac c gctaaagcac

31 cagg c aogtggacat a gagaaa ag ag g cc ttg cc ggtg g ttt

2 4 . gg gagg g ctgatcaccc egaggtgaag acggcccatt caggccgcag tg caa tgg

301 ggcaacgtgg aggtgggcag gga tga g qtg ggag gggag ta cacg t

361 gtggtg g geta gggg ag gga cgggccctgg a sttcc gg gaggag g

421 ccagg gtg gctccgcccg gg ct g g gg tggta a gggct c tgagaaccag

401 gagcaggaga agaca gag ctgaqa a a g gtgatt tggggcaggg gaa gaqg t

541 tgga gtg c cg aacct acagac a cctgagcacc aggagagaac gga aa acg

0 aaggcagccc tgggtgtact gaggcagagt cgagtgaaga cagtgtggct agtgqgccgg

6 cgtggacccc tgcaagtggc ctt ccatt aggag ttc g g gatg t tcagttaccg

72 qgagcccqgc cca ttgga tcctgtqgat ttettgggte tccaggacaa gatcaaggag

7 1 g cc ccg c egaggaageg g ga ggaa ctg g tt gaacggccac agagaag c

84 gggceggegg aagctgcccg cc gg atc gcctcccgtg cctggggcct ccgctttttc

9 1 cgaagccccc ag ggtg gccctcacca gaCgggcggc gggcagcagg cq ccgc c

961 qcagtc c a gac ggagg gtcga gag gccacccgcq cagtgcccac gqgaga a g

102 gaagacct.ee gqgc ggtgcxcagc agcattgggt. ataagagecg ccctgtcgac

108 cca gcg gc cttt.g t ca gct gg gtcatcccca atgtggagqg ccgggttatg

1141 gatgtgccag g acta g cag ggc gg gtgaagagag ga acagg g catag

1201 acaaccaaga tgacag a cctcaccggc agatg tg tgeaggaect gaaggctggq

1261 gctc ct ctggccccag gcctgg ac gcagccatcc agg c gct cagcagccga

132 ggggtccggc c&gtctcttt c cagac gg gaga g tgg Pg cgagga gg gg cgg

38 ggccagggca gggg agc c gggaga g ctggtggatc c aggagat gc gcg ctc

144 c ggg c c ga

B I O 62 Huma DX am o cid q isoform 5)

1 a pags ps stq p i gsgpag taq iik

S pqah diy qpvp g rf g vapdhp v h gx .» gnv vgrd vp i

121 d ra ¾ p « pgvc r v ? g ip¾ e p l avi igqq;iva

101 d vari ltp p h kaaigvlrqs rvktvsivgr p l v k lr r iqlp

241 g dpvd lglqd ik vprprkrlce l x kp gp aarqa a rf

301 rspqqvlpsp dgrraaqvrl a vd atravpt-gd& edlpcgivis .g v srpvd

3 1 psvpfdskig i.p n ffi dvp l g vkrgppgvia ds q iiqd kag

421 p prpgy aaiqa i s r gv rpva ad k da var gqgtgkp r vdpq lri

4 1 g

E Q.; 3 F XR N

I atggc gc g g tggcg ctggtggggc ggt gg gt ggc gga ccggctgcct

6 cccgccggga g cccgag cttc g c c ttt ca ca g ga gaccccocag

3. a gtg g ggg ag gg ag gg t a a gg cc acct g aaag ag

1 1 ac agg a gtgga a ta g ag aaa ag g tg p tgg ggtg q

24 tttggtgtgg cgc tgatc ccccgaggtg aagagctacg ggg ag gg cc tcgggc

30 ctggaaattc ccggtgagga getgecaggt g gtg ccg c cggg ct cgtgggctgg

361 ts aa ggg gaqaa ccaqgagctg gagccaqacc tgagctgtga cacaqeegtg

42 attctggggc gggg a g ggct gg c gtggcccgca tcctactgac c c cc g g

«01 c cct qaga gaaeggaeat cacgaaggca gccctgggtg taetgaggca gagtcgagtg

41 aagacagtgt ggctagtggg ggcgtgga cc tgcaag tggccttcac cattaaggag

60 ctvcgggaga gatt agtt accgggagcc cggccca t

6S1 gg c ccagg acaaga aa ggaggt c cg cgagga ageggctgae ggaa g g

21 tt gaa gg ccacagagaa gc aggg cg gcggaagctg cccgccaggc at ggcc c

"S cg g tggg gcct c t ccc a c gg -cg tg c ac aga ggg

8 4 . gg ggg a aggtgp cg pa ag actagactgg agggtgtcqa tgagqccacc

5 cg g agtg ccaegggaga ca g aa ac c e q:g g gg gg g : ca cag a t

961 ggg aaga ccg c gt cgacccaagc g g c g ac ccaagc ggg cat

021 caatgtg aggg ggg t gg tg g ccaggcctct gc g gg ctggg g a g

1031. agaqgaecta aggtgp a a cacaac atgacpgaca gcetcctcac gg ag a g

1141 g :g agg ac ga gg gq g c g agg qg a q ag

1201 at agg tg P qcag gagggg cgg agt c t c a gggagaa

1261 tgqa g g aggagg g gg g g gg a q gga q c aggqa gaagctggtg

321 gatcctcagg agatg g g cc c gggc cactga

1 ig aa prtrlp pagatpsfch tqektpq i g gpag ytaghil q

61 a v i qpvp v fgvapdhp6v y a d ra l ip lpg vcsarafvgw

121 nglp nq l «pd dtav .lgqgn ald vapi.lltpps; "di.tka a qvlrq rv

S tv vg rrg p qv t k r iiq pga rpildpvdfi g qdk ik vp rprksriteii

241 Irtafcekpgp aeaarqaaas ra ir xs pqqvipapdg iraagvriav triegvdeat

301 r v g ipcg v i ggkarpvdpa vpfdskigvi pnv dv pgi gvvk

361 rgptgviatt mtdsfltggs llg ag l p gprpg a ig ls rgv s k

21 a evargq g g p v gpgemiriig

SE D NO: 65 FP X c A sequence (transcript variant 7

I a ggaaga aggaeagaga gca eag gcecacgtgg acatctacga gaaacagc

6 g gccctt g g gigcg ctttggtgtg gc cc g tc ac cgaggt gaagaatgtc

2 atca&cacst tt eccaga g c at ct gg g g q ccttctgggg aa g ggag

31 gtgggcaggg acgtgacggt gc ggag g cgggaggcct accacg qt gg g gag

241 tacggggcag aggaccatcg ggccctggaa attcctggtg aggagctgcc aggtgtgtgc

3 1 gcc ggg c gtggg c ggt c ac ggg ttc cg agaaccagga gc ggag ca

361 g c tg gct gtgacacagc cgtga v c g gggcagggga acgtggctct ggacgtggcc

421 cgcatcct.ac tgaccccacc tgagcacctg gagagaacgg acatcacgaa gg ag c vg

481 gg gtac ga ggcagagtcg agtgaagaca g g ggctag ggg cggcg ggacc g

1 aagtgg t tcsccattas ggag , , gg gagatgat agtta ggg ag ceggc

sttttggstc ~tg .g g at - ttggg - te agg a aaga teaaggaggt c ceg c g

661 aggaagcggc tg ggaa gcPga^Pcga a ggcca ag agaagocagg g cgg gg a

21 gc g gc aggca gg ctccc t c tgggg t c c tt cg ag ag

?8I cagg g tgc ca caga tgggeggcgg g a cagg g tc g tag gt a t ga

841 ggaggg g t ga gagg ae ~ g gca gcgcccacgg gaga a gga agac t

901 gtgggc gg gc cag ag ca ggg a aagag gc c g cgac aagcgtgccc

961 tttgac ca ag tgggg catcoccaat gtggagggcc ggg tgga gtgccagg

1021 tctacig a gcgg tggg gaagagagga cctacaggtg t a ag cae aaccatgact

100 gacagcttcc " ccggcc gatgctgctg agga c a aggctgggt" gctc ct

1141 ggccccaggc ctggctacgc agccatccag gc ctgc ca gcagccgagg ggtccggcca

1201 gtctctltct cagactggga gaagciggat gccgaggagg tggcccgggg ccagggeacg

12S1 gggaagc a gggagaagci ggtggatcct aggaga g tgcgcctc gggccactga

SEQ ID NO: 66 ma FPXR amino acid sequence (is r 7 )

1 w a vdiy k p vpfgXvrrgv pd p knv int tq a ¾ great

61 vgrdvtvpel r -a avv yga¾dhrai« ipg lpgvq ara fvg y g p rg l p

121 discdcavii gqgBvaidva rii tpp ¾x d ltkaa gv rq svkt wivgrrgpi

181 qva ti eir iqipga p iidpv igi qdkik vp p rkrlteiiir ta kpgpa

241 arqa a ra g rspq qvlpspdgrr aagvrlavxr gvdea ra vptgdtfs«dip

3 1 cg vl igy ksrpvdpsvp dsklg ipr v g rvisdvpg iy sg vkrg

361 d gq qd k g pa gprpg a i a rgvrp d l ae v rggg

421 gkpr¾k:ivdp q r ri gh

SEQ ID NO: 6? Human FDX2 cDNA s q en

1 atgg cgc c tgg cg gggagg g g g g aggg v tactg a gg x g c gg

S ggc ctgg gg a agacc tgggggcacv t ggg egg ggg ggggg gg g gggg

121. a a cagaa agtt agc ga agg g cg ggctg gagaggagga g ggg gg

δ c gg gcgg ccggggacgt g gt g ag accgctcagg ccagcggatc

241. a gcagag : gg g g a a g : : r a gg g g egggg

301 ctggaagggg cctgtgaagc ccccctggcc g tc acct g catgtg tgtgagtgaa

361 gaccacctgg a ct ~gcc t c cccgag gagagggaag a gacatg aga a ggca

421 ccc cctcc aggagaactc gcggctgggc g aga tg "gc ga a c ggag -ggaa

431 ggagcggaa" ca c~gcc aagat ac aggaa - ct a g gga gg c a g -ccc

541 a qc cca ga

SEQ I NO; 6 FDX2 amino

1 . rvl aa r gt nrpggt gsg gva ig ttrkfqatg.e rp ag¾ da g

61 perpgdvvnv v v r g ri pvsgrvgdriV i iaq rhgvd l gac aii a cstchvyvs«

121 dhldlipppa a r d d ffi d a plXq rlg q i ltp l gaa lpkat r yvdg vp

101 p

) NFS Pharmacodynamic Bi ar ers

SE ID NO: 69 Human Ac cDNA sequence (transcript variant 1

atg aacc attc a a tgctg attggat tgta aa c agg'aaagaaa

ttcttcaatt tgaataaatt ggaggattca agatatgggc gc tacca tt ga -caga

121 gtt tt tgg aag ag at tcggaattgt gatgagtttt tgg g agaa acaggatatt

31 gaaaatattc tacattggaa tg acg ag cacaagaaca tagaagtgcc atttaagcct

241 gc cgtg c t gcagga c tt gggt gtgcccgctg tggttgactt tgc g atg

301 g gat g tgaaaaagtt aggag aga ccagagaaaa. ac gt. g x g

361 gatcttgtaa tagatcattc a caggt gatttcaaca gaagggcaga cagtttacag

421 aagaatcaag a ggaatt g a gaa gag g ga t g at t t aaagtggggt

481 cccaggc tt ac a at gcgg t a t cccctggc caggaatcat ccaccaggtg

aatttggaat atttggcaag «gtggv«ttt gatcaggatg gatattatta c c ga agc

601 tcgtgggc cagactcgca c ta atg a g tggct tgggcattct tggttggggt

661 gtcggtggta ttgaag ag ag tgt atg tgggtcag caatcagtat ggtgcttc

721 aggtga tg gc acagg gatggggaag cc acc s ggtaacat cactgaca c

' 8i gtgctcacca ttaccaagca cct cgcc g gttggggtag tgggcaaatt tgtcgagttc

841 ttcggg tg gagtag a gttgt tt g tga gag cta gattg taacatgtgt

901 agagta g gag aa tg tgc t ttc agttgatg a gttagt t a gta tg

961 gtgca cag gt gtgatg agaaaaatta aagtatatta aaaaatatct cagg tgra

1021 gg tg t gagat caa g a cc c t aagacc a acttcaccca g t gtggaa

10S1 ttagatttga aaacagtagt g tgctgt ag gga a aaagg t a ggacaaagtt

1141 gctgtg cg acatgaaaaa gga t tgag agctgccttg gagocaagca aggatttaaa

1201 ggatt aag ttgctcctga acat taat gaccataaga cctttatcta. tgataa.cact

1261 gaattca c ttgc c tgg tt tgtggt attgctg a ttaetagctg ca a a a

1321 agtaatccgt tgtgatgt aggggcagga ttgttagoaa agaaagctgt ggatgctggc

13 1 ctgaacgtga gc ttac t aaaact g ctgtctcctg ggagtggcgt ggtcacctac

1441 t c ca g aaag ggag catgccttat ctgtctcagc ttgggtttga cgtgg ggg

1501 tatggctgca "gacctgcat tggcaacagt ggg- ct ac ctgaacctg" ggtagaagcc

1561 atcacacagg gagaccttgt agctgttgga gtactatotg gaaacaggaa ttttgaaggt

1621 gag tca c cc a a ccg gg caa tat t.t g t t c cccttag aatagcatat

16S1 g aa tgctg gaacca^cag aa ;; ¾ct ;; gagaaagagc ca tggga aaa^gcaaag

1741 gga agcag tatttctgaa agatatctgg ccgactagag aogagatcoa ggoagtggag

1301 gt ag atg c t c ggg gatg tt ag g agt at agaaaataga ga tg gaat

1 1 gaaagctgga atg ttagc aaccccatca gataagctgt ttttc gaa t caaa ct

i a gtatat a aat ac ace a"~ctttgaa aa gactt "ggatctcca g c c a a

1 S1 tc a agtgg a gcc a gt gc~gctaaa~ ttgggagatt cgg a caac tgaccacatc

2041 t c; ag g gaaatar,fcgc a gaaa ag ct r,g t g &acttaa taa gagg

2101 tc a gagaa t;; aa t;c; a tg g c; c gc; gag gr,aatgacgc cgt Sggca

2161 cggggaacat; fctgccaacat tcgcttgtta a ag t t;gaacaagc;a gg ac; acag

2221 a a -ccatc "gc t -gg ggaaatcc"" gatg g - tg a~gctgc"ga g gg acc g

2281 caggcaggcc ttcccctgat g tctggc ggcaaagagt acggtgcagg cagc ccg

2341 gactgggcag ctaagggccc tt c g tg ggaatcaaag ccgtcc gg cgagagctac

2401 gag gca tc accgcagtaa cc ggt ggg a ggg gtga tcccacttga a at t cct

2461 gg gagaa g aga gc ct ggggctcaca gggcaagaac gatacactat ca attcc

2521 gaaaacctca aaccacaaat gaaagtccag gtcaagctgg atactggcaa gaccttccag

£8 1 gctgtcatga ggt ga a tgatgtggag tcac t t tcctcaacgg gggcatcctc

£641 aac aca g t gc agat ggc ag g

SEQ ID NO: 70 Human Ac cDNA se ( ans ri p van a t 2)

1 atgagcaacc ca tcg aca ccttgctgag ccattggatc ctg c a c ggaaag a

61 ttcttcaatt tgaataaatt ggaggattca agatatgggc g t ac att ttcgatcaga

121 gttcttctgg aagcagccat tcggaattgt gatgagt t tggtgaagaa acaggatatt

8 ga aata c ta a ggaa t.g a g ag cacaagaaca agaag gc a taagc

24 gctcgtgtca t gcagga ct t ggg gtgcccgctg tggttgactt tgctgcaatg

3 1 cg ga c g tga ¾g -C v aggaggagat c gag a aaa cc gt c g ctg t

361 gatctx g aa tag cat at aggtt ga - tcaac gaagggoaga gttta a

421 aagaataaag a c g g a a .:. g aaagaaa agagagcgat ttgaa ttt aaagtggggt

481 g tt ttcacaaca^ g gg att c tggc caggaatcat ccaccagg^g

1 aatttggaat at , . g aaq agtggxattt ga - agga g gata atta c aga aq

cgtgqg a aga tegca a ta atg a - atggc - tggg a t t g ttggggt

gt gg -ggta tgaag ag agc.tgr.catg gggt gc aat agt t ggtgctt t

721 caggtga - g g ra aggcr, qatggggaag c ae tggtaacatc ca tga ar

81 g gc c cca t ccaagc cctccgccag grtggggtag tgggcsa.att rg cgag r c

84 ttcggg tg g gtag c gttg att gctga g g ct ttgc aacatg gt

c agagta g gagc a gc tg tttt ccagttgatg aag ag ta cacgtacctg

gtgcaaacag g gtga .ga agaaaaatta aagtatatta aaaaatatc". tcaggctgta

102 ggaatgtttc gagattteaa tgacccttct caaga cag a cacc a ggttgtggaa

10SI ttagatttga aaacagtagt gc gctgt agtgga a aaagg ct a ggacaaagtt

114 gctgtg cg atgaa a gga tgag ag tgcct g gagccaagca ggatt aa

1201 gga^Occaag O gct c Oga acaOcataa^ gacca^aaga c O at a tga^aacact

12 1 g a tg cca ¾ ; ca aaacac

1321 g ca t g -c ctgtgavgtt agg g agga ttg agc agaaag g gga gc gg

13 I ctgaacgtga gc ttac caaaactagc ctgtctcctg ggagtggcgt ggtcacctac

1441 acc caag aaagcggagt catgccttat ctgtctcagc ttgggtttga cgtggtgggc

1501 ta ggctg a " a gcat tgq aa agr, gg rr a crgaa gf. ggtagaag

1561 atcacacagg gaga rrgt agcrgttgga gtae.caf.otg gaaacaggaa ttt g ggt

1021 gag tcac caaca cg gg aa ta tag ct ccttag aatagcatat

1 31 g aa tgctg gaacca^cag a a ;; ¾ c t ;; gagaaagagc ca tggga aaacgcaaag

174 gg ag gg tatttctgaa agatatctgg ccg c agag gaga c a gg gtggag

180 c agt tg tcatoccggg g gttta g ga g tat agaaaataga gaotgtgaat

1S61 gaaagctgga g gc. aa cc at a gataagctgt tttctgg a ttc s tct

1&21 a gratat a aat ac ac a r tttgaa aa e gactt ggatc ca g c c aaa

981 tctatagtgg atgcctatgt gc g taaa ttgggagatt cggtaaeaac tgaccacatc

2041 t c agctg gaa tgc aagaaacagt cctgctgctc ctact t c gagg

2 01 aact ac gagaattcaa ctcctatggc tcccgccgag gtaatgacgc cg catgg a

2 61 cggggaacat ttg at cg ttgt aa g tttt tgaacaagca gg c acag

2221 tcc c tgcc ctgg gg aatc gatgtgtttg gctg ga gcggtaccag

2281 caggcaggcc tt ccc gat cg t tggc ggcaaagagt acggtgcagg cagc cga

2341 gactgggcag ctaagggccc ttcc ctg ggaatcaaag gtc tggc c g¾g ca

2401 g gc c c a gcagta cctggvtggg atgggtgtga cc a t ga a a ct c

2461 gg gag atg cagatgcccv ggggovcaca gggcaagaac gatacactat cat attc a

2&21 gaaaacotca aa acaaa gaaag cag gtcaagctgg ataotggcaa gacctt c g

2 6 8 I gctgtcatga ggt ga a tgatgtggag ctcacttatt tcctcaacgg gggcatcctc

2641 a : a :g a t gcaag gg aag ag

SEP ID NO: 7 Human A ammo acid sequence

1 snp a a p i pvqpgk inlrs l s r grl ir v l ai nc lv kqdi

& fe vtq hkniavpfkp a rv i df g a a rdavkklggd pekinpvcpa

121 v si v nrra s qd l f r r rf sq n g sg v

1 1 ar dqdgv pds v g d s t t; idg g i gwg vgg Iggpis^vlp

241 qv r iig phplvxs^di l g vgvvg v fgpgvaqlsi a i

301 peyqataaff pvde sit l v'q grd e kyi y qav gnifrdfndps qdpdftqvve

361 d t p c sgpkrpqdkv di k scl akqg k dhk fiyd

421 « iahgs iaaitsctnt snpsv»lgag llakkavdag fiv p yi s Ispgsgvvty

431 l sg v p v g g fd g yg cig s gp pep ea i qg vavg v grs n g

541 r prtranv a pp v iay a ag irid k p g n ak gqqvflkdi¾; ptrdaiqava

0 rq v i g k evyqki¾tvn naiat.p s t i pp f nlaid pp

6 sivda lin I v td i sp nia ns paaryit g i p r r g srrg dav a

72 rg fan iri nr q&pg tl lp g ll d v daa ryq qaglpiivla gk ygag r

7 1 dvaakgpfll gikavlaasy ¾ri rs lv g i.p ay p ganadalglt gq r ti ip

S 1 enlkpcpakvq vk dtgkt g av nr d dv a laggii n y n k¾>ak

SE I NO: 2 Human Aco2 cPNA sequence

1 atggcg a acagocaact ggagaetogg ctgoagaaag cactgggagt g gg agta

S c ggcc c gt ag g a cggg c aaggaggcga ag cca a tgagcccaac

121 gag a cat tatgacct g a gagaag aca aa ca aagt cg aa acgac^gaac

31 gg g tga ca t a gga gaagattgag tatggacacc aggatgac cg cag cag

241 gaaattgagc gaggeaagte g aac tg gg tg ggc gg a cgtgtgg catgcaggat

301 gcgacgg c g t gecat g tccagt at age g g ggctgt e ggtggctgtg

361 ca c & ca tc .a rgtga cc tctga t gaageccagg ÷gggggega gaa gac g

421 g ggg agga rcaa c agga g t t aatttc caac agg caaa

4 1 taaggcgtgg g tt aggaa g ggat f, ggaaacattc a agataa tctggaaaae

541 taagcgtaac ctggtgttct tctgattggc actgactccc acacceacaa tggaqgcgga

60 ca gggggc tctgcattgg agttgggggt ccg tg tg tggatgacat ggctgggatc

661 ccc ggga c tgaa gccc c aggt at qgcgtgaagc gaegg c tctctceggt

t g cctca ccaaag tg gatcctgaaq gtqgcaggca cctca ggt gaaaggtggc' 8i acaggtgcaa tcgtggaata cca ggcct g g agac ccatctcctg cactggcatg

841 gcga aa c gcaacatggg gcagaaa t ggggccacca c t cg g t cccttacaac

1 acagg tg agaa ac a gagcaagacc ggccgggaag acatagccaa actagctgat

61 g tt g at cttgg a gcctgaccct ggctgccaaa tga ct a ttgaaa a

1021 aacctcagtg agctg g c aca atca t gggcccttca cccctgacct ggctcaccca

1081 gtggcagaag tgggcaagga ggcagagaag gaaggatggc c ctg acat cgagtggg

1141 ctaataggta g ag ae aa ttcaaqctat gaagatatgg ggcgcacagc ag tgtgg

1201 aag aggca tggcccatgg cct a gtg aagtc ag i: t aa tca accaggtacc

1261 gagcag t c gcgccaccaa tgagcgggac ggctatgcac agatcatgag gga ctggg

1321 ggcatag^cc tggccaatgc ttgtggcccc tgcattggcc agtgggacag gaaggacaac

381 aagaaggggg agaagaacac aatcgtcacc tcctacaaca ggaacttcac gggccg ac

1441 gacgcaaacc c gagacc a tgcctttgtc acgtccccag agattqtcac agccctggcc

1501 attg g gaa aag r, aa ag ag a cg a ta c tga gggca ggatggcaag

1561 aagttcaggc tggagg t ggatgcagat gag tt ca aaggggagtt agacccaggg

1621 caggacacct accagcacec acccaaggac g gcggg agcatgtgga cgtgagcccc

16S1 g ag gcctgcagct cctggagcct tttgacaaqt gggatqgcaa qgacctgqag

1741 ga tg aga t tcat a ggtcaaaggg aagtgtacca ct ac acaa ctcagc q t

1 1 ggcccctggc tcaagttccg tggqcacttg gataa a ct ccaacaacca g t at ggt

1 61 gccatcaaca tt.gaaaac.gg caa gc aa tccgtgcqca a g cgt a tcaggaqttt

192 ggccccgtcc c .g cactg ccgcractac aagaaacatg gcatcaggtg ggtggtgatc

I ggagacgaga actaeggega gggctcgagc egggagcatg cagctctgga g t gcca

2 41 taggggg gggecaacat caccaagagc tttgccagga accacgagac aac tg ag

2101 aaac ggg tg tgc t t gaccttcgca gacccggctg a ta aacaa gatacaccct

21S gtggscaagc agaccaaaca gggcctgaag gactccaccc caggcaagcc ctgaagtg

2221 atcatcaagc a caacgg gacccaggag acca tcct. tgaaccacac cttcaacgag

2231 aegcagattg agtggaaccg g gg aga gc aaca gaatgaagga actgeaacag

2341 tga

SEQ NO: 73 Human Aco2 amino acid sequence

i rnapyaiivtr g a lgvr vaa cqra ayi ydll k ninivrk n

61 pit s v d sq l rgks lr irpdrvaragd atagraaffilgf s glak av

121 p ti b ii -s gvgg d i rakd nq v y flatag k ygv f pgs giihgiilen

181 yaypgviiig tdshtpaggg Iggicigvgg adavdviiiagi pwalkcpkvi gvkitg sg

24 pkdviik vagiitvkgg gaiv gp g d is tg ticn &g i ga t sv n

30 kkyl gr di nXad kd lv dp gc yd i i nia l p in g tpd a p

36 v vg va ¾gspidirvg lig c a s d gr a v kqalahgikc ksq titp

421 ir d gyaqi.lrdiq giv a gp gq dr d i kkg k ivt r n f tgsrn

4S1 danp« ¾ v tspeivtala iagtl p tdyltgtdgk kfrleapdad pkg dpg

541 qdtyqhppkd s gq vdv p grlqil p fdkvjdgkdle dlqilikvkg kc d i a

601 pv kxrg l dnisnr g aini gkan avpnavtqef gpvpdtaryy kk g ir r v i.

1 gda g gss r aa pr ggra ii k a i. tn k kqg p tfa dp adyn p

21 dkX iq k dr pgkpl iikhpnqtqa ti h r tqi aga al r k lq i

S ID NO: 4 Hamas TFR1 cDNA sequence (transcript i 1

1 atgatggatc ag tag t ag t t , aa t g tg g gg agaa attg atat

6 a g c gg t g g aag ag gg ga aa a g atgtgga ga gaaa

12 g gtag tg aagaagaaaa g tga a aa a aaagg aa g a aaaa aaaa

101 agg tagtg aag r. g tggg tgtg gt tt tt cttgattgga

2 4 . tt a gattg g ta ggg a - gtaaa gggg agaa c aaaae a gtg g aga

301 ctggcaggaa ccgagtctcc agtgagggag gagecaggag aggact cc tg agcacg

361 cg tata t gggatgacct g a gagaa ag ttgt.cggaga aa tgga ag cacagacttc

421 accggcacca tcaagctgct g atgaaa tca tgtc ct g tgagg tg tcaa

481 aaagatgaaa at t .gcgt gtatgttgaa aat.oaatt.tc g g a . aa actcagxaaa

341 g tgg g g at aa attt gttaaga t caggtcaaag acagcgctca aaa ggtg

601 a atag g ataagaacgg a t gt tacctggtgg a aa t c gg gggttatgtg

661 gcgta a a aggctgcaac agttac^ggt aaac ggt c atgc .a tt ggtacta

721 a a a t g agga tta a c ct gtg aa gg tc a t gtga t t cagagcaggg

"'8 aaaatcacct ttgcagaaaa gg tg aa gctgaaagct taaatgcaat tggtgtgttg

841 a ata a kgg accagactaa ttccc t g a g ag aact a t fcttgg cat

9 1 gctca c gg ggacaggtga c tta aca ggatt ctt c caa aca tcag

961 i a a t g a aggat^gcct aa i:a g ag ca t i gag

1021 c gcagaaa ag gtttg gaat ggaa ggagactg^c t c tg gaaaacagac

1081 taca gt gg ggtaa tcaga gc ag tgtg agctcactgt g g aatg g

1141 ctgaaagaga taaaaattct taaca ttt ggagtta a aaggctttgt agaaccagat

1201 acta gttg tagttggggc ccagagagat gcatggggcc ctggagctgc aaaatccggt

1261 gtagg a ag ct - c atr, g aaa -gcc agatgt cagat-atggt aaaagat

1321 gggtt gc ag agaag atta tt g agttgg gtg gg ag tgga g

1361 gttggtgcca c gaatggc agagggatac ttcgt c tgca taaa ggctttcact

1441 tatattaatc tggataaagc ggttcttggt accagcaact tcaaggtttc tgccagccca

501 ctgttgtata cg ttat .ga gaaaacaatg caaaatqtga agcatccgg". tactgqgcaa

1561 tttcc.atatc aggacagcaa ctg g cag aaagttqaga aa acttt agacaa g t

1621 gctttccctt "ccttgcata tt .ggaat ccagcaqttt ctttctgttt ttgcgaggac

1661 acaga at crtatttggg taccaccatg gacaccr.ata aggaactgar. tgagaggatt

1 41 cctgagttga acaaagtggc acgagcagct g agagg g ctggtcagtt cgtgatt.«taa

1301 ctaacccatg tgttg tt gaacctggac atgag ggt ac cag c ctg tt

13 1 t c gaggg ctgaacca 'c gagca gac a gg a tgggc a -

1 21 tggc gtat gct agac tct c cgtg actt ccagactaac aacagatttc

1 gggaatgctg agaaaacaga aga ttg t atgaagaaac t aatga t g tgtca g a

2041. gtggagtatc acttcctctc tcccta s ct ca aag ag ctc c ga gt

2101 ttc gggg " ccgg ca a gctg ca gctt ac gg agaacttgaa a tg g aaa

2161 aa ataa g g g t t;; a a tg aacg t;g t ag aac a g g g t;c; ag t; tgg

2221 a ca t agg gagctgcaaa tg tctc ggtgacgttt gg cat g caa^gagttt

2201 aa

SE D NO: 75 Human T cDNA se x

I a g tgga c a gc gat agcattc c ac gtttg g ggaga c a g ta

6 acccggt c g ggctcg gc agtag ggcg a ca g tg gga ga g a ct

2 g gtagatg aagaagaaaa tg tga aat aa a aaagg c aatgt ac aaaa aaaa

81 g gtagtg gaagta tg a gggac attgc gtg cgtctt t cttga tgg

24 t atgat g g tac ggg c attg taa a ggggtagaac caaaaactga gtgtgagaga

3 1 ctggcaggaa c gag ct c agtgagggag gagccaggag agga ccc .gcagca g

36 cgcttavstt ggga gac v gaagagaaag t g cggaga aactggacag acaga v

421 accggcacca tcaagctgci. g tgaaa tca gtcc c g gagg gg tcaa

481 aaaga^gaaa at tg g-c gtatg^tgaa a a c gtgaa aa ac cag aaa

1 g ctgg g g atcaacattt tgttaagatt aggt aaag a ag g t a a ct gg g

a catag g ataagaacgg aga t gtt tacctggtgg agaat tgg gggttatgtg

661 gcgtat; g a agg gcaa agtta ggt aaactgg atg t; attt t;ggta a a

21 a g tttg g ttt ca . tg g atggat agtg t g cagagcaggg

IS aaaa acc tgcagaa a gg g aaa gctgaaagct aa tgcaa tgg g gt g

841 a ata a gg a aga taa attteccatt gt aa g ag aa ttt att tgga a

901 gct a ctgg ggacaggtga cc tt c ca ctgg ttcc ctt cttc caca tc g

961 tttccaccat c cggtc c aggattgcct aa ata g tccagacaat c ccagag t

1021 g tgc ga a agctgtttgg gaatatggaa ggaga gt c c g ct ga aacag

1061 ta a g ggatggtaac t agaaag a g a a g v tg" gagcaa g g

1141 ctgaaagaga taaaaattct taa a ttt ggagttatta aaggctttgt agaa agat

1201 cactatgttg tagttggggc ccagagagat gcatggggcc ctgg g tgc a atccg t

12S1 gtaggc g c ct ctat gaaac tgc c g tg ct cagatatggt cttaaaagat

1321 ggg v tc gc c g aga g at atct t gc ag v gga gtgctggaga ctt gga cg

13 1 gttggtg a c ga tggc gagggata ctttcgtccc tgcatttaaa gg tt c ct

-141 tatattaatc tggataaagc ggttcttggt accagcaact t aaggttt og ag cca

1501 ctg gtata g tta ga gaaaacaa^g caaaa ga agca c g t ac .gggcaa

IS&l tt c atat agga ag aa gg agc aaagtvgaga aga a gct

1621 g ' c c tccttgcata c ggaa ccag ag t tg gagga

1601 a aga tat tta ggg ta ca g cac ta aggaactgat gaga gatt

i~¾l tgagttga aoaaagtgge a gag ag t gcagaggtcg c~ggtcag~t- cgtg aaa

ISO ctaacccatg a gttg att gaacctggac tatgagaggt a aacagc a a tg t a

tt g gagg a ctgaa ca ata aga a ga a aaagg aaa ggg gagc.vSac¾g

1 21 tgg -gtat" c g tcg -gg gsctt t c cgtg ctt ccagactasc aa aga tt

& i gggaatg g agaaaacaga ag t tgt atgaa jaaa aatga g tg ca gag

2041 g ggagta c actt c tc cc tacg a tctccaaaag agtctc t ccgacatgtc

2101 ttct gc cc gc t a c ctgcc gct.tt etgg agaa tg a actgcgtaaa

2161 caaaataacg gtgcttttaa tgaaa .g t tt agaaa a gg t ag ta ttgg

2221 actattcagg gagctg aa tgccctctct gg ga gtt" gggacattga caatgagttt

22 1 aa

SEP I NO: 76 Hitman TF amiao acid e te ce

1 ffi q a rs a g trfsiarqvd g r hv av na n nt anv p

61 r sgsi ygt aviv ig f ig gyc gv pkt r lagtespvre epgedfpaar

121 rlyvd i rk la l stdf tgt lnen preagsq kden ve nqfrefklsk

S v dq v i v sag v iivdkrsgrlv iv n ggyv ayskaatvtg k v a g k

241 kgfediytpv agslvivrag ki kvan a slnaigv i dqtk i v aels rgh

301 a i d pgfpsfnhtq fppsrssglp aip q i ra aae fgn e gdcpsdviktd

301 kavkltvsnv k iki iii gvikg v p vg qrd awgpgaaksg

vg-ca iik a q kd gfqparsiif a sagd gs vga l g isslhikaft

401 yinidkavlg t r kvsa p ll li k qrivkhp gq kv k tldra

54 afp laysgi pavsfcfced td p t x dtyk ri pelnkvaraa asvagqfvik

601 Ithdveinld ry qi s fvrdlnqyra dik agi q s rgd rat ttd

6 gr kt r v k lrdr r v y spyv sp sp r v gsgs t p ali rs klr

fZl qrnga ne i rn iaiat i gaa a s g v did :

