World Journal of Gastroenterology - NET

World Journal of GastroenterologyWorld J Gastroenterol 2013 April 21; 19(15): 2293-2444

ISSN 1007-9327 (print)ISSN 2219-2840 (online)

www.wjgnet.com

The World Journal of Gastroenterology Editorial Board consists of 1352 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 64 countries, including Albania (1), Argentina (8), Australia (33), Austria (15), Belgium (14), Brazil (13), Brunei Darussalam (1), Bulgaria (2), Canada (21), Chile (3), China (82), Colombia (1), Croatia (2), Cuba (1), Czech (6), Denmark (9), Ecuador (1), Egypt (4), Estonia (2), Finland (8), France (29), Germany (87), Greece (22), Hungary (11), India (32), Indonesia (2), Iran (10), Ireland (6), Israel (13), Italy (124), Japan (140), Jordan (2), Kuwait (1), Lebanon (4), Lithuania (2), Malaysia (1), Mexico (11), Morocco (1), Moldova (1), Netherlands (32), New Zealand (2), Norway (13), Pakistan (2), Poland (11), Portugal (6), Romania (4), Russia (1), Saudi Arabia (3), Serbia (3), Singapore (11), Slovenia (1), South Africa (3), South Korea (46), Spain (43), Sri Lanka (1), Sweden (17), Switzerland (12), Thailand (1), Trinidad and Tobago (1), Turkey (30), United Arab Emirates (2), United Kingdom (95), United States (285), and Uruguay (1).

Editorial Board2010-2013

HONORARY EDITORS-IN-CHIEFJames L Boyer, New HavenKe-Ji Chen, BeijingMartin H Floch, New HavenBo-Rong Pan, Xi'anEamonn M Quigley, CorkRafiq A Sheikh, SacramentoNicholas J Talley, Rochester

EDITOR-IN-CHIEFFerruccio Bonino, PisaMyung-Hwan Kim, SeoulKjell Öberg, UppsalaMatt Rutter, Stockton-on-TeesAndrzej S Tarnawski, Long Beach

STRATEGY ASSOCIATE EDITORS-IN-CHIEFYou-Yong Lu, BeijingPeter Draganov, FloridaHugh J Freeman, VancouverMaria Concepción Gutiérrez-Ruiz, MexicoKazuhiro Hanazaki, KochiAkio Inui, KagoshimaKalpesh Jani, BarodaJavier San Martin, Punta del EsteNatalia A Osna, OmahaWei Tang, TokyoAlan BR Thomson, EdmontonHarry Hua-Xiang Xia, LivingstonJohn M Luk, Hong KongHiroshi Shimada, Yokohama

GUEST EDITORIAL BOARD MEMBERSJiunn-Jong Wu, Tainan

Cheng-Shyong Wu, Chia-YiTa-Sen Yeh, TaoyuanTsung-Hui Hu, KaohsiungChuah Seng-Kee, KaohsiungI-Rue Lai, TaipeiJin-Town Wang, TaipeiMing-Shiang Wu, TaipeiTeng-Yu Lee, TaichungYang-Yuan Chen, ChanghuaPo-Shiuan Hsieh, TaipeiChao-Hung Hung, KaohsiungHon-Yi Shi, KaohsiungHui-kang Liu, TaipeiJen-Hwey Chiu, TaipeiChih-Chi Wang, KaohsiungWan-Long Chuang, KaohsiungWen-Hsin Huang, TaichungHsu-Heng Yen, ChanghuaChing Chung Lin, TaipeiChien-Jen Chen, TaipeiJaw-Ching Wu, TaipeiMing-Chih Hou, TaipeiKevin Cheng-Wen Hsiao, TaipeiChiun Hsu, TaipeiYu-Jen Chen, TaipeiChen Hsiu-Hsi Chen, TaipeiLiang-Shun Wang, Taipeihun-Fa Yang, TaichungMin-Hsiung Pan, KaohsiungChun- Hung Lin, TaipeiMing-Whei Yu, TaipeiChuen Hsueh, TaoyuanHsiu-Po Wang, TaipeiLein-Ray Mo, TainanMing-Lung Yu, Kaohsiung

MEMBERS OF THE EDITORIAL BOARD

Albania

Bashkim Resuli, Tirana

Argentina

Julio H Carri, CórdobaBernabe Matias Quesada, Buenos AiresBernardo Frider, Buenos AiresMaria Ines Vaccaro, Buenos AiresEduardo de Santibañes, Buenos AiresAdriana M Torres, RosarioCarlos J Pirola, Buenos AiresSilvia Sookoian, Buenos Aires

Australia

Finlay A Macrae, VictoriaDavid Ian Watson, Bedford ParkJacob George, SydneyLeon Anton Adams, NedlandsMinoti V Apte, LiverpoolAndrew V Biankin, SydneyFilip Braet, SydneyGuy D Eslick, SydneyMichael A Fink, MelbourneMark D Gorrell, SydneyMichael Horowitz, AdelaideJohn E Kellow, SydneyDaniel Markovich, Brisbane

March 7, 2013IWJG|www.wjgnet.com

Phillip S Oates, PerthRoss C Smith, SydneyKevin J Spring, BrisbanePhilip G Dinning, KoagarahChristopher Christophi, MelbourneCuong D Tran, North AdelaideShan Rajendra, TasmaniaRajvinder Singh, AdelaideWilliam Kemp, MelbournePhil Sutton, MelbourneRichard Anderson, VictoriaVance Matthews, MelbourneAlexander G Heriot, MelbourneDebbie Trinder, FremantleIan C Lawrance, PerthAdrian G Cummins, AdelaideJohn K Olynyk, FremantleAlex Boussioutas, MelbourneEmilia Prakoso, SydneyRobert JL Fraser, Daw Park

Austria

Wolfgang Mikulits, ViennaAlfred Gangl, ViennaDietmar Öfner, SalzburgGeorg Roth, ViennaHerwig R Cerwenka, GrazAshraf Dahaba, GrazMarkus Raderer, ViennaAlexander M Hirschl, WienThomas Wild, KapellerfeldPeter Ferenci, ViennaValentin Fuhrmann, ViennaKurt Lenz, LinzMarkus Peck-Radosavljevic, ViennaMichael Trauner, ViennaStefan Riss, Vienna

Belgium

Rudi Beyaert, GentInge I Depoortere, LeuvenOlivier Detry, LiègeBenedicte Y De Winter, AntwerpEtienne M Sokal, BrusselsMarc Peeters, De PintelaanEddie Wisse, KeerbergenJean-Yves L Reginster, LiègeMark De Ridder, BrusselFreddy Penninckx, LeuvenKristin Verbeke, LeuvenLukas Van Oudenhove, LeuvenLeo van Grunsven, BrusselsPhilip Meuleman, Ghent

Brazil

Heitor Rosa, GoianiaRoberto J Carvalho-Filho, Sao PauloDamiao Carlos Moraes Santos, Rio de JaneiroMarcelo Lima Ribeiro, Braganca PaulistaEduardo Garcia Vilela, Belo Horizonte Jaime Natan Eisig, São PauloAndre Castro Lyra, SalvadorJosé Liberato Ferreira Caboclo, BrazilYukie Sato-Kuwabara, São PauloRaquel Rocha, Salvador

Paolo R Salvalaggio, Sao PauloAna Cristina Simões e Silva, Belo HorizonteJoao Batista Teixeira Rocha, Santa Maria

Brunei Darussalam

Vui Heng Chong, Bandar Seri Begawan

Bulgaria

Zahariy Krastev, SofiaMihaela Petrova, Sofia

Canada

Eldon Shaffer, CalgaryNathalie Perreault, SherbrookePhilip H Gordon, MontrealRam Prakash Galwa, OttawaBaljinder Singh Salh, VancouverClaudia Zwingmann, MontrealAlain Bitton, MontrealPingchang Yang, HamiltonMichael F Byrne,VancouverAndrew L Mason, AlbertaJohn K Marshall, Hamilton OntarioKostas Pantopoulos, MontrealWaliul Khan, OntarioEric M Yoshida, VancouverGeoffrey C Nguyen, TorontoDevendra K Amre, MontrealTedros Bezabeh, WinnipegWangxue Chen, OttawaQiang Liu, Saskatoon

Chile

De Aretxabala Xabier, SantiagoMarcelo A Beltran, La SerenaSilvana Zanlungo, Santiago

China

Chi-Hin Cho, Hong KongChun-Qing Zhang, JinanRen Xiang Tan, NanjingFei Li, BeijingHui-Jie Bian, Xi'anXiao-Peng Zhang, BeijingXing-Hua Lu, BeijingFu-Sheng Wang, BeijingAn-Gang Yang, Xi’anXiao-Ping Chen, WuhanZong-Jie Cui, BeijingMing-Liang He, Hong KongYuk-Tong Lee, Hong KongQin Su, BeijingJian-Zhong Zhang, BeijingPaul Kwong-Hang Tam, Hong KongWen-Rong Xu, ZhenjiangChun-Yi Hao, BeijingSan-Jun Cai, ShanghaiSimon Law, Hong KongYuk Him Tam, Hong KongDe-Liang Fu, ShanghaiEric WC Tse, Hong Kong

Justin CY Wu, Hong KongNathalie Wong, Hong KongJing Yuan Fang, ShanghaiYi-Min Mao, ShanghaiWei-Cheng You, BeijingXiang-Dong Wang, ShanghaiXuan Zhang, BeijingZhao-Shen Li, Shanghai Guang-Wen Cao, ShanghaiEn-min Li, ShantouYu-Yuan Li, Guangzhou Fook Hong Ng, Hong KongHsiang-Fu Kung, Hong KongWai Lun Law, Hong KongEric CH Lai, Hong KongJun Yu, Hong KongZe-Guang Han, ShanghaiBian zhao-xiang, Hong KongWei-Dong Tong, Chongqing

Colombia

Germán Campuzano-Maya, Medellín

Croatia

Tamara Cacev, ZagrebMarko Duvnjak, Zagreb

Cuba

Damian C Rodriguez, Havana

Czech

Milan Jirsa, PrahaPavel Trunečka, PragueJan Bures, Hradec KraloveMarcela Kopacova, Hradec KraloveOndrej Slaby, BrnoRadan Bruha, Prague

Denmark

Asbjørn M Drewes, AalborgLeif Percival Andersen, CopenhagenJan Mollenhauer, Odense CMorten Frisch, Copenhagen SJorgen Rask-Madsen, SkodsborgMorten Hylander Møller, HolteSøren Rafaelsen, VejleVibeke Andersen, AabenraaOle Haagen Nielsen, Herlev

Ecuador

Fernando E Sempértegui, Quito

Egypt

Zeinab Nabil Ahmed Said, CairoHussein M Atta, El-MiniaAsmaa Gaber Abdou, Shebein Elkom

March 7, 2013IIWJG|www.wjgnet.com

Maha Maher Shehata, Mansoura

Estonia

Riina Salupere, TartuTamara Vorobjova, Tartu

Finland

Saila Kauhanen, TurkuPauli Antero Puolakkainen, TurkuMinna Nyström, HelsinkiJuhani Sand, TampereJukka-Pekka Mecklin, JyvaskylaLea Veijola, HelsinkiKaija-Leena Kolho, HelsinkiThomas Kietzmann, Oulu

France

Boris Guiu, DijonBaumert F Thomas, StrasbourgAlain L Servin, Châtenay-MalabryPatrick Marcellin, ParisJean-Jacques Tuech, RouenFrancoise L Fabiani, AngersJean-Luc Faucheron, GrenoblePhilippe Lehours, BordeauxStephane Supiot, NantesLionel Bueno, ToulouseFlavio Maina, MarseillePaul Hofman, NiceAbdel-Majid Khatib, ParisAnnie Schmid-Alliana, Nice cedex 3Frank Zerbib, Bordeaux CedexRene Gerolami Santandera, MarseilleSabine Colnot, ParisCatherine Daniel, Lille CedexThabut Dominique, ParisLaurent Huwart, ParisAlain Braillon, AmiensBruno Bonaz, GrenobleEvelyne Schvoerer, StrasbourgM Coeffier, RouenMathias Chamaillard, LilleHang Nguyen, Clermont-FerrandVeronique Vitton, MarseilleAlexis Desmoulière, LimogesJuan Iovanna, Marseille

Germany

Hans L Tillmann, LeipzigStefan Kubicka, HannoverElke Cario, EssenHans Scherubl, BerlinHarald F Teutsch, Ulm Peter Konturek, ErlangenThilo Hackert, HeidelbergJurgen M Stein, Frankfurt Andrej Khandoga, MunichKarsten Schulmann, BochumJutta Elisabeth Lüttges, RiegelsbergWolfgang Hagmann, HeidelbergHubert Blum, Freiburg Thomas Bock, Berlin

Christa Buechler, RegensburgChristoph F Dietrich, Bad Mergentheim Ulrich R Fölsch, Kiel Nikolaus Gassler, AachenMarkus Gerhard, MunichDieter Glebe, GiessenKlaus R Herrlinger, StuttgartEberhard Hildt, BerlinJoerg C Hoffmann, LudwigshafenJoachim Labenz, SiegenPeter Malfertheiner, MagdeburgSabine Mihm, GöttingenMarkus Reiser, BochumSteffen Rickes, MagdeburgAndreas G Schreyer, RegensburgHenning Schulze-Bergkamen, HeidelbergUlrike S Stein, BerlinWolfgang R Stremmel, Heidelberg Fritz von Weizsäcker, BerlinStefan Wirth, WuppertalDean Bogoevski, HamburgBruno Christ, Halle/SaalePeter N Meier, HannoverStephan Johannes Ott, KielArndt Vogel, HannoverDirk Haller, FreisingJens Standop, BonnJonas Mudter, ErlangenJürgen Büning, LübeckMatthias Ocker, ErlangenJoerg Trojan, FrankfurtChristian Trautwein, AachenJorg Kleeff, MunichChristian Rust, MunichClaus Hellerbrand, RegensburgElke Roeb, GiessenErwin Biecker, SiegburgIngmar Königsrainer, TübingenJürgen Borlak, HannoverAxel M Gressner, AachenOliver Mann, HamburgMarty Zdichavsky, TübingenChristoph Reichel, Bad BrückenauNils Habbe, MarburgThomas Wex, MagdeburgFrank Ulrich Weiss, GreifswaldManfred V Singer, MannheimMartin K Schilling, HomburgPhilip D Hard, GiessenMichael Linnebacher, RostockRalph Graeser, FreiburgRene Schmidt, FreiburgRobert Obermaier, FreiburgSebastian Mueller, HeidelbergAndrea Hille, GoettingenKlaus Mönkemüller, BottropElfriede Bollschweiler, KölnSiegfried Wagner, DeggendorfDieter Schilling, MannheimJoerg F Schlaak, EssenMichael Keese, FrankfurtRobert Grützmann, DresdenAli Canbay, EssenDirk Domagk, MuensterJens Hoeppner, FreiburgFrank Tacke, AachenPatrick Michl, MarburgAlfred A Königsrainer, TübingenKilian Weigand, HeidelbergMohamed Hassan, DuesseldorfGustav Paumgartner, Munich

Philipe N Khalil, MunichMartin Storr, Munich

Greece

Andreas Larentzakis, AthensTsianos Epameinondas, IoanninaElias A Kouroumalis, Heraklion Helen Christopoulou-Aletra, ThessalonikiGeorge Papatheodoridis, AthensIoannis Kanellos, ThessalonikiMichael Koutsilieris, AthensT Choli-Papadopoulou, ThessalonikiEmanuel K Manesis, AthensEvangelos Tsiambas, Ag Paraskevi AttikiKonstantinos Mimidis, AlexandroupolisSpilios Manolakopoulos, AthensSpiros Sgouros, AthensIoannis E Koutroubakis, HeraklionStefanos Karagiannis, AthensSpiros Ladas, AthensElena Vezali, AthensDina G Tiniakos, AthensEkaterini Chatzaki, AlexandroupolisDimitrios Roukos, IoanninaGeorge Sgourakis, AthensMaroulio Talieri, Athens

Hungary

Peter L Lakatos, BudapestYvette Mándi, SzegedFerenc Sipos, BudapestGyörgy M Buzás, BudapestLászló Czakó, SzegedPeter Hegyi, SzegedZoltan Rakonczay, SzegedGyula Farkas, SzegedZsuzsa Szondy, DebrecenGabor Veres, BudapestZsuzsa Schaff, Budapest

India

Philip Abraham, MumbaiSri P Misra, Allahabad Ramesh Roop Rai, JaipurNageshwar D Reddy, HyderabadRakesh Kumar Tandon, New DelhiJai Dev Wig, ChandigarhUday C Ghoshal, LucknowPramod Kumar Garg, New DelhiBarjesh Chander Sharma, New DelhiGopal Nath, VaranasiBhupendra Kumar Jain, DelhiDevinder Kumar Dhawan, ChandigarhAshok Kumar, LucknowBenjamin Perakath, Tamil NaduDebidas Ghosh, MidnporePankaj Garg, PanchkulaSamiran Nundy, New DelhiVirendra Singh, ChandigarhBikash Medhi, ChandigarhRadha K Dhiman, Chandigarh Vandana Panda, MumbaiVineet Ahuja, New DelhiSV Rana, Chandigarh

March 7, 2013IIIWJG|www.wjgnet.com

Deepak N Amarapurkar, MumbaiAbhijit Chowdhury, KolkataJasbir Singh, KurukshetraB Mittal, LucknowSundeep Singh Saluja, New DelhiPradyumna Kumar Mishra, MumbaiRunu Chakravarty, KolkataNagarajan Perumal, New Delhi

Indonesia

David handojo Muljono, JakartaAndi Utama, Tangerang

Iran

Seyed-Moayed Alavian, TehranReza Malekzadeh, TehranPeyman Adibi, IsfahanAlireza Mani, TehranSeyed Mohsen Dehghani, ShirazMohammad Abdollahi, TehranMajid Assadi, BushehrArezoo Aghakhani, TehranMarjan Mohammadi, TehranFariborz Mansour-Ghanaei, Rasht

Ireland

Ross McManus, DublinBilly Bourke, DublinCatherine Greene, DublinTed Dinan, CorkMarion Rowland, Dublin

Israel

Abraham R Eliakim, Haifa Simon Bar-Meir, Tel HashomerAmi D Sperber, Beer-Sheva Boris Kirshtein, Beer ShevaMark Pines, Bet DaganMenachem Moshkowitz, Tel-AvivRon Shaoul, HaifaShmuel Odes, Beer ShevaSigal Fishman, Tel AvivAlexander Becker, AfulaAssy Nimer, SafedEli Magen, AshdodAmir Shlomai, Tel-Aviv

Italy

Mauro Bortolotti, BolognaGianlorenzo Dionigi, VareseFiorucci Stefano, PerugiaRoberto Berni Canani, NaplesBallarin Roberto, ModenaBruno Annibale, RomaVincenzo Stanghellini, BolognaGiovanni B Gaeta, NapoliClaudio Bassi, VeronaMauro Bernardi, BolognaGiuseppe Chiarioni, ValeggioMichele Cicala, Rome