I atggagcggc igggg ci attccagaga gcg aaca tg ccc aag t ctc cag

1 a gtc a agcgtgtqga agg cc gg aaagggcacc tgqaggagga agaggaagae

121 ggggaggagg gggcggagac a q ctgcccca ^ggagctgag ggg cc gag

181 c ggg " aga ag gcagc aaa ctca"~ccct ggg gg ag aggacgqagg

241 cta ggg

301 ta g . cg gggtc C .g c cagg g tgcggaqact g ggt aq gag

3 1 ga g -caa gag .qa gg tt a agggca ga ctac g gagcg ct

421 agg catg "cctgcagtt f,gggggag qqg g qg aggacacca" cagg aac

4 ag t ggg aa ggg gg aggct gg ggga -ggc g ctctgactca gga tt g

541 g ggcg cc g gaa g gga g g ggac g acg a a gtgggg g

1 a "t gg at gg t a caa a c g tggg gatgaggc ggg agg

€61 ggagagcagc -gc gc~gg ggaccctgac qt ~ta .qc ~ c .acagcg catcgg aa

" 21 gtcacgggag agctggtgta ogcccactac gggoggcccg aagac gca ggacc g gg

"'8 gccaggggcg tggatccagt gggccgcctg ctgctggtgc gcgtgggggt ga cag ttc

841 gcccagaagg tgaccaatgc caggac t ggggc aag gagtgctcat a ac aga

501 ag gga tc c cagga ccac ca g cca cctg ag gg ag gta

961 gg catg gc a gggaa tggagacccc tacaca tg gcttccctlc c caatcaa

1021 acccagttcc t cagltg atcatcaggc t cccagca tcccagccca gcccat ag

1081 g gac tg cc c cgcc gctgagqaag .caaagg c ctgtggcccc ccaagaa^gg

1141 ggggagcc t ggc ccctta c c gggcc cg gg a gact gcggctagxg

1201 g caacaa c a agg c t c c catc aaca catc tcggctgcat cga gg cgc

1261 tcagagccag atcactacg^. tg ca ggg gcccagaggq a gca gggg cccaggagca

132 gctaaa~ccg tg -gqgga ggct ctc gg ag tgg tg gga ctt - c t ~ a g

1381 g gag aacg q cgqcc c g agaag c t a ag gga gg gg gac

1441 ggaaqcg tggqctccac ggagtgqcta gaqggctacc cag g gct gcacctcaaa

1501 g gta gt a g gc gga aa gca g-cgctggggg atgacaagtt tgc aag

156 accagccccc gaca g tct gag g gtc ga ag ggtgga ttctccoaac

182 acag gggc a a tc c a tgaa ggtg g gttca ca c cagc g ggatgctgag

g ga g c t cca . gga ag ag g a - tca gg c t.g gggagr,

174 i cctg cg -cg ag~ -ctc "~ tatggaggac gaccaggcc" ac ea tcct goacacaaaq

180 gaggacactt a gagaa c gcataaggtg gcaaggc gcctgcccgc cgtggcscag

1861 gccgtggccc agctcgcagg gcag ctc atccggctca gccacgatcg cctgctgccc

1 21 ctcgacttcg c gctacgg gga gtcgt ctcaggcaca t ggaac ". caacgagttc

1901 tctgqggacc ".caaggcccg cgg ctgac ctgcag".ggg tg".actcggc g ggg gga

2041 taca".ccggg cggcggaaaa gctqcggcag gagatc".aca gc".cggagga gagagacgag

2 10 gact a ac goatgtacaa cgtgcgcata atgcgggt .gg agt .c ac t c tt c cag

2 £1 tacgtglcgc cagccgactc c g i g c a t ca tgggccgtgg gac ac cg

2221 ctggg gc c g tgg a c g gg cg c g gc cca acagct gq ga cccggg

2201 g ca tc c ccactggctt aqgagagc cgtt^ccggc g^cagctagc cctgc cac

2341 tggacgctgc aaggggcagc aa gcg agcggggatg c ggaaca t ga aacaa

2401 ttctga

SEQ I NO: 78 Human TFR2 amitio acid se i-c (isoform i j

1 ro q agglsprssg tvyqrvegpr g i ¾ d g¾ ga iah fcpffi¾lrgpe

61 pigsrprqpn ip a ag r a pylvl li ga llg yva g cqa cgd v vvs

121 d d q a f g g q ir - r rvag g~a altqdi r

181 al r d -d yvg i q pdpahp t ag g p i qpd v cp ign

241 v g lv a y grp d lr argvdpvgrl llv vgv sf a kv aq gaqgvl p

3 1 padfsqdppk p si qqav g v lg g p y^pg£psfnq q pp sg Ip ipaqp

36 a ia llrk I gpv pq qgs gspy Igpgprlrlv vrs t tpi nn gci g42 s pd y v ig aqrda pga aksavg ai lvr s v s rprrs llriswdggd

48 f vg l ¾gy vlh vyv ldrta vlgddkfhak spll ii¾ ikqvd p

5 sg t qv v sp s da virp p ss ta V g av s d dqaypfdhf,k

5 0 dty ni kv Iqgrlpavag avaq aqql rlshdrXip idfgrygdvv ir ignln

66 gd kar i q v sargd yiraaekirq ®i ss ¾rd l t x nvr rv f flsq

721 yvspadspfr grgd " ga ahlr sn gtpg at g g rfrrq a

7 1 ¾rtlqgaaaal f .

I N ; 79 F 2 cDNA sequence (transcript v ri i ?.)

1 atgg cg t ga t agga a v - g gcg gcg -cc g agaag . gga a gtg

tgga cga a g a a gt gggg tg aa t cggat cgg teac caaca ctg

12 gggt g atgaggccgg ga gg gg gag gctg cgctggagga cc scgtc

18 t t ccc scagcgceat ggcaa g a ggg gag tgt e a acggg

S5 24 gg c gaag ac tg gga c c gg aggggcgtgg a~ccagtggg c g tgctg

301 tgg -gcg g "ggggg-gat ag t g agaagg ga atg ggac v - ggg

361 g csagg g g a ata ccagag ca gcggac c cccaggaccc ac caagc

42 agcctgtccd g agcagg agtgtatgga a gtg acc ggaac gg agacccctac

481 ac tgqct tcccttcctt c t aa cc cagttccctc c gttgc a gg ct

20 541 c g a c g c at g .gc gaca S gcct cccgc .gct g g g

0 aa ggc c g tggcccccca agaatggcag gggagcctcc taggctcccc ttatcacctg

661 ggccccgggc a gac gcg gctagtggtc aaca caca ggacctccac ccccatcaac

721 gc catcga aggccgctca gagccaga^c acta g gt a cggggcc

781 g ggga g ca ggggc ggag agct aaa ccgc g tggggacggc a ct g

25 841 gagctggtgc ggacct tt ctc at gtg agca cggc tc gg cccg cagaagtctc

901 c ctt a ca g gggacgg ggtgac t ggaagcgtgq gctccacgga gtggctagaa

961 ggctac -ca g g -gctg a ct aaagc g agtgta g tgag gga aacg ag g

1021 ggggg g ac agtttc g aaga ag c ga aag t a gagag :

1081 qtcctgaagc ag gga c tcccaaccac g gggc g tctc tga acaggtgg^g

30 1141 t acca t agc ggga gctgagg g a cgg c a ca gga cagcagtgcc

1201 ttcc ca cgg ctttg ggg g ccct gccgtcgagt tct c ttat ggagg g c

1261 c ggcc acc c tcctgc cacaaaggag ga ac tatg agaacctgca taaggtgctg

1321 aagg g c tg cgc ggc aggcc gtggcccagc tcgcagggca gctcctcetc

1381 cggctcagcc a ga cg c" gctgcccctc gacttcggcc gctacgggga cg cgt c

35 1441 aggcacatcg gg acctc cgag ctct ggggacctc® aggcccgcgg g tgac c g

1501 cagtgggtgt a ggcgcg gggggactac atccgggogg cggaaaagct gcggcaggag

1 6 atctacagct cggaggaqag agacgagcga ctgacacgca tgtacaacgt gcgcataatg

162 cgggtggagt cctacttect ttcccagtac gtgtcgccag ccqactcccc gttccqccac

168 atcttcatgg qccgtggaga ccacacgctg ggcgc gc tgqaccacct gcggctgctg

40 4 cgctccaaca g ccggg c ccccggggcc acctcctoc® c ggc tcca ggagagocgt

1801 ttccggcgtc agctagccct gctcacctgg acgctgcadg gggc g caa tg g g

1361 gggga gtc . ggaa a ga taa ac c ga

SEQ NO: 80 a TFR2 ammo add sequence s f r 2)

45 1 s tq alsrqklcihv dt vg q fpdp p tl vdeag vg eqip sdpd

61 cpysaiq v tgalvyahyg rpedlgdlra 1 ivrv i s qkv raqdfg

21 aqgvliypep adfsqdppkp l qqavyg vl gtgdp t g p xtqt qfppva g

81 p ipaqpi d aiasriirkl gpvap g igspy gpgpilrivv

241 i g i gr d yvviga qrdawgpgda avg aill ivrti nv g rpr si

50 301 i dggd svgst gyl hlka vvyvsldnav gdd akt p llt

361 lkqvdspn gg - y qvv ft psw a v irp lp d a y ta vgvp v .f. a dd

421 qayp l dt nlhkv qgrlpavaqa vaqlagqlli rl.shdrllpl d grygdvvl

481 r i r n gdikargl^i qwvysargdy i aa klrq iyss rd r ynv

4 1 rv y sq vspad p i ngrgd ti galid ril rsns g pga ts g g sr

0 rr a i tlqgaanais g v ni nnf

S . : . . g > g.

I atgac g tg ac aggag gaaaaggagt agctcggaga ggaggaagga gaagtcccgg

1 ga tg gcg ggtgecggcg gagcaaggag acggaggtgt t ta gag t gg a gag

1 2 1 ctgcc ctg caca gt gagc cc a ctggacaagg c atca gcga gg a.

1 8 1 atcagcttoc gegaa ca aagct cctcag tt gctctgaaaa cgag~ccgaa

2 4 1 g gaagctg accagcagat ggacaact^g acc gaaag c tgg g g tttca tg

3 0 1 gtgg gac aagatggcga g c gt agaaa aca cag aa gtt a ggga

3 1 t cac gg ggag f,aa aggaoatag" at x gact cactc cc ctgcgaocat

42 1 gaggagattc g gagaa ct gag - t aaa aatgg tg g v - tgggaa aaaaagoaaa

g atg cagagcggga c tctt a agg g ag g acggt ac aa agagg

5 4 1 g ac gt a scctca c ag ca tgg aagg tt c t acgg aggtgaaa

SO g ra aa ac g t acaa agr c g grgg aaggag c c tg t tcc€61 tgc -cat a "catg g -ga a aat ag ca ca -cc a a gga a - c c -ggat

" 2 1 agcaagac c gagccg cacagca g ga a gaag "cacctactg tga gacag"'8 a c agaac tgattggtta c c tgag gagctgcttg gc gctc g c a gaa ttc

8 4 ac atg c tagact ga a a gac aa ag acc gaact g g caccaagggt

50 caggtagtaa gtgg c gta cgga g c gcaaagcatg ggggctacgt gtggctggag

9 6 acccagggga gg c ta c cgc aacctgcagc cccagtgcat catgtgtgtc

102 aactacgtcc tgagtgagat g gaaga gacgtggtgt tct ca gga ccagactgaa

108 1 ccctg ca agccccacc^ gatggccatg a ag atc ttga^agcag ^.ggcaagggg

1 14 1 gc gtg - g ag ag gta c c -a c a g taa ggagg gc cg ggagc g

120 1 gcccag gg t cc c c aggagacgcc atcatctctc tggatttcgg gaatcagaac

1 2 6 1 cgaggag c ag c a tggcaaggcc a cc gc c cgagccagcc atgggccacg

1 32 1 gagttgagga g a ag a ccagagcgag g -gggag tg gcctt ca cgtgc

138 1 agg ag g ggg a ca a c ag i:g a a g ag ag ag ag tg c

144 1 acgcc aa a g cc gaaga ctattacaca tc ttggax acga c gaa ga gaag g

1 5 1 a gagaagc g ggacacagag gccaaggacc aatgcag a c aga gga

156 1 tcaa gagc tgg ct g gaca ggca c ta atc c a gg cgg ggaaga c

621 cagctaagcc &t tq c cgaggagcgg t ttgg gg agaacccaca gtccaccccc

1 6-8 1 cagcactgct t agtg gacaaacatc ttccagccac tgg tg agccccgcac

174 1 agtc c~ -cc t .gga ~aa gttt ag ag cagctggaga gcaagaagac agag gag

180 accgg ca tg ctcca cttc tg t gccggaagc® aagoatccct gccaccgtgc

1 8 6 gtggc agg coagcacccc tctctcttcc atggggggc® gatscaatac cc gtggcc

1 2 1 ccagatccac atta attt tgg c cac gtgg g t gggat a gcgcacagag

1 0 1 ttct".gggag cagcgccqtt gggqccccct gtctctccac cccatgtctc cac tt aag

204 1 acaaggtctg agggt tggqgctcga ggcccaqacg tg gagt ggccatggta

0 gccctctcca a a gc gaa gctgaagcga oagctggagt atgaagagca agcc t cag

2 £ 1 gac g g g ggggggaccc ac ggtgg ag ac c at g tgtg gaaa gg g

222 1 aagaacctca ggggtgggag c t c a g ggaca agccactgag cg aaa gta

220 1 c aa gata agttcaccca aaacccca^g aggggcctgg ccatcccc gagacatctg

234 1 c c gccac gcctcc c t ccatca cccggggaga acagcaagag cagg tccc

2 4 0 1 a ag g t acg a cc g tacc gga ag c gt cg c g c a caaggtgtca

ggca -gg aa gccggc~gct gggcc tca ttgag -cct acctgctgcc cgaa -g ac

252 1 aga~atgac" g gagg gaa g gcc g g ctgggaagct c acgctc - gcaaggaggg

2 5 1 ga c; cct a gag gga aggc a c; ga

E I NO: 82 Human i a amino acid sequence

1 nt a r a d aar r t y a a p svss idkasiraria

6 1 xx k l ssv s n ¾¾ lkal g ia w t i i «ni s »g

1 2 1 qv¾ g if pc h ir ni lk ng s gkk k s t r i f ff r ftk tvtnrg

8 r vrs sa kvl c gqvk v nnc p n s Icgyk*plls clii p iq p dip l

24 tf sx sro d k ycddr i Iig p llg rsay : s n t ks qrs tkg

3 1 qvvsgqyrmi ak gyv e tqgtviy:npr n qp qcii yv e i k . q

361 s kp i arr na d g q s sn f t k a p e a ap gpgda d f qr:

421 s ayqka iXpp p r.s s q sa ags p a tvp qaaapgsttp satsis.ssscs

481 prtsp d t slds iiki i k ar d t kdqcstq -d naXd i tla p yip dg d

1 ls icp ¾r XX rp p q c fqplapvaph p f ak gq kkt p

1 h agska .pp g aapp l g rs tq p pdpp gp t k¾ravgdqrr,<r:

661 gaap igpp v pp vst traaiegfgar gpdvlapar a an i lkr q ya q f

721 dlsggdppgg r krlrgg s p l k a rrv pnd rg lghp r l

? i p p ppsfii pgeiiSksrfp pq ya q qd y s a s g a rl gp . fe s l it

841 rydc v vpv Igsstllqgq dllraldqat

S I : Human PTGS2 cDNA sequence

1 . atgctcgccc c cc t gc qtq gcq gt ggcg agca st ct

tgc gtt c e a g -ca aaaccgagg" gtatg tga g~gtggga~ tga gtat

121 aagtgcgat" g ac cggac agqa tc ggagaaaact gc aa acc ggaatttttg

181 ac agaa a a t at tct g aac cact caa ca ag g ctacat ac ta cac

241 caaggqat tttq a gt g gaa a c at c ttc t gaaat aattatgagt

301 . tg gt .ga catc agat c t.tg tt gacagtccac c a tt caa tg gacta .

361 ggctacaaaa g tgggaag ct t fca c tc cct t a tag cc tcctc

421 g gc tga g attgcccgac cc ttgggt gtcaaaggta aa g agct tcctgattca

481 tg ag tg a a gcttc a ga aga agtt a tccc atcc c gggc c

541 catga gt tt c ttc tgcc gcac t cgca ag tt -tc gacag tc

601 aagcgagggc c gc t ca caacgggctg ggccatgggg tgg ct aa tcatatttac

661 qg g aaac c tggc ag a a gcgtaaactg gcc ttt agg gaaa a tgaa at

721 agataa - g atggagagar.. gtate.ct.oce a gt aaag ata agg agagatgar.-c

781 ix aagi:cx:ctga g t ;-cgg tci:gctgtgg ggcaggaggt : tggt ;

41 gtgc gtc tg gatg a gccac tc tgqctgcggq aaca cag aq atg ga

01 gtgc a c aggagcatcc tgaatggggt ga g c g tgttcc ga aagcaggc

961 atactgatag gagagactat taagattgtg a tgaaga t a gtg aaca cttgagtggc

1021 tatcacttca aa tgaaa tga agaa tact ttca acaaacaatt c agta caa

1081 aatcgtattg tg tgaatr, taacaccctc tatcactggc atc c ttct gcctgaeacc

1141 -ttcaaa -tc atgaocagaa atacaactat a cagtt tctacaacaa c -ct a ta g

1201 tggaa atg gaattaccca gtttgttgaa tcattcasca ggcaaattgc ggcaggg t

1261 gctggtggta ggaatgttcc acccgcagta sagaaagtat ca aggctt cattga c g

1221 agc qg aga ".gaaatacca gtc".tttaat gagtaccgca aacgcttta". gctgaagccc

12 1 tatqaatcat ".tgaagaact tacaggagaa aaggaaatgt ctqcagagt". ggaa cact

1441 tatqqtgaca tcgatgctgt ggaqctgtat cctgc tc tqqtagaaaa gcctcqgcca

1¾ 1 gatgccatct tt.ggtgaaac catggtagaa g tggag cat .c cc t gaaaggactt

I5 atgggtaatg at tg tc tc fcgc ta gg agcc a gcacttttgg tggagaagtg

1 21 gg- t a a tcatcaacac tg t a cagt c ca -c g a 'c cgtgaagggc

1 31 tg-c ttta ag tg aga ccagagctca ca c t

1741 gcaagttctt cccg ccgg actagatgat atcaatccca cagtactact aaaagaacgt

i¾ 1 t gactg a c tgtag

SEQ I NO: 84 Human PTGS2 amino acid s qu nc

1 ii rall c vla tanp cc shp qx rg v vg qy dcx r gfy g rsc stp l

61 r pt p tv yi t ip ai yv t r li dspptyjiady

121 g k ea f r l tralpp vpdd p -plg vk.gkkq.Ipds veklllr rk lpdp g

181 ffi a q ktd krgpa -ng g gvdln g t a rqrkl r kdg r k

241 q iidg x pp tv dt q a i yppqvpehlr vgq v vpglsurrvyati

301 vlkq¾hpev;g d qi qts ilige^ikiv i dyvq l q y klk dp¾ l rikq fqyq

36 ri a i i y p i i p i t q i d n q iyrsas i l i g i t q v r q i g r v42 aggrnvppav gkvsqasldq r r p y s i g ke ai4 8 g d i i a y v k rp a g vg p s l g wkpsst g g e v

i i i i i c n v g c f t s v p e i. t v t n a s s r s t0 s l

Human succinate dehydrogenase

Human ferritin

Lipid reactive oxygen species

1) Decreased conversion of cysteine to alanine or methylene blue

2 induction and/or promotion of mitochondrial dysfunction:

a.) Decrease in aconitase copy number, amount, and/or activity

b) Decrease in succinate dehydrogenase copy number, amount, and/or activity

3) Induction and/or promotion of iron regulatory protein dysfunction:

a) Decrease in ferritin copy number, amount, and/or activity

b) Increase in transfcrrin-receptor copy number, amount, and/or activity

c) Decrease in if a pha copy number, amount, and/or activity

4) Induction and/or promotion of ferroptosis

a) increase and/or accumulation of lipid reactive oxygen species (ROS)

b) Increase in PTGS2 (COX2) copy number, amount, and/or activity

* included in Table 1 are RN nucleic aci molecules (e.g., thymines replaced with

uredines), nucleic acid moiecuies encoding orthologs of the encoded proteins, as well as

DNA or RNA nucleic acid sequences comprising a nucleic acid sequence having at least

80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,

95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the

nucleic acid sequence of any SEQ D NO listed in Table , or a portion thereof. Such

nucleic acid molecules can have a function of the full-length nucleic acid as described

further herein.

* Included in Table 1 are orthologs of the proteins, as well as polypeptide moiecuies

comprising an amino acid sequence having at least , 8 %, 82%, 83%, 84%, 85%, 86%,

87%, 88%. 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more

identity across their full length with an amino a id sequence of any SEQ ID NO listed in

Table , or a portion thereof. Such polypeptides can have a function of the full-length

polypeptide as described further herein.

II, Sub jects

la one embodiment, the subject for whom cancer treatment is administered or who

is predicted likelihood of efficacy of an anti-cancer therapy (e.g. , iron-sulfur cluster

biosynthesis pathway inhibitory therapy) is determined, is a ma ma (e.g., mouse, rat,

primate, non-human mammal, domestic animal such as dog, cat, ow, horse), and is

preferably human.

In another embodiment of the methods of the invention, the subject has not

undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or

anti-cancer therapy (e.g., iron-stilmr cluster biosynthesis pathway inhibitory therapy) n

still another embodiment, the subject has undergone treatment, such as chemotherapy,

radiation therapy, targeted therapy, and/or anti-cancer therapy (e.g., iron-sulfur cluster

biosynthesis pathway inhibitory therapy).

n certain embodiments, the subject has had surgery to remove cancerous or

precancerous tissue. n other embodiments, the cancerous tissue has not been removed,

e.g., the cancerous tissue may be located in an inoperable region of the body, such as in a

tissue that is essential for ife, or in a region where a surgical procedure would cause

considerable risk of harm to the patient.

The methods of the invention can be used to determine the responsiveness to anti¬

cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy) of many

different cancers in subjects such as those described above n one embodiment, the

cancers are hematologic cancers, such as leukemia. In another embodiment the cancers are

solid tumors, such as lung cancer, melanoma, and/or renal ceil carcinoma. In another

embodiment, the cancer is an epithelial cancer such as, but not limited to, brain cancer (e.g.,

glioblastomas) bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic

cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer,

ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer.

II . Sample Collection. Preparation and Separation

In so e embodiments, biomarker presence, absence, amount, and/or activity

measurements) in a sample from a subject is compared to a predetermined control

(standard) sample. The sample from the subject is typically from a diseased tissue, such as

cancer ce s or tissues. Th coturoi sample can be from the same subject or from a different

subject. The control sample i typically a normal non-diseased sample. However, i some

embodiments, such as for staging o disease or for evaluating the efficacy of treatment, the

control sample can be from a diseased tissue. The control sample can be a combination of

sample from several different subjects. n some embodiments, the biomarker amount

and/or activity measurements) from subject is compared to a pre-determined level. This

ed level is typically obtained from normal samples, such as the normal copy

number, amount, or activity of a biomarker in the cell or tissue type of a member of the

same species as from which the test sample was obtained or a non-diseased cell or tissue

from the subject from which the test samples was obtained. As described herein, a "pre

determined" biomarker amount and/or activity measurements) may be a bio arker amount

and/or activity measurements) used to, by way of example o ly, evaluate a sub jec t that

may be selected for treatment, evaluate a response to an anti-cancer therapy (e.g., iron-

sulfur cluster biosynthesis pathway inhibitory therapy), and/or evaluate a response to a

combination anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory-

therapy plus immunoinhibitory inhibitor therapy). A pre-determined biomarker amoun

and/or activit measurement ) ma e determined in populations of patients with or

without cancer. The pre-determined biomarker amount and/or activity measurements) can

be a single number, equally applicable to every patient, or the pre-determined biomarker

amount and/or activit measurements) can vary according to specific subpopitlations of

patients. Age, weight, height, and other factors of a subject may affect the pre-determined

biomarker amount and/or activity measurements) of the individual. Furthermore, the pre¬

determined biomarker amount and/or activity can be determined for each subject

individually in one embodiment, the amounts determined and/or compared in a method

described herein are based on absolute measurements. n another embodiment, the amounts

determined and/or compared in a metho described herein are based o relative

measurements, such as ratio (e.g., biomarker expression normalized to the expression of a

housekeeping gene, or gene expression at various time points).

The pre-determined biomarker amount and/or activity measurement s) c be any

suitable standard. For example, the pre-determined biomarker amount and/or activity

measurements) ca be obtained from the same or a different human for whom a patient

selection is being assessed in one embodiment, the pre-determined biomarker amount

and/or activity measurements) ca be obtained from a previous assessment of the same

patient In such a maimer, the progress of the selection of the patient can be monitored over

time. In addition, the control can be obtained from a assessment of another human or

multiple humans, e.g., selected groups of humans, if the subject is a hu an in such a

manner, the extent of the selection of the human for whom selection is being assessed can

be compared to suitable other humans, .g other humans who are in a similar situation to

the human of interest, such as those suffering from similar or the same conditions) and/or

of the same ethnic group.

n some embodiments of the present invention the change of biomarker amount

and/or activity measurements.) from the predetermined level is about 0.5 fold, about 1,0

fold, about .5 fold, about 2.0 fold, about 2.5 fold, about 3.0 fold, about 3 5 fold, about 4.0

fold, about 4 5 fold, or about 5 0 fold or greater. In some embodiments, the fold change is

less than about 1, less than about 5, less than about , less than about 20, less than about

30, less than about 40, or less than about 50. o oilier embodiments, th fold change in

biomarker amount and/or activity' measurements) compared to a predetermined level is

more than about , more than about 5, more than about 0, more than about 20, snore than

about 30, more tha about 40, or more than about 50

Biological samples can be collected from a variety of sources from a patient

including body fluid sample, cell sample, or a tissue sample comprising nucleic acids

and/or proteins. "Body fluids" refer to fluids that are excreted or secreted from the body as

well as fluids that are normally not (e.g., amniotic fluid, aqueous humor, bile, blood and

blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory

fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph,

menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat,

synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit). n a preferred

embodiment, the subject and/or control sample is selected from the group consisting of

cells, cell lines, histological slides, paraffin embedded tissues, biopsies, whole blood, nipple

aspirate, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone

marrow. In one embodiment, the sample is serum, plasma, or urine n another

embodiment, the sample is scrum,

The samples can be collected from individuals repeatedly over a longitudinal period

of time (e.g., once or more on the order of days, weeks, months, annually, biannually, etc.).

Obtaining numerous samples from an individual over period of time can be used to verify

results from earlier detections and/or to identify an alieration in biological pattern as a result

of, for example,, disease progression, drug treatment etc. For example, subject samples can

be taken and monitored every month, every two mouths, or combinations of one, two, or

three month intervals according to the invention in addition, the biomarker amount and/or

activity measurements of the subject obtained over time can be conveniently compared with

each other, as well as with those of normal controls during the monitoring period, thereby

providing the subject's own values, as an internal, or personal, control for long-term

monitoring.

Sample preparation and separation can involve any of the procedures, depending on

the type of sample collected and/or analysis of biomarker measurements). Such

procedures include, by way of example only, concentration, dilution, adjustment of p ,

removal of high abundance polypeptides {e.g., albumin, gammaglobulin, and transferrin,

etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of

denat ra ts, desalting of samples, concentration of sample proteins, extraction and

purification of lipids.

The sample preparation can also isolate molecules that are bound in non-eovalent

complexes to oilier protein (e.g., carrier proteins). This process may isolate those

molecules boun to a specific carrier protein (e.g. , albumin), or use a more general process,

such as the release of hound molecules from. all. carrier proteins via. protein denaturation, for

example using an acid, followed by removal of the carrier proteins.

Removal of undesired proteins (e.g., high abundance, uninforrnative, or

undetectable proteins) from a sample can be achieved usi g high affinity reagents, high

molecular weight filters, uStraeentrifugatton and/or e!eei dia!ys s. High affinity reagents

include antibodies or other reagents (e.g., aptamers) that selectively bind to high abundance

proteins. Sample preparation could also include ion exchange chromatography, metal ton

affinity chromatography, ge filtration, hydrophobic chromatography, chromatofocusing,

adsorption chromatography, isoelectric focusing and related techniques. Molecular weight

filters include membranes that separate molecules on the basis of size and molecular

weight. Such filters may further employ re verse osmosis, nanofiltration, ultrafiltration and

microfiltratton.

Ultracenrrifugation is a method for removing undesired polypeptides from a sample

Uliraeentrifugation is the eentrifisgation of a sample at about 15,000-60,000 rp while

monitoring with an optical system the sedimentation (or lack thereof) of particles.

Electrodialysis is a procedure which uses an eiectromembnme or semipermable membrane

in a process i which ions are transported through semi-permeable membranes fro one

solution to another under the influence of a potential gradient. Since the membranes used

in electrodialysis may have the ability to selectively transport ions having positive or

negative charge, reject ions of the opposite charge, or to allow species to migrate through a

semipermabie membrane based on size and charge, it renders electrodialysis useful for

concentration, removal, or separation of electrolytes.

Separation and purification the present invention may include any procedure

known in the art, such as capillary electrophoresis (e.g., in capillary or on-chip) or

chromatography (e.g., in capillary, column or on a chip). Electrophoresis is a method

which can be used to separate ionic molecules under the influence of an electric field.

Electrophoresis can be conducted in gel, capillars', or in a mierocharmel on a chip.

Examples of gels used for electrophoresis include starch, aerylamide, polyethylene oxides,

agarose, or combinations thereof. A gel can be modified fay its cross-linking, addition of

detergents, or denatnrants, immobilization of enzymes or antibodies (affinity

electrophoresis) or substrates (kymography) and incorporation of a p gradient. Examples

of capillaries used for electrophoresis include capillaries that interface with an electrospray.

Capillary electrophoresis (CE) is preferred for separating complex hydrop c

molecules and highly charged solutes. CE technology can also be implemented on

microfluidic chips. Depending on the types of capillary and buffers used. CE can be further

segmented into separation techniques such as capillary zone electrophoresis (CZE),

capillary isoelectric focusing (CIEF), capillary isotachophoresis (clTP) and capillary

eleetroeliromatography (CEC). An embodiment to couple CE techniques to electrospray

ionization involves the use of volatile solutions, for example, aqueous mixtures containing a

volatile acid and/or base and an organic such as an alcohol or ace o tri ,

Capillary tsotachophoresis (ei P) is a technique in which the analytes move through

the capillary at a constant speed but are nevertheless separated by their respective

mobilities. Capillary o electrophoresis (CZE), also known as free-solution CE (PSCE),

is based on differences in the eleetrophoretie mobility of the species, determined by the

charge on the molecule, and the frictional resistance the molecule encounters during

migration which is often directly proportional to the size of the molecule. Capillary

isoelectric focusing (CIEF) allows weakly-iouizabSe amphoteric molecules, to be separated

by electrophoresis in a pH gradient, CEC is a hybrid technique between traditional high

performance liquid chromatography (HPLC) and CE.

Separation and purification techniques used in d e present- invention include any

chromatography procedures known in the art. Chromatography can be based on the

differential adsorption and elution of certain anaiytes or partitioning of analy es between

mobile and stationary phases. Different examples of chromatography include, but no

limited to, liquid chromatography (LC), gas chromatography (GC), high performance liquid

chromatography ( .PLC) etc,

V. Biomarkcr Nucleic Acids and Polypeptides

One aspect: of the presen t invention pertains to the use of isolated nucleic acid

moiecuies that correspond to biomarker nucleic acids that encode a biomarkcr polypeptide

or a portion of such a polypeptide. A s used herein, the term "nucleic a id molecule" is

intended to include DNA moiecuies (e.g., cDNA or genomic DNA) and RNA molecules

(eg., tnRNA) a d analogs of the DNA or RNA generated using nucleotide analogs. Th

nu lei acid molecule can be single-stranded or double-stranded, but preferably is do ie-

stranded DN A.

An "isolated" nucleic acid molecule is one which is separated from other nucleic

acid moiecuies which are present in the natural source of the nucleic acid molecule.

Preferably, an "isolated" nucleic acid molecule is free of sequences (preferably protein-

encoding sequences) which naturally flank the nucleic acid {i.e. , sequences located at th 5

and 3' ends of the nucleic acid) in the genomic DNA of the organism m:which the

nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid

molecule can contain less than about 5 kB, 4 kB, 3 kB, 2 kB, 1 kB, 0.5 kB or 0.1 kB of

nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of

the eel! from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid

molecule, such as a cDNA molecule, can be substantially free of other cellular material or

culture medium when produced by recombinant techniques, or substantially free of

chemical precursors or other chemicals when chemically synthesized

A biomarker nucleic acid molecule of the present invention can be isolated using

standard molecular biolog techniques and the sequence information in the database

records described herein. Using all or a portion of such nucleic acid sequences, nucleic

acid molecules of the invention can be isolated using standard hybridization and cloning

techniques (e.g., as described in Sambrook e l. ed Molecular Clo i g : A Laboratory

Manual, 2nd ., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

A nucleic acid molecule of the invention can be amplified using cDNA, R , or

genomic DNA as a template and appropriate oligoiiueieotide primers according to standard

PGR amplification techniques. Th nucleic acid molecules so amplified cao he cloned into

an appropriate vector and characterized by DNA sequence analysis. Furthermore,

oligonucleotide* corresponding to ail or a portion of a nucleic acid molecule of the

i ve tio can be prepared by standard synthetic techniques, e.g., using a automated DNA

synthesizer.

Moreover, a nucleic acid molecule of the invention can comprise only a portion of a

nucleic acid sequence, wherein die fa l length nucleic acid sequence comprises a marker of

the invention or which encodes a polypeptide corresponding to a marker of the invention.

Such nucleic acid molecules can be used, for example, as a probe or primer. The

probe/primer typically is used as one or more substantially purified oligonucleotides. The

oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under

stringent conditions to at least about 7, preferably about 5, more preferably about 25, 0 ,

75, 100, 125, 50, 175, 200, 250, 300, 350, or 400 or more consecutive nucleotides of a

biomarker nucleic acid sequence. Probes based on the sequence of a biomarker nucleic

acid molecule can be used to dete transcripts or genomic sequences corresponding to one

or more markers of the invention The probe comprises a label group attached thereto, e.g.,

radioisotope, a fluorescent compound an enzyme, or an enzyme co-factor.

A biomarker nucleic acid molecules that differ, due to degeneracy of the genetic

code, from the nucleotide sequence of nucleic acid molecules encoding a protein which

corresponds to the biomarker, and thus encode the protein, are also contemplated.

n addition, it will be appreciated by those skilled in the art tha DNA sequence

polymorphisms that lead to changes in the amino acid sequence can exist within a

population (e.g., the human population). Such genetic polymorphisms can exist among

individuals within a population due to natural allelic variation. An allele is on of a group

of genes which occur alternatively at a given genetic locus n addition, it will b

appreciated that D polymorphisms that affect expression levels can also exist that

may affect the overall expression level of that gene (e.g., by affecting regulation or

degradation).

The ter "allele," which is used interchangeably herein with "allelic variant" refers

to alternative forms of a gene or portions thereof Alleles occupy the same locus or position

on homologous chromosomes. When a subject has two identical alleles of a gene, the

subject is said to be homozygous for the gene or aiiele. When a subject has two different

alleles of a gene, the subject- is said to be heterozygous for the gene or aiiele. For example,

bioma er alleles can differ from each other in a single nucleotide, or several nucleotides,

and can include substitutions, deletions, and insertions of nucleotides. An allele of a gene

can a so b a fbrin of a gene containing one or more mutations.

The term "allelic variant of polymorphic region of gene" or "allelic variant", used

interchangeably herein, refers to an alternative for of a gene having one of several

possible nucleotide sequences found in that region of the gene in the population. As used

herein, allelic variant: is meant to encompass functional allelic variants, non-functional

allelic variants, SNPs, mutations and polymorphisms.

The term "single nucleotide polymorphism" (SNP) refers to a polymorphic site

occupied b a single nucleotide, which is the site of variation between allelic sequences.

The site is usually preceded by and followed by highly conserved sequences of the allele

(e.g., sequences that vary in less than / 00 or 1/1000 members of a population). A S P

usually arises due to substitution of one nucleotide for another at the polymorphic site.

SNPs can also arise from a deletion of a nucleotide or a insertion of a nucleotide relative

to a reference allele. Typically the polymorphic site is occupied by a base other than the

reference base. For example, where the reference allele contains the base T" (thymidine)

at the polymorphic site, th altered aiiele can contain a C (cytidhie), G (guanine), or

"A" (adenine) at the polymorphic site. SNP s may occur in protein-coding nucleic acid

sequences, n which ease they may give rise to defective or otherwise variant protein, or

genetic disease. Such a S may alter the coding sequence of the gene and therefore

specify another amino acid (a "missense" SNP) or a SNP may introduce a stop codon (a

"nonsense" SNP). When a SNP does not alter the amino a id sequence of a protein, the

SNP is called "silent." SNP's may also occur in noncoding regions of the nucleotide

sequence. This may result in defective protein expression, e.g., as result of alternative

spicing, or it may have no effect on the function of the protein.

As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid

molecules comprising an open reading frame encoding a polypeptide corresponding to a

marker of the invention. Such natural allelic variations can typically result in 1-5%

variance in the nucleotide sequence of a given gene. Alternati ve alleles can be identi fied by

sequencing the gene of interest in a number of different individuals. This can be readily

carried out by using hybridization probes to identify the sa e genetic locus in a variety of

individuals. Any and all such nucleotide variations and resulting amino acid

polymorphisms or variations that ar resu lt of natural allelic variation and that do not

alter the functional activity are intend to be within the scope of the inv ntion

n another embodiment, a biomarker nucleic ac d molecule is at least 7, 5, 0, 5,

30, 40, 60 80, 00, 50, 200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1.000, i 100,

1200, 300, 400, 1500, 1600, 00, 1800, 00, 2000, 2200, 2400, 2600, 2S00, 3000,

3500, 000, 4500, or more nucleotides in length and hybridizes under stringent conditions

to a c leic acid molecule corresponding to a . marker of the invention or to a nucleic acid

molecule encoding a protein corresponding to a marker of the invention. As used herein,

the ton "hybridizes under stringent conditions" s intended to describe conditions for

hybridization an washing under which nucleotide sequences at least 60% (65%, 70%,

75% 80%, preferably 85%) identical to each other typically remain hybridized to each

other. Such stringent conditions are known to those skilled n the art and can be found in

sections 6,3 . -6.3,6 of Current Protocols in Molecular Biology, John Wiley & Sons, N,Y,

( 89). A preferred, non-limiting example of stringent hybridization conditions are

hybridization i 6X sodium chloride/sodium citrate (SSC) at about 45 , followed by one

or more washes i 0.2X SSC, 0.1% SDS at 50-65°C.

n addition to naturally-occurring allelic variants of a nucleic acid molecule of the

invention that can exist in the population, the skilled artisan will further appreciate that

sequence changes can be introduced by mutation thereby leading to changes in the amino

ac d sequence of d encoded protein, without altering th biological activity of e protein

encoded thereby. For example, one can make nucleotide substitutions leading to amino

acid substitutions at "non-essential" amino acid residues A "non-essential" amino acid

residue is a residue that can be altered from the wild-type sequence without altering the

biological activity, whereas an "essential" amino acid residue is required for biological

activity. For example, amino acid residues that are not conserved or only sem -conserved

among homologs of various species ay be non-essential for activity and thus would be

likely targets for alteration. Alternatively, amino acid residues tha are conserved among

the homologs of various species (e.g., murine and human) ma be essentia! for activity and

thus would not be likely targets fo alteration.

Accordingly, another aspect of the invention pertains to nucleic acid molecules

encoding a polypeptide of the invention that contain changes in amino acid residues that ar

not essential for activity. Such polypeptides differ in amino acid sequence from the

natu -oce trri g proteins which correspond to the markers of the invention,, yet retain

biological activity- In one embodiment, a biomarker protein has an amino acid sequence

that is at least about 40 identical, 50%, 60%, 70%, 75%, 80%, 83%, 85%, 87,5%, 90%,

, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to the amino acid sequence

of a biomarker protein described herein.

An isolated nucleic acid molecule encoding a variant protein ca be created by

introducing or more nucleotide substitutions, additions or deletions into the nucleotide

sequence of nucleic acids of the invention, such that one more amino acid residue

substitutions, additions, o deletions are introduced into the encoded protein. Mutations can

be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated

mutagenesis- Preferably, conservative amino a d substitutions are made at one or more

predicted non-essential amino acid residues. A "conservative amino acid substitution" is

on in which the amino acid residue is replaced with an amino acid residue having a similar

side chain. Families of a ino acid residues having similar side chains have been defined in

the art. These families include amino acids with basic side chains (e.g., lysine, arginine,

histidrae), acidic side chains (e.g. , aspartic acid, glutamic acid), uncharged polar side chains

(e.g. , glycine, asparagine, giuta.oii.oe, serine, threonine, tyrosine, cysteine), non-polar side

chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine,

tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic

side chains (e.g., tyrosine, phenylalanine, tryptophan, histidirte). Alternatively, mutations

can be introduced randomly along all or part o the coding sequence, such as by saturation

mutagenesis, and the resultant mutants can be screened for biological activity to identify

mutants that retain activity. Following mutagenesis, the encoded protein can be expressed

recombinantly and the activity of the protein can be determined,

n some embodiments, d present invention further contemplates the use of anii-

biomarker antisense nucleic acid molecules, i.e., molecules which are complementary to a

sense nucleic acid of the invention, e.g., complementary to the coding strand of a double-

stranded cDNA molecule corresponding to a marker of the invention or complementary to

an ra A sequence corresponding to a marker of the invention. Accordingly, an antisense

nucleic acid molecule of the invention can hydrogen bond to (i.e. anneal with) a sense

nucleic acid of the invention. The antisense nucleic acid can be complementary to an entire

coding strand, or to only a portion thereof, e.g., ail or part of the protein coding region (or

open reading frame). An antisense nucleic acid molecule can also be antisense to a l or part

of a non-coding region of the coding strand of a nucleotide sequence encoding a

polypeptide of he invention. The non-coding regions ("5' and 3' untranslated regions") ar

t e 5' and 3' sequences which flank the coding region and are not translated into amino

acids.

An antisense oligonucleotide can be, for example, about 5, „ , 0, 25, 30, 35

40, 45, or 50 or more nucleotides in length. An antisense nucleic acid can be constructed

using chemical synthesis and enzymatic ligation reactions using procedures known in the

art. For example, an antisense nucleic acid (e.g., a antisense oligonucleotide) can be

chemically synthesized using naturally occurring nucleotides or variously modified

nucleotides designed to increase the biological stability of the molecules or to increase the

physical stability of the duplex formed between the antisense and sense nucleic acids, e.g.,

phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of

modified nucleotides which can be used to generate the antisense nucleic acid include 5-

f iorourac i S-broroouraci!, 5-ehlorouraeil, 5-iodouracil, hypoxanthine, xanthine, 4-

aeety!eytosine, 5-{carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-

thiouridine, - arbox rn t la ino iet aci , dihydrouracii, b ta-D- a actosyk uco inc,

inosine, N6-isopentenyladenme, -n ethyig ai ir , - h inosir , 2,2-diniethylgnanine,

2- methyladentne, 2 ed y guanine, 3-methylcytosine, 5-methylcytosine, 6 adenme, 7-

methylguanme, 5-methyiaminomethylnraeil, 5-niethoxyaminomethyi-2-thiouracii, beta-D-

mannosylqueosine, S'-methoxycarboxymethyiuracii, S-methoxyuracil, 2 methylthio N6

isopcntcnyladenine, uractl-5-oxyacetic acid (v), wybutoxosine, pseudouraciJ, q eosi , 2-

thiocytosine, 5-methyl-2-thiouracil 2-ihiouraeil, 4-thiouracil, 5-meihyluracil, uracil-S-

oxyacetic acid methylester, uracil-5~oxyaeetic acid v), 5-methyi-2-thiouracil, 3-(3-amino-

3-N-2-earboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense

nucleic acid can be produced biologically using an expression vector into which a nucleic

acid has been sub-cloned in an antisense orientation (i.e., RNA transcribed from the

inserted nucleic acid will be of an antisense orien tation to a target nucleic acid of interes t,

described further in the following subsection).

The antisense nucleic ac d molecules of the invention are typically administered to a

subject or generated in situ such that they hybridize with or bind to cellular RNA and/or

genomic D A encoding a polypeptide corresponding to a selected marker of the invention

to thereb inhibit expression of the marker, e.g., by inhibiting transcription and/or

translation. The hybridization can be by conventional nucleotide complementarity to form

a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which

binds to DNA duplexes, through specific interactions in the major groove of the double

helix. Examples of a route of administration of antisense nucleic acid molecules of the

invention includes direct injection at a tissue site or infusion of the antisense nucleic acid

into a blood- or bone marrow-associated body fluid. Alternatively, antisense nucleic acid

molecules can be modified to target selected cells and then administered systemically. For

example, for systemic administration, antisense molecules can be modified such that they

specifically bind to receptors or antigens expressed on a selected cel surface, e.g., by

Unking the antisense nucleic acid molecules to peptides or antibodies which bind to el!

suriace receptors or antigens. The antisense nucleic acid molecules can a ! o be delivered to

cells using the vectors described herein. To achieve sufficient intracellular co ce tratio s

of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is

placed under control of a strong po 11 or poi ill promoter are preferred.

An antisense nucleic acid molecule of t e invention can be an a-anom c nucleic

acid molecule. An a-anomeric nucleic aci molecule forms specific double-stranded

hybrids with complementary RNA in which, contrary to the usual -un ts, the strands run

parallel to each other Ga l er e a , 1987, Nucleic Ackis Res. 15:6625-6641). The

antisense nucleic acid molecule can also comprise a 2 -c~methylribonucleotide (inoue e l ,

1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (inoue et

i E e . 215:327-330).

The present invention also encompasses ribozymes. Ribozymes are catalytic RNA

molecules with ribonuclease activity which are capable of cleaving a single-stranded

nucleic acid, such as an mRNA, to which they have a complementary region. Thus,

ribozymes (e.g., hammerhead ribozymes as described in Haselhoff and Gerlach, 88,

Nature 334:585-59 ) can be used to catalytically cleave mRNA transcripts to thereby

inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for

a nucleic acid molecule encoding a polypeptide corresponding to a marker of the invention

can be designed based upon the nucleotide sequence of a cDN A corresponding to he

marker. For example, a derivative of a Tetr hymen L- 1VS RNA can be constructed in

which the nucleotide sequence of the active site is complementary to the nucleotide

sequence to be cleaved (see Cecil el l S. Patent No. 4,987,0? ; and Cech e !. U.S.

Patent No. 5, 1 , 42), Alternatively, an mRNA encoding a polypeptide of the invention

can be used to select a catalytic R A having a specific ribonuclease acti vity from a pool of

RNA molecules (see, e.g., Bartel and ostak, 993 Science 26 :14 -14 ).

The pr se invention also encompasses nucleic acid molecules which form triple

helical structures. For example, expression of a biomarker protein can be inhibited by

targeting nucleotide sequences complementary to the regulatory region of the gene

encoding the polypeptide (e.g. , promoter and/or enhancer) to form triple helical

structures th i prevent transcription of the gene in target cells. See generally Helene ( 9 1)

Anticancer Drug . 6(6):5 - 4 Helene ( 92) A n. .Y. Acad. Sci. 660:27-36; and

Maher (1992) i sc ( ):80 - .5 .

n various embodiments, the nuc ic acid molecules of the present invention can be

modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the

stability, hybridization, or solubility of the molecule. For example, the deoxyribose

phosphate backbone of the nucleic acid molecules can be modified to generate peptide

nucleic acid molecules (see yrup et 1996, Bi rganic & Medicinal Chemistry 4(1): 5-

23). A s used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid

mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a

pseudopeptide backbone and only the four natural n cl obas s are retained. The neutral

backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA

under conditions of low ionic strength. Th synthesis of PNA oligomers can b performed

using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996),,

supra; P rry-O' fe et al. (1996) Proc. Na . Acad. Sci. USA 93:14670-675.

PNAs can be used in therapeutic and diagnostic applications. For example, PNAs

can be used as antisense or antigene agents for sequence-specific modulation of gene

expression by, e.g., inducing transcription or translation arrest or inhibiting replication.

PNAs can also be used, e.g. , t e analysis of single base pair mutations in gene by, e.g. ,

PNA directed PCR clamping; as artificial restriction enzymes when used in combination

with other enzymes, e.g., nucleases (Hyrup ( 96), supra; or as probes or primers for

DMA sequence and hybri dization (Hyrup, 96, supra; Perry-O'Keefe et al., 996, Proc.

Natl. Acad. Sci. USA 93:14670-675).

in another embodiment, PNAs can be modified, e.g., to enhance their stability or

cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of

PNA -D A chimeras, or by the use of liposomes or other techniques of drug delivery

known in the art. For example, P -DNA chimeras can be generated which can combine

the advantageous properties of P A a i DNA Such chimeras allo DNA recognition

enzymes,, e.g., ASE and DNA polymerases, to interact with the DNA portion while

the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras

cart be linked using linkers of appropriate lengths selected in terms of base stacki ng,

number of bonds between the nucleobases, and orientation (Hyrup, 96, supra). The

synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra,

and F nn al { 96) Nucleic Acids Res. 24( 7):3357-63. For example, a DNA chain can

be synthesized on a solid support using standard p osp oram itc coupling ch istry and

modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityi)an5iuo-5'-deoxy-

thymidine phosphoramidite can be used as a li between the PNA and the 5' end of DNA

(Mag et l , 1989, Nucleic Acids lies. 17:5973-88). PNA monomers are then coupled in a

step-wise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA

segment (Finn el a , \996, Nucleic Acids Res. 24( 7): 3357-63), Alternatively, chimeric

molecules can be synthesized with a 5' DNA segment and a 3 PNA segment (Peterscr et

al. , 1 7 , Bioarganic Med. e . Lett. 5 : 9- 24).

n other embodiments, the oligonucleotide can include other appended groups s ch

as peptides (e.g., for targeting hos cell receptors in vivo), or agents facilitating transport

across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. S t. USA

86:6553-6556; Lemaitre etal, 1987, Proc. Natl Acad. Set. USA 84:648-652; PCT

Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No.

WO 89. 34). n addition, oligonucleotides can be modified with hybridization-triggered

cleavage agents (see, e.g., ro et at, 988, Bio/Techniques 6:958-976) or intercalating

agents (see, e g Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide can

be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking

agent, transport agent, hybridization-triggered cleavage agent, etc.

Another aspect of the present invention pertains to the use of biomarker proteins and

biologically act e portions thereof. n one embodiment, the native polypeptide

corresponding to a marker can be isolated from cells or tissue sources by an appropriate

purification scheme using standard protein purification techniques in another embodiment,

polypeptides corresponding to a marker of the invention are produced by recombinant DNA

techniques. Alternative to recombinant expression, a polypeptide corresponding to a

marker of the invention can be synthesized chemically using standard peptide synthesis

techniques.

An "isolated" or '"purified" protein or biologically active portion thereof is

substantially free of ceiluiar material or other contaminating proteins from the cell or tissue

source from which the protein is derived, or substantially free of chemical precursors or

other chemicals when chemically synthesized. The language "substantially free of cellular

material" includes preparations of protein i which the protein is separated from ceiluiar

components of the cei s from which it is isolated or recombmantly produced. Thus, protein

that is substantially free of cellular materia! includes preparations of protein having ess

than about 30%, 20%, . %, or 5% (by dry weight) of heterologous protein (also referred to

herein as a "contaminating protein"). When die protein or biologically acti e portion

thereof is recombinantly produced, it is also preferably substantially free of culture

medium, . , culture medium represents less than about 20%, 0%, or 5% of the volume of

the protein preparation. When the protein produced by chemical synthesis,, is

preferably substantially fre of chemical precursors or other chemicals, i.e., it is separated

from chemical precursors or other chemicals which are involved in the synthesis of the

protein. Accordingly such preparations of the protein have less than about 30%, 20%, 0%,

5% (by dry weight) of chemical precursors or compounds other than the polypeptide of

interest.

Biologically active portions of a biomarker polypeptide include polypeptides

comprising amino acid sequences sufficiently identical to or derived from a biomarker

protein amino acid sequence described herein, but which include fewer amino acids than

the fu l length protein, and exhibit at least one activity of the corresponding full-length

protein. Typically, biologically active portions comprise a domain or motif with at least

one activity of the corresponding protein. A biologically active portion of a protein o the

invention ca be a polypeptide which is, for example, , 25, 50, 00 or mor amino acids

in le gt . Moreover, other biologically active portions, i which other regions of the

protein are deleted, ca be prepared b recombinant techniques and evaluated for one or

more of th functional activities of the native form of a polypeptide of the invention.

Preferred polypeptides have an amino acid sequence of a biomarker protein encoded

by a nucleic a id molecule described herein. Other useful proteins are substantially

identical (e.g., at least about 40%, preferably 50%, 60%, 70%, 75%, 80%, 83%, 85%, 88%,

90%, , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to one of these sequences and

retain the functional activity of the protein of the corresponding naturally-occurring protein

yet differ in amino acid sequence due to natural allelic variation or mutagenesis.

To determine the percent identity of two amino acid sequences or of wo nucleic

acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can b

introduced the sequence of a first amino acid or nucleic acid sequence for optimal

alignment with a second amino nucleic acid sequence). The amino acid residues or

nucleotides at corresponding amino acid positions or nucleotide positions ar then

compared. When a position in the first sequence is occupied by the same amino acid

residue or nucleotide as the corresponding position in the second sequence, then the

molecules are identical a that position. The percent identity between the two sequences is

a function of the number of identical positions shared by the sequences (i.e., % identity

of identical positions/total # of positions (e.g., overlapping positions) x i 00). n one

embodiment the two sequences are the same length.

The determination of percent identity between two sequences can he accomplished

using a mathematical algorithm. A preferred, non-limiting example of a mathematical

algorithm utilized for the comparison of two sequences is the algorithm of arlin and

Altsehul (1.990) Pmc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and

Altsehul (1.993) Pmc. Nad. Aca Sci. USA 90:5873-5877. Such an algorithm is

incorporated i to the NBLAST and XBLAST programs of Altsehul, ei !. ( 90) J . Mol.

Biol 215:403-410. BLAST nucleotide searches can. be performed with the NBLAST

program, score - 100, wordlength - to obtain nucleotide sequences homologous to a

nucleic acid molecules of the inven tion. BLAST protein searches can be performed with

the XBLAST program, score - 50, wordlength - 3 to obtai amino acid sequences

homologous to a protei molecules of the invention. To obtain gapped alignments for

comparison purposes. Gapped BLAST can b utilized as described in Altsehul ei ai. ( 997)

Nucleic Acids Res. 25:3389-3402. Alternatively, PS -B ast can be used to perform an

iterated search wh ch defects distant relationships between molecules. When utilizing

BLAST, Gapped BLAST, and PS -Blast programs, the default parameters of the respective

programs (e.g., XBLAST and NBLAST) can be used. See the National Center for

Biotechnology Information (NCB ) website a ncbi.nlm.nih.gov. Another preferred, non-

limiting example of a mathematical algorithm utilized for the comparison of sequences is

the algorithm of Myers and Miller, (1988) p iAppf Biosci, 4 : 1-7. Such an algorithm

is incorporated into the ALIGN program (version 2.0) which is part of the GC sequence

alignment software package. When utilizing the ALIGN program for comparing amino

acid sequences, a PAMI 20 weight residue table, a gap length pena y of , and a gap

penalty of 4 can be used. Yet another useful algorithm for identifying regions of local

sequence similarity and alignment is the FASTA algorithm as described in Pearson and

Lipra an ( ) Pro Natl Acad Sei. USA 85:2444-2448, When using the FASTA

algorithm for comparing nucleotide or amino acid sequences, a PA 120 weight residue

table can, for example, be used with a A-tuple value of 2.

The percent identity between wo sequences can be determined using techniques

similar to those described above, with or without allowing gaps. In calculating percent

identity only exact matches are counted.

The invention also provides chimeric or fusion proteins corresponding to a

biomarker protein. As tsed herein, a "chimeric protein'" or "fusion protein" comprises all

or part (preferably biologically active part) of a polypeptide corresponding to a marker of

the invention operably linked to a heterologous polypeptide (i.e., a polypeptide other than

the polypeptide corresponding to the marker). Within the fusion protein, th term

"operably linked" is intended to indicate that the polypeptide of the invention and th

heterologous polypeptide are fused in-frame to each other. The heterologous polypeptide

can b fused to the a i o-tera ri s or the carboxyi-teoiiinus of the -polypeptide of the

invention.

One useful fusion protein is GST fusion protein in which a polypeptide

corresponding to a marker of the invention is f sed to the carboxyl terminus of GST

sequences. Such fusion proteins can facilitate the purification of a recombinant polypeptide

of th invention.

in another embodiment, the fusion protein contains a heterologous signal sequence,

immunoglobulin fusion protein, toxin, or other useful protein sequence. Chimeric and

fusion proteins of the invention can be produced by standard recombinant DNA techniques,

n another embodiment, the fusion gene can be synthesized by conventional techniques

including automated DNA synthesizers. Alternatively, P R amplification of gene

fragments can be carried out using anchor primers which give rise to complementary

overhangs between two consecutive gene fragments which can subsequently be annealed

and re-amplified to generate a chimeric gene sequence see, e.g., Ausubel et a , supra).

Moreover, many expression vectors are commercially available tha already encode a fusion

moiety (e.g., a GST polypeptide). A nucle ic a id encoding a polypeptide of the invention

can be cloned into such an expression vector such hat the fusion moiety is linked in-frame

to the polypeptide of the invention.

A signal sequence can be used to facilitate secretion and isolation of the secreted

protein or other proteins of interest. Signal sequences are typically characterized b a core

of hydrophobic am no acids which arc generally cleaved from the mature protein during

secretion in one or more cleavage events. Such signal peptides contain processing sites that

5 allow cleavage of the signal sequence from the mature proteins as they pass through the

secretory pathway Thus, the invention pertains to the described polypeptides having a

signal sequence, as well as to polypeptides from which the signal sequence has been

proteoiytieaiSy cleaved ( . ?. , the cleavage products)- h one embodiment, a nucleic acid

sequence encoding a signal sequence can be operably linked in an expression vector to a

i t) protein of interest, such as a protein which s ordinarily not secreted or is otherwise difficult

to isolate. The sig al sequence directs secretion of the protein, such as from a eukaryotic

host into which the expression vector is transformed,, and the signal sequence is

subsequently or concurrently cleaved. The protein can the be readily purified from th

extracellular medium by art recognized methods. Alternatively, signal sequence can be

linked to ihe protein of interest using a sequence which facilitates purification, such as with

a GST domain.

The presen invention also pertains to variants of the biornarker polypeptides

described herein. Such variants have an altered amino acid sequence which can function as

either agonists (mimetics) or as antagonists. Variants can he generated bv mutagenesis.

20 e.g. , discrete point mutation or truncation. An agonist can retain substantially the same, or

a subset, of th biological activities of the naturally occurring form of the protein. An

antagonist of a protein can inhibit one or more of the activities of the naturally occurring

form of the protein by, for example, competitively binding to a downstream or upstream

member of a cellular signaling cascade which includes the protein of interest. Thus,

25 specific biological effects can be elicited by treatment with a variant of limited function.

Treatment of a subject with a variant having a subset of the biological activities of the

naturally occurring form of the protein can have fewer side effects in a subject relative to

treatment with the naturally occurring form of the protein.

Variants of a biornarker protein which function as either agonists (mimetics) or as

0 antagonists can be identified by screening combinatorial libraries of mutants, . . ,

truncation mutants, of the protein of the invention for agonist or a tagonis activity. one

embodiment, variegated library of variants is generated by combinatorial mutagenesis at

the nucleic acid level and is encoded y a variegated gene library. A variegated library of

variants can be produced by, for example, en atica ly iigatimg a mixture o f synthetic

oligonucleotides into gene sequences such that a degenerate set of potential protein

sequences is expressible as individual polypeptides, or alternatively, as a se of larger fusion

proteins (e.g., for phage display). There are a variety of methods which can be used to

produce libraries of potential variants of the polypeptides of the invention fro a

degenerate oligonucleotide sequence. Methods for synthesizing degenerate

oligonucleotides are known in the art (see, e.g., Narang, 983, Tetrahedron 39:3; I akura t

., 9 , A f>n . Rev. i em. 53:323; liakura et 84, Science 198:1056; ke etttl,

83 Nucleic Acki Res. :4?7).

n addition, libraries of fragments of the coding sequence of a polypeptide

corresponding to a marker of the invention can be used to generate a variegated population

of polypeptides for screening and subsequent selection of variants. For example, a library

ofcodiiig sequence fragments can be generated by treating double stranded PGR fragment

of the coding sequence of interest with a nuclease under conditions wherein nicking occurs

only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to

form double stranded DNA which can include sense/an tis se pairs from different nicked

products, removing single stranded portions from reformed duplexes by treatment with S

nuclease, and ligatmg the resulting fragment library into an expression vector. By this

method, an expression library can be derived which encodes amino terminal and Internal

fragments of various sizes of the protein of interest.

Several techniques are known in the art for screening gene products of

combinatorial libraries made by point mutations or truncation, and for screening DNA

libraries for gene products having a selected property. The most widely used techniques,

which are amenable to high throughput analysis, for screening large gene libraries typically

include cloning the gene library into repiieabie expression vectors, transforming appropriate

cells with the resulting library of vectors, and expressing the combinatorial genes under

conditions In which detection of a desired activity facilitates isolation of the vector

encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a

technique which enhances the frequency of functional mutants i the libraries, can be used

in combination w h the screening assays to identify variants of a protein of the invention.

(Arkin and Yourvan, 92, Pr . Nail Aca Set. USA 9 8 -7 5; igrave etai,

93, Protein Engineering 6{3};327- 3 .

The produ ion and use of biomarker nucleic acid and/or biomarker polypeptide

molecules described h rei can be facilitated by using standard recombinant techniques n

some embodiments, such techniques se vectors, preferably expression vectors, containing

a nucleic acid encoding a biomarker polypeptide or a portion of such a polypeptide. As

5 used herein, d e term: "vector" refers to a nucleic acid molecule capable of transporting

another nucleic acid to which it has been linked. One type of vector is a "p!asmid", which

refers to a circular double stranded DNA loop into which additional DNA segments can be

!igated Another type of vector is a vira vector, wherein additional DNA segments can be

!iga d into the viral genome. Certain vectors are capable of autonomous replication in a

) host cell into which hey are introduced (e.g., bacterial vectors having a bacterial origin of

replication an episomal mammalian vectors). Other vectors (e.g., r on-episo a

mammalian vectors) ar integrated into the genome of a host ce l upon introduction into the

host cell, and thereby arc replicated along with the host genome. Moreover, certain vectors,

namely expression vectors, are capable of directing the expression of genes to which they

are operabiy linked. n general, expression vectors of utility in recombinant DNA

techniques are often in the form of plas ids (vectors). However, the present invention is

intended to include such other forms of expression vectors, such as viral vectors (e.g. ,

replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve

eq ent functions .

20 The recombinant expression vectors of the invention comprise a nucleic acid of th

inve tio in a form suitable for expression of the nucleic acid i a ost cell. This means

that the recombinant expression vectors include one or more regulatory sequences, selected

on the basis of the host cells to be used for expression, which is operabiy linked to the

nucleic acid sequence to be expressed. Within a recombinant expression vector, "operabiy

25 linked" is intended to mean that the nucleotide sequence of interest is linked to the

regulatory s q ence(s in a manner which allows for expression of the nucleotide sequence

(e.g., in an in vi r o transcription/translation system or in a host cell when i vector is

introduced into the host cell). Th term "regulatory sequence" is intended to include

promoters, enhancers and other expression control elements (e.g., polyadenylatton signals).

0 Such .regulatory sequences are described, for example, in Goeddei, Me(hods i Enz m log

Gene Expression Teehnoiogy vol. 85, Academic Press, San Diego, CA ( ). Regulatory

sequences include those which direct constitutive expression of a nucleotide sequence i

many types of host ceil and those which direct expression of the nucleotide sequence only

in certain host ceils (e.g. , tissue-specific regulatory sequences) it will be appreciated by

those skilled in the art that the des n of the expression vector can depend on such factors

as e choice of d e host cell to be transformed, the level of expression of protein desired,

and the like. The expression vectors of the invention can be introduced into host cells to

thereby produce proteins or peptides, including fusion proteins or peptides, encoded by

nucleic acids as described herein.

The recombinant expression vectors for use in the invention can be designed tor

expression of a polypeptide corresponding to a marker of the invention in prokaryotie (e.g.,

E. c i) or eukaryotic cells (e.g., insect cells (using baculovirus expression vectors}, yeast

cells or mammalian ceils). Suitable host ceils are discussed further in Goeddel, supra.

Alternatively, the recombinant expression vector can be transcribed and translated in vitro,

for example using T7 promoter regulatory sequences and T7 polymerase.

Expression o f proteins prokaryotes is most often carried out n E. ii with

vectors containing constitutive or inducible promoters directing the expression of either

fusion or non-fusion proteins sion vectors add a number of amino acids to a protein

encoded therein, usually to the amino terminus of the recombinant protein . Such fusion

vectors typically serve three purposes: ) to increase expression of recombinant protein; 2)

to increase the so u i y of the recombinant protein; and 3) to aid in the purification of the

recombinant protein by acting as a iigand in affinity purification. Often, in fusion

expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion

moiety and the recombinant protein to enable separation of the recombinant protein from

the fusion moiety subsequent to purification of the sion protein. Such enzymes, and their

cognate recognition sequences, include Factor Xa, thrombin and ntero nas Typical

fusion expression vectors include pGEX (Pharmacia Biotech nc; Smith and Johnson, 88,

Gene 67:3.1 -40), pMAL (New England Bi abs, Beverly, MA) and pRlT5 (Pharmacia,

Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or

protein A, respectively, to the target recombinant protein.

Examples of suitable inducible non-fusion E, coii expression vectors include p'frc

(Amann et al, 1 88, Gene 69:30 -3 i ) and pET i d (Srudier et al , p . 60-89, In Ge e

Expression Technology: Methods in E ymo gy vol. 185, Academic Press, San Diego, CA,

1). Target biomarker nucleic acid expression from the pTr vector relies on host A

polymerase transcription from a hybrid trp-lac fusion promoter. Target btoniarker nucleic-

acid expression from the pET d vector relies on transcription fr o a T7 gn O- a fusion

promoter mediated by a co-expressed viral polymerase T7 g . This viral

polymerase is supplied by host strains BL21 DE3) or M S . 4 D 3) m a resident

prophage harboring a T7 gn gene under the transcriptional control of acl V 5

promoter.

5 One strategy to maximize recombinant protein expression in E. coli is to expres the

protein in a host bacterium with an impaired capacity to pro eo yti aily cleave the

recombinant protein (Go tesn an p . i 9- 8, n Gene Expression Technology: Methods in

Enzymohgy vol. 85, Academic Press, San Diego, CA, 1990. Another strategy is to alter

the nucleic acid sequence of the nucieic acid to be inserted into an expression vector so that

) the individual codons for each amino acid are those preferentially utilized i E. coli (Wada

e , 992, Nucleic Acids Res. 20:21 .1-2 . Such alteration of nucleic acid sequences

of the invention can be carried out by standard DNA synthesis techniques.