Dario Conte, Milano Francesco Costa, PisaGiovanni D De Palma, NaplesGiammarco Fava, AnconaFrancesco Feo, SassariEdoardo G Giannini, Genoa Fabio Grizzi, MilanSalvatore Gruttadauria, PalermoPietro Invernizzi, MilanEzio Laconi, CagliariGiuseppe Montalto, Palermo Giovanni Musso, TorinoGerardo Nardone, NapoliValerio Nobili, RomeRaffaele Pezzilli, Bologna Alberto Piperno, MonzaAnna C Piscaglia, RomaPiero Portincasa, Bari Giovanni Tarantino, NaplesCesare Tosetti, Porretta TermeAlessandra Ferlini, FerraraAlessandro Ferrero, TorinoDonato F Altomare, BariGiovanni Milito, RomeGiuseppe Sica, RomeGuglielmo Borgia, NaplesGiovanni Latella, L'AquilaSalvatore Auricchio, NaplesAlberto Biondi, RomeAlberto Tommasini, TriesteAntonio Basoli, RomaGiuliana Decorti, TriesteMarco Silano, RomaMichele Reni, MilanPierpaolo Sileri, RomeAchille Iolascon, NaplesAlessandro Granito, BolognaAngelo A Izzo, NaplesGiuseppe Currò, MessinaPier Mannuccio Mannucci, MilanoMarco Vivarelli, BolognaMassimo Levrero, RomeMassimo Rugge, PadovaPaolo Angeli, PadovaSilvio Danese, MilanoAntonello Trecca, RomeAntonio Gasbarrini, RomeCesare Ruffolo, TrevisoMassimo Falconi, VeronaFausto Catena, BolognaFrancesco Manguso, NapoliGiancarlo Mansueto, VeronaLuca Morelli, TrentoMarco Scarpa, PadovaMario M D'Elios, FlorenceFrancesco Luzza, CatanzaroFranco Roviello, SienaGuido Torzilli, Rozzano MilanoLuca Frulloni, VeronaLucia Malaguarnera, CataniaLucia Ricci Vitiani, RomeMara Massimi, L'AquilaMario Pescatori, RomeMario Rizzetto, TorinoMirko D’Onofrio, VeronaNadia Peparini, RomePaola De Nardi, MilanPaolo Aurello, RomePiero Amodio, PadovaRiccardo Nascimbeni, Brescia

Vincenzo Villanacci, BresciaVittorio Ricci, PaviaSilvia Fargion, MilanLuigi Bonavina, Milano Oliviero Riggio, RomeFabio Pace, MilanoGabrio Bassotti, Perugia Giulio Marchesini, Bologna Roberto de Franchis, MilanoGiovanni Monteleone, RomeC armelo Scarpignato, ParmaLuca VC Valenti, MilanUrgesi Riccardo, RomeMarcello Persico, NaplesAntonio Moschetta, BariLuigi Muratori, BolognaAngelo Zullo, RomaVito Annese, FlorenceSimone Lanini, RomeAlessandro Grasso, SavonaGiovanni Targher, VeronaDomenico Girelli, VeronaAlessandro Cucchetti, BolognaFabio Marra, FlorenceMichele Milella, RomeFrancesco Franceschi, RomeGiuseppina De Petro, BresciaSalvatore Leonardi, CataniaCristiano Simone, Santa Maria ImbaroBernardino Rampone, SalernoFrancesco Crea, PisaWalter Fries, MessinaAntonio Craxì, PalermoGerardo Rosati, PotenzaMario Guslandi, Milano Gianluigi Giannelli, BariPaola Loria, ModenaPaolo Sorrentino, AvellinoArmando Santoro, RozzanoGabriele Grassi, TriesteAntonio Orlacchio, Rome

Japan

Tsuneo Kitamura, Chiba Katsutoshi Yoshizato, HigashihiroshimaMasahiro Arai, Tokyo Shinji Tanaka, Hiroshima Keiji Hirata, KitakyushuYoshio Shirai, Niigata Susumu Ohmada, Maebashi Kenichi Ikejima, TokyoMasatoshi Kudo, OsakaYoshiaki Murakami, HiroshimaMasahiro Tajika, NagoyaKentaro Yoshika, ToyoakeKyoichi Adachi, Izumo Yasushi Adachi, SapporoTakafumi Ando, Nagoya Akira Andoh, Otsu Hitoshi Asakura, Tokyo Mitsuhiro Fujishiro, TokyoToru Hiyama, HigashihiroshimaYutaka Inagaki, KanagawaHiromi Ishibashi, Nagasaki Shunji Ishihara, Izumo Toru Ishikawa, Niigata Yoshiaki Iwasaki, OkayamaTerumi Kamisawa, Tokyo

March 7, 2013IVWJG|www.wjgnet.com

Norihiro Kokudo, TokyoShin Maeda, Tokyo Yasushi Matsuzaki, Ibaraki Kenji Miki, TokyoHiroto Miwa, HyogoYoshiharu Motoo, Kanazawa Kunihiko Murase, TusimaAtsushi Nakajima, YokohamaYuji Naito, Hisato Nakajima, TokyoHiroki Nakamura, Yamaguchi Shotaro Nakamura, FukuokaMikio Nishioka, Niihama Hirohide Ohnishi, AkitaKazuichi Okazaki, OsakaMorikazu Onji, EhimeSatoshi Osawa, Hamamatsu Hidetsugu Saito, TokyoYutaka Saito, TokyoYasushi Sano, KobeTomohiko Shimatani, KureYukihiro Shimizu, ToyamaShinji Shimoda, FukuokaMasayuki Sho, NaraHidekazu Suzuki, TokyoShinji Togo, YokohamaSatoshi Yamagiwa, NiigataTakayuki Yamamoto, Yokkaichi Hiroshi Yoshida, Tokyo Norimasa Yoshida, Kyoto Akihito Nagahara, TokyoHiroaki Takeuchi, KochiKeiji Ogura, TokyoKotaro Miyake, TokushimaMitsunori Yamakawa, YamagataNaoaki Sakata, SendaiNaoya Kato, TokyoSatoshi Mamori, HyogoShogo Kikuchi, AichiShoichiro Sumi, KyotoSusumu Ikehara, OsakaTaketo Yamaguchi, ChibaTokihiko Sawada, TochigiTomoharu Yoshizumi, FukuokaToshiyuki Ishiwata, Tokyo Yasuhiro Fujino, AkashiYasuhiro Koga, Isehara cityYoshihisa Takahashi, TokyoYoshitaka Takuma, OkayamaYutaka Yata, Maebashi-cityItaru Endo, YokohamaKazuo Chijiiwa, MiyazakiKouhei Fukushima, SendaiMasahiro Iizuka, Akita Mitsuyoshi Urashima, TokyoMunechika Enjoji, FukuokaTakashi Kojima, SapporoTakumi Kawaguchi, KurumeYoshiyuki Ueno, SendaiYuichiro Eguchi, SagaAkihiro Tamori, OsakaAtsushi Masamune, SendaiAtsushi Tanaka, TokyoHitoshi Tsuda, TokyoTakashi Kobayashi, TokyoAkimasa Nakao, NagogyaHiroyuki Uehara, OsakaMasahito Uemura, KashiharaSatoshi Tanno, SapporoToshinari Takamura, KanazawaYohei Kida, Kainan

Masanori Hatakeyama, TokyoSatoru Kakizaki, GunmaShuhei Nishiguchi, HyogoYuichi Yoshida, OsakaManabu Morimoto, JapanMototsugu Kato, Sapporo Naoki Ishii, TokyoNoriko Nakajima, TokyoNobuhiro Ohkohchi, TsukubaTakanori Kanai, TokyoKenichi Goda, TokyoMitsugi Shimoda, MibuZenichi Morise, NagoyaHitoshi Yoshiji, KashiharaTakahiro Nakazawa, NagoyaUtaroh Motosugi, YamanashiNobuyuki Matsuhashi, TokyoYasuhiro Kodera, NagoyaTakayoshi Ito, TokyoYasuhito Tanaka, NagoyaHaruhiko Sugimura, HamamatsuHiroki Yamaue, WakayamaMasao Ichinose, WakayamaTakaaki Arigami, KagoshimaNobuhiro Zaima, NaraNaoki Tanaka, MatsumotoSatoru Motoyama, AkitaTomoyuki Shibata, ToyoakeTatsuya Ide, KurumeTsutomu Fujii, NagoyaOsamu Kanauchi, TokyAtsushi Irisawa, AizuwakamatsuHikaru Nagahara, TokyoKeiji Hanada, OnomichiKeiichi Mitsuyama, FukuokaShin Maeda, YokohamaTakuya Watanabe, NiigataToshihiro Mitaka, SapporoYoshiki Murakami, KyotoTadashi Shimoyama, Hirosaki

Jordan

Ismail Matalka, IrbidKhaled Jadallah, Irbid

Kuwait

Islam Khan, Safat

Lebanon

Bassam N Abboud, BeirutRami Moucari, BeirutAla I Sharara, BeirutRita Slim, Beirut

Lithuania

Giedrius Barauskas, KaunasLimas Kupcinskas, Kaunas

Malaysia

Andrew Seng Boon Chua, Ipoh

Mexico

Saúl Villa-Trevio, MexicoOmar Vergara-Fernandez, MexicoDiego Garcia-Compean, MonterreyArturo Panduro, JaliscoMiguel Angel Mercado, Distrito FederalRichard A Awad, MexicoAldo Torre Delgadillo, MexicoPaulino Martínez Hernández Magro, CelayaCarlos A Aguilar-Salinas, MexicoJesus K Yamamoto-Furusho, Mexico

Morocco

Samir Ahboucha, Khouribga

Moldova

Igor Mishin, Kishinev

Netherlands

Ulrich Beuers, AmsterdamAlbert Frederik Pull ter Gunne, TilburgJantine van Baal, HeidelberglaanWendy Wilhelmina Johanna de Leng, UtrechtGerrit A Meijer, AmsterdamLee Bouwman, LeidenJ Bart A Crusius, AmsterdamFrank Hoentjen, HaarlemServaas Morré, AmsterdamChris JJ Mulder, Amsterdam Paul E Sijens, GroningenKarel van Erpecum, Utrecht BW Marcel Spanier, ArnhemMisha Luyer, SittardPieter JF de Jonge, RotterdamRobert Christiaan Verdonk, GroningenJohn Plukker, Groningen Maarten Tushuizen, AmsterdamWouter de Herder, RotterdamErwin G Zoetendal, WageningenRobert J de Knegt, RotterdamAlbert J Bredenoord, NieuwegeinAnnemarie de Vries, RotterdamAstrid van der Velde, EdeLodewijk AA Brosens, UtrechtJames CH Hardwick, LeidenLoes van Keimpema, NijmegenWJ de Jonge, AmsterdamZuzana Zelinkova, RotterdamLN van Steenbergen, EindhovenFrank G Schaap, AmsterdamJeroen Maljaars, Leiden

New Zealand

Andrew S Day, ChristchurchMax S Petrov, Auckland

Norway

Espen Melum, Oslo

March 7, 2013VWJG|www.wjgnet.com

Trine Olsen, TromsøEyvind J Paulssen, TromsøRasmus Goll, TromsøAsle W Medhus, OsloJon Arne Søreide, StavangerKjetil Soreide, StavangerReidar Fossmark, TrondheimTrond Peder Flaten, TrondheimOlav Dalgard, OsloOle Høie, ArendalMagdy El-Salhy, BergenJørgen Valeur, Oslo

Pakistan

Shahab Abid, KarachiSyed MW Jafri, Karachi

Poland

Beata Jolanta Jablońska, KatowiceHalina Cichoż-Lach, LublinTomasz Brzozowski, Cracow Hanna Gregorek, WarsawMarek Hartleb, KatowiceStanislaw J Konturek, KrakowAndrzej Dabrowski, BialystokJan Kulig, KrakówJulian Swierczynski, GdanskMarek Bebenek, WroclawDariusz M Lebensztejn, Bialystok

Portugal

Ricardo Marcos, PortoGuida Portela-Gomes, EstorilAna Isabel Lopes, Lisboa CodexRaquel Almeida, PortoRui Tato Marinho, LisbonCeu Figueiredo, Porto

Romania

Dan L Dumitrascu, ClujAdrian Saftoiu, CraiovaAndrada Seicean, Cluj-NapocaAnca Trifan, Iasi

Russia

Vasiliy I Reshetnyak, Moscow

Saudi Arabia

Ibrahim A Al Mofleh, RiyadhAbdul-Wahed Meshikhes, QatifFaisal Sanai, Riyadh

Serbia

Tamara M Alempijevic, BelgradeDusan M Jovanovic, Sremska KamenicaZoran Krivokapic, Belgrade

Singapore

Brian Kim Poh Goh, SingaporeKhek-Yu Ho, SingaporeFock Kwong Ming, SingaporeFrancis Seow-Choen, Singapore Kok Sun Ho, SingaporeKong Weng Eu, SingaporeMadhav Bhatia, SingaporeLondon Lucien Ooi, SingaporeWei Ning Chen, SingaporeRichie Soong, SingaporeKok Ann Gwee, Singapore

Slovenia

Matjaz Homan, Ljubljana

South Africa

Rosemary Joyce Burnett, PretoriaMichael Kew, Cape TownRoland Ndip, Alice

South Korea

Byung Chul Yoo, SeoulJae J Kim, SeoulJin-Hong Kim, SuwonMarie Yeo, Suwon Jeong Min Lee, SeoulEun-Yi Moon, SeoulJoong-Won Park, GoyangHoon Jai Chun, SeoulMyung-Gyu Choi, SeoulSang Kil Lee, SeoulSang Yeoup Lee, Gyeongsangnam-doWon Ho Kim, SeoulDae-Yeul Yu, DaejeonDonghee Kim, SeoulSang Geon Kim, SeoulSun Pyo Hong, Geonggi-doSung-Gil Chi, SeoulYeun-Jun Chung, SeoulKi-Baik Hahm, IncheonJi Kon Ryu, SeoulKyu Taek Lee, Seoul Yong Chan Lee, SeoulSeong Gyu Hwang, SeongnamSeung Woon Paik, SeoulSung Kim, SeoulHong Joo Kim, SeoulHyoung-Chul Oh, SeoulNayoung Kim, Seongnam-siSang Hoon Ahn, SeoulSeon Hahn Kim, SeoulSi Young Song, SeoulYoung-Hwa Chung, SeoulHyo-Cheol Kim, SeoulKwang Jae Lee, SwonSang Min Park, SeoulYoung Chul Kim, SeoulDo Hyun Park, SeoulDae Won Jun, SeoulDong Wan Seo, SeoulSoon-Sun Hong, Incheon

Hoguen Kim, SeoulHo-Young Song, SeoulJoo-Ho Lee, SeoulJung Eun Lee, SeoulJong H Moon, Bucheon

Spain

Eva Vaquero, BarcelonaAndres Cardenas, BarcelonaLaureano Fernández-Cruz, BarcelonaAntoni Farré, SpainMaria-Angeles Aller, MadridRaul J Andrade, MálagaFernando Azpiroz, Barcelona Josep M Bordas, Barcelona Antoni Castells, Barcelona Vicente Felipo, ValenciaIsabel Fabregat, BarcelonaAngel Lanas, Zaragoza Juan-Ramón Larrubia, GuadalajaraMaría IT López, JaénJesús M Prieto, Pamplona Mireia Miquel, SabadellRamon Bataller, BarcelonaFernando J Corrales, PamplonaJulio Mayol, MadridMatias A Avila, PamplonaJuan Macías, SevilleJuan Carlos Laguna Egea, BarcelonaJuli Busquets, BarcelonaBelén Beltrán, ValenciaJosé Manuel Martin-Villa, MadridLisardo Boscá, MadridLuis Grande, BarcelonaPedro Lorenzo Majano Rodriguez, MadridAdolfo Benages, ValenciaDomínguez-Muñoz JE, Santiago de CompostelaGloria González Aseguinolaza, NavarraJavier Martin, GranadaLuis Bujanda, San SebastiánMatilde Bustos, PamplonaLuis Aparisi, ValenciaJosé Julián calvo Andrés, SalamancaBenito Velayos, ValladolidJavier Gonzalez-Gallego, LeónRuben Ciria, CórdobaFrancisco Rodriguez-Frias, BarcelonaManuel Romero-Gómez, SevillaAlbert Parés, BarcelonaJoan Roselló-Catafau, Barcelona

Sri Lanka

Arjuna De Silva, Kelaniya

Sweden

Stefan G Pierzynowski, LundHanns-Ulrich Marschall, StockholmLars A Pahlman, UppsalaHelena Nordenstedt, StockholmBobby Tingstedt, LundEvangelos Kalaitzakis, GothenburgLars Erik Agréus, HuddingeAnnika Lindblom, Stockholm

March 7, 2013VIWJG|www.wjgnet.com

Roland Andersson, LundZongli Zheng, StockholmMauro D'Amato, HuddingeGreger Lindberg, Stockholm Pär Erik Myrelid, LinköpingSara Lindén, GöteborgSara Regnér, MalmöÅke Nilsson, Lund

Switzerland

Jean L Frossard, GenevaAndreas Geier, ZürichBruno Stieger, Zürich Pascal Gervaz, GenevaPaul M Schneider, ZurichFelix Stickel, BerneFabrizio Montecucco, GenevaInti Zlobec, BaselMichelangelo Foti, GenevaPascal Bucher, GenevaAndrea De Gottardi, BerneChristian Toso, Geneva

Thailand

Weekitt Kittisupamongkol, Bangkok

Trinidad and Tobago

Shivananda Nayak, Mount Hope

Turkey

Tarkan Karakan, AnkaraYusuf Bayraktar, Ankara Ahmet Tekin, MersinAydin Karabacakoglu, KonyaOsman C Ozdogan, IstanbulÖzlem Yilmaz, IzmirBülent Salman, AnkaraCan GONEN, KutahyaCuneyt Kayaalp, MalatyaEkmel Tezel, AnkaraEren Ersoy, AnkaraHayrullah Derici, BalıkesirMehmet Refik Mas, Etlik-AnkaraSinan Akay, TekirdagA Mithat Bozdayi, AnkaraMetin Basaranoglu, IstanbulMesut Tez, AnkaraOrhan Sezgin, MersinMukaddes Esrefoglu, MalatyaIlker Tasci, AnkaraKemal Kismet, Ankara Selin Kapan, IstanbulSeyfettin Köklü, AnkaraMurat Sayan, KocaeliSabahattin Kaymakoglu, IstanbulYucel Ustundag, ZonguldakCan Gonen, IstanbulYusuf Yilmaz, IstanbulMüge Tecder-Ünal, Ankaraİlhami Yüksel, Ankara

United Arab Emirates

Fikri M Abu-Zidan, Al-AinSherif M Karam, Al-Ain

United Kingdom

Anastasios Koulaouzidis, EdinburghSylvia LF Pender, SouthamptonHong-Xiang Liu, Cambridge William Dickey, LondonderrySimon D Taylor-Robinson, London James Neuberger, Birmingham Frank I Tovey, LondonKevin Robertson, GlasgowChew Thean Soon, ManchesterGeoffrey Burnstock, LondonVamsi R Velchuru, United KingdomSimon Afford, BirminghamNavneet K Ahluwalia, StockportLesley A Anderson, BelfastAnthony TR Axon, Leeds Jim D Bell, London Alastair D Burt, NewcastleTatjana Crnogorac-Jurcevic, LondonDaniel R Gaya, EdinburghWilliam Greenhalf, Liverpool Indra N Guha, SouthamptonStefan G Hübscher, BirminghamRobin Hughes, LondonPali Hungin, StocktonJanusz AZ Jankowski, Oxford Peter Karayiannis, LondonPatricia F Lalor, BirminghamGiorgina Mieli-Vergani, London D Mark Pritchard, LiverpoolMarco Senzolo, PadovaRoger Williams, LondonM H Ahmed, SouthamptonChristos Paraskeva, BristolEmad M El-Omar, AberdeenA M El-Tawil, BirminghamAnne McCune, BristolCharles B Ferguson, BelfastChin Wee Ang, LiverpoolClement W Imrie, GlasgowDileep N Lobo, NottinghamGraham MacKay, GlasgowGuy Fairbairn Nash, PooleIan Lindsey, OxfordJason CB Goh, BirminghamJeremy FL Cobbold, LondonJulian RF Walters, LondonJamie Murphy, LondonJohn Beynon, SwanseaJohn B Schofield, KentAnil George, LondonAravind Suppiah, East YorkshireBasil Ammori, SalfordCatherine Walter, CheltenhamChris Briggs, SheffieldJeff Butterworth, ShrewsburyNawfal Hussein, NottinghamPatrick O'Dwyer, GlasgowRob Glynne-Jones, NorthwoodSharad Karandikar, Venkatesh Shanmugam, Derby

Yeng S Ang, WiganAlberto Quaglia, LondonAndrew Fowell, SouthamptonGianpiero Gravante, LeicesterPiers Gatenby, LondonKondragunta Rajendra Prasad, LeedsSunil Dolwani, Cardiff Andrew McCulloch Veitch, WolverhamptonBrian Green, BelfastNoriko Suzuki, MiddlesexRichard Parker, North StaffordshireShahid A Khan, LondonAkhilesh B Reddy, CambridgeJean E Crabtree, LeedsJohn S Leeds, SheffieldPaul Sharp, LondonSumita Verma, BrightonThamara Perera, BirminghamDonald Campbell McMillan, GlasgowKathleen B Bamford, LondonHelen Coleman, BelfastEyad Elkord, ManchesterMohammad Ilyas, NottinghamSimon R Carding, NorwichIan Chau, SuttonClaudio Nicoletti, NorwichHendrik-Tobias Arkenau, LondonMuhammad Imran Aslam, LeicesterGiuseppe Orlando, OxfordJohn S Leeds, AberdeenS Madhusudan, NottinghamAmin Ibrahim Amin, DunfermlineDavid C Hay,EdinburghAlan Burns, London

United States

Tauseef Ali, Oklahoma CityGeorge Y Wu, Farmington Josef E Fischer, BostonThomas Clancy, BostonJohn Morton, StanfordLuca Stocchi, ClevelandKevin Michael Reavis, OrangeShiu-Ming Kuo, Buffalo Gary R Lichtenstein, Philadelphia Natalie J Torok, SacramentoScott A Waldman, PhiladelphiaGeorgios Papachristou, PittsburghCarla W Brady, DurhamRobert CG Martin, LouisvilleEugene P Ceppa, DurhamShashi Bala, WorcesterImran Hassan, SpringfieldKlaus Thaler, ColumbiaAndreas M Kaiser, Los AngelesShawn D Safford, NorfolkMassimo Raimondo, JacksonvilleKazuaki Takabe, Richmond VAStephen M Kavic, BaltimoreT Clark Gamblin, Pittsburgh BS Anand, HoustonAnanthanarayanan M, New YorkAnthony J Bauer, PittsburghEdmund J Bini, New YorkXian-Ming Chen, Omaha Ramsey Chi-man Cheung, Palo AltoParimal Chowdhury, ArkansasMark J Czaja, New York

March 7, 2013VIIWJG|www.wjgnet.com

Conor P Delaney, ClevelandSharon DeMorrow, TempleBijan Eghtesad, ClevelandAlessandro Fichera, ChicagoGlenn T Furuta, AuroraJean-Francois Geschwind, BaltimoreShannon S Glaser, TempleAjay Goel, DallasJames H Grendell, New YorkAnna S Gukovskaya, Los AngelesJamal A Ibdah, ColumbiaAtif Iqbal, Omaha Hajime Isomoto, Rochester Hartmut Jaeschke, KansasLeonard R Johnson, MemphisRashmi Kaul, TulsaAli Keshavarzian, ChicagoMiran Kim, ProvidenceBurton I Korelitz, New York Richard A Kozarek, Seattle Alyssa M Krasinskas, PittsburghMing Li, New Orleans Zhiping Li, BaltimoreChen Liu, GainesvilleMichael R Lucey, MadisonJames D Luketich, Pittsburgh Patrick M Lynch, HoustonWillis C Maddrey, DallasMercedes Susan Mandell, AuroraWendy M Mars, PittsburghLaura E Matarese, PittsburghLynne V McFarland, WashingtonStephan Menne, New YorkDidier Merlin, AtlantaGeorge Michalopoulos, PittsburghJames M Millis, ChicagoPramod K Mistry, New HavenEmiko Mizoguchi, BostonPeter L Moses, BurlingtonMasaki Nagaya, BostonRobert D Odze, BostonStephen JD O’Keefe, PittsburghZhiheng Pei, New YorkRaymund R Razonable, MinnesotaBasil Rigas, New YorkRichard A Rippe, Chapel HillPhilip Rosenthal, San FranciscoStuart Sherman, Indianapolis Christina Surawicz, SeattleWing-Kin Syn, DurhamYvette Taché, Los AngelesK-M Tchou-Wong, New YorkGeorge Triadafilopoulos, StanfordChung-Jyi Tsai, LexingtonAndrew Ukleja, FloridaArnold Wald, WisconsinIrving Waxman, ChicagoSteven D Wexner, Weston Jackie Wood, OhioJian Wu, SacramentoZobair M Younossi, VirginiaLiqing Yu, Winston-SalemRuben Zamora, Pittsburgh Michael E Zenilman, New YorkMichael A Zimmerman, ColoradoBeat Schnüriger, CaliforniaClifford S Cho, Madison

R Mark Ghobrial, TexasAnthony T Yeung, PhiladelphiaChang Kim, West LafayetteBalamurugan N Appakalai, MinneapolisAejaz Nasir, TampaAshkan Farhadi, Irvine Kevin E Behrns, GainesvilleJoseph J Cullen, Iowa CityDavid J McGee, ShreveportAnthony J Demetris, PittsburghDimitrios V Avgerinos, New YorkDong-Hui Li, HoustonEric S Hungness, ChicagoGiuseppe Orlando, Winston SalemHai-Yong Han, PhoenixHuanbiao Mo, DentonJong Park, TampaJustin MM Cates, NashvilleCharles P Heise, MadisonCraig D Logsdon, HoustonEce A Mutlu, ChicagoJessica A Davila, HoustonRabih M Salloum, RochesterAmir Maqbul Khan, MarshallBruce E Sands, BostonChakshu Gupta, Saint JosephRicardo Alberto Cruciani, New YorkMariana D Dabeva, BronxEdward L Bradley III, SarasotaMartín E Fernández-Zapico, RochesterHenry J Binder, New HavenJohn R Grider, RichmondRonnie Fass, TucsonDinesh Vyas, WashingtonWael El-Rifai, NashvilleCraig J McClain, LouisvilleChristopher Mantyh, DurhamDaniel S Straus, RiversideDavid A Brenner, San DiegoEileen F Grady, San FranciscoEkihiro Seki, La JollaFang Yan, NashvilleFritz Francois, New YorkGiamila Fantuzzi, ChicagoGuang-Yin Xu, GalvestonJianyuan Chai, Long BeachJingXuan Kang, CharlestownLe Shen, ChicagoLin Zhang, PittsburghMitchell L Shiffman, RichmondDouglas K Rex, IndianapolisBo Shen, ClevelandEdward J Ciaccio, New YorkJean S Wang, Saint LouisBao-Ting Zhu, KansasTamir Miloh, PhoenixEric R Kallwitz, ChicagoYujin Hoshida, CambridgeC Chris Yun, AtlantaAlan C Moss, BostonOliver Grundmann, GainesvilleLinda A Feagins, DallasChanjuan Shi, NashvilleXiaonan Han, CincinnatiWilliam R Brugge, BostonRichard W McCallum, El PasoLisa Ganley-Leal, BostonLin-Feng Chen, Urbana

Elaine Y Lin, New YorkJulian Abrams, New YorkArun Swaminath, New YorkHuiping Zhou, RichmondKorkut Uygun, BostonAnupam Bishayee, Signal HillC Bart Rountree, HersheyAvinash Kambadakone, BostonCourtney W Houchen, OklahomaJoshua R Friedman, PhiladelphiaJustin H Nguyen, JackonvilleSophoclis Alexopoulos, Los AngelesSuryakanth R Gurudu, ScottsdaleWei Jia, KannapolisYoon-Young Jang, BaltimoreOurania M Andrisani, West LafayetteRoderick M Quiros, BethlehemTimothy R Koch, WashingtonAdam S Cheifetz, BostonLifang Hou, ChicagoThiru vengadam Muniraj, PittsburghDhiraj Yadav, PittsburghYing Gao, RockvilleJohn F Gibbs, BuffaloAaron Vinik, NorfolkCharles Thomas, OregonRobert Jensen, BethesdaJohn W Wiley, Ann ArborJonathan Strosberg, TampaRandeep Singh Kashyap, New YorkKaye M Reid Lombardo, RochesterLygia Stewart, San FranciscoMartin D Zielinski, RochesterMatthew James Schuchert, PittsburghMichelle Lai, BostonMillion Mulugeta, Los AngelesPatricia Sylla, BostonPete Muscarella, ColumbusRaul J Rosenthal, WestonRobert V Rege, DallasRoberto Bergamaschi, New York Ronald S Chamberlain, LivingstonAlexander S Rosemurgy, TampaRun Yu, Los AngelesSamuel B Ho, San DiegoSami R Achem, FloridaSandeep Mukherjee, OmahaSanthi Swaroop Vege, RochesterScott Steele, Fort LewisSteven Hochwald, GainesvilleUdayakumar Navaneethan, CincinnatiRadha Krishna Yellapu, New YorkRupjyoti Talukdar, RochesterShi-Ying Cai, New HavenThérèse Tuohy, Salt Lake CityTor C Savidge, GalvestonWilliam R Parker, DurhamXiaofa Qin, NewarkZhang-Xu Liu, Los AngelesAdeel A Butt, Pittsburgh Dean Y Kim, DetroitDenesh Chitkara, East BrunswickMohamad A Eloubeidi, AlabamaJiPing Wang, BostonOscar Joe Hines, Los AngelesJon C Gould, MadisonKirk Ludwig, WisconsinMansour A Parsi, Cleveland

March 7, 2013VIIIWJG|www.wjgnet.com

Perry Shen, Winston-SalemPiero Marco Fisichella, Maywood Marco Giuseppe Patti, ChicagoMichael Leitman, New YorkParviz M Pour, Omaha Florencia Georgina Que, RochesterRichard Hu, Los AngelesRobert E Schoen, PittsburghValentina Medici, SacramentoWojciech Blonski, PhiladelphiaYuan-Ping Han, Los AngelesGrigoriy E Gurvits, New YorkRobert C Moesinger, OgdenMark Bloomston, Columbus

Bronislaw L Slomiany, NewarkLaurie DeLeve, Los AngelesMichel M Murr, TampaJohn Marshall, ColumbiaWilfred M Weinstein, Los AngelesJonathan D Kaunitz, Los AngelesJosh Korzenik, BostonKareem M Abu-Elmagd, PittsburghMichael L Schilsky, New HavenJohn David Christein, BirminghamMark A Zern, SacramentoAna J Coito, Los AngelesGolo Ahlenstiel, BethesdaSmruti R Mohanty, Chicago

Victor E Reyes, Galveston CS Pitchumoni, New BrunswickYoshio Yamaoka, HoustonSukru H Emre, New HavenBranko Stefanovic, TallahasseeJack R Wands, ProvidenceWen Xie, PittsburghRobert Todd Striker, MadisonShivendra Shukla, ColumbiaLaura E Nagy, ClevelandFei Chen, MorgantownKusum K Kharbanda, OmahaPal Pacher, RockvillePietro Valdastri, Nashville

March 7, 2013IXWJG|www.wjgnet.com

S

2293 Colorectalanastomoticleakage:Aspectsofprevention,detectionand

treatment

Daams F, Luyer M, Lange JF

2298 Dipeptidylpeptidase-4:Akeyplayerinchronicliverdisease

Itou M, Kawaguchi T, Taniguchi E, Sata M

2307 Roleofinterleukin-6inBarrett¡'sesophaguspathogenesis

Dvorak K, Dvorak B

2313 Isitworthinvestigatingsplenicfunctioninpatientswithceliacdisease?

Di Sabatino A, Brunetti L, Carnevale Maffè G, Giuffrida P, Corazza GR

2319 Effectofbiliarydrainageoninduciblenitricoxidesynthase,CD14andTGR5

expressioninobstructivejaundicerats

Wang ZK, Xiao JG, Huang XF, Gong YC, Li W

2331 SpecialAT-richsequence-bindingprotein1promotescellgrowthand

metastasisincolorectalcancer

Fang XF, Hou ZB, Dai XZ, Chen C, Ge J, Shen H, Li XF, Yu LK, Yuan Y

2340 DepletionoftelomeraseRNAinhibitsgrowthofgastrointestinaltumors

transplantedinmice

Sun XC, Yan JY, Chen XL, Huang YP, Shen X, Ye XH

2348 UnitedStates-basedpracticepatternsandresourceutilizationinadvanced

neuroendocrinetumortreatment

Strosberg J, Casciano R, Stern L, Parikh R, Chulikavit M, Willet J, Liu Z, Wang X,

Grzegorzewski KJ

2355 Patientcomfortandqualityincolonoscopy

Ekkelenkamp VE, Dowler K, Valori RM, Dunckley P

2362 Colonoscopycanmissdiverticulaoftheleftcolonidentifiedbybariumenema

Niikura R, Nagata N, Shimbo T, Akiyama J, Uemura N

Contents Weekly Volume 19 Number 15 April 21, 2013

� April 21, 2013|Volume 19|�ssue 15|WJG|www.wjgnet.com

EDITORIAL

MINIREVIEWS

REVIEW

ORIGINAL ARTICLE

BRIEF ARTICLE

ContentsWorld Journal of Gastroenterology

Volume 19 Number 15 April 21, 2013

2368 Ultrasound-guidedvs endoscopicultrasound-guidedfine-needleaspirationfor

pancreaticcancerdiagnosis

Matsuyama M, Ishii H, Kuraoka K, Yukisawa S, Kasuga A, Ozaka M, Suzuki S,

Takano K, Sugiyama Y, Itoi T

2374 SeroprevalenceofceliacdiseaseamonghealthyadolescentsinSaudiArabia

Aljebreen AM, Almadi MA, Alhammad A, Al Faleh FZ

2379 FactorsinfluencingclinicaloutcomesofHistoacryl®glueinjection-treated

gastricvaricealhemorrhage

Prachayakul V, Aswakul P, Chantarojanasiri T, Leelakusolvong S

2388 EffectofHelicobacterpylori eradicationonserumghrelinandobestatinlevels

Ulasoglu C, Isbilen B, Doganay L, Ozen F, Kiziltas S, Tuncer I

2395 Increasedinternationalnormalizedratiolevelinhepatocellularcarcinoma

patientswithdiabetesmellitus

Zhang H, Gao C, Fang L, Yao SK

2404 Twist2isavaluableprognosticbiomarkerforcolorectalcancer

Yu H, Jin GZ, Liu K, Dong H, Yu H, Duan JC, Li Z, Dong W, Cong WM, Yang JH

2412 Elevatedserumlevelsofhumanrelaxin-2inpatientswithesophageal

squamouscellcarcinoma

Ren P, Yu ZT, Xiu L, Wang M, Liu HM

2419 Exposuretogastricjuicemaynotcauseadenocarcinogenesisoftheesophagus

Cheng P, Li JS, Zhang LF, Chen YZ, Gong J

2425 Endoscopicpapillaryballoonintermittentdilatationandendoscopic

sphincterotomyforbileductstones

Fu BQ, Xu YP, Tao LS, Yao J, Zhou CS

2433 Dysphagialusoria:Alateonsetpresentation

Bennett AL, Cock C, Heddle R, Morcom RK

2437 Fifteen-year-oldcoloncancerpatientwitha10-yearhistoryofulcerativecolitis

Noh SY, Oh SY, Kim SH, Kim HY, Jung SE, Park KW

�� April 21, 2013|Volume 19|�ssue 15|WJG|www.wjgnet.com

CASE REPORT

ContentsWorld Journal of Gastroenterology

Volume 19 Number 15 April 21, 2013

2441 Duct-to-ductbiliaryreconstructionafterradicalresectionofBismuthⅢahilar

cholangiocarcinoma

Wu WG, Gu J, Dong P, Lu JH, Li ML, Wu XS, Yang JH, Zhang L, Ding QC, Weng H,

Ding Q, Liu YB

�� April 21, 2013|Volume 19|�ssue 15|WJG|www.wjgnet.com

NAMEOFJOURNALWorld Journal of Gastroenterology

ISSNISSN 1007-9327 (print)ISSN 2219-2840 (online)

LAUNCHDATEOctober 1, 1995

FREQUENCYWeekly

EDITOR-IN-CHIEFFerruccio Bonino, MD, PhD, Professor of Gastro-enterology, Director of Liver and Digestive Disease Division, Department of Internal Medicine, University of Pisa, Director of General Medicine 2 Unit Univer-sity Hospital of Pisa, Via Roma 67, 56124 Pisa, Italy

Myung-Hwan Kim, MD, PhD, Professor, Head, Department of Gastroenterology, Director, Center for Biliary Diseases, University of Ulsan College of Medicine, Asan Medical Center, 388-1 Pungnap-2dong, Songpa-gu, Seoul 138-736, South Korea

Kjell Öberg, MD, PhD, Professor, Department of Endocrine Oncology, Uppsala University Hospital, SE-751 85 Uppsala, Sweden

Matt D Rutter, MBBS, MD, FRCP, Consultant Gas-troenterologist, Senior Lecturer, Director, Tees Bowel Cancer Screening Centre, University Hospital of North Tees, Durham University, Stockton-on-Tees, Cleveland TS19 8PE, United Kingdom

Andrzej S Tarnawski, MD, PhD, DSc (Med), Pro-fessor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of Cali-fornia, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States

EDITORIALOFFICEJin-Lei Wang, DirectorXiu-Xia Song, Vice DirectorWorld Journal of GastroenterologyRoom 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, ChinaTelephone: +86-10-59080039Fax: +86-10-85381893E-mail: [email protected]://www.wjgnet.com

PUBLISHERBaishideng Publishing Group Co., LimitedFlat C, 23/F., Lucky Plaza, 315-321 Lockhart Road, Wan Chai, Hong Kong, China

Contents

EDITORS FOR THIS ISSUE

Responsible Assistant Editor: Shuai Ma Responsible Science Editor: Ling-Ling WenResponsible Electronic Editor: Jun-Yao Li Proofing Editorial Office Director: Jin-Lei WangProofing Editor-in-Chief: Lian-Sheng Ma

�V April 21, 2013|Volume 19|�ssue 15|WJG|www.wjgnet.com

Fax: +852-65557188Telephone: +852-31779906E-mail: [email protected]://www.wjgnet.com

PUBLICATIONDATEApril 21, 2013

COPYRIGHT© 2013 Baishideng. Articles published by this Open-Access journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and repro-duction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license.

SPECIALSTATEMENTAll articles published in this journal represent the viewpoints of the authors except where indicated otherwise.

INSTRUCTIONSTOAUTHORSFull instructions are available online at http://www.wjgnet.com/1007-9327/g_info_20100315215714.htm

ONLINESUBMISSIONhttp://www.wjgnet.com/esps/

INDEXING/ABSTRACTING

World Journal of GastroenterologyVolume 19 Number 15 April 21, 2013

I-VI Instructionstoauthors

EditorialBoardMemberofWorldJournalofGastroenterology ,ToruIshikawa,MD,DepartmentofGastroenterology,SaiseikaiNiigataSecondHospital,Teraji280-7,Niigata,Niigata950-1104,Japan

World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN 1007-9327, online ISSN 2219-2840, DOI: 10.3748) is a peer-reviewed open access journal. WJG was estab-lished on October 1, 1995. It is published weekly on the 7th, 14th, 21st, and 28th each month. The WJG Editorial Board consists of 1352 experts in gastroenterology and hepatology from 64 countries. The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endos-copy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastroin-testinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional ther-apy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterol-ogy, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biol-ogy, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gas-troenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians.

World Journal of Gastroenterology is now indexed in Current Contents®/Clinical Medicine, Science Citation Index Expanded (also known as SciSearch®), Journal Citation Reports®, Index Medi-cus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Journal Citation Reports®, Gastroenterology and Hepatology, 2011 Impact Factor: 2.471 (32/74); Total Cites: 16951 (7/74); Current Articles: 677 (1/74); and Eigenfactor® Score: 0.06035 (5/74).

I-IX EditorialBoard

APPENDIX

ABOUT COVER

AIMS AND SCOPE

FLYLEAF

Colorectal anastomotic leakage: Aspects of prevention, detection and treatment

Freek Daams, Misha Luyer, Johan F Lange

EDITORIAL

Online Submissions: http://www.wjgnet.com/esps/[email protected]:10.3748/wjg.v19.i15.2293

2293 April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

World J Gastroenterol 2013 April 21; 19(15): 2293-2297 ISSN 1007-9327 (print) ISSN 2219-2840 (online)

© 2013 Baishideng. All rights reserved.