. another embodiment, the expression vector is a yeast expression vector.

Examples of vectors for expression i yeast S. cerevtsiae include p YepSec l (Batdari et ol,

1.5 1987, M . 6:229-234), pM rjan and Hersko tz. 1 82 Cell 30:933-943),

pJRY (Schultz et !., 87, Gem 54:1 13- 3), pYES2 (Invitrogen Corporation, San

Diego, CA), and pPi (Invitrogen Corp, San Diego, CA).

Alternatively, the expression vector is a baculovirus expression vector. Baculovirus

vectors available for expression of proteins in cultured insect ceils (e.g. Sf 9 cells) include

20 the pAc series (Sm et ί ., 1.983, M Cell Biol. 3: 56- ) and the pVL series

(Lucklow and Summers, 1989, Virology 170:31-39).

n ye another embodiment., a nucleic acid of the present invention is expressed in

mammalian cell using a a mal ian expression vector. Examples of mammalian

expression vectors include pCDM8 (Seed, 1987, Nature 329:840) and pMT2PC (Kaufman

25 et i , 1987, EM O J. 6 : 87-195). When sed i -mammalian cells, the expression vector's

control functions are often provided by viral regulatory elements. For example, commonly-

used promoters are derived from polyoma. Adenovirus 2, cytomegalovirus and Simian

Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic ceils

see chapters 1 and of Sa broo et s r

0 in another embodiment, the recombinant mammalian expression vector is capable of

directing expression of the nucleic acid preferentially in a particular cell type (e.g. , tissue-

specific regulatory elements are used to express the nucleic acid). Tissue-specific

regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific

promoters include the albumin promoter (liver-specific; Pi«kert<?/ al., 987, Genes Dev.

1:268-277), iympho d- pe i promoters (Calame and Eaton, 1.988,, Adv. Immunol 43:235-

2 5), i particular promoters of T cell receptors (W no and Baltimore, 89, E .

8:729-733) an immunoglobulins (Banerji i al.., . 83, Cell 33:729-740; Queen and

Baltimore, . 83, Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament

promoter; Byrne and Ruddle, 89, Pr . Natl. Acad. Sc . USA 86:5473-5477), pancreas-

specific promoters (E l al, 1985, Science 230:912-916), and mammary gland-

specific promoters (e.g., milk whey promoter; U.S. Patent No. 4 ,873, 6 and European

Application Publication No. 264,166). DevelopmentaUy-regulated promoters are also

encompassed, for example the murine hox promoters ( essel and Gruss, 90, Science

249:374-379} and the - etoprote promoter (Camper and Tilghman, 989, Genes Dev.

3:537-546).

The present invention further provides a recombinant expression vector comprising

a DNA molecule cloned i to the expression vector in an antisense orientation. That is, the

DNA molecule is operabiy linked to a regula tor} sequence i manner which allows for

expression (by transcription of the DNA molecule) of an RNA molecule which is antisense

to the raRNA encoding a polypeptide of the invention. Regulatory sequences operabiy

linked to a nucleic acid cloned n the antisense orientation can be chosen which direct the

continuous expression of the antisense RNA molecule in a variety of eel types, for instance

viral promoters and/or enhancers, or regulatory sequences can be chosen which direct

constitutive, tissue-specific or cell type specific expression of antisense RNA. The

antisense expression vector can be in the form of a recombinant piasmid, phagemid, or

attenuated virus in which antisense nucleic acids are produced under the control of a high

efficiency regulatory region, the activity of which can be determined by the cell type into

wh ich the vector is introduced. For a discussion of th regulation of gene expression using

antisense genes (see Weiutraub ei al., 1986, Trends in Genetics, Vol. 1(1)).

Another aspect of the present invention pertains to host cells into which a

recombinant expression vector of the invention ias been introduced. The terms "host ce

and "recombinant host ce are used interchangeably herein. It i understood that such

terms refer not only to the particular subject cell but to the progeny or potential progeny of

such a cell. Because certain modifications may occur in succeeding generations due to

either mutation or environ mental influences, such progen may not, in fact, be identical to

the parent cel l, but are still included within the scope of the term as use herein.

A host cell can be any prokaryotic {e.g., E. call) or eukaryotic cell (e.g. , insect cells,

yeast or mammalian ceils).

Vector D A can be introduced into prokaryotic or eukaryotic cells via conventional

transformation or transfection techttiques. As used herein, the terms "transformation" and

'transfection" are intended to refer to a variety of art-recognized techniques for introducing

foreign nucleic acid i to a . host cell, including calcium phosphate or calcium chloride co-

precipitation, DEAE-dextran-mediated transfection, ip feeti u, or eiectroporation.

Suitable methods for transforming or transfecting hos cells ca be found in Sambrook, et

{supra), and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the

expression vector and transfection technique used, only a small fraction of cells may

integrate the foreign DNA into their genome n order to identify and select these

integrants, a gene that encodes a selectable marker (e.g. , for resistance to antibiotics) is

generally introduced into the host ceils along with the gene of interest Preferred selectable

markers include those which confer resistance to drugs, such as G 8, hygromycin and

methotrexate. Ceils stably transfected with the introduced nucleic acid can be identified by

drug selection (e.g., cells that have incorporated the selectable marker gene will survive,

while the other cells die).

V. Ana zin Biomarker N eic Acids and Poiypeptide

Biomarker nucleic acids and/or biomarker polypeptides can be analyzed according

to the methods described herein and techniques known to the skilled artisan to identify such

genetic or expression alterations useful for the present invention including, but not limited

to, ) an alteration in the level of a biomarker transcript or polypeptide, 2) a deletion or

addition of one or more nucleotides from a biomarker gene, 4 } a substitution of one or more

nucleotides of a biomarker gene , 5) aberrant modification of a biomarker gene, such as an

expression regulatory region, and the like

a Methods for Detection of Cop Number and/or Genomic Nucleic Acid Mutations

Methods of evalua ting the copy number and/or genomic nucleic acid status (e.g.,

mutations) of a biomarker nucleic acid are well known to those of skill in the art. The

presence or absence of chromosomal gain or loss can be evaluated simply by a

determination of copy number of the regions or markers identified herein.

n one embodiment, a biological samp!e is tested for e presence of copy umber

changes in genomic loci containing d e genomic marker. In some embodiments, the

increased copy number of at least one biomarker listed in Tabic i is predictive of better

outcome of iron-sulfur cluster biosynthesis pathway inhibitory therapy. A copy number of

at least 3, 4, 5, 6 7, 8, , or .10 of at least one biomarker listed in Table 1 is predictive o

likely responsive to iron-sulfur cluster biosynthesis pathway inhibitory therapy.

Methods of evaluating the copy number of a . biomarker locus include, but are not

limited to, hybridization-based assays. Hybridization-based assays include, but are not

limited to, traditional "direct: probe" methods, such as Southern blots, in situ hybridization

(e.g., FISH and FISH plus SKY) methods, and "comparative probe" methods, such as

comparative genomic hybridization (CGH), e.g., cDNA-based or oligonueleotide-based

CGH. The methods can b used in a wide variety of formats including, but not limited to,

substrate (e.g. membrane or glass) bound methods or array-based approaches.

n one embodiment, evaluating the biomarker gene copy number in a sample

involves a Southern Blot. a . Southern Blot, the genomic DNA (typically f agmented and

separated on an ee rop o ie gel) is hybridized to a probe specific for the target region.

Comparison of the intensity of the hybridization signal from the probe for the target region

with control probe signal from analysis of normal genomic DNA (e.g., a non-amplified

portion of the same or related cell, tissue, organ, etc.) provides an estimate of the relative

copy number of the target nucleic acid. Alternatively, a Northern blot may b utilized for

evaluating the copy number of encoding nucleic acid in a sample. In a . Northern blot,

mRNA is hybridized to a probe specific for the target region. Comparison of the intensity

of the hybridization signal from the probe for the target region with control probe signai

from analysis of normal R A (e.g., a non-amplified portion of the same or related cell,

tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic

acid. Alternat ely, other methods well known in the art to detect RNA ca be used, such

that higher or lower expression relative to an appropriate control {e.g., a non-amplified

portion of the same or related cell tissue, organ, etc..) provides an estimate of the relative

copy number of the target nucleic acid.

An alternative means for determining genomic copy number is in situ hybridization

(e.g., Angercr ( 87) M t . En y l 52: 649). Generally, in site hybridization comprises

the following steps: ( ) fixation of tissue or biological structure to be analyzed; (2)

prehybridization treatment of the biological structure to increase accessibility of target

D A, and to reduce nonspecific binding; (3 hybridization of the mixture of nucleic acids

to the nucleic acid in the biological structure or tissue: 4) post-hybridization washes to

remove nucleic acid fragments not bound in the hybridization and (5) detection of the

hybridized nucleic acid fragments. The reagent used in each of these steps and the

conditions for use vary depending on th particular application, n a typical In

hybridization assay, ceils are fixed to a solid support, typically a glass slide if a nucleic

acid is to be probed, the cells are typically denatured with heat or alkali. The cells are the

contacted with a hybridization solution at a moderate temperature to permit annealing of

labeled probes specific to the nucleic acid sequence encoding the protein. The targets (e.g.,

cells) are then typically washed at a predetermined stringency or at an increasing stringency

until a appropriate signal to noise ratio is obtained. The probes are typically labeled, e.g.,

with radioisotopes or fluorescent report rs n one embodiment, probes are sufficiently

lo g so as to specifically hybridize with the target nucleic acid(s) under stringent

conditions. Probes generally range n length from about 200 bases to about 00 bases n

some applications it is necessary to block the hybridization capacity of repetitive sequences.

Thus, in some embodiments, t A, huma genomic DNA, or Cot- DNA is used to block

non-specific hybridization.

An alternative eans for determining genomic copy number is comparative

genomic hybridization. In general, genomic DNA is isolated from normal reference cells,

as well as from test cells (e.g., tumor cells) and amplified, if necessary. The two nucleic

acids arc differentially labeled and the hybridized in situ to metap a chromosomes of a

reference ce l. The repetitive sequences in both the reference and test DNAs are either

removed or their hybridization capacity is reduced by some means, for example by

prehybridization with appropriate blocking nucleic acids and/or including such blocking

nucleic acid sequences for said repetitive sequences during said hybridization. The bound,

labeled DNA sequences are then rendered in a visual abl form, if necessary.

Chromosomal regions in the test cells which are at increased or decreased copy number can

be identified b detecting regions where the ratio of signal from the two DNAs is altered.

For example, those regions that have decreased in copy number in the test cells will show

relatively lower signal from the test DNA than the reference compared to other regions of

the genome. Regions that have bee increased fa copy number in the test cells will show

relatively higher signal fr om th test DNA . Where there arc chromosomal deletions or

multiplications, differences in the ratio of the signals fro the two labels will be detected

and the ratio will provide a measure of the copy number. In another embodiment of CGH,

array CGH aCG ), the immobilized chromosome element is repiaced with a collection of

solid support bound target nucleic acids on an array, allowing for a large or complete

percentage of the genome to be represented in the collection of solid support bound targets.

Target nucleic acids may comprise cD As, genomic DNAs, oligonucleotides .g , to

detect single nucleotide polymorphisms) and the like. Array-based CGH may also be

performed with single-color labeling (as opposed to labeling the control and the possible

tumor sample with two different dyes and mixi g them prior to hybridization, which will

yield a ratio due to competitive hybridization of probes on the arrays). In single color

CGH, the control is labeled and hybridized to one array and absolute signals ar read, and

the possible tumor sample is labeled and hybridized to a second array (with identical

content) a d abso te signa are read. Copy number difference is calculated based o

absolute signals from the two arrays. Methods of preparing immobilized chromosomes or

arrays and performing comparative genomic hybridization are well known in the art (see,

g U.S. Pat. Nos: 6,335,167; 6,197,501; 5,830,645; and 5,665,549 and Albertson { 84)

E BO J 3 : 1227-1234; Pinkei (1988) P c NatL Acad Set. USA 85: 9138-9142; EPO

P b No, 430,402; Methods in Molecular Biology, Vol. 33: n situ Hybridization Protocols,

Choo, ed., Humana Press, Totowa, N i . (1 94 , etc.) n another embodiment, the

hybridization protocol of Pinkef ei l. ( 98) Nature Genetics 20: 207-2 i , or of

Kaliioniemi (1992) V e Natl Acad S t USA 89:5321.-5325 (1992) is used.

in still another embodiment, amplification-based assays can be used to measure

copy number in such amplification-based assays, the nucleic aci sequences act as a

template in an amplification reaction (e.g.. Polymerase Chain Reaction (PCR)). In a

quantitative amplification, the amount of amplification product will be proportional to t e

amount of template in the original sample. Comparison to appropriate controls, e.g. healthy

tissue, provides a measure of the copy number.

Methods of qua itat ve amplification are well known to those of skill in the art.

For example, quantitative PCR involves simultaneously co-amplifying a known quantity of

a control sequence using the same primers. This provides an internal standard that may be

used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided in

nis et . (1990) PGR Protocols, Guide to Methods and Applications, Academic Press,

Inc. N .Y ) Measurement of DNA copy number at mtcrosatelltte loci using quantitative

PCR analysis is described in Gmzonger, ei al. (2000) Cancer Research 60:5405-5409. The

known nucleic acid sequence for the genes is sufficient to enable one of sk the art to

routinely select primers to amplify any portion of the gene. Fluorogenic quantitative PCR

may also be used in the methods of the invention, n fluorogenic quantitative PCR,

quantitation is based on amount of fluorescence signals, e.g., Taq an and SY.8R green.

Other suitable amplification methods include, but are not limited to, ligase chain

reaction (LCR.) (see Wu and Wallace ( 89) Genomics 4 : 560, Landegrea, et al. ( 988)

Science 241:1077, and Barringer et a . (1.990) Gene 89: 1.17 , transcription amplification

( wo , et al. ( 89) Pro . Mat!. Acad. Set USA 86: 73), self-sustained sequence

replication (Guateili, e . (1990) Proc. N Aca Sci. USA 87: 874), dot PCR and linker

adapter PCR, etc.

Loss of heterozygosity (LOH) and major copy proportion (MCP) mapping (Wang,

Z.C., et al. (2004) Cancer Res 64(1);64-71 ; Seymour, A . B., ei ei (1994 Cancer Res 54,

2763-4; Hahn, S. A , et at. (3995) Cancer Res 55, 4670-5; imu a, M., et al. (3996) Gems

Chromosomes Cancer 7, 88-93; L et al, (2008) M C fbr . 9, 204-219) may also be

used to identify regions of amplification or deletion.

b. Methods for Detection of Biomarker Nucleic Aci Expression

Biomarker expression may be assessed by an of a wide variety of well-known

methods for detecting expression of a transcribed molecule or protein. Non-limiting

examples of such methods include immunological methods for detection of secreted, ce i-

surface, cytoplasmic, or nuciear proteins, protein purification methods, protein function or

activity assays, nucleic acid hybridization methods, nucleic acid reverse transcription

methods, and nucleic acid amplification methods.

in preferred embodiments, activity of a particular gene is characterized by a

measure of gene transcript (e.g. mRNA), by a measure of the quantity of translated protein,

or by a measure of gene product activity. Biomarker expression can be monitored in a

variety of ways, including by detecting mRNA levels, protein levels, or protein activity, any

of which can b measured using standard techniques. Detection can involve quantification

of the level of ge e expression (e.g., genomic DNA, cDNA, mRNA, protein, or enzyme

activity), or, alternatively, cati.be a qualitative assessment of the level of gene expression, in

particular in comparison with a control level. The type of level being detected will be clear

from the context.

In another embodiment, detecting or determining xpression levels of a biomarker

and. functionally similar homoiogs thereof, including a fragment or genetic alteration

- 3.00 -

thereof e.g. , in regulatory or promoter regions thereof) comprises detecting or determining

RNA levels for the marker of interest In one embodiment, o e or ore cells from the

subject to be tested a e obtained and RNA is isolated fr o the cells. In a preferred

embodiment, a sample of breast tissue cells is obtained from the subject.

n one embodiment, RNA is obtained from a single cell. For example, a cell can be

isolated from a tissue sample by laser capture microdissection (LCM). Using this

technique, a cell can b isolated from a tissue section, including stained tissue section,

thereby assuring that the desired cell is isolated (see, e.g., Bonner et al. ( 97) Science 278:

1481; Emmert-Buck et a ( 996 ) Science 274:998; Fend et al. (1999) Am. J . Path. 4 : 61.

and Murakami et al. (2000) Kidney nt . 58 1346), For example, Murakami et al,, supra,

describe isolation of a cell from a previously imimmostained tissue section.

t is also be possible to obtain cells from a subject and culture the cells in vitro, such

as to obtain a larger population of cells from which RNA can. be extracted. Methods for

establishing cultures of non-transformed cells, i.e., primary ce l cultures, are k in the

art.

Whe isolating RNA from tissue samples or cells from individuals, it may be

important to prevent a y further changes in gene expression after the tissue or cells has

been removed from the subject. Changes in expression levels are known to change rapidly

following perturbations, . heat shock or activation with lipopoiysaecharide (LPS) or

other reagents n addition, the RNA in the tissue and cells may quickly become degraded.

Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is s ap

frozen as soon as possible.

RNA can be extracted from: the tissue sample by a variety o methods, e.g., the

guanidium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al., 1979,

Biochemistry i 8:5294-5299). R from single cells can be obtained as described n

methods for preparing cD A libraries from single cells, such as those described in Dulac,

C . (.1998) Curr. Top. Dev. Biol. 36 245 and Jena et al. (1996) J . Immunol. Methods

0 :1 9 , Care to avoid RNA degradation must be taken, e.g. , b inclusion of RNA s n .

The RNA sample can then be enriched in particular species. n one embodiment,

poly(A)-*- RNA is isolated from the RNA samp le n general, such purification takes

advantage of the po iy -A tails on R A . In particular and as noted above, poly-T

oligonucleotides may be immobilized within on a sol id support to serve as affinity ligands

- 1.01 -

for mRNA. Kits for this purpose are commercially available,, e.g., the MessageMaker kit

(Life Technologies, Grand Island, NY).

in a preferred embodiment, the RNA population is enriched in marker sequences.

Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds

5 of linear amplification based o DNA synthesis and template-directed in vitro

transcription (see, e .g ., Wang et al. (1989) PNAS 86, 9 17; Dutac et a!., supra, and Jena et

a , supra).

The population of RNA, enriched or not in particular species or sequences, ca

farther be amplified. As defined herein, an "amplification process" is designed to

i t) strengthen, increase, or augment a molecule within the RNA. For example, where RNA is

mRNA, art amplification process suc as RT-PCR can be utilized to amplify the mRNA,

such that a signal is detectable or detection is enhanced. Such art amplification process is

beneficial particularly when the biological, tissue, or tumor sample is of a small size or

volume.

Various amplification and detection methods ca be used. For example, it is within

the scope of the present invention to reverse transcribe mRNA into cDNA followed by

polymerase chain reaction (RT-PCR); or, to use a single e zyme for both steps as described

in U.S. Pat. No. 5,322,770, or reverse transcribe mR into cDNA followed by symmetric

gap l ase chain reaction (RT-AGLCR) as described by R. L. Marshall ; e al, PCR

20 Methods and Applications 4 : 80-84 (1994). Real time PCR may also be used.

Other known amplification methods which ca be utilized herein include but are not

limited to the so-called "NASBA" or "3SR" technique described in PNAS USA 87: 74-

1878 (1990) and also described in Nature 350 (No. 6313): 91-92 (1991); Q-beia

amplification as described in published European Patent Application (EPA) No. 4544610;

25 strand displacement amplification (as described in G . T. Walker et al., Clin. Chem. 42: 9-1

(1996) and European Patent Application No. 684315; target mediated amplification, as

described by PCT Publication W 932246 ; PCR; ligase chain reaction (LCR) (see. e.g. ,

W and Wallace, Genomics 4, 560 (1989), Landegren et al. Science 241, 1077 (1988));

self-sustained sequence replication (SSR) (see, e.g., Guatelti et al., Proc. Nat. Acad. Sci.

0 USA, 87, 1874 ( 1990)); and transcription amplification (see, e.g. , wo et al., Proc. Natl

Acad. Sci. USA 86, 3 (1989)).

Many techniques are known in the state of the art for determining absolute and

relative levels of gene expression, commonly used techniques suitable for use in the present

invention include Northern analysis, RNase protection assays (RPA), microarravs and PCR-

based techniques, such as quantitative PCR and different l d play PC . For example.

Northern blotting involves running a preparation of RNA on a denaturing agarose gel, and

transferring it to a suitable support, such as activated cellulose, nitrocellulose or glass or

nylon membranes. Radiolabeled cD A or RNA is then hybridized to the preparation,,

washed a d analyzed by autoradiography.

In situ hybridization visualization may also be employed, wherein a radioaetively

labeled amisense RNA probe is hybridized with a thin section of a biopsy sample, washed,

cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples

may be stained with hematoxylin to demonstrate the histological composition of the

sample, and dark field imaging with a suitable light filter shows the developed emulsion.

Non-radioactive labels such as digoxigenin may also be used.

Alternatively, RNA expression can be detected on a DNA array, hip or a

microarray. Labeled nucleic acids of a test sample obtained from subject may be

hybridized to a solid surface comprising biomarker DNA. Positive hybridization signal s

obtained with the sample containing biomarker transcripts. Methods of preparing DNA

arrays a d their use ar well known in the ar (see, e.g., U.S. Pat. os:

6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485 and Schena et at (1995)

Science 20, 467-470; Gerhold et a . ( 99) J'rends In i c e . Set 24, .1 68-173; and

Lennon et al. (2000) Drug Discovery Today 5, 59-65, which are herein incorporated by

reference in their entirety). Serial Analysis of Gene Expression (SAGE) can also be

performed (See for example U.S. Patent Application 20030215858).

To monitor mRNA levels, for example, raRNA is extracted from the biological

sample to be tested, reverse transcribed, and fiuorescentiy-labeled cDNA probes are

generated. The microarravs capable of hybridizing to marker cDNA are then probed with

the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This

intensity correlates with the hybridization intensity and expression levels.

Types of probes that can be used i the methods described herein include cDNA,

riboprobes, synthetic oligonucleotides and genomic probes. The type of probe used will

generally be dictated by the particular situation, such as riboprobes for in siiu hybridization,

and cDNA for Northern blotting, for example. I one embodiment, the probe is directed to

nucleotide regions unique to the RNA . The probes ma be as short as is required to

differentially recognize marker mRNA transcripts, and may be as short as, for example, 5

bases: however, probes of at least !7„ , 19 or 20 or more bases can be used. one

embodiment, the primers and probes hybridize specifically under stringent conditions to a

DNA fragment having the nucleotide sequence corresponding to t e marker. As herein

used, the term "stringent conditions" means hybridization will occur only if there is at east

95% identify in nucleotide sequences in another embodiment, hybridization under

"stringent conditions" occurs when there is at least 9 % identity between the sequences.

The form of labeling of the probes may be any that is appropriate, such as the use o

radioisotopes, for example, J P and , S. Labeling with radioisotopes may be achieved,

whether the probe is synthesized chemically or biologically, by the use of sui tably labeled

bases.

In one embodiment, the biological sample contains polypeptide molecules from the

test subject. Alternatively, the biological sample can contain mRNA molecules from the

test subject or genomic DNA molecules from the test subject.

In another embodiment, the methods further involve obtaining a control biological

sample from a control subject, contacting the control sample with a compound or agent

capable of detecting marker polypeptide, mRNA, genomic DNA, or fragments thereof, such

that the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof,

is detected in the biological sample, and comparing the presence of the marker polypeptide,

mRNA, genomic DNA, or fragments thereof, in the control sample with the presence of th

marker polypeptide, mRNA, genomic DNA, or fragments thereof n the test sample

c. Methods for Detection of Biomarker Protein Expression

The activity or level of a biomarker protein can be detected and/or quantified by

detecting or quantifying the expressed polypeptide. The polypeptide can be detected and

quantified by any of a number of means well known to those of skill the art Aberrant

levels of polypeptide expression of the polypeptides encoded by a biomarker nucleic acid

and functionally similar homologs thereof, including a fragment or genetic alteration

thereof (e.g., in regulatory or promoter regions thereof) are associated w th the likelihood of

response of a cancer to an anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway

inhibitory therapy). Any method known i the art for detecting polypeptides can be used

Such methods include, but are not limited to, immunodiffusion, immunoeiectrophoresis,

radioimmunoassay ( A), enzyme-linked immunosorbent assays (ELlSAs),

immunoflttorescent assays, Western blotting, b nder-l g nd assays, immuaohisto c c ica

techniques, agglutination, complement assays, high performance liquid chromatography

(HPLC), thin layer chromatography (TLC), hyperdi u ion chromatography and the like

(e.g., Basic and Clinical Immunology, Sites and Terr, eds., Appleton and Lange, Norwaik,

Conn, pp -262, which is incorporated by reference). Preferred are binder-iigand

immunoassay methods including reacting antibodies with epitope or epitopes and

competitively displacing a labeled polypeptide or derivative thereof.

For example, E SA and A procedures may be conducted such that desired

biomarker protein standard is labeled (with a radioisotope such as or or art

assayable enzyme, such as horseradish peroxidase or alkaline phosphatase), and, together

with the unlabelled sample, brought into contact with the corresponding antibody, whereon

a second antibody is used to b nd the first, and radioactivity or the immobilized enzyme

assayed (competitive assay). Alternatively, the biomarker protein in the sample is allowed

to react with the corresponding immobilized antibody, radioisotope- or enzyme-labeled

anti-biomarkcr p tcina body is allowed to react with d e system, a d radioactivity or th

enzyme assayed (ELiSA-sandwieh assay). Other conventional methods may also be

e ploye as s tabl .

The above techniques may be conducted essentially as a "one-step" or "two-step"

assay. A "one-step' assay involves contacting antigen with immobilized antibody a d,

without washing, contacting the mixture with labeled antibody. .4 "two-step" assay

involves washing before contacting, the mixture with labeled antibody. Other conventional

method may also be employed as suitable.

in one embodiment, a method for measuring biomarker protein levels comprises th

steps of: contacting a biological specimen with an antibody or variant (e.g., fragme )

thereof which selectively binds the biomarker protein, and detecting whether said antibody

or variant thereof is bound to said sample and thereby measuring the levels of the

biomarker protein.

Enzymatic and radiolabeling of biomarker protein and/or the antibodies may be

effected by conventional means. Such means will generally include covaiest linking of the

enzyme to the antigen or the antibody in question, such as by g!utara!dehyde, specifically so

as not to adversely affect the activity of the enzyme, by which is meant that the enzyme

must still be capable of interacting with its substrate, although it is not necessary for all of

the enzyme to be active, provided that enough remains active to permit the assay to be

effected. Indeed, some techniques for binding enzyme are non-specific (such as using

formaldehyde), and will only yield a proportion of active enzyme.

it is usually desirable to immobilize one component of the assay system: on a

support, thereby allowing other components of the system to be brought into contact with

the component and readily removed without laborious and time-consuxnvng labor. t is

possible for a second phase to be immobilized away from the first, but one phase is usually

sufficient,

i t is possible to immobilize the enzyme itself on a support, but if sol id-phase

enzyme is required, then this is generally best achieved by binding to antibody and affixing

the antibody to a support, models and systems for which are well-known in the art. Simple

polyethylene may provide a suitable support.

Enzymes employable for labeling are not particularly limited, but may be selected

from the members of the oxidase group, for example. These catalyze production o

hydrogen peroxide by reaction with their substrates, and glucose oxidase is often used for

its good stability, ease of availabiiitv and cheapness, as well as the ready availabiiitv of its

substrate (glucose). Activity of the oxidase may be assayed by measuring the concentration

of hydrogen peroxide formed after reaction of the enzyme-labeled antibody with the

substrate under controlled conditions well-known in th a t

Other techniques a be used to detect bioraarker protein according to a

practitioner's preference based upon the present disclosure. One such technique is Western

blotting (Towbin et at., Proe. Nat Acad. Sci 76:4350 (1979)), wherein a suitably treated

sample is run on an SDS - AGE gel before being transferred to a solid support, such as a

nitrocellulose fi lter Aoti-biomarket protein antibodies (unlabeled) are then brought into

contact w h the support and assayed by a secondary immunological reagent, such as

labeled protein A or anti- n tnog obu in (suitable labels including l horseradish

peroxidase and alkaline phosphatase). Chromatographic detection may also be used.

m no stoche istry may be use to detect expression of btomarker protein, e.g.,

in a biopsy sample. A suitable antibody is brought into contact with, for example, a thin

layer of cells, washed, and then contacted with a second, labeled antibody. Labeling ma

be by fluorescent markers, enzymes, such as peroxidase, avidin, or radioiabeliing. The

assay s scored visually, using microscopy.

Anti-biomarker protein antibodies, such as intrabodies, may also be used for

imaging purposes, for example, to detect: th presence of btomarker protein in cells and

tissues of a subject. Suitable labels include radioisotopes, iodine ( J i), carbon (i C.I,

sulphur ( }. tritium ( ), indium ( ¾n), and technetium ( m7c), fluorescent labels, such

as fluorescein and rhodamine, and biotin.

For in viva imaging purposes, antibodies are not detectable, as such, from outside

the body, and so us be labeled. f otherwise modified, to permit detection. Markers for

this purpose may be any that do not substantially interfere with the antibody binding, but

which allow externa! detection. Suitable markers may include those that may b detected

by X-ra i grap y NMR or MR . For X-radiographie techniques, suitable markers include

any radioisotope that emits detectable radiation but that is not overtly harmful to the

subject, such as barium or cesium, for example. Suitable markers for NMR an MR!

generally include those with a detectable characteristic spin, such as deuterium, which may

be incorporated into the antibody by suitable labeling of nutrients for the relevant

hybridoma, for example.

The size of the subject, and the imaging system used, will determine the quantity of

imaging moiety needed to produce diagnostic images n the case of a radioisotope moiety,

for a human subject, the quantity of radioactivity injected will normally range from about 5

to 20 millicuries of technetium- 9 . The labeled antibody or antibody fragment will then

preferentially accumulate at the location of cells which contain biomarker protein. The

labeled antibody or antibody fragment can then be detected using known techniques.

Antibodies tha may be used to detect biomarker protein include any antibody,

whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal,

that bind sufficiently strongly and specifically to the biomarker protein to be detected. An

antibody ay have a ¾ of at most about 1 *M M 1 , ( , )" M, Μ

or . The phrase "specifically binds" refers to binding of, for example, an antibody to

an epitope or antigen or antigenic determinant in such a manner that binding can b

clispiaeed or competed with a second preparation of identical or similar epitope, antigen or

antigenic determinant. An ant ody may bind preferentially to the biomarker protein

re tive to other proteins, such as re ted proteins.

Antibodies are commercially available or may be prepared according to methods

known in the art.

Antibodies and derivatives thereof that ay be used encompass polyclonal or

monoclonal antibodies, chimeric, human, humanized, primat ed ( D -grafted), veneered

or single-chain antibodies as well as functional fragments, i.e., biomarker protein binding

fragments, of antibodies. For example, antibody fragments capable of binding to a

biomarker protein or portions thereof, including, bu not limited to, Fv, Fab, Fab' and F ab'

2 fragments can be used. Such fragments can be produced b enzymatic cleavage or by

recombinant techniques. For example, papain or pepsin cleavage ca generate Fab or F(ah')

2 fragments, respectively. Other proteases with the requisite substrate specificity can also

be used to generate Fab or F(ab') 2 fragments. Antibodies can also bo produced in a variety

o truncated forms using antibody genes in which one or more stop codons have been

introduced upstream of the natural stop site. Fo example, a chimeric gene encoding a F(ab')

2 heavy chain portion can be designed to include DNA sequences encoding the € , domain

and hinge region of the heavy chain.

Synthetic and engineered antibodies are described in, e.g., ab ly et a U.S. Pat

No. 4,816,56? Cabiiiy et aL European Patent No, 0,125,023 B ; Boss et aL US, Pat. No.

4,816,397; Boss et a!., European Patent No. 0,120,694 ; Neuberger, M . S . et aL WO

86/01533; Neuberger, . S. et al., European Patent No. 0, 4,276 Bl; Winter, U.S. Pat.

No. 5,2.25,539; Winter, European Patent No. 0,239,400 Bl; Queen t al, European Patent

No. 0451216 Bl; and Pad!an, E. A. et al, EP 0519596 A . See also, Newman, , et al,

Biotechnology, : 55- 460 { 92), regarding primatized antibody, and Ladner et aL

U.S. Pat. No. 4,946,778 and Bird, . E. et a!., Science, 242: 423-426 ( 88)) regarding

single-chain antibodies. Antibodies produced from a library, e.g., phage display library,

may also be used.

n so e embodiments, agents that specifically bind to a biomarker protein other

than antibodies are used, such as peptides. Peptides that specifically bind to a biomarker

protein can b identified by any means known n the ait. For example, specific peptide

binders of a biomarker protein can be screened for using peptide phage display libraries.

d . Methods for Detection of Biomarker Structural Alterations

The following illustrative methods can be used to identify the presence of a

structural alteration in a biomarker nucleic acid and/or biomarker polypeptide molecule in

order to, for example, identify sequences or agents that affect translation of iron-sulfur

cluster biosynthesis-related genes.

in certain embodiments, detection of the alteration involves the use of a

probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Pat, os, 4,683,195 and

4,683,202), such as anchor PCR or RACE. PCR, or, alternatively, in a ligation chain

reaction (LCR) (see, e.g., Landegran et (1988) Science 2 1:1077-1080; and akazawa

et al. ( 994) Proc. Natl. Acad. Set. USA 91:360-364.), the latter of which can be particularly

useful for detecting point mutations in a biomarker nucleic acid such as a biomarker gene

(see Abravaya et al. (1995) Nucleic Acids Res. 23:675-682). This method can include the

steps of collecting a sample of ceils from a subject, isolating nucleic acid ( . . genomic,

R A or both) f om the cells of the sample, contacting t nucleic ac sample with one or

ore primers which specifically hybridize to a biomarker gene under conditions such that

hybridization and amplification of the biomarker gene (if present) occ urs, and detecting the

presence or absence o an amplification product, or defecting he size of the amplification

product and comparing th length to a control sample t is anticipated that PCR and/or

C may be desirable to use as a preliminary amplification step in conjunction with any of

the techniques used for detecting mutations described herein.

Alternative amplification methods include: self sustained sequence replication

(Guatelli, J . C. et al. ( . 90) Proc. Natl. Acad. Sci. USA 87: 874-1.878), transcriptional

amplification system (K oh, D. Y. e al. (.1 89) Proc. Natl. Acad. Sci. USA 86: .1 3- 77)

Q-Beta Rcplicasc (Lizardi, P . M. et al. ( 1 88) Bio-Technology 6 : 1 7), or any other

nucleic acid amplification method, followed by the detection of the amplified molecules

using techniques well known to those of skill in the art. These detection schemes are

especially useful for the detection of nucleic acid molecules if such molecules are present in

very low nu bers

n an alternative embodiment, mutations in a biomarker nucleic acid from a sample

cell can be identified by alterations in restriction enzyme cleavage patterns. For example,

sample and control DNA is isolated, amplified (optionally), digested with one or more

restriction e do c!eases, and fragment length sizes are determined by gel electrophoresis

and compared. Differences in fragment length sizes between sample and control DNA

indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes

(see, for example, U.S. Pat, No 5,498,53 ) can be used to score for the presence of specific

mutations by development or loss of a ribozyme cleavage site.

In other embodiments, genetic mutations in biomarker nucleic acid can be identified

by hybridizing a sample and control nucleic acids, e.g., DNA or RNA„ to high density

arrays containing hundreds or thousands of oligonucleotide probes (Crontn, M . T, et al.

996) Hum. Muta 7:244-255; Kozal M. J, et al. ( 996) Nat. M ed . 2:753-759). For

example, biomarker genetic mutations can be identified in two dimensional arrays

containing light-generated DNA probes as described in Croni et al 1 96) supra. Briefly,

a first hybridization arra of probes can be used to scan through long stretches of DNA in a

sample and control to identify base changes between the sequences by making linear arrays

of sequential overlapping probes. This step allows the identification of point mutations.

This step is followed by a second hybridization array that allows the characterization o

specific mutations by using smaller, specialized probe arrays complementary to all variants

or mutations detected . Each mutation array is composed of parallel probe sets, one

complementary to the wild-type gene and the other complementary to the mutant gene.

Such biomarker genetic mutations can be identified n a . variety of contex ts, including, for

example, g r l e and somatic mutations.

n yet another embodiment, any of a variety of sequencing reactions known in the

art can be used to directly sequence biomarker gene and detect mutations by comparing

the sequence of the sample biomarker with the corresponding wild-type (control) sequence.

Examples of sequencing reactions include those based on techniques developed by Maxam

and Gilbert ( 977) Pr . Nad Acad. Sc USA 74 :560 or Sanger ( 1977) Proc. Natl. Acad

Set USA 74:5463. It is also contemplated that any of a variety of automated sequencing

procedures can be utilized when performing the diagnostic assays (Naeve (1995)

Biotech l iq s 19:448-53), including sequencing by mass spectrometry (see, e.g. , PCX

International Publication No. WO 94/ 10 1; Cohen el l. (1996) Adv. hr at gr. 36:127-

2; and Griffin et al ( 93) Appl. Bi c m. Bi t cfm i 38:147-159).

Other methods for detecting mutations in biomarker gene inc de methods i

which protection fr o cleavage agents is used to detect mismatched bases in RNA/RNA or

RNA/DNA heterodup exes (Myers et al (1985) Science 230:1242). In general, the art

technique of "mismatch cleavage" starts by providing heterod p e es formed by

hybridizing (labeled) R A or D A containing the wild-type biomarker sequence with

potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded

duplexes ar treated with a agent which cleaves single-stranded regions of the duplex such

as which will exist due to base pair mismatches between the control and sample strands.

For instance, RNA/DNA duplexes can be treated with RNase and D A D A hybrids

treated with SI nuclease to enzymatically digest the mismatched regions. In other

embodiments, either D /DMA or R /D ditpiexes can be treated with hydroxyiaraine

or osmium tetroxide and with piperidine in order to digest mismatched regions. After

digestion of the mismatched regions the resulting material is then separated by size on

denaturing po yac ylam de gels to determine the site of mutation. See, for example, Cotton

et al. ( 988) Proc. Natl. Acad. Set. USA 85:4397 and Saleeba et al (1992) Methods

- n o -

Enzymoi. 2 7:286-295. n a preferred embodiment, the control DMA or A can be

labeled for defection.

in still another embodiment, the mismatch cleavage reaction employs one or ore

proteins that recognize mismatched base pairs in double-stranded DMA (so called "DNA

mismatch repair" enzymes) in defined systems for detecting and mapping poi t mutations

in biomarker cD s obtained from samples of cells. For example, the utY enzyme of

colt cleaves A at G/A mismatches and the thymidine DNA glyeosylase from HeLa ceils

cleaves T at G/T mismatches (Hsu et al. ( 94 ) Carcinogenesis 15: 57- 662). According

to an exemplary embodiment, a probe based on a biomarker sequence, e.g. , a wild-type

biomarker treated with a DNA mismatch repair enzyme, and the cleavage products, if any,

can be detected from electrophoresis protocols or the like (e.g., U.S. Pat. No. 5.459.039.)

n other embodiments, alterations in eiectrophoretic mobility can be used to identify

mutations biomarker genes. For example, single strand conformation polymorphism

SC may be used to detect differences in eiectrophoretic mobility between mutant and

wild type nucleic acids (Orita ei a . (1989) Pr Natl. Acad. S t USA 86:2766; see also

Cotton ( ) Mi Res. 285:125-144 and Hayashi (1992) Gene Anal Tech. Appl 9:73-

79), Single-stranded DNA fragments of sample and control biomarker nucleic acids will be

denatured and allowed to renature. The secondary structure of single-stranded nucleic acids

varies according to sequence, the resulting alteration in eiectrophoretic mobility enables the

detection of even a single base change. The DNA fragments ay be labeled or detected

with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather

tha DNA), in which the secondary structure is more sensitive to a change in sequence. In

a preferred embodiment, the subject- method utilizes heteroduplcx analysis to separate

doable stranded heteroduplcx molecules on the basis of changes in eiectrophoretic mobility

(Keen et al. (19 ) Trends Genet. 7:5).

In ye another embodiment th movement of mutant or wild-type fragments i

polyacrylamide gels containing a gradient of denaturant is assayed using denaturing

gradient gel electrophoresis (DOGE) (Myers et i. ( 85) Nature 3:495). When D GE

is use as the method of analysis, DNA will be modified to ensure that it does not

completely denature, for example by adding a GC clamp of approximately 40 bp o ig

mel ng GC-rich DNA by P R, In a further embodiment, a temperature gradient is use in

place of a denaturing gradient to identify differences in the mobil it of control and sample

DNA (Rosenbaum and Reissner (1987) i p ys. Chem. 265: 2753)

Examples of other techniques for detecting point mutations include, but are not

limited to, selective oligonucleotide hybridization, selective amplification, or selective

primer extension. For example, oligonucleotide primers may be prepared in which the

known mutation is placed centrally and t en hybridized to target DNA under conditions

which permit hybridization onl a perfect match is found (Saiki et al. ( 1 86) Nature

324 3; Saiki e a (1989) Pro Natl. Acad. Set USA 86:6230). Such allele specific

oligonucleotides ar hybridized to PCR amplified target DNA or a number of different

mutations whe the oligonucleotides are attached to the hybridizing membrane a d

hybridized with labeled target DNA.

Alternatively, allele specific amplification technology which depends on selective

PCR amplification may be used in conjunction with the instant invention. Oligonucleotides

used as primers for specific amplification may carry the mutation of interest in the center of

the molecule (so that amplification depends on differentia! hybridization) (Gibbs el al.

(1989) Nucleic Ackk Res'. 17:2437-2448) or at the extreme 3' end of one primer where,

under appropriate conditions, mismatch can prevent, or reduce polymerase extension

(Prossner ( 93) Ti ch :238). In addition it may be desirable to introduce a novel

restriction s e in the region of the mutation to create cleavage-based detection (Gasparini e

al. (1992) Mol. Cell Probes 6 : . t is anticipated that in certain embodiments amplification

ma also b performed using Taq ligase for amplification (Barany (1991) Proc, Natl. Acad.

Sci USA 88:1 89). In such cases,, ligation will occur only i there is a perfect match at the 3'

end of the 5' sequence making it possible to detect the presence of a known mutation at a

specific site by looking for the presence or absence of amplification.

. Anti-Cancer Therapies

The efficacy of anti-cancer therapy . iron-sulfur cluster biosynthesis pathway

inhibitory therapy) is predicted according to biomarker presence, absence, amount and/or

activity associated with a cancer (e.g., cancer) in a subject according to the methods

described herein. In one embodiment, such anti-cancer therapy (e.g., iron-sulfur cluster

biosynthesis pathway inhibitory therapy) or combinations of therapies (e.g. , anti-PD- and

anti-immunoi bibitory- therapies) can e administered to a desired subject or once a subject

is indicated as being a likely responder to anti-cancer therapy (e.g., iron-sulfur cluster

biosynthesis pathway inhibitory therapy) n another embodiment, such anti-cancer therapy

(e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy) can be avoided once a

subject is indicated as not being a likely responder to he anti-cancer therapy (e.g., iron-

sulfur cluster biosynthesis pathway inhibitory therapy) and an alternative treatment

regimen, such as targeted and/or unta ge d anti-cancer therapies can be administered.

Combination therapies are also contemplated and can com p se , for example, one or more

chemotherapeutie agents and radiation, o e or more chemotherapeutie agents and

immunotherapy, or one or more chemotherapeutie agents, radiation and chemotherapy,

each combination of which can be with or without anti-cancer therapy (e.g., iron-sulfur

cluster biosynthesis pathway inhibitory therapy).

The iron-sulfur cluster biosynthesis pathway and exe p lar agents useful for

inhibiting the iron-sulfur cluster biosynthesis pathway, or other h o arke s described

herein, have been described above.

The term: "targeted therapy" refers to administration of agents that selectively

interact with a . chos biomol cu e to thereby treat cancer. For example, targeted thcrepy

regarding the inhibition of immune checkpoint inhibitor is useful in combination with the

methods o f the present invention. The term "immune checkpoint inhibitor" means a group

of molecules on the cell surface of CD and/or CD8-¾- T ceils that fine-tune immune

responses by down-modulating or inhibiting an anti-tumor immune response. mmune

checkpoint proteins are well known in the ar and include, without limitation, CTLA-4, Pi

1, VISTA, 7- 12 , B7-H3, PD-Ll, Β7-Ϊ 4, B 7 6 2B COS, VE , PD-L2. C D 60.

gp49B, P -B .1 fam il receptors, TIM- , Τ Ϊ -3, Τ ΪΜ-4, LAG-3, BTLA, SI Pa p a

(CD47), CD48, 2B4 (CD244), B 7 B7.2, iLT-2, iLT-4, T G T , and A2aR (see, for

example, W 20 12/ 77624). Inhibition of o e or more immune checkpoint inhibitors can

block or otherwise neutralize inhibitory signaling to thereb upregulate a n immune

response in order to more efficaciously treat cancer.

immunotherapy is one form of targeted therapy that may comprise, for example, the

use of cancer vaccines and/or sensitized antigen presenting cells. For example, an oncolytic

virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells

unharmed, making them potentially useful in cancer therapy. Replication of oncolytic

viruses both facilitates tumor cell destruction and also produces dose amplification a the

tumor site. They may also act as vectors for anticancer genes, allowing them to b e

specifically deli vered to the tumor site. The m unot erapy can involve passi ve immunity

for short-term protection of a host, achieved by the administration of pre-formed antibody

directed against a cancer antigen or disease antigen { ?. , administration of a monoclonal

antibody, optionally linked to a chemotherapeutie agent or toxin, to a tumor antigen). For

example, anti-VEGF and TO inhibitors are .known to be effective in treating renal cell

carcinoma. Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized

epitopes of cancer ceil lines. Alternatively, antisense polynucleotides, ribozymes, RNA

interference molecules, triple helix polynucleotides and the like, can be used to selectively

modulate biomolecules are linked to the initi ation progression, and/or pathology of a

umor or cancer.

The term ntargeted therapy" referes to admi nistration of agents that do not

selectively interact with a chosen biomol c le yet treat cancer. Representative examples of

untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation

therapy.

n one embodiment, mitochondrial coiactor therapy is useful For example, vitamin

E is known to block c ll death via ferroptosis such that mitochondrial coiactor therapy can

alleviate or improve any toxicity associated with ISC biosynthesis pathway inhibition.

Mitochondrial cofaetor therapies are well known in the art and include, for example,

coenzyme 0 (ubiquinone), riboflavin, thiamin, niacin, vitamin K (phylloq non an

menadione), creatine, carnitine, an other antioxidants such as ascorbic acid and lipoic acid

(see, for example, an- age e . l (2003),/ Am. Diet. Assoc. 103:1029-1038 and Parik el

l. (2009) rr. Tre Options Neurol. 11:4.14-430).

n one embodiment, chemotherapy s used. Chemotherapy includes the

administration of a chemotherapeutie agent. Such a chemotherapeutie agent may be, but s

no limited to, those selected from among the following groups of compounds: platinum

compounds, cytotoxic antibiotics, antimetabolities, an t -mitotic agents, alkylating agents,

arsenic compounds, D A topoisomerase inhibitors, taxanes, nucleoside analogues, plant

alkaloids, and toxins; and synthetic derivatives thereof. Exemplary compounds include, but

are no limited o, alkylating agents: cispfatin, treos fan and trofosfamide; p lant alkaloids:

vinblastine, paclitaxel, docetaxol; DNA topoisomerase inhibitors: teniposide, crisnatol, and

mitomycin; anti-folates: methotrexate, mycophetiolic acid, and hydroxyurea; pyrimidine

analogs: 5-fluorouracil, doxi ridin , and cytosine atabinoside; purine analogs:

mercaptopurine and thioguanine; DNA antimetabolites: 2'-deoxy-5-fl uorouridine,

aphidicolin glycinate, and pyrazoioiniidazole; and antimitotic agents: halichondrim

colchicine, and rhi oxi Compositions comprising one or more chemotherapeutie agents

(e.g., FLAG, CHOP) may also be used. FLAG comprises darabine, cytosine arabinoside

(Ara-C) and G-CSF CHOP comprises cyclophosphamide, vincristine, doxorubicin, and

prednisone. In another embodiments, PARP (t ., PARP-l and/or PARP-2) inhibitors ar

used a d such inhibitors arc wel known in the art (e.g., Olaparib, ABT-8 , BS!-20! ,

BGP-15 (N-Gene Research Laboratories, inc.); lN - 0 i (Inoiek Pharmaceuticals Inc.);

PJ34 (Sor no et al., 20 ; Paeher et ai, 2002b): 3-aminoberizamide (Trevigen); 4-amirto-

l ,8- aph halimide; (Trevigen); 6(5H)-phetianthridinone (Trevigen); b n amide (U.S. Pat,

Re 36,397); and N 1025 (Bowman et al). The mechanism of action is generally related to

t e ability of PARP inhibitors to bind PARP and decrease ts activity. PARP catalyzes the

conversion of .beta.-uicotiuamide adenine diuu eot de (NAD+) into nicotinamide and

po -ADP- ose (PAR). Both poly (ADP-ribose) and PARP have bee linked to

regulation of transcription, cell proliferation, genomic stability, and carcinogenesis

(Bouchard V. J . et.al. Experimental Hematology, Volume 31, Number 6, June 2003, pp.

446-454(9); Hereeg 2.; Wang Z.-Q, Mutation Research/Fundamental and Molecular

Mechanisms of Mutagenesis, Volume 477, Number 1, 2 j n, 2001, pp. 97-1 10(14)).

Poly(ADP-ribose) polymerase i (PARP!) is a key molecule n the repair of DNA single-

strand breaks (SSBs .) (de Murcia J. et al. 1997. Proc Na l Acad Sci USA 94:7303-7307;

Schreiber V, Dan e F A e J de Murcia G (2006) Nat Rev Mol Ce l Bio 7:517-528;

Wang Z Q, et al. (1997 Genes e :2347-2 8 . Knockout of SSB repair by inhibition

of PARPl function induces DNA double-strand breaks (DSBs) that can trigger synthetic

lethality in cancer cells with defective homology-directed DSB repair (Bryant E et al

(2005) Nature 434:913-917; Fa ner H, t al. (2005) Nature 434:917-921). The foregoing

examples of ehemotherapeittie agents are illustrative, and are not intended to be limiting.

In another embodiment, radiation th erap is used. The radiation used in radiation

therapy can be ionizing radiation. Radiation therapy can also be gamma rays. X-rays, or

proton beams. .Examples of radiation therapy include, but are no limited to, external-beam

radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium),

radioisotopes such as strontium-89 thoracic radiation therapy, intraperitoneal P-32

radiatton therapy, and/or total abdominal and pelvic radiation therapy. For a general

overview of radiation therapy, see He!imaa, Chapter : Principles of Cancer Management:

Radiation Therapy, 6th edition, 20 , DeVita et ai., eds., J . B . Lippencott Company,

Philadelphia. The radiation therapy can be administered as external b a radiation or

teletherapy wherein the radiation is directed from remote source. The radiation treatment

can aiso be administered as internal therapy or brachytherapy wherein a radioactive source

is placed inside the body close to cancer cells or a tumor mass. Also encompassed is the use

of p otody a ic therapy comprising the administration of photosensitizers, such as

hematoporphyrin and its derivatives, V r op rfr (BPD - A), phthalocyanine,

photosensitizer Pc4, demethoxy- hypocrellin A; and 2BA-2-DMHA.

n another embodiment, hormone therapy is used. Hormonal therapeutic treatments

can comprise, fo example, hormonal agonists, ormonal antagonists .g flutanride,

bicaiutamide, tamoxifen, raloxifene, leupro!icle acetate (L P . N), L - H antagonists),

inhibitors of hormone biosynthesis and processing, and steroids (e.g. , dexamethasone,

retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotestosterone,

glucocorticoids, mineralocorttcoids, estrogen, testosterone, progestins), vitamin A

derivatives (e.g., all-trans retinoic aci (ATRA)); vitamin ) 3 analogs; antigestagens (e.g.,

mifepristone, onapristone), or antiandrogens i . . cyproterone acetate).

in another embodiment, hyperthermia, a procedure in which body tissue is exposed

to high temperatures (up to tV . is used. Heat ay he p shrink tumors by damaging

cells or depriving them of substances they need to live. Hyperthermia therapy cart be local,

regional, ari whole-body hyperthermia, using external and internal heating devices.

Hyperthermia is almost always used with other forms of therapy (e.g., radiation therapy,

chemotherapy, and biological therapy) to try to increase their effectiveness. Local

hyperthermia refers to heat that is applied to a very small area, such as a tumor. The area

ma be heated externally with high-frequency waves aimed at a tumor from a device

outside the body. To achieve internal heating, one of several types of sterile probes may b

used, including thin, heated wires or hollow tubes filled with warm water; implanted

microwave antennae; and radiofrequency electrodes. In regional hyperthermia, an organ or

a !imb is heated. Magnets and devices that produce high e ergy are placed over the region

to be heated n another approach, called perfusion, some of the patient's blood is removed-

heated, and then pumped (perfused) into the region that is to be heated internally. Whole-

body heating is used to treat metastatic cancer that has spread throughout the body. It can

be accomplished using warm-water blankets, hot wax, inductive coils (like those in electric

biatikets), or thermal chambers (similar to large incubators). Hyperthermia does not cause

any marked increase in radiation side effects or complications. e at applied directly to the

skin, however, can cause discomfort or even significant local pain in about half the patients

treated it can also cause blisters, which generally heal rapidly

still another embodiment, photodynamic therapy (also called PDT, photoradiation

therapy, phototherapy, or photochemotherapy) i used for the treatment of some types of

cancer. t is based on the discovery that certain chemicals known as photosensitizing agents

can ki l one-celled organisms when the organisms are exposed to a particular type of light.

PDT destroys cancer cells through the use of a fixed- frequency laser light in combination

with a photosensitizing agent n PDT, the photosensitizing a nt s injected into the

bloodstream and absorbed by cells all over the body. The agent remains in cancer ce ls for

a longer time than it does in normal cells. When the treated cancer cells are exposed to

laser ght, the photosensitizing agent absorbs the l ght and produces a acti e form of

oxygen thai destroys the treated cancer ceils. Light exposure must be timed carefully so

that it occurs when most of the photosensitizing agent has left healthy cells but is still

present in the cancer cells. The laser light used in PDT can be directed through a fiber¬

optic (a very thin glass strand). The fiber-optic is placed close to the cancer to deliver th

proper amount of light The fiber-optic can be directed through a bronchoscope into the

lungs for the treatment of lung cancer or through an endoscope into the esophagus for the

treatment of esophageal cancer. An advantage of PDT is that i causes minima] damage to

healthy tissue. However, because the laser light currently in use cannot pass through more

than about 3 centimeters of tissue (a little more than one and an eighth inch), PDT is mainly

used to treat tumors on or just under the skin or on the lining o internal organs.

Photodynamic therapy makes the skin and eyes sensitive to light for 6 weeks or more after

treatment. Patients ar advised to avoid direct sunlight and bright indoor light for at least

weeks. If patients must go outdoors, they nee to wear protective clothing, including

sunglasses. Other temporary side effects of PDT are related to the treatment of specific

areas and can include coughing, trouble swallowing, abdominal pain, and painful breathing

or shortness of breath. In December 95, the .S. Food and Drug Administration (FD A)

approved photosensitizing agent called porftmer sodium, or PhotofriniK), to relieve

symptoms of esophageal cancer that is causing an obstruction and for esophageal cancer

thai cannot be satisfactorily treated with lasers alone. In January 98 the DA approved

porfimer sodium for the treatment of early aonsmall ce ong cancer in patients for whom

the usual treatments for lung cancer are not appropriate. The National Cancer Institute and

other institutions are supporting clinical trials (research studies) to evaluate the use of

photodynamic therapy for several types of cancer, including cancers of the bladder, brain,

larynx, and oral cavity.

in yet another embodiment laser therapy is used to harness high-intensity light to

destroy cancer cells. This technique is often used to relieve symptoms of cancer such as

bleeding or obstruction, cspecialiv when the cancer cannot be cured by other trcatnicnis. It

may also be used to treat cancer by shrinking or destroying tumors. The term "laser" stands

for light amplification by stimulated emission of radiation. Ordinary light, such as that

from a light bulb, has many wavelengths arid spreads in a l directions. Laser light, on the

other hand, has a specific wavelength arid is focused in a narrow beam. This type of high-

intensity light contains a lot of energy. Lasers are very powerful and may be used to cut

through steel or to shape diamonds. Lasers also ca be used for very precise surgical work,

such as repairing a damaged retina in the eye or cutting through tissue (in place of a

scalpel}. Although there are several different kinds of lasers, only three kinds have gained

wide use in medicine: Carbon dioxide (CO;) aser T s type of laser can remove thin

layers from the skin's surface without penetrating deeper layers. This technique is

particularly useful in treating tumors that have no spread deep into the skin and certain

precancerous conditions. As an alternative to traditional scalpel surgery, the C laser is

also able to cut the skin. The laser is used in this way to remove skin cancers.

eody um:yt ri u n-alumin »--garne d:YAG) laser— Light from this laser ca penetrate

deeper into tissue than light from the other types of lasers, and it can cause blood to clot

quickly. It can be carried through optical fibers to less accessible parts of the body. This

type of laser is sometimes used to treat throat cancers. Argon laser- This laser can pass

through only superficial layers of tissue and is therefore useful in dermatology and n ey

surgery. It also is used with light-sensitive dyes to treat tumors in a procedure known as

phoiodynamic therapy (PDT). Lasers have several advantages over standard surgical tools,

including: Lasers are more precise than scalpels. Tissue near an incision is protected, since

there is little contact with surrounding skin or other tissue. The hear produced by lasers

sterilizes the surgery site, thus reducing the risk of infection. Less operating time may be

needed because the precision of the laser allows for a smaller incision. Healing time is

often shortened; since laser heat seals blood vessels, there is less bleeding, swelling, or

scarring. Laser surgery may be less complicated. For example, with fiber optics, laser light

can be directed to parts of the body without making a large incision. More procedures ay

be done on an outpatient basis. Lasers can be used in two ways to teat cancer; by

shrinking or destroying a tumor with heat, or by activating a chemical—known as

photosensitizing agent~~that destroys cancer ceils n PDT, a photosensitizing agent is

retained in cancer cells and can be stimulated by light to cause a reaction that kills cancer

cells. CO and d YAG lasers are used to sh nk or destroy tumors. They may be used

with endoscopes, tubes that allow physicians to see into certain areas of the body, such as

the bladder. The light from some lasers cm be transmitted through a flexible endoscope

fitted with fiber optics. This allows physicians to see and work in parts of the body that

could not otherwise be reached except by surgery and therefore allows very precise aiming

of the laser beam. Lasers also may be used with low-power microscopes, givi g the doctor

a clear view of the site being treated. Used with other instruments, laser systems can

produce a cutting area as small a 200 microns in diameter—less than the width of a ver

fi n thread. Lasers are used to treat many types of cancer. Laser surgery is a standard

treatment for certain stages of glottis (vocal cord), cervical skin, lung, vaginal, vulvar, and

penile cancers. In addition to its use to destroy the cancer, laser surgery is also used to help

relieve symptoms caused by cancer (palliative care). For example, lasers may b used to

shrink or destroy a tumor that is blocking a patient's trachea (windpipe), making it easier to

breathe. It is also sometimes used for palliation in colorectal and anal cancer. Laser-

induced interstitial thermotherapy (LOT) is one of the mos recent developments in laser

therapy. LOT uses the same idea as a cancer treatment called hyperthermia; that heat may

help shrink tumors by damaging cells or depriving them of substances they need to live n

this treatment, lasers are directed to interstitial areas (areas between organs) in the body.

The laser light then raises the temperature of the tumor, which damages or destroys cancer

cells.

The duration and/or dose of treatment with anti-cancer therapy (e.g iron-sulfur

cluster biosynthesis pathway inhibitory therapy) may vary according to th particular iron-

sulfur cluster biosynthesis pathway inhibitor agent or combination thereof. An appropriate

treatment time for particular cancer therapeutic agent will be appreciated by the skilled

artisan. The invention contemplates the continued assessment of optimal treatment

schedules for each cancer therapeutic agent, where the phenotype of the cancer of the

subject as determined b the methods of the invention s a factor n determining optimal

treatment doses and schedules.

Any means for the introduction of a polynucleotide into mammals, huma or non-

human, or cells thereof may be adapted to the practice of this invention for the delivery of

the various constructs of the invention into the intended recipient. n one embodiment of

the invention, the D A constructs are delivered to ce ls by rans ct on, i.e. by delivery of

'"naked" DNA or in a complex with a colloidal dispersion system. A colloidal system

includes macromolecule complexes, nanocapsules, microspheres, beads, and lipkl-based

systems including oil-in- ate r emulsions, micelles, mixed micelles, a d liposomes. The

preferred colloidal system of this invention is a ip d-eon p exed or Uposome-formulated

DNA. the former approach, prior to formulation of DNA, e.g., with lipid, a plasmid

containing a ransge e bearing the desired D A constructs may first be experimentally

optimized for expression (e.g. inclusion of an intron in the 5' untranslated region and

elimination of unnecessary sequences (Feigner, et a , Ann NY Acad Sci 126- 9 , 95).

Formulation of DNA, e.g. with various lipid or liposome materials, may then be effected

using known methods and materials and delivered to the recipient mammal. See, e.g.,

Canonieo et ai. Am J Respir Cel Mo Biol 0:24-29, 94; Tsan e al, Am Physiol 268;

Alton et al., Nat Genet. 5: .35- 2, 1.993 and U.S. patent No. 5,679,647 by Carson et al.

The targeting o f liposomes can b e classified based on anatomical and mechanistic

factors. Anatomical classification is based on the level of selectivity, for example, organ-

specific, cell-specific, an organelie-speeifie. Mechanistic targeting can be distinguished

based upon whether it is passive or active. Passive targeting utilizes die natural tendency of

liposomes to distribute io ceils of he reticuloendothelial s tem (RES) in organs, which

contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the

liposome by coupling d e liposome to a specific igand such as a monoclonal antibody

sugar, glycoiipid, or protein, or by changing th composition or size of the liposome in

order to achieve targeting to organs and cell types other than the naturally occurring sites of

localization.

The surface of d e targeted deli very system may be modified in a variety of ways.

n the ease of a liposomal targeted delivery system, lipid groups can be incorporated into

the lipid bi ayer of the liposome in order to maintain the targeting Iigand in stable

association with the liposomal bilayer. Various linking groups can be used for joining the

lipid chains to the targeting iigand. Naked DN or DNA associated with a delivery

vehicle, e.g., liposomes, can be administered to several sites in a subject (see below).

Nucleic acids can be delivered i an desired vector. These include viral or non-

viral vectors, including adenovirus vectors, adeno-associatcd virus vectors, .retrovirus

vectors, entivirus vectors, an plasmid vectors. Exemplary types of viruses include HSV

(herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency

virus), V (bovine immunodeficiency virus), and MLV (murine leukemia virus) Nucieic

- 1.20 -

acids can be administered in any desired format that provides sufficiently efficietu delivers'

levels, including in virus particles, in liposomes, i nanoparticles, and comp!exed to

polymers.

The nucleic acids encoding a protein or nucleic acid of interest may be in a p as i

or viral vector, or other vector as is known in the art. Such vectors are well known and an

can be selected for a par iculat application. n one embodiment of the invention, the gene

delivery vehicle comprises a promoter and a deinethylase coding sequence. Preferred

promoters are tissue-specific promoters and promoters which are activated by cellular

proliferation, such as the thymidine kinase a d thymidilate synthase promoters. Other

preferred promoters include promoters which are activatable by infection with a virus, such

as the - and β-iuterferon promoters, and promoters which are activatable by a hormone,

such as estrogen. Other promoters which can be used include the Moloney virus LTR, the

CMV promoter, and the ous albumin promoter, A promoter may be constitutive or

inducible.

in another embodiment, naked polynucleotide molecules are used as gene delivery

vehicles, as described in WO 90/ 092 and U.S. Patent 5,580,859. Such gene delivery

vehicles can be either growth factor D A or NA and, in certain embodiments, are linked

to killed adenovirus. Curie! et al. Hum. Gene. Ther. 3:147-154, 1992. Other vehicles

which can optionally be used include DNA-hgand (W t et al., J . Biol Chem.

264:16985-16987, 1989), hpid-DNA combinations (Feigner et al., Proc. Natl. Acad. Sci.

USA 84:7413 7417, 89), liposomes (Wang et ai„ Proc, Natl. Acad. Sci. 84:7851-7855,

1987) and mieroprojeetiles (Williams e a ., Proc. Natl. Acad. Sci. 88:2726-2730, 1991).

A gene delivery vehicle can optionally comprise viral sequences such as a viral

origin of replication or packaging signal These viral sequences can be selected from

viruses such as asirovirus, eoronavirus, orthomyxovirus, papovavirus, paramyxovirus,

parvovirus, picornaviats, poxvirus, retrovirus, togavirus or adenovirus. In a preferred

embodiment, the growth factor gene delivery vehicle is a recombinant retroviral vector.

Recombinant retroviruses and various uses thereof have been described in numerous

references including, for example, Mann et al., Ce l 33:153, 1983, Cane and Mulligan,

Proc. N a Acad. Sci. A 81:6349, 1.984, Miller eta!., Human Gene Therapy 1:5-14,

1990, U.S. Pate t N os 4,405,712, 4,861,719, and 4,980,289, and PC Application s .

WO 89/02,468, WO 89/05,349, and WO 90/02,806. Numerous retroviral gene delivery

vehicles can be utilized in the present invention, including for example those described n

EP 0 4 5 731; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent

No. 5,219,740; WO 93 30; WO 93 21 ; V le and Hart, Cancer Res. 53:3860-3864.

93; Vile and Hart, Cancer Res. 53:962-967, 93; Ram et a . Cancer Res. 53:83-88,

993; Takamiya e al., J. Neurosci. Res. 33:493-503, 1992; Baba e al., J . Neurosurg.

79:729-735. 1993 (U.S. Patent No. 4,777,127, OB 2,200,651, EP 0,345,242 and

W0 /0 05).

Other viral vector systems that can be used to deliver a polynucleotide of the

invention have been derived from herpes vims, g., Herpes Simplex Vi s (U.S. Patent No.

5,631,236 by Woo et al, issued May 20, 97 and WO 00/0 9 b e r vex), vaccinia

virus (Rklgcway ( 988) R dge ay , "Mammalian expression vectors," In; Rodriguez R ,

Denhardt I) T ed. Vectors: A survey of molecular cloning vectors and their uses.

Stoneha Butterworih,; Baichwal and Sugden (1986) "Vectors for gene transfer derived

from animal DNA viruses: Transient and stable expression of transferred genes," in:

K ch apat R, ed. Gene transfer. New York; Plenum Press; Coupar et al. (1988) Gene,

68: -10), and several RNA viruses. Preferred viruses include an aiphavirus, a poxivirus,

arena virus, a vaccinia virus, a polio virus, and the like. They offer several attractive

features for various mammalian cells (Friedmann (1989) Science, 244:1275-1281;

Ridgeway, 88, supra; Baichwal and Sugden, 1986, s pra Coupar et a , 1988; Horwich et.

al.(1990) J.Virol., 64:642-650).

n other embodiments, target DNA in the genome can be manipulated using well-

known methods in the art. For example, the target DNA in the genome ca be manipulated

by deletion, insertion, and/or mutation are retroviral insertion, artificial chromosome

techniques, gene insertion, random insertion with tissue specific promoters, gene targeting,

transposabie elements and/or any other method for introducing foreign DNA or producing

modified DNA/modified nuclear D . Other modification techniques include deleting

DNA sequences from a genome and/or altering nuclear DNA sequences. Nuclear DNA

sequences, for example, may be altered y site-directed mutagenesis.