Freek Daams, Misha Luyer, Department of Surgery, Catharina Ziekenhuis, 5623 EJ Eindhoven, The NetherlandsJohan F Lange, Department of Surgery, Erasmus Medical Cen-ter, 3015 CE Rotterdam, The NetherlandsAuthor contributions: Daams F and Luyer M performed the review of literature and wrote the paper; Lange JF supervised the data collection and revised the paperCorrespondence to: Freek Daams, MD, Department of Sur-gery, Catharina Ziekenhuis, Michelangelolaan 2, 5623 EJ Eind-hoven, The Netherlands. [email protected]: +31-6-55688542 Fax: +31-40-2443370Received: December 31, 2012 Revised: January 18, 2013 Accepted: February 5, 2013Published online: April 21, 2013

AbstractAll colorectal surgeons are faced from time to time with anastomotic leakage after colorectal surgery. This complication has been studied extensively without a significant reduction of incidence over the last 30 years. New techniques of prevention, by innovative anastomotic techniques should improve results in the future, but standardization and “teachability” should be guaranteed. Risk scoring enables intra-operative decision-making whether to restore continuity or devi-ate. Early detection can lead to reduction in delay of diagnosis as long as a standard system is used. For treatment options, no firm evidence is available, but future studies could focus on repair and saving of the anastomosis on the one hand or anastomotical break-down and definitive colostomy on the other hand.


Key words: Colorectal surgery; Complications; Postop-erative care; Anastomotic leakage; Prevention

Core tip: This editorial covers the past achievements and future challenges in the field of colorectal anasto-

motic leakage. New anastomotic techniques and risk scores should improve incidence numbers and early detection, whereas future research could focus on pres-ervation of the anastomosis in case of leakage.

Daams F, Luyer M, Lange JF. Colorectal anastomotic leakage: Aspects of prevention, detection and treatment. World J Gastro-enterol 2013; 19(15): 2293-2297 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2293.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2293

INTRODUCTIONAnastomotic leakage after colorectal resection (CAL) is a dreaded complication and is reported to have a significant mortality (6%-22%)[1]. Morbidity is dramatically increased opposed to patients without CAL and leads to reopera-tions, radiological interventions and permanent stoma in 56%[2]. CAL is the leading cause of postoperative death after colorectal surgery, increases the risk of a permanent stoma significantly. Although available data on the effect of CAL on long-term oncologic outcome is not univocal, most papers on this topic report worse oncologic outcome in terms of increased local recurrence and negative asso-ciation with survival[3]. Despite great numbers of studies investigating risk factors, surgical techniques and preven-tion of CAL, over the last three decades incidence has not reduced. In a recent publication by the Dutch Surgical Colorectal Audit incidence of CAL after restorative colon and rectum resections in 9192 registered patients in The Netherlands over 2010 was 8.7% (Table 1). Additionally, with patients expected to become older and to have more co morbidities, every patient but also every colorectal sur-geon will increasingly be exposed to CAL and forthcoming difficulties in diagnosis and treatment. Incidence should be reduced and outcome must improve. Understanding cur-rent developments and its omissions will lead to design of relevant future research.

RISK FACTORS Extensive literature is available on the topic of risk fac-tors for anastomotic leakage. Among other factors are male gender, smoking, obesity, alcohol abuse, preopera-tive steroid and non-steroidal anti-inflammatory drugs use, longer duration of operation, preoperative transfu-sion, contamination of the operative field and timing during duty hour[4-7]. Increasingly, aspects of case volume for rectal surgery are discussed in respect to postopera-tive complications. Asteria et al[8] described case volume per centre < 20 is correlated to CAL. In line with this finding, Biondo et al[9] described in their study over 1046 emergency colorectal resection that CAL occurred less frequent in patients who were treated by special-ized colorectal surgeons. Recently, risk factor studies have also been undertaken for laparoscopic colorectal surgery, identifying body mass index, tumour distance from the anal verge, tumour depth, and pelvic outlet as independent predictors for increased operative time and morbidity after laparoscopic total mesorectal excision[10]. Furthermore, American Society of Anesthesiologists Ⅲ/Ⅳ patients and operative time longer itself are risk fac-tors for CAL after laparoscopic colorectal surgery[11]. It is debatable whether leakage rates might have been lower if preoperative radio-chemotherapy is not applied as widely as is done nowadays, since neo-adjuvant therapy is one of the strongest risk factors amongst the above mentioned. This great abundance of literature does not provide colorectal surgeons with clear guidance in the decision of when to renounce from restorative surgery. To pro-vide an objective assessment of the risk of anastomotic leakage, Dekker et al[12] developed and tested the Colon Leakage Score (CLS). In this score multiple risk factors were taken up and points were attributed to the patients per risk factor. As a predictor, CLS had an excellent area under the curve of the receiver-operating characteristics curve (AUC 0.95, 95%CI: 0.89-1.00), and an odds ratio of 1.74 (95%CI: 1.32-2.28). To our knowledge this tool is unique in its ability to detect high-risk patients preopera-tively and objectively assesses the necessity for diverting ileostomy or non-restorative surgery.

SURGICAL TECHNIQUEA recent review from our group addresses all the impor-tant steps that surgeons need to take into mind when creating a colorectal anastomosis[13]. Although some prerequisites should be present as adequate blood flow, without any tension in the absence of peritonitis, no clear value can be given for these aspects. When the little evidence that is available for the hand-sewn anastomosis is evaluated, it can be concluded that an inverting single layer continuous suture technique with slowly absorbable monofilament material seems preferable. Strong evidence lacks for other important aspects as distance from the su-ture to the edge of the anastomosis, distance between the sutures, layers included in the suture, suture tension and the optimal configuration. The highest level of evidence

exists for the equality regarding to CAL of stapling vs hand sewn anastomosis, without evidence for one tech-nique being superior to the other[14]. Following the above mentioned statements, currently stapling techniques might be of preference since the technique is uniform and easy to learn, making it ideal for comparing results between hospitals and surgeons and for teaching young surgeons.

There is a need for development of new techniques since all previous research has not lead to radically de-creased leakage rates. Many experimental techniques have been investigated and some have shown at least equal result in comparison to hand-sewn techniques. Not many techniques tested in animal experiments have been translated to the human setting. Reasons for this could be that no standard models and robust translatable outcome measures exist for colorectal experiments. In humans, the so-called compression anastomosis is shown to have similar leakage rates compared to hand-sewn anastomo-sis[14,15]. Extra-luminal sealing using fibrin glue or acrylates have been reported mostly in animal studies, few reports on their use in human colorectal anastomosis have not shown beneficial effects on CAL[16]. Endo-luminal sealing by means of a biodegradable barrier has shown to be suc-cessfully applied in humans and a multicentre randomised clinical trial is currently being undertaken (Figure 1)[17].

Future studies should in our opinion focus on tech-niques that are easy to learn and have high reproducibility. To enhance reproducibility, animal studies should use the same animal models that are currently available or under construction.

EARLY DETECTIONAnastomotic leakage typically becomes clinically appar-


Daams F et al . Colorectal anastomotic leakage

Colon Rectum< 75 yr ≥ 75 yr < 75 yr ≥ 75 yr

Resections 10249 (59.0) 7246 (41.0) 5076 (72.0) 1933 (28.0) Anastomotic leakage 666 (7.4) 449 (7.3) 310 (11.4) 55 (8.1)

Table 1 Number of colon and rectum resections in The Neth-erlands in 2011 and percentage anastomotic leakage n (%)

Anastomosis

Endoluminal seal (C-seal)

Anus

Figure 1 C-seal. Endoluminal biodegradable anastomotic cover. Printing with permission from Bakker et al[17].

ent between the 5th and the 8th postoperative day, but many exceptions exist, with one study even reporting a mean of the 12th postoperative day for the diagnosis of CAL[18]. Clinical signs of systemic inflammatory response syndrome, fever, ileus and pain are frequent but have low positive predictive value for CAL, when observed separately. In a study by den Dulk et al[19] these clinical features were combined into a clinical scoring system (Dutch Leakage Score), with which patients were scored daily in a systematical and uniform way. Points are attrib-uted to certain clinical symptoms (i.e., fever, heart rate), nutritional status (signs of ileus, gastric retention, type of intake) and laboratory findings [i.e., C-reactive protein (CRP) level, leucocytes, kidney function]. After applying the score system retrospectively on a historical cohort, the score was used prospectively. It was shown that pa-tients with a higher score were prone to CAL requiring intensive clinical observation or radiological evaluation (Figure 2). This scoring system reduced delay in diagno-sis of anastomotic leak from 4 to 1.5 d, decreasing false negative diagnostic imaging representing a major factor of delay in diagnosis[20]. Although it is not known if the application of the score leads to an increase of negative imaging, the score could be especially beneficial in daily clinical practise where young doctors and nursing staff could identify high risk patients very easily and in a stan-dardised manner. Furthermore, it could improve compa-rability of studies when applied more universally.

This interval between surgery and clinical onset sug-gests a preclinical phase in which non-clinical methods could be used to predict CAL. Consequently, routine postoperative measurement of serum level CRP is stud-ied for infectious complications after colorectal surgery in general and CAL in particular. In a meta-analysis by Warschkow et al[21] including six studies, a cut-off of 135

mg/L on postoperative day 4 resulted in a negative pre-dictive value of 89% for infectious complications. CRP and other biochemical parameters detect systemic reac-tions, while other techniques are recently applied to de-tect local, juxta-anastomotical changes in metabolism and ischemia. Microdialysis of the peritoneal cavity is such a technique using an indwelling two-lumen catheter that detects changes in oxygenation locally at the site of anas-tomosis. Few studies have shown the ability to distinct patients with CAL after rectum resection from patients with an uncomplicated course, although these have insuf-ficient samples to provide predictive values[22,23]. Future studies should focus on preclinical detection of CAL, since patients that are reoperated in an early phase could be protected from septic sequellae of clinical CAL.

TREATMENTWhen facing and treating patients with CAL, surgeons have to take into account many different aspects, i.e., age, health status and current clinical condition of the pa-tient, extent of dehiscence, time between operation and reoperation, indication of primary resection, presence of diverting stoma and localisation of the anastomosis. These variables lead to individualisation of treatment strategies and incomparable outcome. However, few studies, showing that surgeons believe that the anasto-mosis can be repaired rather than dismantled, have paved the way for a trial in which next to mortality and morbid-ity, preservation of the anastomosis could be one of the endpoints[24,25]. Difficulties in designing such a trial are the aforementioned large variety of clinical course, the unpredictability of CAL and the relatively low incidence of CAL per centre.


Leakage-score

Re-evaluation and laboratory investigation within 12 h; CT-scan with rectal contrast?

≤ 3 points 4-7 points ≥ 8 points Clinically proven AL

No action

CT-scan with rectal contrast

Positive CT-scan (confirmed AL): Initiate treatment. Relaparotomy?

Negative CT-scan (no AL): Other focus? Relaparotomy?If not, re-evaluation with laboratory investigation after 12 h

Figure 2 The Dutch Leakage Score. According to the points attributed to the patients on the basis of clinical symptoms, treating doctors can follow this diagnostic flowchart. Reprinted from den Dulk et al[19]. CT: Com-puted tomography; AL: Anastomotic leak.



79-86 [PMID: 20083758 DOI: 10.1001/archsurg.2009.208]10 Akiyoshi T, Kuroyanagi H, Oya M, Konishi T, Fukuda M,

Fujimoto Y, Ueno M, Miyata S, Yamaguchi T. Factors affect-ing the difficulty of laparoscopic total mesorectal excision with double stapling technique anastomosis for low rectal cancer. Surgery 2009; 146: 483-489 [PMID: 19715805 DOI: 10.1016/j.surg.2009.03.030]

11 Canelas A, Bun M, Laporte M, Peczan C, Rotholtz N. Lapa-roscopic emergency surgery for ulcerative colitis. Colorectal Dis 2010; 12: 35 [DOI: 10.1111/j.1463-1318.2010.02367.x]

12 Dekker JW, Liefers GJ, de Mol van Otterloo JC, Putter H, Tollenaar RA. Predicting the risk of anastomotic leakage in left-sided colorectal surgery using a colon leakage score. J Surg Res 2011; 166: e27-e34 [PMID: 21195424 DOI: 10.1016/j.jss.2010.11.004]

13 Slieker JC, Daams F, Mulder IM, Jeekel J, Lange JF. Sys-tematic review of the technique of colorectal anastomosis. JAMA Surg 2013; 148: 190-201 [PMID: 23426599]

14 Lustosa SA, Matos D, Atallah AN, Castro AA. Stapled versus handsewn methods for colorectal anastomosis sur-gery. Cochrane Database Syst Rev 2001; (3): CD003144 [PMID: 11687041 DOI: 10.1002/14651858.CD003144]

15 Påhlman L, Ejerblad S, Graf W, Kader F, Kressner U, Lind-mark G, Raab Y. Randomized trial of a biofragmentable bowel anastomosis ring in high-risk colonic resection. Br J Surg 1997; 84: 1291-1294 [PMID: 9313717 DOI: 10.1046/j.1365-2168.1997.02771.x]

16 Huh JW, Kim HR, Kim YJ. Anastomotic leakage after lapa-roscopic resection of rectal cancer: the impact of fibrin glue. Am J Surg 2010; 199: 435-441 [PMID: 19481197 DOI: 10.1016/j.amjsurg.2009.01.018]

17 Bakker IS, Morks AN, Hoedemaker HO, Burgerhof JG, Leu-venink HG, Ploeg RJ, Havenga K. The C-seal trial: colorectal anastomosis protected by a biodegradable drain fixed to the anastomosis by a circular stapler, a multi-center random-ized controlled trial. BMC Surg 2012; 12: 23 [PMID: 23153188 DOI: 10.1186/1471-2482-12-23]

18 Hyman N, Manchester TL, Osler T, Burns B, Cataldo PA. Anastomotic leaks after intestinal anastomosis: it’s later than you think. Ann Surg 2007; 245: 254-258 [PMID: 17245179 DOI: 10.1097/01.sla.0000225083.27182.85]

19 den Dulk M, Noter SL, Hendriks ER, Brouwers MA, van der Vlies CH, Oostenbroek RJ, Menon AG, Steup WH, van de Velde CJ. Improved diagnosis and treatment of anasto-motic leakage after colorectal surgery. Eur J Surg Oncol 2009; 35: 420-426 [PMID: 18585889 DOI: 10.1016/j.ejso.2008.04.009]

20 Doeksen A, Tanis PJ, Vrouenraets BC, Lanschot van JJ, Tets van WF. Factors determining delay in relaparotomy for anastomotic leakage after colorectal resection. World J Gastroenterol 2007; 13: 3721-3725 [PMID: 17659732 DOI: 10.1007/s00384-008-0487-z]

21 Warschkow R, Beutner U, Steffen T, Müller SA, Schmied BM, Güller U, Tarantino I. Safe and early discharge after colorectal surgery due to C-reactive protein: a diagnostic meta-analysis of 1832 patients. Ann Surg 2012; 256: 245-250 [PMID: 22735714 DOI: 10.1097/SLA.0b013e31825b60f0]

22 Ellebaek Pedersen M, Qvist N, Bisgaard C, Kelly U, Bern-hard A, Møller Pedersen S. Peritoneal microdialysis. Early diagnosis of anastomotic leakage after low anterior resec-tion for rectosigmoid cancer. Scand J Surg 2009; 98: 148-154 [PMID: 19919919]

23 Matthiessen P, Strand I, Jansson K, Törnquist C, Andersson M, Rutegård J, Norgren L. Is early detection of anastomotic leakage possible by intraperitoneal microdialysis and intra-peritoneal cytokines after anterior resection of the rectum for cancer? Dis Colon Rectum 2007; 50: 1918-1927 [PMID: 17763907]

24 Phitayakorn R, Delaney CP, Reynolds HL, Champagne BJ, Heriot AG, Neary P, Senagore AJ. Standardized algorithms

CONCLUSIONColorectal anastomotic leakage is a serious complication that has great clinical impact on patients, putting surgeons in dilemmas of prevention, diagnosis and treatment. Many aspects of colorectal anastomotic leakage like eti-ology remain unclear. Current practise however should comprise intra-operative risk assessment and subsequent adaptation of operative technique when necessary. Cur-rent optimal suture technique appears to be using slowly absorbable monofilament sutures applied in a continuous, inverting, single layer manner or stapling. Postoperatively, early detection plays a key role and a leakage score system and routine laboratory tests (CRP at postoperative day 3-4) contribute strongly to it. When reoperating, sparing the anastomosis should be kept in mind as a valid treat-ment option, although more research is needed on which clinical state allows this option.

REFERENCES1 Rullier E, Laurent C, Garrelon JL, Michel P, Saric J, Parneix

M. Risk factors for anastomotic leakage after resection of rectal cancer. Br J Surg 1998; 85: 355-358 [PMID: 9529492 DOI: 10.1046/j.1365-2168.1998.00615.x]

2 Lindgren R, Hallböök O, Rutegård J, Sjödahl R, Matthiessen P. What is the risk for a permanent stoma after low anterior resection of the rectum for cancer? A six-year follow-up of a multicenter trial. Dis Colon Rectum 2011; 54: 41-47 [PMID: 21160312 DOI: 10.1007/DCR.0b013e3181fd2948]

3 Walker KG, Bell SW, Rickard MJ, Mehanna D, Dent OF, Chapuis PH, Bokey EL. Anastomotic leakage is predictive of diminished survival after potentially curative resection for colorectal cancer. Ann Surg 2004; 240: 255-259 [PMID: 15273549 DOI: 10.1097/01.sla.0000133186.81222.08]

4 Lipska MA, Bissett IP, Parry BR, Merrie AE. Anastomotic leakage after lower gastrointestinal anastomosis: men are at a higher risk. ANZ J Surg 2006; 76: 579-585 [PMID: 16813622 DOI: 10.1111/j.1445-2197.2006.03780.x]

5 Konishi T, Watanabe T, Kishimoto J, Nagawa H. Risk fac-tors for anastomotic leakage after surgery for colorectal can-cer: results of prospective surveillance. J Am Coll Surg 2006; 202: 439-444 [PMID: 16500248 DOI: 10.1016/j.jamcollsurg.2005.10.019]

6 Buckley JE. Credibility and drug education: a critique and reformulation. Int J Addict 1989; 24: 489-497 [PMID: 2689358 DOI: 10.1007/s00384-009-06924]

7 Gorissen KJ, Benning D, Berghmans T, Snoeijs MG, Sosef MN, Hulsewe KW, Luyer MD. Risk of anastomotic leakage with non-steroidal anti-inflammatory drugs in colorectal surgery. Br J Surg 2012; 99: 721-727 [PMID: 22318712 DOI: 10.1002/bjs.8691]

8 Asteria CR, Gagliardi G, Pucciarelli S, Romano G, Infantino A, La Torre F, Tonelli F, Martin F, Pulica C, Ripetti V, Di-ana G, Amicucci G, Carlini M, Sommariva A, Vinciguerra G, Poddie DB, Amato A, Bassi R, Galleano R, Veronese E, Mancini S, Pescio G, Occelli GL, Bracchitta S, Castagnola M, Pontillo T, Cimmino G, Prati U, Vincenti R. Anastomotic leaks after anterior resection for mid and low rectal cancer: survey of the Italian Society of Colorectal Surgery. Tech Coloproctol 2008; 12: 103-110 [PMID: 18545882 DOI: 10.1007/s10151-008-0407-9]

9 Biondo S, Kreisler E, Millan M, Fraccalvieri D, Golda T, Fra-go R, Miguel B. Impact of surgical specialization on emer-gency colorectal surgery outcomes. Arch Surg 2010; 145:



for management of anastomotic leaks and related abdomi-nal and pelvic abscesses after colorectal surgery. World J Surg 2008; 32: 1147-1156 [PMID: 18283511 DOI: 10.1007/s00268-008-9468-1]

25 Daams F, Slieker JC, Tedja A, Karsten TM, Lange JF. Treat-ment of Colorectal Anastomotic Leakage: Results of a Ques-tionnaire amongst Members of the Dutch Society of Gastroin-testinal Surgery. Dig Surg 2013; 29: 516-521 [PMID: 23485790]

P- Reviewers Rege RV, Mayol J S- Editor Gou SX L- Editor A E- Editor Li JY


Dipeptidyl peptidase-4: A key player in chronic liver disease

Minoru Itou, Takumi Kawaguchi, Eitaro Taniguchi, Michio Sata

Minoru Itou, Eitaro Taniguchi, Division of Gastroenterology, Department of Medicine, Kurume University School of Medi-cine, Kurume 830-0011, JapanTakumi Kawaguchi, Michio Sata, Division of Gastroenterology, Department of Medicine and Department of Digestive Disease Information and Research, Kurume University School of Medi-cine, Kurume 830-0011, JapanAuthor contributions: Itou M and Kawaguchi T collected the materials and wrote the manuscript; Taniguchi E discussed the topic; Sata M supervised the manuscript.Correspondence to: Takumi Kawaguchi, MD, PhD, Division of Gastroenterology, Department of Medicine and Department of Digestive Disease Information and Research, Kurume University School of Medicine, 67 Asahi-machi, Kurume 830-0011, Japan. [email protected]: +81-942-317902 Fax: +81-942-317820Received: October 29, 2012 Revised: February 27, 2013Accepted: March 6, 2013Published online: April 21, 2013

AbstractDipeptidyl peptidase-4 (DPP-4) is a membrane-associ-ated peptidase, also known as CD26. DPP-4 has wide-spread organ distribution throughout the body and exerts pleiotropic effects via its peptidase activity. A representative target peptide is glucagon-like peptide-1, and inactivation of glucagon-like peptide-1 results in the development of glucose intolerance/diabetes mel-litus and hepatic steatosis. In addition to its peptidase activity, DPP-4 is known to be associated with immune stimulation, binding to and degradation of extracellular matrix, resistance to anti-cancer agents, and lipid ac-cumulation. The liver expresses DPP-4 to a high degree, and recent accumulating data suggest that DPP-4 is involved in the development of various chronic liver dis-eases such as hepatitis C virus infection, non-alcoholic fatty liver disease, and hepatocellular carcinoma. Fur-thermore, DPP-4 occurs in hepatic stem cells and plays a crucial role in hepatic regeneration. In this review, we described the tissue distribution and various biologi-cal effects of DPP-4. Then, we discussed the impact of DPP-4 in chronic liver disease and the possible thera-

REVIEW





peutic effects of a DPP-4 inhibitor.


Key words: Incretin; Viral hepatitis; Insulin resistance; Steatohepatitis; Cancer; Sitagliptin; Vildagliptin; Alo-gliptin; Teneligliptin; Linagliptin

Core tip: Dipeptidyl peptidase-4 (DPP-4) is a membrane-associated peptidase, also known as CD26. DPP-4 has widespread organ distribution throughout the body and exerts pleiotropic effects via its peptidase activity. In this review, we described the tissue distribution and various biological effects of DPP-4. Then, we discussed the im-pact of DPP-4 in chronic liver disease and the possible therapeutic effects of a DPP-4 inhibitor.

Itou M, Kawaguchi T, Taniguchi E, Sata M. Dipeptidyl pepti-dase-4: A key player in chronic liver disease. World J Gastroen-terol 2013; 19(15): 2298-2306 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2298.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2298

DISTRIBUTION OF DIPEPTIDYL PEPTIDASE-4Dipeptidyl peptidase-4 (DPP-4, enzyme code number 3.4.14.5) is a 110 kDa membrane-associated peptidase, which was originally identified in 1966 as a dipeptide naphthylamidase that hydrolyzed glycyl-prolyl-beta-naph-thylamide[1]. DPP-4, also known as CD26[2-4], is expressed on the apical surfaces of epithelial and acinar cells and in endothelial cells, fibroblasts, and lymphocytes[5-8]. DPP-4 also exists as a soluble circulating form in plasma[9].

DPP-4 occurs in all organs including the small intes-tine, biliary tract, exocrine pancreas, spleen, and brain in both rodents and humans[10-12]. This widespread organ distribution indicates that DPP-4 has pleiotropic biologi-cal activities. The liver is one of the organs that highly ex-

presses DPP-4[8]. In the healthy human liver, intense stain-ing for DPP-4 is seen in hepatic acinar zones 2 and 3, but not in zone 1. Similar lobular heterogeneity is also seen in the expression of cytochrome p450, gamma-glutamyl-transpeptidase (GGT), and glutamine synthetase[13-15]. This heterogeneous lobular distribution suggests that DPP-4 may be involved in the regulation of hepatic metabolism.

BIOLOGICAL ACTIVITIES OF DPP-4PeptidaseDPP-4 is an enzyme that cleaves N-terminal dipeptides of proline or alanine-containing peptides including incre-tin, appetite-suppressing hormones (neuropeptide), and chemokines as listed in Table 1. Representative targets are glucagon-like peptide (GLP)-1, GLP-2, peptide YY, chemokine ligand 12/stromal-derived factor-1 (CXCL12/SDF-1), and substance P. Thus, DPP-4 exerts pleiotropic effects on glucose metabolism, gut motility, appetite regu-

lation, inflammation, immune system function, and pain regulation though its peptidase activity (Figure 1).

Immune stimulationDPP-4 expression is downregulated in the resting state of T-cells; however, expression is upregulated by antigenic or mitogenic stimulation via an interleukin-12-dependent mechanism[16-18]. DPP-4 activates intracellular molecules including p56lck, phospholipase C-γ, and mitogen-activated protein kinase (MAPK)[11]. This activation enhances T-cell maturation and migration, cytokine secretion, antibody production, immunoglobulin isotype switching of B cells, and activation of cytotoxic T cells[19,20]. In addition, soluble CD26 binds to mannose 6-phosphate receptor and is taken up by CD14 positive monocytes, increasing their antigen presenting activity and T-cell proliferation[11,21,22].

Binding to extracellular matrixDPP-4 has the ability to bind to the Binding to extracel-lular matrix (ECM), preferentially to the collagens Ⅰ and Ⅲ, and fibronectin[23,24], and is involved in hepatocyte-extracellular matrix interactions[23,25]. The putative col-lagen binding site of DPP-4 is located at the C-terminal portion of the molecule, separate from the peptidase catalytic site[26].

In a mouse xenograft model, treatment with anti-DPP-4 monoclonal antibody inhibits the growth of renal cell carcinoma via disruption of binding to the extracel-lular matrix[27]. On the other hand, over expression of DPP-4 induces apoptosis of prostate cancer cells by inhi-bition of cell migration and invasion through down-regu-lation of MAPK-extracellular signal-regulated kinase-1/2 activation[28]. Thus, the role of DPP-4 may differ in dif-ferent types of cancer.

Degradation of ECMDPP-4 binds to adenosine deaminase and activates plas-minogen-2, leading to an increase in plasmin levels[11]. The increased plasmin degrades type Ⅳ collagen, fibro-nectin, laminin, and proteoglycan, and activates matrix metalloproteinases. These changes result in the degrada-tion of the ECM[29,30].

Resistance to anti-cancer agentsDPP-4 is thought to be associated with sensitivity to anti-cancer agents in hematologic malignancies. DPP-4 has been linked to high topoisomerase Ⅱα levels, resistance to anti-cancer agents, and the malignant potential of T-cell lymphoma[11,21,22]. Treatment with anti-DPP-4 monoclonal antibody causes dephosphorylation of both MAPK and integrin β1 in T-cell lymphoma, leading increased sensi-tivity to anti-cancer agents and greater survival[31]. Similar beneficial effects of anti-DPP-4 monoclonal antibody have been reported in renal cell carcinoma[27] and malig-nant mesothelioma tumors[32].

Lipid accumulationDPP-4 affects lipid metabolism by the inactivation of


Itou M et al . DPP-4 in liver disease

Category Peptide Ref.

Glucose metabolism GLP-1 [94-97]GIP [97-99]

Glucagon [97,100,101]PACAP-38 [102-104]

Gut motility GLP-2 [97,105,106]VIP [107-109]NPY [109,110]GRP [103]

Peptide histidine methionine [94,102] Appetite regulation Peptide YY [107,111] Chemokine CCL5/RANTES [112-114]

CCL11/eotaxin [115,116]CCL22/MDC [112]CXCL9/MIg [117-119]

CXCL10/IP10 [114,119,120]CXCL11/I-TAC [121,122]CXCL12/SDF-1 [93,113]

Growth IGF-1 [123,124]GHRH [94,125]

Reproduction Prolactin [126-128]hCGα [129]LHα [123]

Vasodilation CGRP [107,110]Bradykinin [107,108]

Pain regulation Enkephalin [130]Endomorphins [109,130-132]

Substance P [109,110,133,134] Homeostasis Thyotropin α [123,135] Inhibition of endothelial cell growth

Vasostatin-Ⅰ [136]

Table 1 Target peptide of dipeptidyl peptidase-4

GLP: Glucagon-like peptide; GIP: Glucose-dependent insulinotoropic peptide; PACAP-38: Pituitary adenylate cyclase-activating polypeptide-38; VIP: Vasoactive intestinal peptide; NPY: Neuro-peptide Y; GRP: Gastrin-releasing peptide; CCL: Chemokine (C-C motif) ligand; RANTES: Regu-lated upon activation; MDC: Macrophage-derived chemokine; CXCL: Chemokine (C-X-C motif) ligand; MIg: Monokine induced by gamma interferon; IP-10: Protein 10 from interferon (γ)-induced cell line; I-TAC: Interferon-inducible T-cell α chemoattractant; SDF-1: Stromal-derived factor-1; IGF-1: Insulin-like growth factor-1; GHRH: Growth hormone re-leasing hormone; hCGα: Human chorionic gonadotropin α subunit; LHα: Leutinizing hormone α chain; CGRP: Calcitonin-related peptide.

peptides such as GLP-1, neuropeptide Y, and peptide YY. In addition, DPP-4 is known to directly affect lipid metabolism. Knock-out of the gene encoding DPP-4 directly causes activation of the peroxisome proliferator-activated receptor-α pathway and inactivation of the sterol regulatory element binding protein-1 pathway[33], thereby increasing lipid oxidation, reducing lipogenesis, and resulting in the prevention of high-fat diet-induced hepatic steatosis.

CHANGES IN DPP-4 IN PATIENTS WITH LIVER DISEASESerum level of DPP-4 is elevated in patients with liver cirrhosis[34,35] and up-regulation of hepatic DPP-4 expres-sion is thought to be responsible for this elevation[36]. Here, we describe the effects of DPP-4 according to each pathophysiology.

Hepatitis C virus infectionPatients with hepatitis C virus (HCV) infection show increased serum DPP-4 expression in hepatocytes[37,38]. Lymphocyte subset analysis has also shown that CD8+ T-cells, which express DPP-4, are present in the portal and periportal areas in patients with HCV infection[39]. Since HCV infects CD8+ T-cells[39-41], HCV-infected T-cells may be responsible for the increased serum DPP-4 activity in patients with HCV infection.

In addition, glucose intolerance with insulin resistance is a feature of HCV infection and is associated with dis-ease progression as well as prognosis[42-52]. Besides hepatic inflammation and steatosis, HCV itself is involved in the development of insulin resistance through the impair-ment of insulin receptor substrate-1/2[52-54]. Moreover, HCV infection is known to be associated with increased DPP-4 expression in the ileum, liver, and serum[38]. Trans-fection with cDNA encoding part of the HCV non-structural genome region 4B/5A induces expression of DPP-4 in hepatocyte cell lines[55]. Furthermore, eradica-tion of HCV by interferon therapy results in a decrease in serum DPP-4 levels[56-61] and administration of sitagliptin

significantly improves HCV-related glucose intolerance[62]. Since there is no significant association between serum DPP-4 activity and severity of liver disease in patients with HCV infection[38], HCV infection may directly up-regulate DPP-4 activity, leading to impairment in glucose metabolism.

Non-alcoholic fatty liver diseaseNon-alcoholic fatty liver disease (NAFLD) is a hepatic manifestation of metabolic syndrome and the most com-mon cause of chronic liver disease[63-66]. Although various factors are responsible for the development of NAFLD, a high glucose load is known to induce DPP-4 expression in HepG2 cells[67] and hepatic DPP-4 mRNA expression level in the livers is significantly higher in patients with NAFLD, compared to healthy subjects[67]. In fact, serum DPP-4 activity and hepatic expression of DPP-4 are cor-related with hepatic steatosis and NAFLD grading[68]. Moreover, DPP-4 deficient rats show lower levels of hepatic proinflammatory and profibrotic cytokines and re-duced hepatic steatosis compared to wild type rats. These favorable changes in lipid metabolism are independent of glucose metabolism[69]. Similar to these results from animal experiments, in patients with NAFLD, DPP-4 activity in serum and liver specimens correlate with markers of liver damage such as serum GGT and alanine aminotransfer-ase levels, but do not correlate with fasting blood glucose levels and glycosylated hemoglobin (HbA1c) values[68,70]. Thus, hepatic DPP-4 expression in NAFLD may be di-rectly associated with hepatic lipogenesis and liver injury.

Recently, DPP-4 inhibitor has been reported to im-prove hepatic steatosis in mice and humans[71]. We also experienced a case of refractory NAFLD that was suc-cessfully treated with sitagliptin, a DDP-4 inhibitor[72]. Moreover, it is reported that sitagliptin ameliorates liver enzymes and hepatocyte ballooning in patients with non-alcoholic steatohepatitis[73]. Taken together, these findings may indicate that DPP-4 inhibitors ameliorate hepatic injury and glucose impairment in patients with NAFLD.

Hepatocellular carcinomaIncreased DPP-4 expression is seen in various malignant


Biological activities of DPP-4

Immune stimulation

T-cell proliferation Immune globulin production IL-2 and IFN-γ secretion

Resistant to anti-cancer agents

High topoisomerase Ⅱα level

Lipid accumulation

Inactivation of PPARα Activation of SREBP-1c

Peptidase

Inactivation of 1. Incretin (GLP-1, GLP-2)2. Appetite-suppressing hormone3. Chemokine etc .

Binding to ECM

Inhibition or promotion ofcell migration and invasion

Degradation of ECM

Degradation of type Ⅳ collagenActivation of MMPs

Figure 1 Pleiotropic effects of dipeptidyl pep-tidase-4. Dipeptidyl peptidase-4 (DPP-4) exerts various effects on metabolism and chemokine through peptidase activity. In addition, DPP-4 is involved in immune stimulation, binding to and degradation of extracellular matrix, and resistant to anti-cancer agents. DPP-4 also directly affects lipid accumulation. GLP: Glucagon-like peptide; ECM: Extracellular matrix; MMPs: Metalloproteinases; IL: Interleukin; IFN: Interferon; PPAR: Peroxisome proliferator-activated receptor; SREBP: Sterol regulatory element binding protein.



the effects of long-term administration of a DPP-4 in-hibitor on infection and carcinogenesis.

REFERENCES1 Hopsu-Havu VK, Glenner GG. A new dipeptide naphthyl-

amidase hydrolyzing glycyl-prolyl-beta-naphthylamide. Histochemie 1966; 7: 197-201 [PMID: 5959122 DOI: 10.1007/BF00577838]

2 Misumi Y, Hayashi Y, Arakawa F, Ikehara Y. Molecular cloning and sequence analysis of human dipeptidyl pep-tidase IV, a serine proteinase on the cell surface. Biochim Biophys Acta 1992; 1131: 333-336 [PMID: 1352704 DOI: 10.1016/0167-4781(92)90036-Y]

3 Kameoka J, Tanaka T, Nojima Y, Schlossman SF, Morimoto C. Direct association of adenosine deaminase with a T cell activation antigen, CD26. Science 1993; 261: 466-469 [PMID: 8101391 DOI: 10.1126/science.8101391]

4 Morrison ME, Vijayasaradhi S, Engelstein D, Albino AP, Houghton AN. A marker for neoplastic progression of human melanocytes is a cell surface ectopeptidase. J Exp Med 1993; 177: 1135-1143 [PMID: 8096237 DOI: 10.1084/jem.177.4.1135]

5 Drucker DJ, Nauck MA. The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 in-hibitors in type 2 diabetes. Lancet 2006; 368: 1696-1705 [PMID: 17098089 DOI: 10.1016/S0140-6736(06)69705-5]

6 Holst JJ. Glucagon-like peptide-1: from extract to agent. The Claude Bernard Lecture, 2005. Diabetologia 2006; 49: 253-260 [PMID: 16416146 DOI: 10.1007/s00125-005-0107-1]

7 McCaughan GW, Gorrell MD, Bishop GA, Abbott CA, Shackel NA, McGuinness PH, Levy MT, Sharland AF, Bow-en DG, Yu D, Slaitini L, Church WB, Napoli J. Molecular pathogenesis of liver disease: an approach to hepatic inflam-mation, cirrhosis and liver transplant tolerance. Immunol Rev 2000; 174: 172-191 [PMID: 10807516 DOI: 10.1034/j.1600-0528.2002.017420.x]

8 Mentzel S, Dijkman HB, Van Son JP, Koene RA, Assmann KJ. Organ distribution of aminopeptidase A and dipeptidyl peptidase IV in normal mice. J Histochem Cytochem 1996; 44: 445-461 [PMID: 8627002 DOI: 10.1177/44.5.8627002]

9 Kikuchi M, Fukuyama K, Epstein WL. Soluble dipeptidyl peptidase IV from terminal differentiated rat epidermal cells: purification and its activity on synthetic and natural peptides. Arch Biochem Biophys 1988; 266: 369-376 [PMID: 2461166 DOI: 10.1016/0003-9861(88)90268-8]

10 Heike M , Möbius U, Knuth A, Meuer S, Meyer zum Büschenfelde KH. Tissue distribution of the T cell activation antigen Ta1. Serological, immunohistochemical and bio-chemical investigations. Clin Exp Immunol 1988; 74: 431-434 [PMID: 2466591]

11 Gorrell MD, Gysbers V, McCaughan GW. CD26: a multi-functional integral membrane and secreted protein of acti-vated lymphocytes. Scand J Immunol 2001; 54: 249-264 [PMID: 11555388 DOI: 10.1046/j.1365-3083.2001.00984.x]

12 Dinjens WN, ten Kate J, Wijnen JT, van der Linden EP, Beek CJ, Lenders MH, Khan PM, Bosman FT. Distribution of adenosine deaminase-complexing protein in murine tissues. J Biol Chem 1989; 264: 19215-19220 [PMID: 2681214]

13 Moody DE, Taylor LA, Smuckler EA. Immunofluores-cent determination of the lobular distribution of a con-stitutive form of hepatic microsomal cytochrome P-450. Hepatology 1985; 5: 440-451 [PMID: 3888809 DOI: 10.1002/hep.1840050317]

14 Irie M, Suzuki N, Sohda T, Anan A, Iwata K, Takeyama Y, Watanabe H, Fischer P, Scherberich JE, Sakisaka S. Hepatic expression of gamma-glutamyltranspeptidase in the hu-man liver of patients with alcoholic liver disease. Hepatol Res 2007; 37: 966-973 [PMID: 17854466 DOI: 10.1111/j.1872-

tumors, such as breast cancer[74,75], brain glioma[76], malig-nant mesothelioma[77], and squamous cell laryngeal carci-noma[78]. In hepatocellular carcinoma (HCC), increased DPP-4 expression is also seen in liver specimens and serum from both rats[79] and humans[80].

Inhibition of DPP-4 in human hepatoma cells is reported to suppress tyrosine kinase, leading to anti-apoptotic effects[81]. However, Yamamoto et al[82] recently reported a case in which dramatic regression of HCC was seen after four weeks’ treatment with DPP-4 inhibitor in a patient with HCV-related chronic hepatitis. Although it is unclear whether DPP-4 inhibitor is directly involved in the regression of HCC, marked invasion of CD8+ T-cells was seen around the HCC tissue[82], suggesting that the DPP-4 inhibitor may have improved immune response, which has been impaired by chronic HCV infection[38]. Although exogenous insulin or sulfonylurea treatment increases the risk of HCC[83], treatment with DPP-4 in-hibitor does not show any tumor promoting effects in mice[84]. Thus, a DPP-4 inhibitor may safely exert benefi-cial effects on HCV-related HCC through modulation of immunity.