In other embodiments, recombinant biomarkcr polypeptides, and fragments thereof

can be administered to subjects n sotne embodiments, fusion proteins can be constructed

and administered which have enhanced biological properties. In addition, the biomarker

polypeptides, and fragment thereof, can be modified according to well-known

pharmacological methods n the art (e.g., pegylation, glycosylation, oiigotnertzation, etc.) in

order to further enhance desirable biological activities, such as increased bioavaiiabiiity aad

decreased proteolytic degradation.

. . lineal Efficacy

Clinical efficacy can be measured b any method .known in th art. For example,

the response to an a i-ea eer therapy (e.g., iron-sulfur biosynthesis pathway

inhibitory therapy), relates to a y response of the cancer, e.g., a tumor, to the therapy,

preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or

adjuvant chemotherapy. Tumor response may be assessed in a neoadjuvant or ad va

situation where the siz of a tumor after systemic intervention can be compared to the initial

size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation and

the e l tlari ty of a tumor can be estimated histologically and compared to the cellularuy of

a tumor biopsy taken before initiation of treatment. Response may also be assessed by

caliper measurement or pathological examination of the tumor after biopsy or surgical

resection. Response may be recorded in a quantitative fashion like percentage change in

tumor volume or cellularity or using a semi-quantitative scoring system such as residual

cancer burden (Sy ans ei i , J. Clin. Oncol. (2007) 25:4414-4422) or Miller-Payne score

(Ogston et , (2003) Breast (Edinburgh, Scotland) 12:320-32?) in qualitative fashion

like "pathological complete response" (pCR), "clinical complete remission" (cCR).

clinical partial remission" (cPR), "clinical stable disease" SD), "clinical progressive

disease" (cP D) or other qual itative criteria. Assessment of tumor response may be

performed early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours,

days, weeks or preferabiv after a few months. A typical endpoint for response assessment

is upon termination of neoadjuvant chemotherapy or upo surgical removal of residual

tumor cells and/or the rumor bed.

In some embodiments, clinical efficacy of the therapeutic treatments described

herein may be determined by measuring the clinical benefit rate (CBR). The clinical

benefit rate is measured by determining the sum of the percentage of patients who are

complete remission (CR), the number of patients who are in partial remission (PR) and the

number of patients having stable disease (S ) at a time point at least 6 months ou from the

od of therapy. The shorthand .for this formula is CB R-i-PR SD o ver 6 months. In

some embodiments, the CBR for a particular tron-sulfur cluster biosynthesis pathway

inhibitor therapeutic regimen is at least 25% 30%, 3 5 40% 45%, 5 55%, 60%, 6 5

70%, 75%. 80%, 85%, or more.

Additional criteria for evaluating the response to anti-cancer therapy (e.g., iron-

sulfur cluster biosynthesis pathway inhibitory therapy) are related to "survival;' which

includes all of the following: sitrvivai until mortality, also known as overall survival

(wherein said mortality may be either irrespective of cause or rumor related); "recurrence-

free survival" (wherein the term recurrence shall include both localized and distant

recurrence); metastasis free survival; disease free survival (wherein the term disease shall

include cancer and diseases associated therewith). The length of said survival may be

calculated b reference to a defined start point (e.g., time of diagnosis or start of treatment)

and end point (e.g., death, recurrence or metastasis). In addition, criteria for efficacy of

treatment can be expanded to include response to chemotherapy, probability of survival,

probability of metastasis within a given time period, and probability o tumor recurrence.

For example, in order to determine appropriate threshold values, a particular iron-

sulfur cluster biosynthesis pathway inhibitor therapeutic regimen can be administered to a

population of subjects and the outcome can be correlated to biomarker measurements that

were determined prior to administration of any anti-cancer therapy (e.g., iron-sulfur cluster

biosynthesis pathway inhibitory therapy). The outcome measurement may be pathologic

response to therapy given in the neoadjuvant setting. Alternatively, outcome measures,

such as overall sitrvivai and disease-free survival can b monitored over a period of time for

subjects following anti-cancer therapy (e.g.. iron-sulfur cluster biosynthesis pathway

inhibitors' therapy) for who biomarker measurement values are known. In certain

embodiments, the same doses of iron-su!fur cluster biosynthesis pathwa inhibitor agents

are administered to each subject n related embodiments, the doses administered are

standard doses known in the ait for iron-sulfur cluster biosynthesis pathway inhibitor

agents. The period of time for which subjects are monitored can vary. For example,

subjects ma be monitored for at least 2, 4, 6, 8, 10, 14, , , 0, 25, 30, 35, 0, 45,

50, 55, or 60 months. Biomarker measurement threshold values that correlate to outcome

of an anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy)

can be determined using methods such as those described in the Examples section.

5 - 1 r r Uses and Methods of the Present nventio

The compositions described herein can be used in a variety of diagnostic,

prognostic, and therapeutic applications regarding hiomarkers described herein, such as

those listed n le . .

a . Screening Methods

One aspect of the present invention relates to screening assays, including non-cell

based assays. n one embodiment, the assays provide a method for identifying whether a

cancer is likely to respond to anti-cancer therapy (e.g. , iron-sulfur cluster biosynthesis

pathway inhibitory therapy) and/or whether an agent cars inhibit the growth of or kill a

cancer cell that is unlikely to respond to anti-cancer therapy (e.g., iron-sulfur cluster

biosynthesis pathway inhibitor}- therapy).

n one embodiment, the invention relates to assays for screening test agents which

bind to, or modulate the biological activity of, at least one biomarker listed in Table . m

one embodiment, a method for identifying such an agent entails determining the ability of

the agent to modulate, e.g. inhibit, the at least one biomarker fisted in Table .

In one embodiment, an assay is a ceil-free or cell-based assay, comprising

contacting at ieast one biomarker listed in Table 1 with a test agent, and determining the

ability of the test agent to modulate inhibit) the enzymatic activity of the biomarker,

such as by measuring direct binding of substrates or by measuring indirect -parameters as

described below.

n another embodiment, an assay is a cell-free or cell-based assay, comprising

contacting at least one biomarker listed in Tab e 1, with a test agent, and determining the

ability of the test agent to modulate the ability of the biomarker to regulate NFS or other

iron-sulfur cluster biosynthesis pathway member, such as by measuring direct binding of

substrates or by measuring indirect parameters as described below.

For example, n a direct binding assay, biomarker protein for their respective target

polypeptides or molecules) can be coupled with radioisotope or enzymatic label such that

binding can be determined by detecting the labeled protein or molecule n a complex. For

example, the targets can be labeled with S, C, or J , either directly or indirectly,

and the radioisotope detected by direct counting of radioemmission or by scintillation

counting. Alternatively, the targets can be enzymatieally labeled with, for example,

horseradish peroxidase, alkaline phosphatase, or hi ferase, and the enzymatic label

detected by determination of con version of an appropriate substrate to product.

Determining the interaction between biomarker and substrate can also be accomplished

using standard binding or enzymatic analysis assays. I one or more embodiments of the

abov described assay methods, it may be desirable to immobilize polypeptides or

molecules to facilitate separation of eompiexed from n omp exed forms of one or both of

e proteins or molecules, as well as to accommodate automation of the assay.

Binding of test agent to a target can be accomplished in any vessel suitable for

containing the reaetants. Non-limiting examples of s ch vessels include microliter plates,

test tubes, an micro-centrifuge tubes immobilized forms of the antibodies of the present

invention ca also include antibodies bound to a solid phase like a porous, microporous

(with an average pore diameter less than about one micron) or macroporous (wi h an

average pore diameter of snore than about microns) material, such as a membrane,

cellulose, nitrocellulose, or glass fibers; a bead, such as that made of agarose or

polyacrylamide or latex; or a surface of a dish, plate, or well, such as o made of

polystyrene,

n a alternative embodiment, determining the ability of the agent to modulate the

interaction between the biomarker and its natural binding partner can be accomplished by

determining the ability of the tes agen to modulate the activity of a polypeptide or other

product that functions downstream or upstream of its position within die ron snl ur chtster

biosynthesis pathway.

The present invention further pertains to novel agents identified by the above-

described screening assays. Accordingly, it is within the scope of this invention to further

use an agent identified as described herein in an appropriate animal model. For example,

an agent identified as described herein can be used in an animal model to determine the

efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an

antibody identified as described herein can be used in an animal model to determine the

mechanism of action of such an agent

b. Predictive Medicine

The present invention also pertains to the field of predictive medicine in which

diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic

(predictive) purposes to thereby treat an individual prophylaetieally. Accordingly, one

aspect of the present invention relates to diagnostic assays for determining the presence,

absence, amount, and/or activity level of a biomarker described herein, such as those listed

in Table 1, in the context of a biological sample (e.g., blood, serum,, cells, or t sue) to

thereby determine whether an individual afflicted with a cancer is likely to respond to anti¬

cancer therapy iron-sulfur cluster biosynthesis pathway inhibitory therapy , whether

in an original or recurrent cancer. Such assays can be used for prognostic or predictive

purpose to thereby prophylactieaily treat an individual prior to the o set or after recurrence

of a disorder characterized by or associated with bioraarker polypeptide, nucleic acid

expression or activity. The skilled artisan w ll appreciate that any method can use one or

more (e.g., combinations) of biomarkers described herein, such as those listed in Table 1,

Another aspect of the present invention pertains to monitoring the influence of

agents (e.g., drugs, compounds, and small nucleic acid-based molecules) on the expression

or activity of a bioraarker listed in Table . Thes and other agents are described in further

detail in the following sections.

Th skilled artisan will a so appreciate that, in certain embodiments, the methods

of the present invention implement a computer program and computer system. For

example, a computer program can be used to perform the algorithms described herein, A

computer system can also store and manipulate data generated by the methods of the

present invention which comprises a plurality of bioraarker signal changes/profiles which

can be used by a computer system in Implementing the methods of this invention. n

certain embodiments, computer system receives biomarker expression data; ( i) stores the

data; and ( i ) compares the data in any number of ways described herein (e.g., analysis

relative to appropriate controls) to determine the state of informative biomarkers from

cancerous or pre-eaneerous tissue. n other embodiments, a computer system (i) compares

the determined expression biomarker level to a threshold value; and (ii) outputs an

indication of whether said biomarker level is significantly modulated (e.g., above or below)

the threshold value, or a phenotype based on said indication.

certain embodiments, such computer systems are also considered part of the

present invention. Numerous types of computer systems can be used to implement the

analytic methods of this invention according to knowledge possessed by a skilled artisan in

the bioinformatics and/or computer arts. Several software components can be loaded into

memory during operation of such a computer system . The software components can

comprise both software components that are standard in the art and components that are

special to the present invention (e.g., dC P software described i Lin el « . (2004)

i info rm ics 20, Ϊ 233- 240; radial basis machine learning algorithms (RBM) known in

the art).

- 77 -

The methods of the invention can also be programmed or modeled in

mathematical software packages that allow symbolic entry of equations and high-level

Specification of processing, including specific algorithms to be used, thereby freeing a user

of the need to procedurally program individual equations and algorithms. Such packages

include, e.g., Matlab from Mathworks ( ati k, Mass.), Mathematics from Wolf a

Research (Champaign, ill ) or S-Plus from MathSoft (Seattle, Wash ).

n certain embodiments, the eot p ter comprises a database for storage of

biomarker data. Such stored profiles ca be accessed and used to perform comparisons of

interest at a later point i time. For example, biomarker expression profiles of a sample

derived from the non-cancerous tissue of a subject and/or profiles generated from

population-based distributions of informative loci of interest in relevant populations of the

same species can be stored and later compared to that of a sample derived from the

cancerous tissue of the subject or tissue suspected effacing cancerous of the subject

n addition to the exemplary program structures and computer systems described

herein, other, alternative program structures and computer systems wil be readily apparent

to the skilled artisan. Suc alternative systems, which do not depart from the above

described computer system and programs structures either in spiri or in scope, are therefore

intended to be comprehended within the accompanying claims

c Diagnostic Assays

Th present invention provides, in part, methods, systems, and code for accurately

classifying whether a biological sample is associated with a cancer that is likely to respond

to anti-cancer therapy g ., iron-sulfur cluster biosynthesis pathway inhibitory therapy). In

some embodiments, i present invention is useful for classifying a sample (e.g., from a

subject) as associated with or at ris for responding to or not responding to anti-cancer

therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy) using a statistical

algorithm and/or empirical data (e.g., the amount or activity of a biomarker listed in Table

I).

An exemplary method for detecting the amount or activity of a biomarker listed i

Table 1, and thus useful fo classifying whether a sample is likely or unlikely to respond to

anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy)

involves obtaining a biological sample from a test subject and contacting the bi ogical

sample with an agent, such as a protein-binding agent like an antibody or antigen-binding

fragment thereof, or a nucleic acid-binding agent like an oligonucleotide, capable of

defecting he amount or activity of the biornarker in the biological sample. In some

embodiments, at least one antibody or antigen-binding fragment thereof is used, wherein

two, three, four, five, six, seven, eight, nine, ten, or more such antibodies or antibody

fragments can be used n combination (e.g., n sandwich BLlSAs) or in serial In certain

instances, the statistical algorithm is a single learning statistical classifier system. For

example, a single learning statistical classifier system can be used to classify a sample as a

based upon a prediction or probability value and the presence or level of the biomarker.

The use of a single learning statistical classifier system typically classifies the sample as,

for example, a likel anti-cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway

inhibitory therapy) responder or progressor sample with a sensitivity, specificity, positive

predictive va e, negative predictive value, and/or overall accuracy of at least about 75%,

76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,

91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

Other suitable statistical algorithms are well known to those of skill n the art For

example, learning statistical classifier systems include a machine learning algorithmic

technique capable of adapting to complex data sets (e.g., parte! of markers of interest) and

making decisions based upon such data sets. Irt some embodiments, a single learning

statistical classifier system such as a classification tree (e.g., random forest) is used. In

other embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, , or more learning statistical

classifier systems are used, preferably in tandem. Examples of learning statistical classifier

systems include, but are not limited to, those using inductive learning (e.g. ,

decision/classification trees such as random forests, classification and regression trees

(C& T), boosted trees, etc.), Probably Approximately Correct PAC) learning,

onneet o ist learning (e.g., neural networks ( N), artificial neural networks (ANN), neuro

fuzzy networks (NFN), network structures, pereeptrons such as multi-layer pereeptrons,

multi-layer feed-forward networks, applications of neural networks, Bayes n learning in

belief networks, etc ) , reinforcement learning (e.g . passive learning in a known

environment such as naive learning, adapt e dynamic learning, and temporal difference

learning, passive learning in an unknown environment, active learning in an unknown

environment, learning action-value functions, applications of reinforcement learning, etc),

and genetic algorithms and evolutionary programming. Other learning statistical classifier

systems include support vector machines (e.g. , Kernel methods), multivariate adaptive

regression splines (MARS), Levenberg-Marquardt algorithms,, Gauss-Newton algorithms.

mixtures of Gaussians, gradient- descent algorithms, and learning vector quantization

(LVQ). In certain embodiments, the method of the present invention further comprises

sending the sample classification results to a clinician, . . an oncologist

n another embodiment, the diagnosis of a subject is followed by administering to

the individual a therapeutically effective amount of a defined treatment based upon the

diagnosis.

n one embodiment, the methods further involve obtaining a control biological

sample (e.g. , biological sample from a subject who does not have a cancer or whose cancer

is susceptible to anti-cancer therapy (eg., iron-sulfur cluster biosynthesis path way

inhibitory therapy), a biological sample from the subject during remission, or a biological

sample from the subject during treatment for developing a cancer progressing desp e anti¬

cancer therapy (eg., iron-sulfur cluster biosynthesis pathway inhibitory therapy).

d . Prognostic Assays

The diagnostic methods described herein ftjrthermore be utilized to identify

subjects having or at risk of developing a cancer that is likely or unlikely to be responsive

to a -cancer therapy (e.g., iron-sulfur cluster biosynthesis pathway inhibitory therapy).

The assays described herein, such as the preceding diagnostic assays or the following

assays, can. be utilized to identify1a subject having or at risk of developing a disorder

associated with a misreguiatiion of the amount or acti vity of at least one biomarker

described in Table .1 such as in cancer. Alternatively, the prognostic assays can b utilized

to identify a . subject having or at risk for developing a disorder associated with a

misregulatiori of the at least one biomarker described in Table , such as i cancer.

Furthermore, the prognostic assays described herein can be used to determine whether a

subject can be administered an agent (eg., an agonist, antagonist, peptidomimetic,

polypeptide, peptide, nucleic acid, small molecule, or other drag candidate) to treat a

disease or disorder associated with the aberrant biomarker expression or activity

e . Treatment Methods

Another aspect of the invention pertains to methods of modulating the expression or

activity of one or more biomarkers described herein {e.g., those listed in Table I and the

Examples or fragments thereof,) for therapeutic purposes. The biomarkers of the present

invention have bee demonstrated to correlate with cancers. Accordingly, the activity

and/or expression of the biomarker, as well as the interaction between one or more

biomarkers or a fragment thereof and its naiurai binding partners) or a fragments) thereof,

can be modulated in order to treat cancers.

Modulatory methods of the invention involve contacting a cel with one or more

biomarkers of the invention, including one or more biomarkers of the invention, including

one or more biomarkers listed in Tabic i and the Examples or a fragment thereof or agent

that modulates o e or more of the acti vities of biomarker activity associated with the ceil.

An agent that modulates biomarker activity can be an agent as described herein, such as a

nucleic acid or a polypeptide, a naturally-occurring binding partner of the biomarker, an

antibody against the biomarker, a combination of antibodies against the biomarker and

antibodies against other immune related targets, one or more biomarkers agonist or

antagonist, a peptidomimetie of one or more biomarkers agonist or antagonist, one or snore

biomarkers peptide i etic other small molecule, or small RNA directed against or a

tnitnic o f one or more biomarkers nucleic acid gene expression product.

An agent that modulates the expression of one or more biomarkers of the present

invention, including one or more biomarkers of the invention, including one or more

biomarkers listed in Table and the Examples or a fragment thereof s, e.g., an antisense

nucleic acid molecule, Ai molecule, shRNA, mature iR A, pre-iniRNA, pri -r iR A

m R A *, an i-miR , or a miRNA binding site, or a variant thereof or other small RNA

molecule, triplex oligonucleotide, ribozyme, or recombinant vector for expression of one or

more biomarkers polypeptide. For example, an oligonucleotide complementary to the area

around one or more biomarkers polypeptide translation initiation site can be synthesized.

One or more antisense oligonucleotides can be added to cell media, typically a t 200 ug m ,

or administered to a patient to prevent the synthesis of one or more biomarkers polypeptide.

Th antisense oligonucleotide is taken up by cells and hybridizes to one or more biomarkers

RNA to prevent translation. Alternatively, an oligonucleotide which binds double-

stranded DNA to form a triplex construct to preve DNA unwinding and transcription can

be used. As a result of either, synthesis of biomarker polypeptide is blocked. When

biomarker expression is modulated, preferably, such modulation occurs by a means other

than by knocking out the biomarker gene.

Agents which modulate expression, by virtue of the fac tha they control the

amount of biomarker in a cell, also modulate the total amount of biomarker activity in a

eel ,

- 1.31 -

one embodiment, the agent stimulates one or more activities of one or more

biomarkers of the invention, including one or more biomarkers listed in Table and the

Examples or a fragment thereof. Examples of such stimulatory agents include active

biomarker polypeptide or a fragment thereof and a nucleic acid molecule encoding t e

biomarker or a fragment thereof that ha been introduced into the cell (e.g., cDNA, R A,

shR As siR As, small NAs, mature iR A, pre-tmRNA, pri-miRNA, r 'RNA*, a ti-

miRNA, or a miRNA binding site, or a variant thereof, or other functionally equivalent

molecule known to a skilled art isan) n another embodiment, the agent inhibits one or

more biomarker activities. n one embodiment, the agent inhibits or enhances the

interaction of the biomarker with it natural binding partner{s). Examples of such

inhibitory agents include antisense nucleic aci molecules, an -bion ker antibodies,

biomarker inhibitors, and compounds identified in the screening assays described herein.

These modulatory methods can be performed vitro (e.g., by contacting the cell

with the agent) or, alternatively, by contacting an agent with cells in vivo (e.g., by

administering the agent to a subject). As such, the present invention provides methods of

treating an individual afflicted with a condition or disorder that would benefit from tip- or

down-modulation of one or more biomarkers of the present invention listed in Table 1 or 2

and the Examples or a fragment thereof, e.g., a disorder characterized by unwanted,

insuffi cient or aberrant expression or activity of the biomarker or fragments thereof. n one

emb odiment, the method involves administering an agent (e.g.. an agent identified by a

screening assay described herein), or combination of agents that modulates (e.g.,

upregulates or downregulates) biomarker expression or activity. n another embodiment,

the method involves administering one or more biomarkers polypeptide or nucleic acid

molecule as therapy to compensate for reduced, aberrant, or unwanted biomarker

expression or activity.

Stimulation of biomarker activity is desirable n situations in which the biomarker is

abnormally downregu ated and/or in which increased biomarker activity is likely to have a

beneficial effect. Likewise, inhibition of biomarker activity is desirable in i at io ns in

wh ich biomarker is abnormally upregulated and/or in which decreased biomarker activity is

likely to have a beneficial effect.

n addition, these modulatory agents ca also be administered in combination

therapy with, e.g., chemotherapeutic agents, hormones, antiangiogens, radioiabe!led,

compounds, or with surgery, cryotherapy, and/or radiotherapy. The preceding treatment

methods can be administered in conjunction with other forms of conventional therapy .g ,

standard-of-care treatments for cancer well known to the skilled artisan), either

consecutively with, pre- or post-conventional therapy. For example, these modulatory

agents can b administered w th a therapeutically effective dose of ehemotherapeutie age t.

In another embodiment these modulatory agents are administered in conjunction with

chemotherapy to enhance the activity a d efficacy of the chemotherapeutie agent. The

Physicians' Desk Reference ( D ) discloses dosages of chemotherapeutie agents that have

bee use in the treatment of various cancers. The dosing regimen and dosages of these

aforementioned chemotherapeutie drugs that are therapeutically effective wii! depend on

the particular melanoma, being treated, the extent of the disease and other factors familiar

to the physician of skill in the art an can be determined by the physician.

· .

In another aspect, the present invention provides pharmaceutically acceptable

compositions which comprise a merapeut ca.lly~effecti e amount of an agent that modulates

(e.g. , decreases) biomarker expression and/or activity, formulated together with o e or

more pharmaceutically acceptable carriers (additives) and/or diluents. A s described in

detail below, the pharmaceutical compositions of the present invention may be specially

formulated for administration in solid or liquid form, including those adapted for th

following: (1) oral administration, for example, drenches (aqueous or non-aqueous

solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral

administration, for example, by subcutaneous, intramuscular or intravenous injection as, for

example, a sterile solution or suspension; (3) topical application, for example, as a cream,

ointment or spray applied to the s in; (4) imravagtnally or intrarectaSiy, for example, as a

pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal

preparation or solid particles containing the compound.

The phrase "iiierapeutically-effeetive amount' as used herein means that amount of

an agent that modulates (e.g., inhibits) biomarker expression and/or activity which is

effective for producing some desired therapeutic effect, e.g., cancer treatment, at a

reasonable benefit/risk ratio.

The phrase "pharmaceutically acceptable' is employed herei to refer to those

agents, materials, compositions, and/or dosage forms which are, within the scope of sound

medical judgment, suitable for use in contact with the tissues of human beings and animals

without excessive toxicity, irritation, allergic response, or other problem or complication,

commensurate w h a reasonable benefit/risk ratio.

The phrase pha ce ti al y -accep abie carrier" as used herein means a

pharoiaceuticaliy-acceptable material composition or vehicle, such as a liquid or solid

filler, diluent, exeipient, solvent or encapsulating material, involved in carrying or

transporting the subject chemical from one organ, or portion of the body, to another organ,

or portion of the body. Each carrier must be "acceptable" in the sense of being compatible

with the other ingredients of the formulation a d not injurious to the subject. Some

examples of materials which can serve as phan¾aceuticaily-accepiabie carriers include: (1

sugars, suc as lactose, glucose and sucrose; (2) starches, such as co starch and potato

starch; (3) cellulose, an its derivatives, such as sodium earboxymethyl cellulose, ethyl

cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) ta c; (8)

exctpients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil,

cottonseed oil saftlower oil, sesame oil, olive oil, co oil and soybean oil; (10) glycols,

such as propylene glycol; ( po y ls, such as glycerin, sorbitol, mannitol and

polyethylene glycol; (12) esters, such as ethyl oSeaic and ethyl laurate; ( 3) agar; (14)

buttering agents, such as magnesium hydroxide ari aluminum hydroxide; ( 5) alginie acid;

(16) pyrogen-fVee water; ( ) isotonic saline; ( ) Ringer's solution; (19) ethyl alcohol; (20)

phosphate buffer solutions; and (21 other non-toxic compatible substances employed in

pharmaceutical formulations.

The term pharmaceu Uy-ac eptable salts" refers to th relatively non-toxic,

inorganic and organic acid addition salts of the agents that modulates (e.g., inhibits)

biomarker expression and/or activity. These salts can be prepared in situ during the final

isolation and purification of the respiration uncoupling agents, or by separately reacting a

purified respiration uncoupling agent in its free base for with a suitable organic or

inorganic acid, and isolating the salt thus formed. Representative salts include the

hydrohromide, hydrochloride, sulfate, bis l ate, phosphate, nitrate, acetate, valerate, oieate,

pahnitate, stearate, laurate, bcnzoaie, lactate, phosphate, tosylate, citrate, maleate, fumarate,

succinate, tartrate, napthylate, mesylate, ghieohepfonate, tactobionate, and laurylsulphonate

salts and the like (See, for example, Berge a ( 977) "Pharmaceutical Salts", . P rm.

S 66:1-19).

In other cases, the agents useful in the methods of the present invention may contain

one or more acidic functional groups and, thus, are capable of forming pharmaceutically-

acceptable salts with pharraaceutically-acceptable bases. The term "pharmaceutically-

acceptable salts" these instances refers to the relatively non-toxic, inorganic and organic

base addition salts of agents tha modulates (e.g., inhibits) biomarker expression. These

salts can likewise be prepared in situ during the final isolation and purification of the

respiration uncoupling agents, or by separately reacting th purified respiration uncoupling

agent in its free acid form with a suitable base, such as the hydroxide, carbonate or

bicarbonate of a pha ace tiea ly aee p able metal cation, with ammonia, or with a

pharaiaceuticaliy-acceptable organic primary, secondary or tertiary amine. Representative

alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium,

and aluminum salts and the like. Representative organic amines useful for the formation of

base addition salts include ethylamine, iethyla ine ethylene-diamine, ethanolaniine,

diethanolamine, piperazine and the like (see, for example, Berge e l. supra).

Wetting agents, m lsifi rs and lubricants, such as sodium la ry sulfate and

magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening,

flavoring and perfuming agents, preservatives and antioxidants can also be present in the

compositions.

Examples of pharmaceuticaily-aceeptable antioxidants include: ( I ) water soluble

antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisu!fate, sodium

metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl

palmitate, butylated hydroxyanisole (B A), butylated hydroxytoluene B T), lecithin,

propyl gaiiate, a pha-tocopherol, and e like: and (3) metal chelating agents, such as citric

acid, ethylenediamine etraaeeti acid (EDTA), sorbitol, tartaric acid, phosphoric acid, d

the like.

Formulations useful in the methods of th present invention include those suitable

for ora , nasal, topical (including buccal and sublingual) rectal, vaginal, aerosol and/or

parenteral administration. The formulations may conveniently be presented in unit dosage

form and may be prepared by any methods well known in the art of pharmacy. The amount

of active ingredient which can be combined with carrier material to produce a single

dosage form will vary depending upon the hos being treated, the particular mode of

administration. The amount of active ingredient, which ca be combined with a carrier

material to produce a single dosage form will generally be that amount of the compound

which produces a therapeutic effect. Generally, out of one hundred per cent, this amount

will range from about 1 per cent to about ninety-nine percent of active ingredient,

preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per

ce t to about 30 per cent.

Methods of preparing these formulations or compositions include the step of

bringing into association an agent that modulates (e.g., inhibits) biomarker expression

and/or activity, with the carrier and, optionally, one or ore accessory ingredients. n

general, the formulations are prepared by uniformly a d intimately bringing into association

a respiration uncoupling agent with liquid earners, or finely divided solid carriers, o both,

and then, if necessary, shaping the product.

Formulations suitable for oral administration may be in the form of capsules,

cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or

tragaeanth), powders, granules, or as solution or a suspension in an aqueous or non¬

aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup,

or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia)

and/or as mouth washes and the like, each containing a predetermined amount of a

respiration uncoupling agent as an active ingredient. A compound may also be administered

as a bolus, electuary or paste.

n solid dosage forms for oral administration (capsules, tablets, pills, dragecs,

powders, granules and the like), the active ingredient is mixed with one or more

pharmaeeutically-acceptabie carriers, such as sodium citrate or dicalciu phosphate, and/or

any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose,

mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymeihylcellulose,

alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3 humectants, such as

glycerol; (4) disintegrating agents, such a agar-agar, calciu carbonate, potato or tapioca

starch, alg ni aci , certain silicates, and sodium carbonate; (5) solution retarding agents,

such as paraffin (6) absorption accelerators, such as quaternary ammonium compounds; (?)

wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8)

absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stea t ,

magnesium stearate, solid polyethylene glycols, sodium iauryl sulfate, and mixtures

thereof; and (10) coloring agents n the case of capsules, tablets and pills, the

pharmaceutical compositions may also comprise buffering agents. Solid compositions of a

similar type may also be employed as fillers in soft and hard-filled gelatin capsules using

such excipients as lactose or milk sugars, as well as high molecular weight polyethylene

glycols and the like.

A tablet- may be made by compression or molding, optionally with o e or more

accessory ingredients. Compressed tablets may be prepared usi g binder (for example,

gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative,

disintegrant (for example, sod starch glycol ate or cross-linked sodium earboxyrnethyi

cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a

suitable machine mixture o the powdered peptide or peptido im t e moistened w an

inert liquid diluent.

Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules,

may optionally be scored or prepared with coatings and shells, such as enteric coatings and

other coatings well known in th p a nace tiea -formulat ng art. They ay also be

formulated so as to provide slow or controlled release of the active ingredient therein using,

for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired

release profile, other polymer matrices, liposomes a d 'or microspheres. They may be

sterilized by, for example, filtration through bacteria-retaining filter, or by incorporating

sterilizing agents in the form of sterile solid compositions, which can be dissolved in sterile

water, or some other sterile injectable medium immediately before use. These compositions

may also optionally contain opacifying agents and may be of a composition that they

release the active ingredient s) only, or preferentially, in a certain portion of the

gastrointestinal trac t, optionally, in a delayed manner. Examples of embedding

compositions, which can be used include polymeric substances and waxes. The acti v

ingredient ca also be in micro-encapsulated form, i appropriate, with o e or more of the

above-described exc ipients .

Liquid dosage forms for oral administration include pharmaceutically acceptable

emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the

active ingredient, the liquid dosage forms may contain inert diluents commonly used in the

art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such

as ethyl alcohol, isopropyi alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl

benzoate, propylene glycol, 3-buty ene glycol, oils (in particular, cottonseed, groundnut,

corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene

glycols and fatty acid esters of sorbitan, and mixtures thereof.

Besides inert diluents, the oral compositions ca also include adjuvants such as

wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring,

perfuming and preservative agents.

Suspensions, addition to the active agent ma contain suspending agents as, for

example, ethoxyiated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters,

raicfocrystalline ccliiilose, aluminum metabydroxidc, bentonite, agar-agar and iragaeanth,

and mixtures thereof.

Formulations for rectal or vaginal administration may be presented as a suppository,

which may be prepared by mixing one or more respiration uncoupling agents with one or

more suitable nonirritating excipients or carriers comprising, for example, cocoa butter,

polyethylene glycol, suppository wa or a salicylate, and which s solid at room

temperature, but liquid at body temperature and, therefore, will melt i the rectum or

vaginal cavity and release the active agent.

Formulations which are suitable for vaginal administration also include pessaries,

tampons, creams, gels, pastes, foams or spray formulations containing such earners as are

known n the art to be appropriate.

Dosage forms for the topical or transdermal administration of an agent that

modulates (e.g., inhibits) biomarker expression and/or activity include powders, sprays,

ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active

component may be mixed under sterile conditions with a plmrmaceutically -acceptable

carrier, and with any preservatives, buffers, or propellants which may be required.

The ointments, pastes, creams and gels m contain, in addition to a respiration

uncoupling agent, excipients, such as animal and vegetable fats, oils, waxes, paraffins,

starch, tragaca h cellulose deri vatives, polyethylene glycols, silicones, bentomtcs, silicic

acid, talc and zinc oxide, or mixtures thereof.

Powders and sprays can contain, in addition to an agent that modulates (e.g.,

inhibits) biomarker expression and/or activity, excipients sitch as lactose, tale, silicic acid,

aluminum hydroxide, calcium silicates and pol a de powder, or mixtures of these

substances. Sprays can additionally contain customary propellants, such as

cl oro uorohyd ocarbons and volatile unsubstituted hydrocarbons, such as butane and

propane.

The agent that modulates ., inhibits.) biomarker expression and/or activity, can

be alternatively administered by aerosol. This is accomplished by preparing an aqueous

aerosol, liposomal preparation or solid particles containing the compound. A nonaqueous

(e.g. , fluorocarbon propellant) suspension could be used. Sonic nebulizers are preferred

because they minimize exposing the agent to shear, which cart result: in degradation of the

compound.

Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or

suspension of the agent together w th conventional pharmaceutically acceptable carriers a d

stabilizers. Th carriers and stabilizers vary with the requirements of the particular

compound, but typically i clude nonionic surfactants (Tweens, Pluronics, or polyethylene

glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino

acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are

prepared from isotonic solutions.

Transdermal patches have the added advantage of providing controlled delivery of a

respiration uncoup ng agent to the body. Such dosage forms can be made by dissolving or

dispersing the agent in the proper medium. Absorption enhancers can also be used to

increase the flux of the p ptido i e c across the skin. The rate of such flux can be

controlled by either providing a rate controlling membrane or dispersing the

pcptidomimetic i a polymer matrix or gel.

Ophthalmic formulations, eye ointments, powders, solutions an the like, are also

contemplated as being within the scope of this invention.