Stem cell and hepatic regenerationIncreased hepatic DPP-4 expression has been reported to occur in the cirrhotic liver[85,86]. Although the impact of increased DPP-4 expression remains unclear, Lee et al[87] recently reported that human liver stem cells express DPP-4, but not CD34 and CD45, which are hematopoi-etic stem cell and endothelial progenitor cell markers. Thus, DPP-4 is a specific marker of adult hepatic stem and progenitor cells, indicating that DPP-4 may be in-volved in the regeneration in chronically inflamed liver.

CXCL12/SDF-1 causes hematopoietic stem cell (HSC) homing and is an important chemokine for hepat-ic regeneration[88-91]. CXCL12/SDF-1 is a target peptide of DPP-4 and the inhibition of the cell-surface DPP-4 activity of HSC/hematopoietic progenitor cell popula-tions increases their CXCL12/SDF-1 directed chemotax-is, homing, and engraftment[92]. Therefore, inhibition of DPP-4 may be an effective therapy for increasing the ef-ficacy and success of HSC/hematopoietic progenitor cell transplantation[92]. DPP-4 inhibition also increases num-ber of progenitor cells, and stabilization of endogenous CXCL12/SDF-1 by DPP-4 inhibition is achievable and may be a promising strategy to intensify sequestration of regenerative stem cells[93].

CONCLUSIONIn this review, we described the tissue distribution and bi-ological effects of DPP-4. Then, we discussed the impact of DPP-4 in chronic liver disease and the possible effects of a DPP-4 inhibitor. DPP-4 plays crucial roles in the de-velopment of various chronic liver diseases, and DPP-4 inhibition seems to have beneficial effects in chronic liver diseases. However, DPP-4 inhibitors also modulate the immune system, and further studies will be focused on



034X.2007.00151.x]15 Häussinger D, Gerok W. Hepatocyte heterogeneity in

glutamate uptake by isolated perfused rat liver. Eur J Biochem 1983; 136: 421-425 [PMID: 6414814 DOI: 10.1111/j.1432-1033.1983.tb07759.x]

16 Fox DA, Hussey RE, Fitzgerald KA, Acuto O, Poole C, Pal-ley L, Daley JF, Schlossman SF, Reinherz EL. Ta1, a novel 105 KD human T cell activation antigen defined by a mono-clonal antibody. J Immunol 1984; 133: 1250-1256 [PMID: 6205075]

17 Hegen M, Niedobitek G, Klein CE, Stein H, Fleischer B. The T cell triggering molecule Tp103 is associated with di-peptidyl aminopeptidase IV activity. J Immunol 1990; 144: 2908-2914 [PMID: 1969875]

18 Yamabe T, Takakura K, Sugie K, Kitaoka Y, Takeda S, Okubo Y, Teshigawara K, Yodoi J, Hori T. Induction of the 2B9 antigen/dipeptidyl peptidase IV/CD26 on hu-man natural killer cells by IL-2, IL-12 or IL-15. Immu-nology 1997; 91: 151-158 [PMID: 9203979 DOI: 10.1046/j.1365-2567.1997.00230.x]

19 Ohnuma K, Takahashi N, Yamochi T, Hosono O, Dang NH, Morimoto C. Role of CD26/dipeptidyl peptidase IV in human T cell activation and function. Front Biosci 2008; 13: 2299-2310 [PMID: 17981712 DOI: 10.2741/2844]

20 Matteucci E, Giampietro O. Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem 2009; 16: 2943-2951 [PMID: 19689275 DOI: 10.2174/092986709788803114]

21 Ohnuma K, Yamochi T, Uchiyama M, Nishibashi K, Yoshi-kawa N, Shimizu N, Iwata S, Tanaka H, Dang NH, Morim-oto C. CD26 up-regulates expression of CD86 on antigen-presenting cells by means of caveolin-1. Proc Natl Acad Sci USA 2004; 101: 14186-14191 [PMID: 15353589 DOI: 10.1073/pnas.0405266101]

22 Ohnuma K, Uchiyama M, Yamochi T, Nishibashi K, Hosono O, Takahashi N, Kina S, Tanaka H, Lin X, Dang NH, Morim-oto C. Caveolin-1 triggers T-cell activation via CD26 in as-sociation with CARMA1. J Biol Chem 2007; 282: 10117-10131 [PMID: 17287217 DOI: 10.1074/jbc.M609157200]

23 Piazza GA, Callanan HM, Mowery J, Hixson DC. Evidence for a role of dipeptidyl peptidase IV in fibronectin-mediated interactions of hepatocytes with extracellular matrix. Bio-chem J 1989; 262: 327-334 [PMID: 2573346]

24 Cheng HC, Abdel-Ghany M, Pauli BU. A novel consensus motif in fibronectin mediates dipeptidyl peptidase IV ad-hesion and metastasis. J Biol Chem 2003; 278: 24600-24607 [PMID: 12716896 DOI: 10.1074/jbc.M303424200]

25 Walborg EF, Tsuchida S, Weeden DS, Thomas MW, Barrick A, McEntire KD, Allison JP, Hixson DC. Identification of dipeptidyl peptidase IV as a protein shared by the plasma membrane of hepatocytes and liver biomatrix. Exp Cell Res 1985; 158: 509-518 [PMID: 3891389 DOI: 10.1016/0014-4827(85)90474-4]

26 Löster K, Zeilinger K, Schuppan D, Reutter W. The cysteine-rich region of dipeptidyl peptidase IV (CD 26) is the col-lagen-binding site. Biochem Biophys Res Commun 1995; 217: 341-348 [PMID: 8526932 DOI: 10.1006/bbrc.1995.2782]

27 Inamoto T, Yamochi T, Ohnuma K, Iwata S, Kina S, Inamoto S, Tachibana M, Katsuoka Y, Dang NH, Morimoto C. Anti-CD26 monoclonal antibody-mediated G1-S arrest of human renal clear cell carcinoma Caki-2 is associated with retino-blastoma substrate dephosphorylation, cyclin-dependent kinase 2 reduction, p27(kip1) enhancement, and disruption of binding to the extracellular matrix. Clin Cancer Res 2006; 12: 3470-3477 [PMID: 16740772 DOI: 10.1158/1078-0432.CCR-06-0361]

28 Wesley UV, McGroarty M, Homoyouni A. Dipeptidyl pep-tidase inhibits malignant phenotype of prostate cancer cells by blocking basic fibroblast growth factor signaling path-way. Cancer Res 2005; 65: 1325-1334 [PMID: 15735018 DOI:

10.1158/0008-5472.CAN-04-1852]29 Gonzalez-Gronow M, Hershfield MS, Arredondo-Vega

FX, Pizzo SV. Cell surface adenosine deaminase binds and stimulates plasminogen activation on 1-LN human pros-tate cancer cells. J Biol Chem 2004; 279: 20993-20998 [PMID: 15016824 DOI: 10.1074/jbc.M401023200]

30 Gorrell MD. Dipeptidyl peptidase IV and related enzymes in cell biology and liver disorders. Clin Sci (Lond) 2005; 108: 277-292 [PMID: 15584901 DOI: 10.1042/CS20040302]

31 Sato T, Yamochi T, Yamochi T, Aytac U, Ohnuma K, McKee KS, Morimoto C, Dang NH. CD26 regulates p38 mitogen-activated protein kinase-dependent phosphorylation of integrin beta1, adhesion to extracellular matrix, and tu-morigenicity of T-anaplastic large cell lymphoma Karpas 299. Cancer Res 2005; 65: 6950-6956 [PMID: 16061680 DOI: 10.1158/0008-5472.CAN-05-0647]

32 Inamoto T, Yamada T, Ohnuma K, Kina S, Takahashi N, Yamochi T, Inamoto S, Katsuoka Y, Hosono O, Tanaka H, Dang NH, Morimoto C. Humanized anti-CD26 monoclonal antibody as a treatment for malignant mesothelioma tu-mors. Clin Cancer Res 2007; 13: 4191-4200 [PMID: 17634548 DOI: 10.1158/1078-0432.CCR-07-0110]

33 Conarello SL, Li Z, Ronan J, Roy RS, Zhu L, Jiang G, Liu F, Woods J, Zycband E, Moller DE, Thornberry NA, Zhang BB. Mice lacking dipeptidyl peptidase IV are protected against obesity and insulin resistance. Proc Natl Acad Sci USA 2003; 100: 6825-6830 [PMID: 12748388 DOI: 10.1073/pnas.0631828100]

34 Eggstein S, Kreisel W, Gerok W, Eggstein M. [Dipeptidyl aminopeptidase IV in hospitalized patients and in galac-tosamine hepatitis of the rat: Activity and lectin affinity chromatography in serum and hepatic plasma membranes]. J Clin Chem Clin Biochem 1989; 27: 547-554 [PMID: 2575117]

35 Nilius R, Stuhec K, Dietrich R. Changes of dipeptidylpepti-dase IV as a membrane marker of lymphocytes in acute and chronic liver diseases--biochemical and cytochemical inves-tigations. Physiol Res 1991; 40: 95-102 [PMID: 1681896]

36 Matsumoto Y, Bishop GA, McCaughan GW. Altered zonal expression of the CD26 antigen (dipeptidyl peptidase IV) in human cirrhotic liver. Hepatology 1992; 15: 1048-1053 [PMID: 1350563 DOI: 10.1002/hep.1840150613]

37 Grüngreiff K, Hebell T, Gutensohn K, Reinhold A, Rein-hold D. Plasma concentrations of zinc, copper, interleukin-6 and interferon-γ, and plasma dipeptidyl peptidase IV ac-tivity in chronic hepatitis C. Mol Med Report 2009; 2: 63-68 [PMID: 21475791 DOI: 10.3892/mmr_00000062]

38 Itou M, Kawaguchi T, Taniguchi E, Sumie S, Oriishi T, Mit-suyama K, Tsuruta O, Ueno T, Sata M. Altered expression of glucagon-like peptide-1 and dipeptidyl peptidase IV in pa-tients with HCV-related glucose intolerance. J Gastroenterol Hepatol 2008; 23: 244-251 [PMID: 17944883 DOI: 10.1111/j.1440-1746.2007.05183.x]

39 Bonacini M, Govindarajan S, Kohla M, Lai MM, Lindsay KL. Intrahepatic lymphocyte phenotypes in hepatitis C virus infection: a comparison between cirrhotic and non-cir-rhotic livers. Minerva Gastroenterol Dietol 2007; 53: 1-7 [PMID: 17415341]

40 Dimitropoulou D, Karakantza M, Tsamandas AC, Mouzaki A, Theodorou G, Gogos CA. T-lymphocyte subsets in pe-ripheral blood and liver tissue of patients with chronic hep-atitis B and C. In Vivo 2011; 25: 833-840 [PMID: 21753143]

41 Rahman W, Huang P, Belov L, Chrisp JS, Christopherson RI, Stapelberg PM, Warner FJ, George J, Bowen DG, Strasser SI, Koorey D, Sharland AF, McCaughan GW, Shackel NA. Analysis of human liver disease using a cluster of differenti-ation (CD) antibody microarray. Liver Int 2012; 32: 1527-1534 [PMID: 22863037 DOI: 10.1111/j.1478-3231.2012.02854.x]

42 Sakata M, Kawahara A, Kawaguchi T, Akiba J, Taira T, Taniguchi E, Abe M, Koga H, Kage M, Sata M. Decreased expression of insulin and increased expression of pancreatic



transcription factor PDX-1 in islets in patients with liver cir-rhosis: a comparative investigation using human autopsy specimens. J Gastroenterol 2013; 48: 277-285 [PMID: 22790351 DOI: 10.1007/s00535-012-0633-9]

43 Miyajima I, Kawaguchi T, Fukami A, Nagao Y, Adachi H, Sasaki S, Imaizumi T, Sata M. Chronic HCV infection was associated with severe insulin resistance and mild athero-sclerosis: a population-based study in an HCV hyperen-demic area. J Gastroenterol 2013; 48: 93-100 [PMID: 22678465 DOI: 10.1007/s00535-012-0610-3]

44 Eslam M, Kawaguchi T, Del Campo JA, Sata M, Khattab MA, Romero-Gomez M. Use of HOMA-IR in hepatitis C. J Viral Hepat 2011; 18: 675-684 [PMID: 21914084 DOI: 10.1111/j.1365-2893.2011.01474.x]

45 Eslam M, Aparcero R, Kawaguchi T, Del Campo JA, Sata M, Khattab MA, Romero-Gomez M. Meta-analysis: insulin resistance and sustained virological response in hepatitis C. Aliment Pharmacol Ther 2011; 34: 297-305 [PMID: 21623851 DOI: 10.1111/j.1365-2036.2011.04716.x]

46 Fukushima N, Kuromatsu R, Arinaga-Hino T, Ando E, Takata A, Sumie S, Nakano M, Kawaguchi T, Ide T, Torimu-ra T, Sata M. Adipocytokine involvement in hepatocellular carcinoma after sustained response to interferon for chronic hepatitis C. Hepatol Res 2010; 40: 911-922 [PMID: 20887596 DOI: 10.1111/j.1872-034X.2010.00699.x]

47 Kawaguchi T, Taniguchi E, Itou M, Sumie S, Yamagishi S, Sata M. The pathogenesis, complications and therapeutic strategy for hepatitis C virus-associated insulin resistance in the era of anti-viral treatment. Rev Recent Clin Trials 2010; 5: 147-157 [PMID: 20482494 DOI: 10.2174/157488710792007257]

48 Kawaguchi T, Sata M. Importance of hepatitis C virus-as-sociated insulin resistance: therapeutic strategies for insulin sensitization. World J Gastroenterol 2010; 16: 1943-1952 [PMID: 20419831 DOI: 10.3748/wjg.v16.i16.1943]

49 Sumie S, Kawaguchi T, Komuta M, Kuromatsu R, Itano S, Okuda K, Taniguchi E, Ando E, Takata A, Fukushima N, Koga H, Torimura T, Kojiro M, Sata M. Significance of glucose intolerance and SHIP2 expression in hepatocellular carcinoma patients with HCV infection. Oncol Rep 2007; 18: 545-552 [PMID: 17671700]

50 Kawaguchi T, Ide T, Taniguchi E, Hirano E, Itou M, Sumie S, Nagao Y, Yanagimoto C, Hanada S, Koga H, Sata M. Clear-ance of HCV improves insulin resistance, beta-cell function, and hepatic expression of insulin receptor substrate 1 and 2. Am J Gastroenterol 2007; 102: 570-576 [PMID: 17222321 DOI: 10.1111/j.1572-0241.2006.01038.x]

51 Kawaguchi T, Nagao Y, Tanaka K, Ide T, Harada M, Ku-mashiro R, Sata M. Causal relationship between hepatitis C virus core and the development of type 2 diabetes mellitus in a hepatitis C virus hyperendemic area: a pilot study. Int J Mol Med 2005; 16: 109-114 [PMID: 15942686]

52 Kawaguchi T, Yoshida T, Harada M, Hisamoto T, Nagao Y, Ide T, Taniguchi E, Kumemura H, Hanada S, Maeyama M, Baba S, Koga H, Kumashiro R, Ueno T, Ogata H, Yoshimura A, Sata M. Hepatitis C virus down-regulates insulin recep-tor substrates 1 and 2 through up-regulation of suppressor of cytokine signaling 3. Am J Pathol 2004; 165: 1499-1508 [PMID: 15509521 DOI: 10.1016/S0002-9440(10)63408-6]

53 Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Tsukamoto K, Kimura S, Moriya K, Koike K. Hepatitis C virus infection and diabetes: direct involvement of the virus in the devel-opment of insulin resistance. Gastroenterology 2004; 126: 840-848 [PMID: 14988838]

54 Pazienza V, Clément S, Pugnale P, Conzelman S, Foti M, Mangia A, Negro F. The hepatitis C virus core protein of genotypes 3a and 1b downregulates insulin receptor substrate 1 through genotype-specific mechanisms. Hepa-tology 2007; 45: 1164-1171 [PMID: 17465001 DOI: 10.1002/hep.21634]

55 Harada T, Kim DW, Sagawa K, Suzuki T, Takahashi K, Saito

I, Matsuura Y, Miyamura T. Characterization of an estab-lished human hepatoma cell line constitutively expressing non-structural proteins of hepatitis C virus by transfection of viral cDNA. J Gen Virol 1995; 76 (Pt 5): 1215-1221 [PMID: 7730805]

56 Maes M, Bonaccorso S, Marino V, Puzella A, Pasquini M, Biondi M, Artini M, Almerighi C, Meltzer H. Treatment with interferon-alpha (IFN alpha) of hepatitis C patients in-duces lower serum dipeptidyl peptidase IV activity, which is related to IFN alpha-induced depressive and anxiety symptoms and immune activation. Mol Psychiatry 2001; 6: 475-480 [PMID: 11443537 DOI: 10.1038/sj.mp.4000872]

57 Lee S, Macquillan GC, Keane NM, Flexman J, Jeffrey GP, French MA, Brochier J, Price P. Immunological mark-ers predicting outcome in patients with hepatitis C treated with interferon-alpha and ribavirin. Immunol Cell Biol 2002; 80: 391-397 [PMID: 12121229 DOI: 10.1046/j.1440-1711.2002.01102.x]

58 Stone SF, Lee S, Keane NM, Price P, French MA. Associa-tion of increased hepatitis C virus (HCV)-specific IgG and soluble CD26 dipeptidyl peptidase IV enzyme activity with hepatotoxicity after highly active antiretroviral therapy in human immunodeficiency virus-HCV-coinfected patients. J Infect Dis 2002; 186: 1498-1502 [PMID: 12404169 DOI: 10.1086/344892]

59 Andrieu T, Thibault V, Malet I, Laporte J, Bauvois B, Agut H, Cahour A. Similar increased serum dipeptidyl peptidase IV activity in chronic hepatitis C and other viral infections. J Clin Virol 2003; 27: 59-68 [PMID: 12727530 DOI: 10.1016/S1386-6532(02)00128-2]

60 Maes M, Bonaccorso S. Lower activities of serum pepti-dases predict higher depressive and anxiety levels follow-ing interferon-alpha-based immunotherapy in patients with hepatitis C. Acta Psychiatr Scand 2004; 109: 126-131 [PMID: 14725594 DOI: 10.1046/j.0001-690X.2003.00230.x]

61 Yang SS, Fu LS, Chang CS, Yeh HZ, Chen GH, Kao JH. Changes of soluble CD26 and CD30 levels correlate with re-sponse to interferon plus ribavirin therapy in patients with chronic hepatitis C. J Gastroenterol Hepatol 2006; 21: 1789-1793 [PMID: 17074015 DOI: 10.1111/j.1440-1746.2006.04677.x]

62 Arase Y, Suzuki F, Kobayashi M, Suzuki Y, Kawamura Y, Matsumoto N, Akuta N, Imai N, Kobayashi M, Sezaki H, Saito S, Hosaka T, Ikeda K, Kumada H, Ohmoto Y, Amakawa K, Tsuji H, Hsieh SD, Kobayashi T. Efficacy and safety in sitagliptin therapy for diabetes complicated by chronic liver disease caused by hepatitis C virus. Hepatol Res 2011; 41: 524-529 [PMID: 21435130 DOI: 10.1111/j.1872-034X.2011.00798.x]

63 Iwasaki T, Yoneda M, Inamori M, Shirakawa J, Higurashi T, Maeda S, Terauchi Y, Nakajima A. Sitagliptin as a novel treatment agent for non-alcoholic Fatty liver disease patients with type 2 diabetes mellitus. Hepatogastroenterology 2011; 58: 2103-2105 [PMID: 22024083 DOI: 10.5754/hge11263]

64 Sumida Y, Yoneda M, Hyogo H, Yamaguchi K, Ono M, Fujii H, Eguchi Y, Suzuki Y, Imai S, Kanemasa K, Fujita K, Chayama K, Yasui K, Saibara T, Kawada N, Fujimoto K, Ko-hgo Y, Okanoue T. A simple clinical scoring system using ferritin, fasting insulin, and type IV collagen 7S for predict-ing steatohepatitis in nonalcoholic fatty liver disease. J Gas-troenterol 2011; 46: 257-268 [PMID: 20842510 DOI: 10.1007/s00535-010-0305-6]

65 Eguchi Y, Hyogo H, Ono M, Mizuta T, Ono N, Fujimoto K, Chayama K, Saibara T. Prevalence and associated metabolic factors of nonalcoholic fatty liver disease in the general population from 2009 to 2010 in Japan: a multicenter large retrospective study. J Gastroenterol 2012; 47: 586-595 [PMID: 22328022 DOI: 10.1007/s00535-012-0533-z]

66 Sumida Y, Yoneda M, Hyogo H, Itoh Y, Ono M, Fujii H, Eguchi Y, Suzuki Y, Aoki N, Kanemasa K, Fujita K, Chayama K, Saibara T, Kawada N, Fujimoto K, Kohgo Y,



Yoshikawa T, Okanoue T. Validation of the FIB4 index in a Japanese nonalcoholic fatty liver disease popula-tion. BMC Gastroenterol 2012; 12: 2 [PMID: 22221544 DOI: 10.1186/1471-230X-12-2]

67 Miyazaki M, Kato M, Tanaka K, Tanaka M, Kohjima M, Nakamura K, Enjoji M, Nakamuta M, Kotoh K, Takayanagi R. Increased hepatic expression of dipeptidyl peptidase-4 in non-alcoholic fatty liver disease and its association with in-sulin resistance and glucose metabolism. Mol Med Rep 2012; 5: 729-733 [PMID: 22179204 DOI: 10.3892/mmr.2011.707]

68 Balaban YH, Korkusuz P, Simsek H, Gokcan H, Gediko-glu G, Pinar A, Hascelik G, Asan E, Hamaloglu E, Tatar G. Dipeptidyl peptidase IV (DDP IV) in NASH patients. Ann Hepatol 2007; 6: 242-250 [PMID: 18007554]

69 Ben-Shlomo S, Zvibel I, Shnell M, Shlomai A, Chepurko E, Halpern Z, Barzilai N, Oren R, Fishman S. Glucagon-like peptide-1 reduces hepatic lipogenesis via activation of AMP-activated protein kinase. J Hepatol 2011; 54: 1214-1223 [PMID: 21145820 DOI: 10.1016/j.jhep.2010.09.032]

70 Firneisz G, Varga T, Lengyel G, Fehér J, Ghyczy D, Wich-mann B, Selmeci L, Tulassay Z, Rácz K, Somogyi A. Serum dipeptidyl peptidase-4 activity in insulin resistant patients with non-alcoholic fatty liver disease: a novel liver disease biomarker. PLoS One 2010; 5: e12226 [PMID: 20805868 DOI: 10.1371/journal.pone.0012226]

71 Shirakawa J, Fujii H, Ohnuma K, Sato K, Ito Y, Kaji M, Sakamoto E, Koganei M, Sasaki H, Nagashima Y, Amo K, Aoki K, Morimoto C, Takeda E, Terauchi Y. Diet-induced adipose tissue inflammation and liver steatosis are prevent-ed by DPP-4 inhibition in diabetic mice. Diabetes 2011; 60: 1246-1257 [PMID: 21330637 DOI: 10.2337/db10-1338]

72 Itou M, Kawaguchi T, Taniguchi E, Oriishi T, Sata M. Di-peptidyl Peptidase IV Inhibitor Improves Insulin Resistance and Steatosis in a Refractory Nonalcoholic Fatty Liver Dis-ease Patient: A Case Report. Case Rep Gastroenterol 2012; 6: 538-544 [PMID: 22949894 DOI: 10.1159/000341510]

73 Yilmaz Y, Yonal O, Deyneli O, Celikel CA, Kalayci C, Du-man DG. Effects of sitagliptin in diabetic patients with nonalcoholic steatohepatitis. Acta Gastroenterol Belg 2012; 75: 240-244 [PMID: 22870790]

74 Leccia F, Nardone A, Corvigno S, Vecchio LD, De Placido S, Salvatore F, Veneziani BM. Cytometric and biochemical characterization of human breast cancer cells reveals hetero-geneous myoepithelial phenotypes. Cytometry A 2012; 81: 960-972 [PMID: 22791584 DOI: 10.1002/cyto.a.22095]

75 Wilson CH, Abbott CA. Expression profiling of dipeptidyl peptidase 8 and 9 in breast and ovarian carcinoma cell lines. Int J Oncol 2012; 41: 919-932 [PMID: 22736146 DOI: 10.3892/ijo.2012.1522]

76 Mareš V, Stremeňová J, Lisá V, Kozáková H, Marek J, Syrůček M, Šoula O, Šedo A. Compartment- and malig-nance-dependent up-regulation of γ-glutamyltranspeptidase and dipetidylpeptidase-IV activity in human brain gliomas. Histol Histopathol 2012; 27: 931-940 [PMID: 22648548]

77 Aoe K, Amatya VJ, Fujimoto N, Ohnuma K, Hosono O, Hi-raki A, Fujii M, Yamada T, Dang NH, Takeshima Y, Inai K, Kishimoto T, Morimoto C. CD26 overexpression is associ-ated with prolonged survival and enhanced chemosensitiv-ity in malignant pleural mesothelioma. Clin Cancer Res 2012; 18: 1447-1456 [PMID: 22261805 DOI: 10.1158/1078-0432.CCR-11-1990]

78 Starska K, Głowacka E, Kulig A, Lewy-Trenda I, Bryś M, Lewkowicz P. The role of tumor cells in the modification of T lymphocytes activity--the expression of the early CD69+, CD71+ and the late CD25+, CD26+, HLA/DR+ activation markers on T CD4+ and CD8+ cells in squamous cell la-ryngeal carcinoma. Part I. Folia Histochem Cytobiol 2011; 49: 579-592 [PMID: 22252752 DOI: 10.5603/FHC.2011.0081]

79 McCaughan GW, Siah CL, Abbott C, Wickson J, Ballesteros M, Bishop GA. Dipeptidyl peptidase IV is down-regulated

in rat hepatoma cells at the mRNA level. J Gastroenterol Hepatol 1993; 8: 142-145 [PMID: 8097118 DOI: 10.1111/j.1440-1746.1993.tb01505.x]

80 Stecca BA, Nardo B, Chieco P, Mazziotti A, Bolondi L, Cavallari A. Aberrant dipeptidyl peptidase IV (DPP IV/CD26) expression in human hepatocellular carcinoma. J Hepatol 1997; 27: 337-345 [PMID: 9288609 DOI: 10.1016/S0168-8278(97)80180-8]

81 Gaetaniello L, Fiore M, de Filippo S, Pozzi N, Tamasi S, Pignata C. Occupancy of dipeptidyl peptidase IV activates an associated tyrosine kinase and triggers an apoptotic sig-nal in human hepatocarcinoma cells. Hepatology 1998; 27: 934-942 [PMID: 9537431 DOI: 10.1002/hep.510270407]

82 Yamamoto S, Tokuhara T, Nishikawa M, Nishizawa S, Nishioka T, Nozawa A, Takahashi A, Watanabe Y, Wada R, Wakasa K, Kubo S. Spontaneous regression of hepatocel-lular carcinoma after improving diabetes mellitus: possiblly responsible for immune system. Kanzo 2012; 53: 164-167

83 Kawaguchi T, Taniguchi E, Morita Y, Shirachi M, Tatei-shi I, Nagata E, Sata M. Association of exogenous insulin or sulphonylurea treatment with an increased incidence of hepatoma in patients with hepatitis C virus infection. Liver Int 2010; 30: 479-486 [PMID: 20040053 DOI: 10.1111/j.1478-3231.2009.02191.x]

84 Kissow H, Hartmann B, Holst JJ, Viby NE, Hansen LS, Rosenkilde MM, Hare KJ, Poulsen SS. Glucagon-like pep-tide-1 (GLP-1) receptor agonism or DPP-4 inhibition does not accelerate neoplasia in carcinogen treated mice. Regul Pept 2012; 179: 91-100 [PMID: 22989472 DOI: 10.1016/j.regpep.2012.08.016]

85 Levy MT, McCaughan GW, Abbott CA, Park JE, Cunning-ham AM, Müller E, Rettig WJ, Gorrell MD. Fibroblast acti-vation protein: a cell surface dipeptidyl peptidase and ge-latinase expressed by stellate cells at the tissue remodelling interface in human cirrhosis. Hepatology 1999; 29: 1768-1778 [PMID: 10347120 DOI: 10.1002/hep.510290631]

86 Reynard MP, Turner D, Navarrete CV. Allele frequencies of polymorphisms of the tumour necrosis factor-alpha, in-terleukin-10, interferon-gamma and interleukin-2 genes in a North European Caucasoid group from the UK. Eur J Im-munogenet 2000; 27: 241-249 [PMID: 10998089]

87 Lee JH, Park HJ, Kim YA, Lee DH, Noh JK, Kwon CH, Jung SM, Lee SK. The phenotypic characteristic of liver-derived stem cells from adult human deceased donor liver. Transplant Proc 2012; 44: 1110-1112 [PMID: 22564638 DOI: 10.1016/j.transproceed.2012.02.020]

88 Mavier P, Martin N, Couchie D, Préaux AM, Laperche Y, Zafrani ES. Expression of stromal cell-derived factor-1 and of its receptor CXCR4 in liver regeneration from oval cells in rat. Am J Pathol 2004; 165: 1969-1977 [PMID: 15579440 DOI: 10.1016/S0002-9440(10)63248-8]

89 Zheng D, Oh SH, Jung Y, Petersen BE. Oval cell response in 2-acetylaminofluorene/partial hepatectomy rat is attenuat-ed by short interfering RNA targeted to stromal cell-derived factor-1. Am J Pathol 2006; 169: 2066-2074 [PMID: 17148669 DOI: 10.2353/ajpath.2006.060211]

90 Ishikawa T, Factor VM, Marquardt JU, Raggi C, Seo D, Kitade M, Conner EA, Thorgeirsson SS. Hepatocyte growth factor/c-met signaling is required for stem-cell-mediated liver regeneration in mice. Hepatology 2012; 55: 1215-1226 [PMID: 22095660 DOI: 10.1002/hep.24796]

91 Tsuchiya A, Imai M, Kamimura H, Takamura M, Yamagiwa S, Sugiyama T, Nomoto M, Heike T, Nagasawa T, Naka-hata T, Aoyagi Y. Increased susceptibility to severe chronic liver damage in CXCR4 conditional knock-out mice. Dig Dis Sci 2012; 57: 2892-2900 [PMID: 22674400 DOI: 10.1007/s10620-012-2239-8]

92 Campbell TB, Broxmeyer HE. CD26 inhibition and hema-topoiesis: a novel approach to enhance transplantation. Front Biosci 2008; 13: 1795-1805 [PMID: 17981668 DOI:



10.2741/2800]93 Jungraithmayr W, De Meester I, Matheeussen V, Baerts L,

Arni S, Weder W. CD26/DPP-4 inhibition recruits regenera-tive stem cells via stromal cell-derived factor-1 and benefi-cially influences ischaemia-reperfusion injury in mouse lung transplantation. Eur J Cardiothorac Surg 2012; 41: 1166-1173 [PMID: 22219460 DOI: 10.1093/ejcts/ezr180]

94 Mentlein R, Gallwitz B, Schmidt WE. Dipeptidyl-peptidase IV hydrolyses gastric inhibitory polypeptide, glucagon-like peptide-1(7-36)amide, peptide histidine methionine and is responsible for their degradation in human serum. Eur J Biochem 1993; 214: 829-835 [PMID: 8100523 DOI: 10.1111/j.1432-1033.1993.tb17986.x]

95 Deacon CF, Johnsen AH, Holst JJ. Degradation of glucagon-like peptide-1 by human plasma in vitro yields an N-termi-nally truncated peptide that is a major endogenous metabo-lite in vivo. J Clin Endocrinol Metab 1995; 80: 952-957 [PMID: 7883856 DOI: 10.1210/jc.80.3.952]

96 Hansen L, Deacon CF, Orskov C, Holst JJ. Glucagon-like peptide-1-(7-36)amide is transformed to glucagon-like peptide-1-(9-36)amide by dipeptidyl peptidase IV in the capillaries supplying the L cells of the porcine intestine. Endocrinology 1999; 140: 5356-5363 [PMID: 10537167 DOI: 10.1210/en.140.11.5356]

97 Brubaker PL, Drucker DJ. Structure-function of the glu-cagon receptor family of G protein-coupled receptors: the glucagon, GIP, GLP-1, and GLP-2 receptors. Recep-tors Channels 2002; 8 : 179-188 [PMID: 12529935 DOI: 10.1080/10606820213687]

98 Deacon CF, Nauck MA, Meier J, Hücking K, Holst JJ. Deg-radation of endogenous and exogenous gastric inhibitory polypeptide in healthy and in type 2 diabetic subjects as revealed using a new assay for the intact peptide. J Clin Endocrinol Metab 2000; 85: 3575-3581 [PMID: 11061504 DOI: 10.1210/jc.85.10.3575]

99 Deacon CF, Danielsen P, Klarskov L, Olesen M, Holst JJ. Dipeptidyl peptidase IV inhibition reduces the degrada-tion and clearance of GIP and potentiates its insulinotropic and antihyperglycemic effects in anesthetized pigs. Diabetes 2001; 50: 1588-1597 [PMID: 11423480 DOI: 10.2337/diabe-tes.50.7.1588]

100 Ballantyne GH. Peptide YY(1-36) and peptide YY(3-36): Part I. Distribution, release and actions. Obes Surg 2006; 16: 651-658 [PMID: 16687037 DOI: 10.1381/096089206776944959]

101 Ballantyne GH. Peptide YY(1-36) and peptide YY(3-36): Part II. Changes after gastrointestinal surgery and bariatric surgery. Obes Surg 2006; 16: 795-803 [PMID: 16756746 DOI: 10.1381/096089206777346619]

102 Zhu L, Tamvakopoulos C, Xie D, Dragovic J, Shen X, Fenyk-Melody JE, Schmidt K, Bagchi A, Griffin PR, Thornberry NA, Sinha Roy R. The role of dipeptidyl peptidase IV in the cleavage of glucagon family peptides: in vivo metabolism of pituitary adenylate cyclase activating polypeptide-(1-38). J Biol Chem 2003; 278: 22418-22423 [PMID: 12690116 DOI: 10.1074/jbc.M212355200]

103 Ahrén B, Hughes TE. Inhibition of dipeptidyl peptidase-4 augments insulin secretion in response to exogenously administered glucagon-like peptide-1, glucose-dependent insulinotropic polypeptide, pituitary adenylate cyclase-ac-tivating polypeptide, and gastrin-releasing peptide in mice. Endocrinology 2005; 146: 2055-2059 [PMID: 15604213 DOI: 10.1210/en.2004-1174]

104 Green BD, Irwin N, Flatt PR. Pituitary adenylate cyclase-activating peptide (PACAP): assessment of dipeptidyl pep-tidase IV degradation, insulin-releasing activity and antidia-betic potential. Peptides 2006; 27: 1349-1358 [PMID: 16406202 DOI: 10.1016/j.peptides.2005.11.010]

105 Brubaker PL, Izzo A, Hill M, Drucker DJ. Intestinal func-tion in mice with small bowel growth induced by glucagon-like peptide-2. Am J Physiol 1997; 272: E1050-E1058 [PMID:

9227451 DOI: 10.1210/en.2003-0309]106 Walsh NA, Yusta B, DaCambra MP, Anini Y, Drucker DJ,

Brubaker PL. Glucagon-like peptide-2 receptor activation in the rat intestinal mucosa. Endocrinology 2003; 144: 4385-4392 [PMID: 12960094]

107 Byrd JB, Touzin K, Sile S, Gainer JV, Yu C, Nadeau J, Adam A, Brown NJ. Dipeptidyl peptidase IV in angiotensin-con-verting enzyme inhibitor associated angioedema. Hyperten-sion 2008; 51: 141-147 [PMID: 18025295 DOI: 10.1161/HY-PERTENSIONAHA.107.096552]

108 Lambeir AM, Durinx C, Proost P, Van Damme J, Scharpé S, De Meester I. Kinetic study of the processing by dipeptidyl-peptidase IV/CD26 of neuropeptides involved in pancre-atic insulin secretion. FEBS Lett 2001; 507: 327-330 [PMID: 11696365 DOI: 10.1016/S0014-5793(01)02982-9]

109 Mentlein R, Roos T. Proteases involved in the metabo-lism of angiotensin II, bradykinin, calcitonin gene-related peptide (CGRP), and neuropeptide Y by vascular smooth muscle cells. Peptides 1996; 17: 709-720 [PMID: 8804084 DOI: 10.1016/0196-9781(96)00066-6]

110 Hernanz A, Medina S, de Miguel E, Martín-Mola E. Effect of calcitonin gene-related peptide, neuropeptide Y, substance P, and vasoactive intestinal peptide on interleukin-1beta, interleukin-6 and tumor necrosis factor-alpha production by peripheral whole blood cells from rheumatoid arthritis and osteoarthritis patients. Regul Pept 2003; 115: 19-24 [PMID: 12873794 DOI: 10.1016/S0167-0115(03)00127-7]

111 Reinehr T, Roth CL, Enriori PJ, Masur K. Changes of dipep-tidyl peptidase IV (DPP-IV) in obese children with weight loss: relationships to peptide YY, pancreatic peptide, and in-sulin sensitivity. J Pediatr Endocrinol Metab 2010; 23: 101-108 [PMID: 20432813 DOI: 10.1515/JPEM.2010.23.1-2.101]

112 Lun SW, Wong CK, Ko FW, Hui DS, Lam CW. Increased ex-pression of plasma and CD4+ T lymphocyte costimulatory molecule CD26 in adult patients with allergic asthma. J Clin Immunol 2007; 27: 430-437 [PMID: 17525828 DOI: 10.1007/s10875-007-9093-z]

113 Liu Z, Christensson M, Forslöw A, De Meester I, Sundqvist KG. A CD26-controlled cell surface cascade for regulation of T cell motility and chemokine signals. J Immunol 2009; 183: 3616-3624 [PMID: 19687096 DOI: 10.4049/jimmu-nol.0804336]

114 Rai AK, Thakur CP, Kumar P, Mitra DK. Impaired expres-sion of CD26 compromises T-cell recruitment in human vis-ceral leishmaniasis. Eur J Immunol 2012; 42: 2782-2791 [PMID: 22806538 DOI: 10.1002/eji.201141912]

115 Struyf S, Proost P, Schols D, De Clercq E, Opdenakker G, Lenaerts JP, Detheux M, Parmentier M, De Meester I, Scharpé S, Van Damme J. CD26/dipeptidyl-peptidase IV down-regulates the eosinophil chemotactic potency, but not the anti-HIV activity of human eotaxin by affecting its inter-action with CC chemokine receptor 3. J Immunol 1999; 162: 4903-4909 [PMID: 10202035]

116 Forssmann U, Stoetzer C, Stephan M, Kruschinski C, Skrip-uletz T, Schade J, Schmiedl A, Pabst R, Wagner L, Hoff-mann T, Kehlen A, Escher SE, Forssmann WG, Elsner J, von Hörsten S. Inhibition of CD26/dipeptidyl peptidase IV en-hances CCL11/eotaxin-mediated recruitment of eosinophils in vivo. J Immunol 2008; 181: 1120-1127 [PMID: 18606664]

117 Lambeir AM, Proost P, Durinx C, Bal G, Senten K, Au-gustyns K, Scharpé S, Van Damme J, De Meester I. Kinetic investigation of chemokine truncation by CD26/dipeptidyl peptidase IV reveals a striking selectivity within the che-mokine family. J Biol Chem 2001; 276: 29839-29845 [PMID: 11390394 DOI: 10.1074/jbc.M103106200]