Pharmaceutical compositions of this invention suitable for parenteral administration

comprise one or more respiration uncoupling agents in combination with on or more

pharfflaeeuticaily-aceeptable sterile isotonic aqueous or nonaqueous solutions, dispersions,

suspensions or emulsions, or sterile powders which may be reconstituted into sterile

injectable solutions or dispersions just prior to use, which may contain antioxidants,

buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the

intended recipient or suspending or thickening agents

Examples of suitable aqueous and nonaqueous carriers which may be employed in

the pharmaceutical compositions of the invention include water, etltanol, polyols (such as

glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof

vegetable oils, such as oiive oil, and injectable organic esters, such as ethyl oleate. Proper

fluidity can be maintained, for example, by the use of coating materials, such as lecithin, b

the maintenance of the required particle size in the case of dispersions, and by the use of

surfactants.

These compositions may also contain adjuvants such as preservati ves, wetting

agents, emulsifying agents and dispersing agents. Prevention of the action of

microorganisms may be ensured b the inclusion of various antibacterial and antifungal

agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like t may also be

desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the

co positions n addition, prolonged absorption of the injectable pharmaceutical form may

be brought about by the inclusion of agents which delay absorption such as aluminum

noste ar te a d gelatin.

In some cases, in order to prolong the eff ec of a drug, it is desirable to slow the

absorption of the drug from subcutaneous or intramuscular injection. This ay be

accomplished by the use of a liquid suspension of crystalline or amorphous material havi g

poor water solubility. The rat of absorption of the drug then depends upon its rate of

dissolution, which, in turn, may depend upon crystal size and crystalline form.

Alternatively, delayed absorption of a parenteraily-administered drug form is accomplished

by dissolving or suspending the drug in an o l -vehicle.

injectable depot forms are made by forming mieroeneapsu!e matrices of an agent

that modulates (e.g., inhibits) biomarker expression and/or activity, in biodegradable

polymers such as polylaetide-polyglyeolide. Depending on the ratio of drug to polymer,

and the nature of the particular polymer employed, the rate of drug release ca be

controlled. Examples of other biodegradable polymers include poly(orthoesters) and

po yianhydrides). Depot injectable formulations are also prepared by entrapping the drug

in liposomes or microemulsions, which are compatible with bod tissue.

When the respiration uncoupling agents of the present invention are administered as

pharmaceuticals, to humans and animals, the can be given per se or as a pharmaceutical

composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active

ingredient in combination with a pharmaceutically acceptable carrier,

Actual dosage levels of the active ingredients n the pharmaceutical compositions of

th s i ention may be determined by the methods of the prese invention so as to obtain an

amount of the active ingredient, which i effective to achieve the desired therapeutic

response for a particular subject, composition, and mode of administration, without being

toxic to the subject.

The nucleic acid molecules of the invention ca be inserted into vectors and used as

gene therapy vectors. Ge e therapy vectors can be delivered to a subject by, for example,

intravenous injection, local administration (see U.S. Pat. No, 5,328,470) or by stereotactic

injection (see e.g., Chen t (1994) Proc. Natl. Acad. Sc USA 91:3054 3057). Tire

pharmaceutical preparation of the ge e therapy vector ca include the gene therapy vector

in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery

vehicle is imbedded. Alternatively, where the complete gene delivery vector be

produced intact from recombinant ceils, e.g., retroviral vectors, the pharmaceutical

preparation can include on or more cells which produce the gene delivery m

The present invention also encompasses kits for detecting and or modulating

biomarkers described herein. A kit of the present invention may also include instructional

materials disclosing or describing the use of the kit or an antibody of the disclosed

invention in a method of the disclosed invention as provided herein. A kit may also include

additional components to facilitate the particular application for which the kit is designed.

For example, a kit may additionally contain means of detecting the labe (e.g., enzyme

substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary

labels such as a sheep an -mousc- , etc.) and reagents necessary for controls (e.g.,

control biological samples or standards), A kit may additionally include buffers and other

reagents recognized for use in a method of the disclosed invention. Non-limiting examples

include agents to reduce non-specific binding, s ch as a carrier protein or a detergent.

Other embodiments of the present invention are described in the following

Examples. The present invention is further illustrated by the following examples which

should not be construed as further limiting.

EXAMPLES

Example 1: Materials and Methods for x s 2-5

a. Cell lines an culture conditions

YD38 was obtained from the Korean Ceil Line Bank; ΪΜ95 was from the Japanese

Co ection of Research Bioresources Cell Bank; MK 1 an KE97 were from the Riken

Cell Bank; SN J- W138 and MDA-M468 were from the American Type Culture Center;

MK 4 and YCC1 were provided by the P . Jaime Lab; and NHBE were purchased from

Lonz (CC-2540). Cells were cultured in DMEM (YCC ), DMEM plus 10 g L insulin

(ΪΜ95), R (MDA-MB469, MK MKN74, N ! KE97, a nd YD ), or EMEM

(W 8) All edia was supplemented w th % FBS. NHBE were cultured in BEGM

growth medium bullet kit (Lonza CC- 0).

b. RNA and cDNA rescue constructs

NF shRNAs target sequences and corresponding Broad TRC (The RNAi

Consortium) -numbers and match region arc listed in Tabic 2 . Negative controls included a

non-targeting shRNA (N ), and two separate sbRNAs specific for luciferase (Luc2 and

Luc3). sb IF , which disrupts mitotic spindie dynamics, served as a positive control for

cell death. Pairs of o gos were synthesized (Eurofitis MWG Operons) for ea h target

sequence, following th genera! structure of: ACCG-Oligo A and COAA-O!igo B , to

introduce sticky Bbsl ends, and where O o A is: ACCGG- sense target sequence-

GTTAATATTCATAGC(ioop)-antisense seq er e-TTTT , and O igo B is; the reverse

complement of O go A . A!i shRNAs were cloned into the Cellecta vectors pRSI6-U6-(sh)-

UbiC-TagGFP-2A-Puro (for constitutive shRNA expression) and RSlT i 2-U /TO- s }-

CMV-TetR-TagRFP-Puro (for Dox-indncihle shRNA expression) at the Bbsl sites.

Insertion of shRNAs was confirmed by sequencing and by Ss restriction digests.

Overlap P R was used to generate NFSI-shRNA-resistant cDNA constructs (see

Table 4). Wild-type NFS I cDNA. was mutagenized as listed in Table 3 using the primer

pairs listed in Table generating silent mutations i NFS I that cause resistance to

knockdown by NFS sh sh4, or sh6. The sequence-confirmed NF s RN A resis an

mutant PG products were introduced into the pDONR223 Gateway donor vector, then

transferred into a Gateway-adapted pLVX-neo entry vector (by Gateway Cloning, Life

Technologies). NFS!-sh5 i an UT -targeted shRNA and was rescued using wild-type

NFS cDNA

Table 2 , N FS and control shRNAs

shRNA Broad TRC MatchshRNA Target Sequence (Sense)

Name Library # Region

NFSi-i GCTACTGAATCCAACAACATA TRCN 0 14 3 CDS

NFS 1-2 GCGCACTCTTCTATCAGGTTT T R C N ) 0881 CDS

NFS -3 CCACAAGCGAATCTCAAAGTT T CN 00 9073 CDS

NFS1-4 CAGTTCCAGAAAGGTATATTT TR.CN0000229753 CDS

NFS 1-5 C GTGAC TCCACC AGTTATTC TR N0 229756 'UTR

NFS 1-6 AGCGGCTGATACA.GAATA.TAA TR.CNG0002 18827 CDS

NFS 1- GGGACCCTAAGCACCATTATC TRCN 00 22 754 CDS

NFS -8 TGTGAACiCGTCTTCGAGAAAT TRC 22975S CDS

non-

T CAACAAGATGAAGAGCACCAA NA targeting

s CTTCGAAATGTCCGTTCGGTT T € N 0 00 2:243 CDS

sbLUC3 CAAATCACAGAATCGTCGTAT TRCN0000072246 CDS

s KI ί GCGTACAAGAACATCTATAAT TRCNOOOOi 16500 CDS

Table 3. Silent mutations introduced into NFSI coding sequence

Underlined nucleotides are the mutated nucleotides

Table 4 Primers used for generating shRNA-resistartt NFS cDNAs

Bold nucleotides are tlie silent mutations introduced in the shRNA-resistant CDSItalicized nucleotides ar Gateway adapter sequences

Scheme for overlap PCR method used to generate s NFS -resistant cDNA clones

293T cells were transfected using Lipofeciamine (Life Technologies) and packaging

p as ids carrying VSV'g and delta 8.2, along with shRNA or cDNA expression vector to

generate lentiviral particles. Viral supematants were collected and cleared by

eentri&gat o . Supematants containing cDNA virus were concentrated using Lenti-X

Concentrator (Clontech), titered by infection in limiting dilution, and used at 8 to 10 uL per

500,000 cells to achieve an MO! of approximately 0.5. infections using s RNA

ler t i ses were carried out using 40 or 50 uL of viral supernatant (using pRS16 or

pRSlT12 constructs, respectively) per 100,000 cells, corresponding to an approximate MOi

of 3. in generating stable inducible shRNA lines, ce ls were selected ing puromyc in ( -3

g depending on cell line) for 5-7 days.

Clonogenic assays were performed for longer-term assessment of prol erat e

phenotypes. Three days following doxycycline (dox)-inducdon (of stable, inducible

shRNA lines using 0.5 g/ L dox) or infection (for constitutive shRNA expression), cells

were trypsinized, counted (Countess Automated Cell Counter, Life Technologies), and re-

plated duplicate or triplicaie n 6-weii dishes at 750 to 3000 cells per well depending on

cell line. C onogeni growth was monitored by FP (pRSiT12 vector) or GFP (pRSI6

vector) expression at 1 wee intervals using a laser scanning ytome er to measure colony

area and numbers of colonies per well (IsoCyte, imageXpress Ve os). Two to three weeks

after plating ceils, cells were stained using crystal violet a an additional visualization of

colony formation. For shorter-term proliferative assays, cells were also plated o to 96-weil

plates using the Ceil Titer-Glo Luminescent Ce l Viability Assay (Promega G757 } to

measure cell viability o the day of plating and 6 days post-plating.

Aconitase activity was assessed three to eleven days post-infection or do induction

in one million ce ls using the Aconitase Activity Coiorimetric Assay Kit (Btovision K 7 -

00). Succinate dehydrogenase activity was assessed using the Succinate Dehydrogenase

Activity Coiorimetric Assa Kit (Biovisio.n 66 -100).

e.

TC A (The Cancer Genome Atlas) data were accessed and analyzed via the

eBioPoitai for Cancer Genomics (through the Computational Biology Center at Memorial

Sloan-Kettering Cancer Center (available on the World Wide Web at ebioportal.org/public-

portal/). Growth rate normalization was performed when comparing proliferative

phenotypes of NFS shRNAs and controls across multiple cell lines. Cell Titer-Glo (CTG)

measurements were background-corrected, and the specific growth rate, mu, was calculated

as v C G, , . The data wer plotted as /r where is

the average mu of control shRN -treated wells,

f . R analysis

R was purified using the RNeasy Min K t (Qiageu), and cD synthesized

using the Superscript® V LO Kit (Life Technologies). Quantitative RT-PCR was carried

out using Taqman® Assays (Life Technologies, Hs00738907_mi for NF ,

HsOOl 5 .33 n i for PTGS2, Hs00824723_m.l for Ubc, a housekeeping gene control) on a

ViiA 7 Real Time PCR System (Life Technologies).

g . Protein analysis

Cells were lysed in P-40 lysis buffer (Boston BioProducts) supplemented with x

Halt Protease/ Phosphatase inhibitor Cocktail (Pierce Biotechnology, h ), . ra

Dithiottireitol, and 1 raM Pheny ethanes fony t uori de. L sates were cleared by

cent fugat o and quantified using a BCA Protein Assay Kit (Pierce Biotechnology, c.) .

Lysates were resolved by SDS-PAGE (using Mini-Protean TGX gradient gels, Bio-Rad

Laboratories), transferred to nitrocellulose (using the B ot Gel Transfer Device and Dry

Blotting System, Life Technologies) and blocked n 5% nonfat m k (Bbtting-Gra.de

Blocker, Bio-Rad). Antibodies for S ! (mouse monoclonal antibody B-7, Santa Cruz

Biotechnology, inc.), FT (rabbit monoclonal antibody D D4, C ei Signaling

Technology), a d GAP D (rabbit monoclonal antibody 0 Ce l Signaling

Technology) were diluted : 000 in 5% milk in TBS/Tween-20 (Boston BioProducts).

Peroxidase-conjugatcd secondary antibodies (Donkey anti-rabbit gG or Donke ant -

mouse gG, Jackson ImmundResearch Laboratories, inc.) were used at :5000 in 5%

blocking solution, and protein bands were detected using Pico SnperSignal West Pico

Chemiluminescent substrate (Thermo Scientific, Pierce Biotechnology, Inc.).

Example 2: NFS! and other members of iron-sulfur cluster biosynthesis

pathway are biomarkers of cancer and targets for inhibiting cancer

NFS 1 is a pyrio¾xaI-5 '-phosphate-dependent cysteine desuifurase that removes

inorganic sulfur from cysteine, creating alanine as a byproduct. It is primarily localized to

mitochondria and is critical for iron-sulfur cluster biosynthesis and thiomodi ca ion of

transfer RNAs (tRNAs). The accessory protein SD i promotes efficient interaction

between NFS! and it substrate cysteine. NFS! exists as a heterodimer with IS . and

binds to SCU and FX during iron-sulfur cluster biogenesis, FXN (Frataxin) is an iron-

binding protein thought to provide iron for Iron-Sulfur Cluster (ISC) formation. FXN a so

interacts w h NFS , and may facilitate cysteine binding to NFS 1 by exposing its substrate

binding sites (Pandey e a (2 ) J . Biol. C 288(52» ISCU serves as a scaffold on

which SCs assemb le. A numbe r of proteins (HSCB, SPA , GRPEL 1/2, GLRX5,

BOLA3, SCA. 2, .BA57, UBPL) act as aperon s to transfer ISCs from ISCU to

apoproteins requiring ISCs for activity, which include components of the citric acid cycle

and oxidative phosphorylation, amongst others. F may serve as another scaffolding

protein for ISC formation (Li et . (2 1 ) Bi h . 52). A schematic diagram further

illustrating the iron-sulfur cluster biogenesis pathway is shown in gure .

NFS 1 is frequently amplified in various human cancers. For example. Figure 2

shows the results of NFS amplification assessed across available TCGA (The Cancer

Genome Atlas) datasets using the cBioPortal for Cancer Genomics (available on the World

Wide Web at cbioportal .org pub -p r a - Colorectal d cervical cancers exhibit the

highest levels of NFS 1 amplification. Notably, 15% colorectal cancers of a total of 212

cases showed NFS1 amplification. Approximately 3% stomach cancers of a total o 2

cases also showed NFSl amplification. Approximately 2-4% of tested breast invasive

carcinoma, cervical squamous cancer, lung adenocarcinoma, ovarian cystadenorna, prostate

carcinoma, sarcoma, and melanoma cases showed NF amplification. NFS! amplification

within a span of genes was also present i recurrent focal amplification in all lung

cancers.

addition to NFS amplification, additional iron-sulfur c ster biogenesis pathwa

members are amplified in tumors. Figure 3 shows the results of collective alterations of

NFS L LYRM4/1SD1 1, S , and FXN evaluated across available TCGA datasets using

the cBioPortal for Cancer Genomics (available on the World Wide Web at

cbioportal.org/pitblic-poiiai/). These biomarkers were amplified in many different cancers

and an even larger percentage of tumors have overexpression of NFS! and overexpression

of other iron-sulfur cluster biogenesis pathway members despite the fact thai they lack

amplifications. Colorectal cancer, ovarian cancer, and sarcomas exhibit the highest levels

of iro -sulfur cluster biogenesis pathway dysregnlation.

Similarly, Figure 4 shows the results of mutation analyses of solute carrier family 25

mitochondrial iron transporter, member 28 (SLC25A28), a mediator of iron uptake,

assessed across TCGA samples using datasets from the cBioPortal for Cancer Genomics

(available on the World Wide Web at cbiopoitai.org/pubiic-portal/) and the Memorial

Sloan-Kettering Cancer Center (MS CC . A markers show represent missense

mutations, except for the seventh marker from the left located at the -ter in us of the

Mito carr domain, which represents a frameshift deletion. SLC25A28 R C/ is a

recurring mutation in colorectal and gastric cancers. S.LC25A28 gatn-of-function mutations

are believed to be particularly dependent on NFS .

E xample 3: Knockdown of NFSl inhibits clonogenic cell growth

Knockdown of NFS inhibits clonogenic cell growth. For example, inducible

knockdown of NFS 1 using sli As causes potent growth inhibition in cells of the gastric

cancer cel ine , 4. NFS is amplified in the MKN /4 ceil line. Other ceil lines that

are dependent on N FS overexpression are well known in the art and include, for example,

the AGS and KE39 ceil lines. Such ceil lines, including MKN74, can grow as xenografts in

SG mice. MK.N74 stable cell ines carrying dox-inducible shRNAs for if (positive

kill control), luciferase Luc2 or Luc3: negative controls), or NFS 1 shRNAs (NFS1-L -4, -

5, -6) were induced to express shRNAs by addition of dox (0,5 lig/mL) io he culture media,

or left un-induced (no dox). Three days post- ox-i cri , cells were trypsinized.

counted, and plated at low density (750 cells per well of a 6-well dish) for assaying

clonogenic growth. Additional cells were also collected a d assessed by q-RT-PCR for

NFS ! knockdown, Clonogeme growth (relative colony area show in Figure 5, as we l as

the number of objects) was monitored by red fluorescent protein (RFP) expression over two

weeks scanning the plates on a laser scanning cytometer ( soCyte, ImageXpress V os),

The average coiony area at days 7 or 14 post-plating from 2 replicate wells was normalized

to the average of the negative controls (Figure 5). Clonogenic growth was also visualized

by crystal violet (CV) staining at day 4 (Figure 5; bottom panel).

n order to verify the specificity of the growth inhibition effects to FS

knockdown. cDNA rescue experiments were conducted to confirm on-target activity o

NFS1 shRNAs. Stable N FS -s RNA ( FS l -s 5) or shRNA. control lines were infected

with lentivirus expressing wild-type NFS cDNA, and compared to uninfected

counterparts. Cells were cultured in the presence or absence of 0 5 g/ dox for 3 days,

then replated to assay for clonogenic growth. NFS 1 knockdown was confirmed by q-RT-

PCR, and colony growth was a so monitored on a laser scanning cytometer. Ceils were

fixed and stained with crystal violet at day 14 post-plating. Stable MKN74-shNFSl cells

induced with dox were significantly impaired in eolouy formation (see, for example, the left

boxed images of Figure 6 relative to the negative controls, while the addition of NFS!

cDNA restores colony formation (see, for example, the right boxed images of Figure 6).

Similar results were obtained from other rescue experiments performed with additional

NFS shRNAs (s , sh.4, sh6) with corresponding NFS! cD constructs resistant to

knockdown b each shRNA (see Example ).

NFS! knockdown was also determined to cause differential effects on cell growth

across a panel of different cell lines. A panel of el! lines were infected with constitutive

NFS shRNAs (sh4, sh5, l 6) negati ve control shRN As (for Luc2, Luc3), and positive kill.

control shRNA. (for if 1). Three days post- infection, cells were trypsinized, counted, and

re-plated in 6-we plates. Cell viability was measured on the day of re-plating and at day

6 post-re-pi a ing by Ce -Titer® G o and. the data was growth rate normalized (see

Example ). Cells collected on the day of re-plating were assessed for NFS b c-RT

PC Rand Figure 7 shows that NFS knockdown yielded a range of NFS 1-dependency with

respect to modulation of ce l growth.

Finally, it was determined that shutting off NFS sh NA function restored

clonogenic growth. For example, stable YD38 s RNA lines were cultured in the presence

or absence of 1 u L Dox for 3 days, then trypsinized and replated to assay for clonogenic

growth with 1) continued Dox, 2) continued absence of Dox, or 3) withdrawal of Dox.

Knockdown of N S was assessed on the day of replating. At day 1 post-re-plating,

colonies were visualized and quantified with a laser scanning cy ometer and colony area

was normalized to the average of the negative co rols. Figure shows that withdrawal of

Dox allowed increased clonogenic growth for sh4, $h5, and sh6. Thus, growth inhibition

induced by NFSI knockdown in cell lines like YD38 can be reversed by s ut ing- ff

shNFSl expression.

Example 4: Pharmacodynamic markers related to NFS act as biomarkers for

NFS activity and cell growth modulation and ceil-free and cell-based screening

strategies for identifying inhibitors of NFS and/or other biomarkers listed in Table 1

Previous studies indicate that iron-sulfur dependent mitochondrial enzymes, such as

succinate dehydrogenase (SDH) and aconitase (Aco), act as pharmacodynamic biomarkers

for NF I function. For example. Figure 9 shows that SDH and Aco activity are

coordinately modulated according to N F activity (Majewska et (2 3) J . Biol. Chem.

288 ;2 34-291 2) and Figure 10 further shows tha SDH and Aco activity are significantly

decreased following NFS knockdown.

in addition, it is believed that cell death due to NFSI knockdown is due, at least in

part, to dysregulation of free iron levels through a non-apoptotic, iron-dependent form of

cell death known as ferroptosis (Figure 1). n particular, Erastin, 3R-RSL3 & PE

induce ferroptosis and PTGS2 (Cox2) is a known biomarker of ferroptosis, as wel l as

biomarker of oxidative stress, which is a hallmark of ferroptosis (Figure 12 and Yang et

(2014.) Cell 56:3 7-331), The implication of modulation of NFS! and free iro levels are

also believed to involve the change in expression of ferritin and transferrin receptors, whose

translation is regulated by iron-response-proteins.

Moreover, HlF2a is modulated via NFS modulation. IF2a is an ndruggab e

transcription factor in oncology and inflammation that is activated by mutations (either

directly or indirectly) n a subset of cancers. For example, Thompson el ctl. (2014) Blood

:366-376 demonstrate that HlF2a regulates neutrophil longevity and modulates

inflammation. Figure shows that iron-regulatory protein 1 (IRP.1) inhibits H 2a

translation ant! activity s ch that ! P i activators would downregulate the lF2a pathway.

NFS! inhibition leads to depletion of Pe~S clusters. t has been detemiined herein that such

depletion leads to acti vation of Iron Response Element Binding Protein (IRE-BP) since

modulation of genes regulated by the ro Response Element, such as the transferrin

receptor and fe rri tin was observed in the s RNA knockdown lines described. Thus, it is

believed that HlF2a is modulated by this same regulator}' mechanism and that NFS

inhibition leads to decreased F2a levels. Z er er i (2008) Mol. Cell 32:838-848

demonstrate that compounds that induce IRE-BP activity decrease HIF2a mRNA and

protein levels and it is expected that NFS 1 inhibition has the same consequences. HI a

gain-of-function mutations have been described in congenital polycythemia and number of

cancers including paragangliomas and these mutations are believed to be driver

imitations. Thus, NFS inhibition not only affects fundamental iron metabolism in tumors,

bu also directly shuts down signaling from a mutated driver mutation. Mutations in F2a

or other mutations that activate F1IF levels, such as imitations in succinate dehydrogenase,

are thus predictive biomarkers for NFS 1 therapy.

Additionally, lF2a has been demonstrated to be important for myeloid cell

function in particular neutrophils (Thompson el al. (2014) Blood . 23:366-376), and it is

expected that NFS! will modulate activity of myeloid cells within the hypoxic tumor

nii roei viro rie t. Tumor-associated myeloid cells have been demonstrated to inhibit the

anti-tumor immune response such that inhibition of NFS 1 is expected to lead to increased

apoptosis of tumor associated myeloid cell which can have therapeutic benefit. These

expected anti-tumor mechanisms of NFS 1 inhibition (via modulation of F2a) could be

achieved without chronic long-term NFS! inhibition.

In order to confirm that such pharmacodynamic markers associated with NFS I can

be used as adjuncts or surrogate markers for directly assessing NFS 1 modulation, several

experiments were performed. Figure shows the results of M N 74 stable ceil lines

carrying dox-indueible shRNAs for if t 1 (positive kill control), !ueiferase (Lue2 or Luc3:

negative controls), or NFS I . shRNAs (NFS -4, -5, ~6) tha were cultured in the presence or

absence of doxycyciine (0.5 ug/mL). Three days posi-dox-induetion, ceils were

trypsimzed, counted, and some cells assessed by Western blot for NFS.! knockdown and

ferritin (FT : ferritin heavy chain 1) levels with GAPDH served as loading control (left

panel). A o i ase activity was also assessed a this time point using .1 million ceils per

condition (middle panel). The stable lines were repiated at 3 days post-dox, cultured for 3

days further, and assessed for FS m A knockdown (top right panel) or PTGS (Cox2)

NA levels (bottom right panel by q-RT-PCR Figure . shows that NFS knockdown

results in decreased aconitase levels and ferritin levels. In addition, PT 2 (COX2)

m A was induced and 1R was activated as a result of NFS 1 inhibition.

Similarly, after 7 days of NFS 1 knockdown, decreases in aconitase activity and

ferritin protein levels, along with upregulation of T.F C protein were observed (Figure 5).

Specifically, M 74 cells stabl carrying individual inducible NPS shRNAs, negative

controls (shLuc2 or shLuc3) or positive ki l control (shK ), were induced with

doxycycline for 7 clays. These cells were then either lysed in RIPA buffer, quantified, and

equall loaded o a SDS-PAGE gel tor analysis by Western by staining for TfRC, N F ,

FTL, or GAPDH (loading control); or rypsin z d, counted, lysed, and analyzed for

aconitase activity. Aconitase activity was normalized to the protein concentration of each

lysate. After . days of NFS 1 knockdown, decreases in aconitase activity were maintained

along with decreases in succinate dehydrogenase (SDH) activity as determined by the

readout of succinate conversion to iuraarate arid as normalized against protein

concentration of each analyzed lysate. Specifically, stable M .N74 shR lines were

induced to express NFS or negati ve control shRNAs by doxycycline treatment for 1. days.

These cells were then either lysed in R PA buffer, quantified, and equally loaded on a SDS-

gel for analysis by Western and staining for NFS1 and GAPDH; or trypsioized,

counted, lysed and analyzed for succinate dehydrogenase activity a d aconitase activity.

SDFl activity correlated withaconitase activity and NFS! knockdown and was consistent in

rep i ate experiments,

described above, F2a is an "undruggable" transcription factor that is a ive in

a subset of cancers, regulates neutrophil longevity, and modulates inflammation (Thompson

t l. (2014) Blood .16:366-376). NFS. knockdown was determined to be associated with

down-regulation of l 2a protein levels (Figure 16), which also correlated with the down-

regulation o T protein levels, with the effects on both proteins likely due to the

activation of iron-regulatory protein 1 (1R.P1). Specifically, stable shRNA lines of the

NFS -amplified colorectal line C2B were established following infection and

puromycin-selection for each respective shRNA constructs (individual inducible NFS 1

shRNAs: s i , sh2 sh4, sh5, sh6; negative (shLuc2 or shL e3) or positive kill control

(shKi.fl )) . These stable lines were induced with doxyeycline For 2 weeks, and split 3 times

during the course of culture. These cells were then ysed in the plate w th ic cold R PA

buffer, quantified, and equally loaded on a SDS-PAGE gel for analysis by Western

analyses. Treatment of parental C2.8BEI cells with the hypoxia mimicking agent, cobalt

5 chloride, showed modulation of HIF2alpha level relative to untreated parental C2BBE.1

cells, as expected, and highlighted the correct molecular weight band to monitor for

modulation fay Nf S KD Western analyses were carried out using antibodies specific for

S I, FTH1, RlF2aipha, GAPDH and v n ulin with the latter two proteins serving as

loading controls.

i ) Thus, candidate biomarkers for iron-sulfur cluster biosynthesis pathway modulation

and iron-dependent cell death (ferroptosis) correlate with NFS 1 inhibition.

Example 5: A rescue of NFS1 confirms o -target activity of NFS s NAs

As described above, cDNA rescue experiments are useful- for confirming the

specificity of effects observed with modulating the expression of a gene such as NFS by

shRNAs (Figure 6). Figure A confirms tha the K 4 gastric cell line harbors

amplifications of NFS , as dete n ne y fluorescent in situ hybridization (FISH) analyses

relative to C.EP20, a chromosome 20 centromere marker, and DAP! used to stain genomic

DNA. Stable N FS shRNA cell lines were allowed to undergo clonogenic growth and were

20 then analyzed thirteen days post-doxycyeline activation of the shRNA expression constructs

in addition to cDNA rescue. Figure B shows the results of the cells wherein the cells

were either rescued with wild-type NFS 1 (WT NFS or a mutant N FS that is eatalyi a y

dead due to a C38 mutation (NFS m ) . NFS acts as a dominant negative mutant

with growth inhibitory effects comparable to that of NF -sh , Specifically, the stable

25 MK. 4 shRN A lines (for the negative control shRNAs NT. , l . c2, or Luc3, or the NFS 1

shRNA) were each infected with lentivirus (generated using the pLVX-neo vector) at an

approximate MO of 3 to constitutively over-express GFP as a negative control, WT NFS! ,

o FSl and selected for o e wee using neomycin. These selected lines were then

treated with doxycycline to induce shRNA expression, and at day 3 post-doxycyeline, these

0 cells were trypsinized and replated to assess their clonogenic growth in duplicate in 6 ell

plates. Figure 7 shows that impaired clonogenic growth mediated by NF sh5 a TR-

targeted shRNA: KD 87% by q PCR, was restored b WT NFS 1, but not by NFS l ,

The combination o FSl -shS an FS ,> completely inhibited clonogenic growth.

Similarly, Figure shows that cD rescue with WT NFS! (i the same clonogenic

growth experiment: described in Figure } restored the S !-shS-dependent effect o

aconitase activity. Specifically, cell lysates w e prepared from 100cm plates of the same

sets of infected ceils described n Figure 1 , and analyzed for aconitase activity te days

5 after doxycyciine treatment. Aconitase activity was normalized to protein concentration of

ea h lysa . Similar experiments with NFS ' caused insufficient number of cells for

analyses si ce the mutant MPS strongly inhibited cei growth.

WT NFS , but not FSl also rescued the NFS i~sh5~dependent inhibition of

FT protein levels a d the up-reg ation of T protein levels (Figure 1 ), Specifically,

i t) the same infected ce ls described in Figure 1? were used in this experiment. These ce ls

were cultured in cm plates, induced with doxycyciine for 7 days to induce shRNA

expression, and lysed in cold RI.PA buffer. Equal quantities of protein was loaded onto

SDS-PAGE gels, a d Western analysis done to assess protein levels of NFS FTH1 and

TfRC, wi h v cul and GAPDH staining also done as loading controls. Bands on

1.5 Westerns were quantified by densitometry, and graphed relative to loading controls. Again,

the NFS , effects were similar to those of FS l-sb5 on biomarker modulation.

t was further determined that the NFS 1 catalytic mutant causes decrease in

aconitase activity and ferritin levels comparable to that with FS l-s or NF sh5 (Figure

20). M 4 cells were infected at an approximate MO of 3 at time of cell replating into

20 10cm dishes, using lendvirus expressing either constitutive shRNAs (from pRS 6 vector:

NFS -s NFS -s .5 or negative control shRNAs, shhie2 or shluc3), or constitutive

cDNAs (from pLVX-neo vector: WT NFS , C38 catalytic mutant NFS , or GFP

(negative control). Selection of infec ted cells was carried out using puromycin (for pRS 6

vectors) or neomycin (for pLVX-neo vectors), beginning 2 ays after infection. Seven days

25 post-infection, cells were either lysed for further analysis of aconitase activity, or lysed with

cold R PA buffer, and lysates were then quantified and loaded in equa protein quantities

onto an SDS-PAGE gel. Western analysis was carried out to detect NFS! , FT and

vtnctiltn (loading control) levels. Aconitase activity was normalized to protein

concentrations.

0

Example Biochemical assays reporting NFS activity

As described above in the specification, iron-sulfur cluster biosynthesis pathwa

members and pharmacodynamic markers related to same can be used in various screening

assay to identify modulators (eg., inhibitors) of iron-sulfur cluster biosynthesis pathway

members of interest

in certain embodiments, biochemical screening for evaluating expression arid

activity of a biomarker listed i Table , such as due to application of inhibitors of a

biomarker listed in Table (e.g., NFS inhibitors), are presented (see, for example, Li et al.

(2004) Am. . Physiol. Cell Physiol. 28? :C 54 -C 55 ; Tsai and Baroadeau (2010)

i . 49 :9 2-9 9; Sc mu ker et al. (201 ) PLoS ONE 6:et6199). Protein for use in

the assays ca be purified from any number of natural or recombinant sources (see, for

example, Majewska e . (2013) J. Biol Chem. 288:29134-29142). For example, . call

expressing a c stron c expression vector encoding both N FS and IS can be used to

readily purify a complex of NFS! and 1S 1 by, for example, using a tagged protein (see,

for example, Marelja et al. (2008) J. Biol. Chem 283:25178-25185). In addition, the

expression vector or post-translation modifications can be engineered to remove

mitochondrial signal peptides and oilier domains that are not associated with protein

function. The activity of a biomarker of interest, such as the effect of a test agent or

compound on a purified protein, can be analyzed using direct or indirect enzymatic assays.

n a indirect method, analysis of an enzymatic reaction product can he analyzed as

surrogate for directly measuring enzyme action. For example, sulfide-based (e.g.,

methylene blue assays or fluorogenic sulfide probes, such a AzMC to AMC detection) or

alanine-hased (e.g., alanine dehydrogenase activity) detection methods can be used to

analyze F readout (Figure 2 . in one embodiment, a reaction mixture containing a

buffer, purified NFS / SD , cysteine, and PLP cofactor can be created i the presence or

absence of a test agent or compound and any enzymatic reaction can be stopped with the

addition of ,N-dimeihyl-p-phenylenediami«e and Fe ¾ in H solution such that

monitoring of the production of methylene blue at a absorbauce of 670 am will indicate

the extent of inhibition. The methylene b ue-cystei e desulfurase assay is a standard

coloriraetrk assa that is well known in the art (see, for example, Pandey el al (201 ) ./.

Biol. Chem. 286:38242-38252). However, the assay has not heretofore been adapted for

use in high-throughput format, such as for use in high- capacity plates containing 96 wells.

gure 22A provides a representative methylene blue assay suitable for a high-throughput

format, This was accomplished by making a reaction buffer having 0 niM T s p 8.0,

200 ffl:M N aC , 100 uM pyrodoxial phosphate, 0 uM DTT, and 0 µΜ of L-Cysteine.

This mixture was then added to wells of a clear 96-weSl plate. After, a range of

concentrations of sodium sulfide could be added for use as a standard. To defect the

sulfide, µί o ,N ira t yl-p-p enyl nediara m and of PeCi were added, an

after an incubation time of up to one hour, the absorbance of the well was measured at 670

am using an BnSpire® plate reader. Figure 22B demonstrates a representative sulfide

detection range, wher i reactions were run with DMPPDA sulfide probe and a standard

curve of sodium sulfide concentration as substrate was used to generate methylene blue.

Here, the same protocol that was described for Figure 22A was used. Briefly, wells were

set up with the reaction buffer, sodium sulfide was diluted serially to a range of uM and

rsM concentrations and added to the wel s, th e methylene blue production was detected

after dimethyl-p-phenylenediamme and F ¾ ad been added v a plate reader. The

"blanks" for the experiment were wells that recei ved the same reagents, without any sodium

sulfide. T values were calculated for each sulfide concentration as a measurement of how

robust the potential assay would be. Sulfide detection and Z values at 5 uM and above

were especially robust.

Since hydrogen sulfide does no remain in solution over time, standard curves can

become unreliable such that sulfide production is underestimated and sulfide generated by

NF fscS can be lost during the reaction (Figure 23). n order to avoid sulfide loss, other

indirect detection assay can be used. In on embodiment, a uorogeni probe ca be used,

such as ?-a2ido-4-methylcoitinarin (AzMC) (Thorson el at. (2013) Ang w ite Chemie.

Intl. Ed. 52:464 1-4544). AzMC reacts with and detects sulfide as NFS 1produces it, so

sulfide loss is minimized relative to a methylene blue assa in which DMPPDA isn't added

until the NFS! reaction is complete (e.g., for at least 20 minutes). AzMC assays have not

heretofore been adapted to measure NFS activity . Figure 24A provides a representative

AzMC assay suitable for a high-throughput format. This was accomplished by making a

reaction buffer having 00 mM Tris, pH 8.0, 200 mM NaCL 00 µ pyrodoxial phosphate,

5 mM glutathione, 00 uM of L-cysteine and 0 5 mg/mL ofBSA. This mixture was then

added to wells of a . black, clear-bottom 96-we plate. "The AzMC probe was then added to

each well to a final concentration of . µΜ Then, a range of Sodium Sulfide

concentrations could b added for use as a standard. The reaction was either incubated in

the dark at room temperature for at least an hour prior to measuring the fluorescence, or

time course protocol was used via the plate reader to measure the fluorescence over time.

Fluorescence was measured at an excitation of 365 nm with an emission of 450 nm. Figure

24B demonstrates a representative sulfide detection range, wherein reactions were run with

AzMC sulfide probe a d a standard curve of sodium sulfide concentration as subs trate was

used to generate d e f u r phore A C. same protocol that was described for Figure

24A was used. Briefly, wells were set up with the reaction buffer, sodium sulfide was

diluted serially to a range of µΜ a d M concentrations and added to the weils, the Az C

probe wa added, th reaction was incubated at room temperature for one hour in the dark,

after which the fluorescence was measured via. a .plate reader. The "blanks" for the

experi ment were wells tha received the sa e reagents, without any sodium sulfide. Z'

values were calculated for eac sulfide concentration as a measurement of how robust the

potential assay would i . Sulfide detection and Z' values at 500 M and above were

especially robust. Figure 24C demonstrates enzyme kinetics of IscS using the AzMC assay

optimized for high-throughput analyses. To study the enzyme kinetics of the IscS protein

via the AzMC Assay, the same reaction buffer described for Figure 24A was made, without

L-cystcinc. The reaction mixture was thai added to a w is of a black, clear-bottom 96-

wel plate. Then, the AzMC probe was added, sodium sulfide standards were made as

described above, and L-cysteine was added to different we s at different concentrations.

Th react ion was then carried out at 37 C with different concentrations of L-cysteine and at

several time points in order to find the initial velocities for each substrate concentration.

The final IscS concentration ed was 250 n . After calculating the initial velocities, a

ic a is M ten Graph and a Lineweaver-Burk Plot were made, and the and V

were subsequently determined.

n another embodiment, alanine assays cati.be used (Colin t a (2 3) J. Amer.

Chem. Sac. 1.35:733-740; Tsai and aro dea (2 .0) 49: 2-9139; Anthony et

. (20! I) P S ONE 6:e20374). As with the AzMC assay described herein, alanine assays

have not heretofore been adapted to measure NFS activity. Figure 2 provides a

representative alanine assay suitable for a high-throughput format. This was accomplished

by making an NFS reaction buffer having 0 mM Tr s p 8.0, 00 M a l, 0 µΜ

pyrodoxiai phosphate, 1 0 µ TT, 0 µΜ of L-cysteine. This mixture was then added

to wells of a clear, UV- transparent 96- well plate. If protein was being tested, i would be

added at this point and incubated for the appropriate amount of time. For the alanine

dehydrogenase reaction, the pH was increased to by adding a reaction mixture of 0

mM sodium carbonate buffer with the same concentrations of NaCl, pyrodoxiai phosphate,

and DTT as described. As a co-substrate, mM NAD* was added. A range of L-alanine

concentrations were used as standards, and were added to the same reaction mixture

described above. Alanine dehydrogenase was added to a final concentration of 0.03

uni s/ L to each well, and this reaction was run for 30 minutes at room temperature. The

alanine dehydrogenase converts alanine and NAD to NADH, which fluoresced and could

be measured at n excitation of 340 a artel an e issio of 460 nm. The blank for this

reaction would be the reaction mixture without L-alanine and Figure 25 demonstrates a

representative NADH detection range, wherein reactions were run with alanine

dehydrogenase (AlaDH) and a standard curve of alanine concentration as substrate was

used to generate NADH, which fluoresces at 460 am. The same protocol that was

described for Figure 25A was used. Briefly , we ls were set up with the NFS reac tion

buffer, L-alanine was diluted serially to a range of u and aM concentrations and added to

the wells, the AlaDH reaction buffer an subsequently the AlaDH were added, and the

reaction was incubated at room temperature for 30 minutes, after which the fluorescence

was measured via a plate reader. The "blanks'" for the experiment were wells that received

the same reagents without any L-alanine. Z >values were calculated for each L-alanine

concentration as a measurement of how robust the potential assay would be. Alanine

detection and Z values a 500 n and above were especially robust. Figure 25C

demonstrates e zyme kinetics of IscS using the alanine assay optimized for high-

throughput analyses. To study the enzyme kinetics of the scS protein via the alanine assay;

the same N FS reaction buffer described for Figure 25A was made without L-eysteine. The

reaction mixture was then added to a series of PC tubes. Then, L-a an ne was added to

the standards tubes, and L-cysteine added to different tubes at different concentrations.

The IscS protein was added to a fi na concentration of 250 nM The IscS reaction was then

carried out at 37 with different concentrations of L-eysteine and at different ti e points,

in order to find the initial velocities for each substrate concentration. The reactions at each

time point would be halted via heat inactivation a 9S°C, and after ail reactions were

finished, the AlaDH reaction was ru under the conditions described in Figure 25A. After

measuring the fluorescence and calculating the alanine concentration, the initial velocities

were found, a Michaeiis-Menten Graph and a Lineweaver-Burk Plot were made an the K

and V a were subsequently determined.

By contrast, direct enzymatic assay, such as that using the same enzymatic

reaction mixture described above, but actively monitoring the production of alanine via a

mass-spectrometer (e.g., such as the Agilent apklFire platform), can be used to identify

the extent- or inhibition. Test agents or compounds that reduce the production of alanine,

for example, can be identified as NFS inhibitors.

in other e bodim nts, ce Sba ed screening methods to identify modulators of a

biomarker listed in Table 1 (e.g., Nf S inhibitors) are presented (see, for example, Li et al.

5 (2004) Am. . Physiol. Cei Physiol. 287:C 547 C. 559). Cells treated with or without a

test ag or compound can be monitored for the. modulation o Fe-S dependent e ymes

such as by assaying decreases in aconitase activity or modulation of other activities listed in

Table I . Cells treated with or without a test agent or compound can also be monitored for

the modulation of iron-responsive reporter genes. For example, antibodies can be used to

i t) detect levels of endogenous RE-moduiated proteins to provide readout of iron-sulfur

cluster depletion which will result from NFS 1 inhibition. This assay could be configured as

a high content screen (Weerapana et al. {2 0) Nature 468:790-795) Alternatively, stable

cell lines expressing reporter gene (e.g.. lueiferase, GFP, etc.) with t« A context that

contains iron response elements that will increase mRNA stability and ultimately reporter

15 gene activity ca be used. The use of a destabilized reporter gene would likely increase

sensitivity. n one embodiment, the mRNA context of transferrin receptor can be used as

model, wherein iron response elements in 3' UT that increase stability of mRNA under

low Fe-S levels.

n still another embodiment, the fact that REs in 3' UT stabilize mRNA, while

20 IRE in 5' UT reduces translation, can be exploited by generating at least two reporters,

one that will be upregulated a d one that will be down regulated upon inhibition, such as

NFS inhibition (Fe-S cluster depletion), and the ratio of at least two reporters can be

monitored. This can be done with either fluorescent proteins or lueiferase proteins or a

combination of both. Figure 26 shows art exemplary schematic diagram illustrating

25 possible reporter constructs. For example, the first reporter ca have a UTR arrangement

similar to ferritin mRNA that wi l have low protein levels upon NFS I inhibition (e.g.,

UTR of f r tm-firef y luficerase-2A-GFP reporter). The second reporter can have a 3'

UTR arrangement similar to transferrin receptor mRNA that will have increased protein

levels of the report with increases in NFS 1 inhibition (e.g., Re i !a luciferase-2A-RFP

0 reporter-3' UTR of transferrin receptor). Drug selection markers, such as puromycin, can

also be used. Appropriate control constructs, such as those illustrated in Figure 26 can also

be used. The readout would be the ratio of at least two reporters. For example, NFS

inhibition will increase the ratio of Renilla-to-firefly lueiferase ratios a d or RFP-to-GFP

ratios. Similarly, simplified reporters with just FTL.iron response element ( E)- uci erase

and a corresponding control can be used. The engineered constructs can be expressed via

an number of wel -k own vectors, including viruses, such as lentiviral vectors shown i

Figure 25, plasmids, and the like. Such a strategy, in addition to allowing the use of the

luciferase ratio to identify NFS inhibitors, could also be adapted for live ce l i agi g

using the ratio of, for example, wo fluorescent markers.

Example 7: Microbial pathogen growth inhibited using inhibitors of NFS homologs

Inhibitors of NFS 1 homologs n microbial pathogens are believed to have

therapeutic potential as inhibitors of microbial pathogenic growth since the catalytic

cysteine residue is always conserved. Such NFS! homologs are essential for growth in a

variety of bacterial/fungal species including eli o ier pylori via its NFSl homolog, NifS

(Olson i !. (2000) c em. 30:16213-16219; my c b ci ri tuberculosis via its NFSl

homolog, IscSMtb (Rybmker et l (20 ) Biochem. J. Feb. e-pub: and yeast v its

NFSl homolog, fs p (Li . ( 99) J. Biol. Chem. 274:33025-22034). Human NFS 1 is

similar to the E coli homolog and the conserved deep substrate pocket and

conservation of the catalytic cysteine support draggability of NFS i homologs using agents

such as small molecules and eovalent inhibitors.

incorporation by Reference

All publications, patents, and patent applications mentioned herein are hereby

incorporated by reference in their entirety as if each Individual publication, patent o patent

application was specifically and indi vidual! indicated to be Incorporated by reference i

ase of conflict, the present application, including any definitions herein, will control.

Also incorporated by reference i their entirety are any polynucleotide and

polypeptide sequences which reference an accession number correlating to an entry in a

public database, such as those maintained by The Institute for Genomic Research (TIGR)

on the World Wtde Web and/or the National Center for Biotechnology information (NCBi)

on the World Wide Web.

- i 59 -

Equivalents

Those skilled in the art will recognize, o be ab e to ascertain using no ore than

routine experimentation, many cquivaleiits to the specific embodiments of the invention

described herein. Such equivaients are intended to be encompassed by the following

claims.

What- is claimed is;

1. A method of treating a subject afflicted with a cancer comprising s m is ri g t

the subject an agent that inhibits the copy number, amount, and/or activity of at least one

biomarker listed n Tabic 1, thereby treating the subject afflicted with the cancer.

2 . The method of claim i , wherein the is administered in a pharmaceutically

acceptable formulation.

3 . The method of claim , whereiii the agent directly bi ds the at least o e biomarker

listed in Table

4. The method of claim , wherein the at least one biomarker listed in Table is

toman NFS 1 or an ortholog thereof.

5 . The method of claim , further comprising administering on or more additional

anti-cancer agents, optionally comprising mitochondrial eofaetor therapy.

6 . method of inhibiting hyperproliferative growth of a cancer ceil or cells, the

method comprising contacting the cancer ce l or cells with an agent that inhibits the copy

number, amount, and/or activity of at least one biomarker listed in Table , thereby

inhibiting hyperproiiferative growth of the cancer cell or cells.

7. The method of claim 6, wherein the step of contacting occur in vivo, ex vivo, or in

vitro.

8. The method of c a m 6, wherein the agent is administered in a pharmaceutically

acceptable formulation.

9 . The method of claim 6, wherein the agent directly binds the a least one biomarker

listed in Table .

.0. The method of claim 6, wherein the at least one biomarker listed in Table is

human NFS! or an ortholog thereof,

. The method of claim 6, further comprising administering one or more additional

anti-cancer agents, optionally comprising mitochondrial eofaetor therapy.

1.2. A method of determining whether a subject afflicted with a cancer or a t risk for

developing a cancer would benefit fro iron-sulfur cluster (ISC) biosynthesis pathway

inhibitor therapy, the method comprising:

a) obtaining a biologies! sample from the subject;

b) determining the copy number, amount, and/or activity of at least one biomarker

listed in Tabic 1 in a subject sample;

c) deter.oii.uing the copy number, amount, and or activity of the at least one

biomarker in a control; and

d) comparing the cop .number, amount, and/or activity of the at least one biomarker

detected in steps b) and c);

wherein a significant increase in the copy number, amount and/or activity of the at

least o e biomarker in the subject sample relative to the control copy number, amount,

a d or acti vit of the at least one biomarker indicates that the subject afflicted with the

cancer or at risk for developing the cancer would benefit fro ISC biosynthesis pathway

inhibitor therapy.

1 . The method of claim , further comprising recommending, prescribing, or

administering ISC biosynthesis pathwa inhibitor therapy if the cancer is determined to

benefit from SC biosynthesis pathway inhibitor therapy.

14, The method o f claim 2 , further comprising recommending, prescribing, or

administering anti-cancer therapy other than ISC biosynthesis pathway inhibitor therapy if

the cancer is determined to not benefit from ISC biosynthesis pathway inhibitor therapy.

!5. The method of claim 14, wherein the anti-cancer therapy is selected fr o the

group consisting of targeted therapy, chemotherapy , radiation therapy, aad/or

hormonal therapy.

16. The method of any one of claims .2 - wherein the control sample is determined

from a cancerous or non-cancerous sample from either the patient or a member of the same

species to which the patient belongs.

. The method of any one of claims 2- 6, wherein the control sample comprises cells.

. The method of any one of claims 12- 7, further comprising determining

responsiveness to ISC biosynthesis pathway inhibitor therapy measured by at least one

criteria selected from the group consisting of clinical benefit rate, survival until mortality,

pathological complete response, semi-quantitative measures of pathologic response, clinical

complete remission, clinical partial remission, clinical stable disease, recurrence-free

survival, metastasis free survival, disease free survival, circulating tumor ce l decrease,

circulating marker response, and ECIST criteria,

1.9. A . method of assessing the efficacy of an agent for treating a cancer i a subject,

comprising:

a) detecting in a first subject sample and maintained i the presence of the agent the

copy number, amount or activity of at least one biomarker listed in Table I :

b) detecting the copy number, amount, and/or activity of the at least one biomarker

listed in Tab c 1 hi a second subject sample and maintained in the absence of the test

compound; an

c) comparing the copy r amount, and/or activ ity of the at least one biomarker

listed i Table 1 from steps a) and b), wherein a significantly increased copy number,

amount, and/or activity of the at least one biomarker listed in Table 1 in the first subject

sample relative to the second subject sample, indicates that the agent treats the cancer in the

subject.

20. A method of monitoring the progression of a cancer in a sub jec t, comprising;

a) detecting in a subject sample at a first point in time the copy number, amount,

and/or activity of at least one biomarker listed in Table 1;

b) repeating step a) during at least one subsequent point in time after administration

of a therapeutic agent; and

c) comparing the copy number, amount, and/or acti vity detected in steps a) and b),

wherein a significantly increased copy number, amount, and/or activity of at least one

biomarker listed in Table in the first subject sample relative to at least one subsequent

subject sample, indicates that the agent treats the cancer in the subject.

2 1. The method of claim 20, wherein between the first point in time and he subsequent

point in time, the subject as undergone treatment, completed treatment, and/or is in

remission for the cancer.

22. The method of claim 20 or , wherein between the first point in time and the

subsequent point n time, the subject has undergone SC biosynthesis pathway inhibitor

therapy.

23. The method of any one of claims 20-22, wherein the first a d/or a least one

subsequent sampie s selected from the group consisting o f ex vivo and i vivo samples.

24. The etho of any one of claims 20-23, wherein the first and/or at least one

subsequent sampie is obtained from an animal model of the cancer.

5 The method of any o e of claims 20-24, wherein the first and/or at least one

subsequent sampie is a portion of a single sample or pooled samples obtained from the

subject.

26. cell-based method for identifying an agent which inhibits a cancer, the method

comprising;

a) contacting a ce expressing at least one biomarker listed in Table 1 with te st

agent; and

b) determining the effect of the test agent on the copy number, .level of expression,

or level of activity of the at leas one biomarker listed in Table 1 to thereby identify an

agent that inhibits the cancer.

27. The method of claim 26, wherein said ce ls are isolated from an animal model of a

cancer.

28. The method of claim 26 or 27, wherein said cells are from a subject: afflicted with a

cancer.

29. The method of any one of claims 26-28, wherein said ceils are unresponsive to SC

biosynthesis pathway inhibitor therapy.

30. The method of any one of claims 26-29, wherein the step of contacting occurs in

vivo, ex vivo, or i vitro.

31. The method of any one of claims 26-30, further comprising determining the ability

of the test agen to bind to the at least one biomarker listed in Table i before or after

determining the effect of the test agent on the copy number, level of expression, or level f

activity of the at least one biomarker listed in Table .

32 The method of an o e of claims 2- , wherein the sample comprises ceils, cell

hues, histological slides, paraffin embedded tissue, fresh frozen tissue, fresh tissue,

biopsies, blood, plasma, serum., buccal scrape, saliva, cerebrospinal fluid, urine stool

mucus, or bone marrow, obtained from the sub ject.

33 A ceil-free method for identifying a compound which inhibits a cancer, the method

comprising:

a) determining the effect of a test compound on the amount or activity of at least on

biomarker listed in Table 1 contacted with a test compound;

b) determining the amount or activity of the at least one biomarker listed in Table 1

maintained in the absence of the test compound; and

c) comparing the amount and/or activity of the at least one biomarker listed in Table

1 from steps a) an b , wherein a significantly increased amount, and/or activity of the at

least one biomarker listed in Table 1 in step a) relative to step b , identifies a compound

which inhibits the cancer.

34 The method of claim 33, further comprising determining the ability of the test

compound to hind to the at least one biomarker listed in Table 1 betore o after determining

the fect of the test compound on the amount or act ty of the at least one biomarker

35 The method of claim 33 or 34, wherein steps a) and b are selected from the group

consisting of a methylene blue assay, a 7 a do 4 thylco rria n A C assay an

alanine assay, and a mass spectrometry assay,

36, The method of claim 35, wherein the methylene blue assay comprises i) reacting the

at least one biomarker listed in Tabic 1 in a buffer comprising a) cysteine, b a pyri doxai

phosphate cofactor, and c) optionally th test compound; it) stopping the reaction by adding

N,N-difflethyl-p-phenylenediamine and iron chloride (FeC ) in hydrogen chloride (HCl)

solution, and iii) determining the production of methylene blue via a sorbar e of light

having a wavelength of 670 nm.

37. The method of claim 35„wherein the A MC assay comprises i reacting the at least

one biomarker listed i Table i i a buffer comprising a) cysteine,, b) a pyridoxal phosphate

cofactor, c) glutathione as reducing agent, d) bovine serum albumin, e) 7-azido-4-

methylcoumarin, and f) optionally, the test compound; and ii) fluoromefrically monitoring

the reaction product, 7-amino-4-methyleoumarin.

38. The method of claim 35, wherein the alanine assay comprises i) reacting the at least

one biomarker listed i Table 1 in a buffer comprising a) cysteine, b) a pyridoxal ptiosphate

cofactor, c) DTT as reducing agent, and d) optionally, the test compound; ii) performing a

secondary reaction to measure alanine production in a buffer containing a) NAD

{nicotinamide adenine drnueJeotide) and b) alanine dehydrogenase enzyme; and tii)

fluorometrica!ly measuring the reaction product, ADH.

39. The method of claim 35, wherein the mass spectrometry assay comprises i) reacting

the at least one biomarker listed in Tab e .1 in a buffer comprising a) cysteine, b) a pyridoxal

phosphate cofactor, and c) optionally th test compound; and ii) determining the production

of alanine using mass spectrometry.

40. The method of a y one of claims 1.2-39, wherein the copy number is assessed by

microarray. quantitative PG (qPC ) high-throughput sequencing, comparative genomic

hybridization (CGH), or fluorescent in situ hybridization (FISH).

4 . The method of any one of claims 2-39 wherein the amount of the at least one

biomarker is assessed by detecting the presence in the samples of a .polynucleotide

molecule encoding the biomarker or a portion of said polynucleotide molecule.

42. The method of claim 41, wherein the polynucleotide molecule is a A cDNA,

or functional variants or fragments thereof

43. The method of claim 4 1, wherein the step of detecting further comprises amplifying

the polynucleotide molecule,

44. The method of any one of claims 12-43, wherein the amount of the at least one

biomarker is assessed by annealing a nucleic acid probe w th the sample of the

polynucleotide encoding the one or more biomarkers or a portion of said polynucleotide

molecule under stringent hybridization conditions.

45. The method of any one of claims 2-39, wherein the amount of the at least one

biomarker is assessed b detecting the presence a polypeptide of the at least one biomarker.

46. method of claim , wherein the presence of said polypeptide is detected using

a reagent which specifically binds with said polypeptide.

47 The method of claim 46, wherein th reagent is selected from the grou consisting

of an antibody, art antibody derivative, a d a antibody fragment.

48. The method of any one of claims 2-39, wherein the activit of the a least one

biomarker is assessed by determining the magnitude of modulation of at least one NFS

pharmacodynamic biomarker listed in Table 1

49. The method of any one of claims 12-39, wherein the activity of the at least one

biomarker is assessed by determining the magnitude of modulation of the activity or

expression level of at least one downstream target of the at least one biomarker,

50. The method of any one of claims 1-49, wherein the SC biosynthesis pathway

inhibitor agent or test compound modulates biomarker selected from the group consisting

of human NFS , human LYRM4, human ISC , hu a FXN, human F , human

GLRXS, human BOLA3, human SCB, human HSPA9, human 1SCA1, human ISCA2,

human ΪΒΑ 7, human N BP , human SLC25A28, human FDXR, human FDX2, a d

ortho!ogs of said hiomarkers thereof.

. The method of any one of claims 1-50, wherein the SC biosynthesis pathway

inhibitor agen t or test compound is an inhibitor selected from the group consisting of a

small molecule, antiseuse nucleic acid, interfering A , sh A , siR A aptamer,

rtbozyme, dominant-negative protein binding partner, and combinations thereof

52. The method o any one of claims 1-5 , wherein the at least one biomarker is

selected from the group consisting of 2, 3, 4, 5, 6, 7, 8 9, 10, or more hiomarkers.

53. The method of any one of claims 1-52, wherein the at least one biomarker is

selected from the group of SC biosynthesis pathway hiomarkers listed in Tab c Ϊ .

54. The method of claim 53 wherein the iSC biosynthesis pathway biomarkers listed in

Table 1 are seiected from the group consisting of human NFS human LYRM4„ human

iSCU, human FXN, human F , human GLRX5, human BOLA3, human HSCB, human

HS 9, human JSCA1, human ISCA2, human ΪΒΑ 7 human N BPL human SLC25A28,

human FDXR, human FDX2, and orthoiogs of said biomarkers thereof.

55. The method of any one of claims 1-52, wherein the at least o e biotnarker is

selected from the group of NFS pharmacodynamic biomarkers listed in Table .

56. The method of claim 5.5, wherein the FS ban codynam c biomarkers listed in

Table 1 are selected from the group consisting of human aconitase, human succinate

dehydrogenase, human ferritin,, human transferrin -receptor, human Hi†2alpha human

PTGS2, a d lipid reactive oxygen species ( OS .

The method of any on of claims -56, wherein the cancer is selected from the

group consisting of paragangliomas, colorectal cancer cervical cancer, lung

adenocarcinoma, ovarian cancer, and myeloid cancer withi a hypoxic t or

microenvironraent.

58. The method of any one of claims I-57, wherein the sub c is a mammal

59. The method of claim 58, wherein the mammal is an animal model of cancer.

60. The method of claim 58, erei the mammal is a human.

INTERNATIONAL SEARCH REPORT International application No.

PCT/US 15/29439

A . CLASSIFICATION O F SUBJECT MATTERIPC(8) - A61 K 38/00, C12Q 1/68 (2015.01)

CPC - A61K 38/00, C12Q 1/6883

According to International Patent Classification (IPC) or to both national classification and IPC

B . FIELDS SEARCHED

Minimum documentation searched (classification system followed by classification symbols)IPC(8): A6 1 38/00, C12Q 1/68 (2015.01)CPC: A61K 38/00, C12Q 1/6883

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searchedUSPC: 514/19.3, 435/6.1 1, 435/6.13, 435/6.14

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)PatBase, PubWest, Google Scholar, Google Patents: Cancer, treat, prevent, inhibit, block, silence, NSF1 , LYRM4, ISCU, FXN, NFU1 ,GLRX5, BOLA3, HSCB, HSPA9, ISCA1, ISCA2, IBA57, NUBPL, SLC25A28, FDXR, Aco1, Aco2, TER1, TER2, Hif2a, PTGS2, growth,hyperproliferative, pharmaceutic*

C . DOCUMENTS CONSIDERED T O B E RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

US 2010/0190656 A 1 (LI e t al.) 29 July 2010 (29.07.2010); para [01 14], [0168], [0170], [0172), 1-1 1[0173]; SEQ ID NO: 1195

□ Further documents are listed in the continuation of Box C .

Special categories of cited documents: " '

□later document published after the international filing date orpriority

A" document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand

to be of particular relevance the principle or theory underlying the invention

E" earlier application or patent but published on or after the international "X" document of particular relevance; the claimed invention cannot befiling date considered novel or cannot be considered to involve an inventive

L" document which may throw doubts on priority claim(s) or which is step when the document is taken alone

cited to establish the publication date of another citation or other "Y" document of particular relevance; the claimed invention cannot bespecial reason (as specified) considered to involve an inventive step when the document is

O" document referring to an oral disclosure, use, exhibition or other combined with one or more other such documents, such combinationmeans being obvious to a person skilled in the art

P" document published prior to the international filing date but later than "&" document member of the same patent famjlythe priority date claimed

Date o f the actual completion o f the international search Date of mailing o f the international search report

09 September 2015 (09.09.2015) 2 9 S EP 2015Name and mailing address of the ISA/US Authorized officer:

Mail Stop PCT, Attn: ISA/US, Commissioner for Patents Lee W . Young

P.O. Box 1450, Alexandria, Virginia 22313-1450

Facsimile No. 571-273-8300

Form PCT/ISA/2 0 (second sheet) (January 201 5)

INTERNATIONAL SEARCH REPORT International application No.

PCT/US 15/29439

Box No. I Nucleotide and/or amino acid sequence(s) (Continuation of item l.c of the first sheet)

1. With regard to any nucleotide and/or amino acid sequence disclosed in the international application, the international search wascarried out on the basis of a sequence listing:

forming part of the international application as filed:

in the form of an Annex C/ST.25 text file.

on paper or in the form of an image file.

b. furnished together with the international application under PCT Rule \3ler. 1(a) for the purposes of international searchonly in the form of an Annex C/ST.25 text file.

furnished subsequent to the international filing date for the purposes of international search only:

in the form of an Annex C/ST.25 text file (Rule \3ter. 1(a)).

on paper or in the form of an image file (Rule 13 .l(b) and Administrative Instructions, Section 713).

In addition, in the case that more than one version or copy of a sequence listing has been filed or furnished, the requiredstatements that the information in the subsequent or additional copies is identical to that forming part of the application asfiled or does not go beyond the application as filed, as appropriate, were furnished.

3 . Additional comments:

Form PCT/ISA/2 10 (continuation of first sheet ( 1)) (January 201 5)

INTERNATIONAL SEARCH REPORT International application No.

PCT/US 15/29439

Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet)

This international search report has not been established in respect of certain claims under Article 7(2)(a) for the following reasons:

Claims Nos.:because they relate to subject matter not required to be searched by this Authority, namely:

□ Claims Nos.:because they relate to parts of the international application that do not comply with the prescribed requirements to such anextent that no meaningful international search can be carried out, specifically:

3. Claims Nos.: 17, 18, 23-25, 29-32, 40-60because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a).

Box No. Ill Observations where unity of invention is lacking (Continuation of item 3 of first sheet)

This Internationa] Searching Authority found multiple inventions in this international application, as follows:This application contains the following inventions or groups of inventions which are not so linked as to form a single general inventiveconcept under PCT Rule 13.1. In order for all inventions to be examined, the appropriate additional examination fees must be paid.

Group I, claims 1-1 1, directed to a method of treating a subject afflicted with a cancer, or a method of inhibiting hyperproliforative growthof a cancer cell or cells.

Group II, claims 12-16, 19-22, 26-28 and 33-39, directed to a method of determining whether a subjet afflicted with a cancer or at risk fordevdoping a cancer would benefit from iron-sulfur cluster (ISC) biosynthesis pathway inhibitor therapy, a method of assessing theefficacy of an agent for treating a cancer in a subject, a method of monitoring the progression of a cancer in a subject, or a method foridentifying an agent which inhibits a cancer.

""Continued in Supplemental Box**" *

1 I As all required additional search fees were timely paid by the applicant, this international search report covers all searchableclaims.

2. As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment ofadditional fees.

3. I As only some of the required additional search fees were timely paid by the applicant, this international search report coversonly those claims for which fees were paid, specifically claims Nos.:

4 . No required additional search fees were timely paid by the applicant. Consequently, this international search report isrestricted to the invention first mentioned in the claims; it is covered by claims Nos.:1-1 1

Remark on Protest | | The additional search fees were accompanied by the applicant's protest and, where applicable, thepayment of a protest fee.I I The additional search fees were accompanied by the applicant's protest but the applicable protestfee was not paid within the time limit specified in the invitation.

No protest accompanied the payment of additional search fees.

Form PCT/ISA/210 (continuation of first sheet (2)) (January 201 5)

INTERNATIONAL SEARCH REPORT International application No.

PCT/US 15/29439

Continuation of Box III: Observations where unity of invention is lacking

The inventions listed as Groups I and II do not relate to a single special technical feature under PCT Rule 13.1 because, under PCTRule 13.2, they lack the same or corresponding special technical features for the following reasons:

Special technical featuresGroup I has the special technical feature of treating a subject afflicted with a cancer by administering an agent that inhibits the copynumber, amount and/or activity of at least one biomarker in Table 1, that is not required by Group II.

Group II has the special technical feature of comparing the copy number, amount, and/or activity of the at least one biomarker detectedin different steps, that is not required by Group .

Common technical features:Groups l-ll share the common technical feature of an agent that inhibits the copy number, amount, and/or activity of at least onebiomarker listed in Table I .

However, this shared technical feature does not represent a contribution over prior art, because this shared technical feature isanticipated by US 2010/0190656 A 1 (LI et al ) .

Li teaches a method of treating a subject afflicted with a cancer comprising administering to the subject an agent that inhibits the copynumber, amount, and/or activity of at least one biomarker (para [0170] 'Another embodiment is directed to a method for treating orpreventing a breast cancer associated with altered, preferably increased, expression or activity of a breast cancer polypeptide, themethod comprising administering to a subject in need of such treatment an effective amount of an antagonist of a breast cancerpolypeptide.') listed in Table I , thereby treating the subject afflicted with the cancer (SEQ ID NO: 1195 is 100% homologous to SEQ IDNO: 1; para [01 14] 'In other embodiments, the presence or absence of a cancer in a patient may be determined by (a) contacting abiological sample, e.g., obtained from a patient, with one or more (e.g., a plurality of) binding agents (e.g., binding agents that arepolynucleotides, polypeptides, or antibodies) specific for one or more of the breast cancer markers selected from the group consisting ofthe markers provided in the Tables herein (e.g., Table 2) and set forth in SEQ ID Nos:1-5970'; [0168] 'Another embodiment of thepresent invention is directed to a method for inhibiting the growth of a cell that expresses a breast cancer polypeptide, wherein themethod comprises contacting the cell with an antibody, an oligopeptide or a small organic molecule that binds to the breast cancerpolypeptide, and wherein the binding of the antibody, oligopeptide or organic molecule to the breast cancer polypeptide causes inhibitionof the growth of the cell expressing the breast cancer polypeptide. The cell can be a cancer cell and binding of the antibody, oligopeptideor organic molecule to the breast cancer polypeptide can cause death of the cell expressing the breast cancer polypeptide.').

As the technical features were known in the art at the time of the invention, they cannot be considered special technical features thatwould otherwise unify the groups.

Therefore, Groups l-ll lack unity of invention under PCT Rule 13.

Form PCT/ISA/2 0 (extra sheet) (January 201 5)