118 Bisset LR, Schmid-Grendelmeier P. Chemokines and their receptors in the pathogenesis of allergic asthma: progress and perspective. Curr Opin Pulm Med 2005; 11: 35-42 [PMID: 15591886 DOI: 10.1097/01.mcp.0000144502.50149.e0]

119 Wong PT, Wong CK, Tam LS, Li EK, Chen DP, Lam CW.

P- Reviewers Bener A S- Editor Wen LL L- Editor Cant MR E- Editor Li JY

P- Reviewers Bener A S- Editor Song XX L- Editor Stewart GJ E- Editor Li JY



Decreased expression of T lymphocyte co-stimulatory mol-ecule CD26 on invariant natural killer T cells in systemic lu-pus erythematosus. Immunol Invest 2009; 38: 350-364 [PMID: 19811413 DOI: 10.1080/08820130902770003]

120 Crane M, Oliver B, Matthews G, Avihingsanon A, Ubolyam S, Markovska V, Chang JJ, Dore GJ, Price P, Visvanathan K, French M, Ruxrungtham K, Lewin SR. Immunopathogene-sis of hepatic flare in HIV/hepatitis B virus (HBV)-coinfected individuals after the initiation of HBV-active antiretroviral therapy. J Infect Dis 2009; 199: 974-981 [PMID: 19231993 DOI: 10.1086/597276]

121 Proost P, Schutyser E, Menten P, Struyf S, Wuyts A, Opde-nakker G, Detheux M, Parmentier M, Durinx C, Lambeir AM, Neyts J, Liekens S, Maudgal PC, Billiau A, Van Damme J. Amino-terminal truncation of CXCR3 agonists impairs receptor signaling and lymphocyte chemotaxis, while pre-serving antiangiogenic properties. Blood 2001; 98: 3554-3561 [PMID: 11739156 DOI: 10.1182/blood.V98.13.3554]

122 Ludwig A, Schiemann F, Mentlein R, Lindner B, Brandt E. Dipeptidyl peptidase IV (CD26) on T cells cleaves the CXC chemokine CXCL11 (I-TAC) and abolishes the stimulating but not the desensitizing potential of the chemokine. J Leu-koc Biol 2002; 72: 183-191 [PMID: 12101279]

123 Mentlein R. Dipeptidyl-peptidase IV (CD26)--role in the inactivation of regulatory peptides. Regul Pept 1999; 85: 9-24 [PMID: 10588446 DOI: 10.1016/S0167-0115(99)00089-0]

124 Liu X, Murali SG, Holst JJ, Ney DM. Enteral nutrients poten-tiate the intestinotrophic action of glucagon-like peptide-2 in association with increased insulin-like growth factor-I responses in rats. Am J Physiol Regul Integr Comp Physiol 2008; 295: R1794-R1802 [PMID: 18832087 DOI: 10.1152/ajp-regu.90616.2008]

125 Faidley TD, Leiting B, Pryor KD, Lyons K, Hickey GJ, Thompson DR. Inhibition of dipeptidyl-peptidase IV does not increase circulating IGF-1 concentrations in growing pigs. Exp Biol Med (Maywood) 2006; 231: 1373-1378 [PMID: 16946406]

126 Nausch I , Mentlein R, Heymann E. The degradation of bioactive peptides and proteins by dipeptidyl pep-tidase IV from human placenta. Biol Chem Hoppe Seyler 1990; 371 : 1113-1118 [PMID: 1982212 DOI: 10.1515/bchm3.1990.371.2.1113]

127 Ohta N, Takahashi T, Mori T, Park MK, Kawashima S, Takahashi K, Kobayashi H. Hormonal modulation of prolyl endopeptidase and dipeptidyl peptidase IV activities in the mouse uterus and ovary. Acta Endocrinol (Copenh) 1992; 127: 262-266 [PMID: 1357903]

128 Rovenský J, Buc M, Lojda Z, Ruzicková M, Blazícková

S, Rauová L, Mistina T, Vigas M, Lackovic V. Effect of domperidone-induced hyperprolactinemia on selected im-mune parameters in healthy women. Arch Immunol Ther Exp (Warsz) 1995; 43: 221-227 [PMID: 8744700]

129 Fujiwara H, Fukuoka M, Yasuda K, Ueda M, Imai K, Goto Y, Suginami H, Kanzaki H, Maeda M, Mori T. Cytokines stimulate dipeptidyl peptidase-IV expression on human luteinizing granulosa cells. J Clin Endocrinol Metab 1994; 79: 1007-1011 [PMID: 7962267 DOI: 10.1210/jc.79.4.1007]

130 Sakurada C, Sakurada S, Hayashi T, Katsuyama S, Tan-No K, Sakurada T. Degradation of endomorphin-2 at the supra-spinal level in mice is initiated by dipeptidyl peptidase IV: an in vitro and in vivo study. Biochem Pharmacol 2003; 66: 653-661 [PMID: 12906930]

131 Rónai AZ, Király K, Szebeni A, Szemenyei E, Prohászka Z, Darula Z, Tóth G, Till I, Szalay B, Kató E, Barna I. Immuno-reactive endomorphin 2 is generated extracellularly in rat isolated L4,5 dorsal root ganglia by DPP-IV. Regul Pept 2009; 157: 1-2 [PMID: 19540879 DOI: 10.1016/j.regpep.2009.06.006]

132 Király K, Szalay B, Szalai J, Barna I, Gyires K, Verbeken M, Rónai AZ. Intrathecally injected Ile-Pro-Ile, an inhibitor of membrane ectoenzyme dipeptidyl peptidase IV, is antihy-peralgesic in rats by switching the enzyme from hydrolase to synthase functional mode to generate endomorphin 2. Eur J Pharmacol 2009; 620: 21-26 [PMID: 19695241 DOI: 10.1016/j.ejphar.2009.08.018]

133 Guieu R, Fenouillet E, Devaux C, Fajloun Z, Carrega L, Sabatier JM, Sauze N, Marguet D. CD26 modulates nocicep-tion in mice via its dipeptidyl-peptidase IV activity. Behav Brain Res 2006; 166: 230-235 [PMID: 16154213 DOI: 10.1016/j.bbr.2005.08.003]

134 Busek P, Stremenová J, Krepela E, Sedo A. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines. Physiol Res 2008; 57: 443-449 [PMID: 17949241]

135 Tian L, Gao J, Hao J, Zhang Y, Yi H, O’Brien TD, Sorenson R, Luo J, Guo Z. Reversal of new-onset diabetes through mod-ulating inflammation and stimulating beta-cell replication in nonobese diabetic mice by a dipeptidyl peptidase IV in-hibitor. Endocrinology 2010; 151: 3049-3060 [PMID: 20444936 DOI: 10.1210/en.2010-0068]

136 Zhang XY, De Meester I, Lambeir AM, Dillen L, Van Don-gen W, Esmans EL, Haemers A, Scharpé S, Claeys M. Study of the enzymatic degradation of vasostatin I and II and their precursor chromogranin A by dipeptidyl peptidase IV us-ing high-performance liquid chromatography/electrospray mass spectrometry. J Mass Spectrom 1999; 34: 255-263 [PMID: 10226356 DOI: 10.1002/(SICI)1096-9888(199904)34]

P- Reviewers Tao YX, Kristine F S- Editor Huang XZ L- Editor A E- Editor Li JY


Role of interleukin-6 in Barrett’s esophagus pathogenesis

Katerina Dvorak, Bohuslav Dvorak

Katerina Dvorak, Department of Cellular and Moleculart Medi-cine, The University of Arizona, Tucson, AZ 85724, United StatesBohuslav Dvorak, Department of Pediatrics and Steele Chil-dren’s Research Center, The University of Arizona, Tucson, AZ 85724, United StatesAuthor contributions: Dvorak K and Dvorak B solely contrib-uted to this paper.Supported by GI SPORE Grant p50 CA95060 from the Na-tional Cancer Institute, to Dvorak KCorrespondence to: Katerina Dvorak, PhD, Associate Pro-fessor, Department of Cellular and Moleculart Medicine, The University of Arizona, Tucson, AZ 85724, United States. [email protected]: +1-520-9710255 Fax: +1-520-6265009Received: August 16, 2012 Revised: October 31, 2012Accepted: November 14, 2012Published online: April 21, 2013

AbstractBarrett’s esophagus (BE) is a metaplastic lesion of the distal esophagus arising as a consequence of chronic gastroesophageal reflux disease. Multiple studies show that BE is associated with increased risk of esophageal adenocarcinoma (EAC). Epidemiological studies and animal models demonstrate that chronic inflammation triggered by repeated exposure to refluxate predisposes to the development of BE and EAC. The chronic inflam-mation is associated with cytokine alterations. Interleu-kin 6 (IL-6) is a cytokine that stimulates cell prolifera-tion and apoptosis resistance is frequently increased in different cancers. Importantly, IL-6 and transcriptional factor signal transducer and activator of transcription 3 (STAT3) that is activated by IL-6 are also increased in BE and EAC. This review critically appraises the role of IL-6/STAT3 pathway in progression of BE to EAC from the published evidence currently available.


Key words: Barrett’s esophagus; Interleukin 6; Bile ac-ids; Inflammation; Apoptosis

Dvorak K, Dvorak B. Role of interleukin-6 in Barrett’s esophagus pathogenesis. World J Gastroenterol 2013; 19(15): 2307-2312 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2307.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2307

INTRODUCTIONBarrett’s esophagus (BE) is a condition where normal squamous epithelium is replaced by metaplastic intestinal-like columnar epithelium containing goblet cells. This premalignant lesion is associated with a nearly 40-fold increased risk for the development of esophageal ad-enocarcinoma (EAC), a cancer with poor prognosis, and a median survival of less than one year[1]. EAC is most common in the Caucasian population in the western countries. EAC incidence increased almost six fold be-tween 1975 and 2001[2] and EAC mortality also increased more than sevenfold[2]. Currently, EAC has the fastest growing incidence rate of all cancers in the United States. Approximately 17000 patients will be diagnosed with esophageal cancer in 2012 and about 14600 patients will die of this cancer in the United States[3].

There is overwhelming evidence that BE arises as a consequence of chronic gastroesophageal reflux disease (GERD). GERD is a very common medical condition in the United States affecting 40% of the adult population at least monthly. One third of these patients have erosive esophagitis and 6%-14% of patients undergoing endos-copy for symptomatic GERD have BE[1]. This repre-sents about 2 million people in the United States alone[4]. The rate of transformation to cancer is about 0.1%-0.2% per year[3].

Histopathologic steps in the progression of BE include: (1) metaplasia of the normal esophageal squamous epithe-lium to a specialized intestinal glandular epithelium; (2) low-grade dysplasia; (3) high-grade dysplasia; and (4) esophageal adenocarcinoma with invasive and metastatic potential. However, little is known, about the signaling pathways pro-moting the development of metaplasia and dysplasia.

MINIREVIEWS





ChRONIC INflammaTION aND CyTOkINe DysRegUlaTION IN BeEpidemiological studies and animal models demonstrate that chronic inflammation predisposes to the development of various forms of cancer including gastrointestinal malignancies[5]. In the esophagus, chronic inflammation is triggered by repeated exposure to components of reflux-ate such as gastric acid and bile acids. Indeed, chronic re-flux is the strongest risk factor for the development of BE and EAC[6]. A major regulatory pathway linking inflam-mation and cancer is activation of nuclear factor kB (NF-kB) signaling. The same pathway initiates transcription of cytokines. In agreement with the inflammatory hypothesis of BE/EAC development, NF-kB is constitutively acti-vated in BE or EAC but is not detected in esophagitis or the adjacent normal esophageal mucosa[7].

Esophageal mucosa damaged by refluxate is common-ly infiltrated by inflammatory cells of different lineages. First, the damaged site is infiltrated by neutrophils and monocytes (acute inflammation) followed by lympho-cytes and plasma cells primarily at the site of metaplasia (chronic inflammation)[8]. Cytokines that are produced by the inflammatory cells and by Barrett’s epithelium play a crucial role in BE carcinogenesis[9]. Furthermore, noxious compounds, such as reactive oxygen and nitrogen species, released during chronic inflammation may damage DNA and induce mutations that subsequently promote cancer development.

Interestingly, Barrett’s esophagus is characterized by a unique cytokine environment compared to erosive esoph-agitis. While BE is associated with Th2 cytokines, erosive esophagitis is distinguished primarily by a Th1 cytokines profile[10]. This difference in the cytokine profile does not seem to be simply a result of the development of intes-tinal metaplasia since the cytokine profile is completely different in the duodenum or the gastric antrum[10]. We analyzed multiple cytokines in human tissues using cyto-kine arrays[11]. Interleukin-6 (IL-6) levels were consistently increased in BE compared to control tissues. The expres-sion of other cytokines, such as IL-8, was variable and inconsistent.

Il-6 aND CaNCeRThis review is focused on the IL-6/signal transducer and activator of transcription 3 (STAT3) pathway. IL-6 is a potent, pleiotropic Th2 cytokine that regulates immune defense response. Its release is triggered by tissue damage or infection. IL-6 acts as both a pro-inflammatory and anti-inflammatory cytokine. IL-6 plays a central role in the transition from the acute to the chronic phase of the inflammatory process[12]. Importantly, the IL-6 pathway is one of the most important mechanisms linking inflam-mation to cancer[13].

IL-6 overexpression is implicated in the pathogenesis of different tumors, including cancers of the ovary, pros-tate, breast, kidney and lung[14]. IL-6 is also associated with

the development of colon cancer, predominantly colitis-associated colon cancer. Recent in vivo evidence shows that IL-6 controls tumor formation and growth in a mouse colitis-associated colon cancer[15]. These studies indicate that the ablation of IL-6 reduces tumor burden, while the elevation of IL-6 levels accelerates tumor formation. The effects of IL-6 are mediated by STAT3. As expected, STAT3 deficiency reduced tumor incidence and growth, while STAT3 hyperactivation had an opposite effect in this model[15]. These studies clearly indicate that IL-6/STAT3 signaling is crucial in the carcinogenesis that is linked to inflammation, such as colitis-associated colon cancer.

Only a few studies investigating the role of IL-6 in esophageal carcinogenesis were reported[11,16,17]. We have shown that IL-6 is secreted from BE and EAC tissues and that phosphorylated STAT3 is expressed in BE and EAC[11,16]. These studies were confirmed by Zhang et al[17]. Non-transformed and transformed human Barrett’s epi-thelial cell lines were used in this study. Phospho-STAT3 was expressed only by transformed Barrett’s cells, which also exhibited higher levels of IL-6 mRNA and of IL-6 and Mcl-1 proteins than non-transformed Barrett’s cells.

In a recent study, serum IL-6 was significantly in-creased in esophageal cancer (86%) as compared to car-cinoembryonic antigen (30%) and squamous cell cancer antigen (24%)[18]. This was noted for both squamous cell carcinoma of the esophagus (87.1%, 23% and 33%, respectively) and EAC (7%, 39% and 13%, respectively). Interestingly, concentrations of IL-6 depended on dis-tant metastases and patient’ survival[18]. Importantly, both colitis-associated colon cancer and esophageal adenocar-cinoma are associated with chronic inflammation. There-fore, elevated IL-6/STAT3 signaling is one of the key pathways involved in esophageal tumorigenesis.

aUTOCRINe pRODUCTION Of Il-6 By CaNCeR CellsOne strategy used by cancer cells to upregulate growth and survival pathways is through autocrine production of growth and survival factors. IL-6 is produced by different cells, including immune cells and epithelial cells[19]. Ex-pression of IL-6 by cancer cells suggests that IL-6 acts as an autocrine growth factor to promote tumorigenesis[20].

But why is IL-6 a crucial factor in tumorigenesis if STAT3 can be activated by other cytokines? Grivennikov et al[21] suggested that tumors choose IL-6 to constitu-tively activate STAT3, because immune cells together with malignant cells are capable of producing massive amounts of “start-up” IL-6 (but not other family mem-bers) required for tumor progression. Indeed, both IL-6 and the IL-6 receptor are expressed in intestinal epithelial cells and these proteins are also increased in colorectal cancers[22]. Importantly, our studies indicate that premalig-nant BE tissue expresses membrane-bound IL-6 receptor as well as soluble IL-6 receptor (sIL-6R) and secretes in-creased amounts of IL-6 as BE progresses to esophageal adenocarcinoma (unpublished data)[11,16].


Dvorak K et al . IL-6 and Barrett's esophagus

sTaT3 aND CaNCeRIL-6 activity is mediated through activation of at least three different pathways. First, IL-6 binds to either cog-nate IL-6 receptor (IL-6Ra) or sIL-6R. Followed by bind-ing to the receptors: (1) IL-6 induces association of signal transducer gp130 and ErbB, which leads to the activation of the MAP kinase pathway and activation of transcrip-tion factor NF-IL-6; (2) IL-6 promotes activation of Phosphatidylinositol 3-kinases, a prominent kinase associ-ated with NF-kB activation and apoptosis resistance[23]; and (3) IL-6 signaling is primarily mediated by the Janus kinase (JAK)/STAT pathway (Figure 1). In this pathway the complex of IL-6 and its receptor interacts with the membrane bound gp130[24]. This event leads to the phos-phorylation of JAKs and subsequent phosphorylation of the transcription factor STAT3. Activated STAT3 then forms dimers and translocates from the cytoplasm to the nucleus. In the nucleus, STAT3 activates the transcription of specific genes by binding to consensus DNA elements.

There are six essential alterations to normal cell physi-ology, which together define a cancer cell. These include: evasion of apoptosis, self-sufficiency in growth signals, insensitivity to growth-inhibitory signals, limitless replica-tive potential, tissue invasion and metastasis and sustained angiogenesis[25]. STAT3 participates in the regulation of these processes[26]. Particularly, STAT3 increases the expression of genes that are required for angiogenesis, uncontrolled proliferation and survival[27]. These include genes such as anti-apoptotic genes (Bcl-xL, Mcl1 and sur-vivin), or genes involved in proliferation (c-MYC, cyclin D1) or angiogenesis (vascular endothelial growth factor). All

these proteins are associated with tumorigenesis and they are expressed in BE or EAC[11,28-31].

In addition, STAT3 contributes to constitutive NF-kB activation in tumor cells. Recent studies show that STAT3 prolongs NF-kB nuclear retention through acetyltransfer-ase p300-mediated RelA acetylation, thereby interfering with NF-kB nuclear export and thus inducing permanent NF-kB activation. Another important effect of STAT3 is that STAT3 negatively regulates the expression of tumor suppressor gene p53[27]. Importantly, p53 activity can be restored in cells by inhibiting STAT3 signaling[27].

sTaT3 RegUlaTIONThe activation of STAT3 is regulated by suppressors of cytokine signaling (SOCS) and protein inhibitors of activated STATs (PIASs). These proteins are often de-regulated in different cancers. SOCS-3 negatively regulates activated receptor complexes by inactivating JAKSs or by blocking recruitment sites for STAT3[32]. It also target signaling complexes for ubiquitination and degradation. PIAS3 blocks the DNA-binding activity of STAT3 and inhibits STAT3-mediated gene activation[33]. Silencing of SOCS3 expression due to aberrant methylation of the gene in various cell lines and cancers was reported by He et al[34]. Inactivation of SOCS-3 is frequently observed also in dysplastic Barrett’s esophagus and EAC due to promoter hypermethylation[35]. In normal squamous epi-thelium and normal gastric mucosa, SOCS-3 methylation was not observed. The expression of PIAS3, another in-hibitor of activated STAT3 protein, was also decreased in various cancers including prostate, colon, gastric or brain cancer[36]. However, such studies have not been performed in BE or EAC.

INCRease IN Il-6 assOCIaTeD wITh CaNCeR IN maleThe reasons for the higher prevalence of BE in males are not clear. Similarly to esophageal adenocarcinoma, hepa-tocellular carcinoma (HCC) is more prevalent in the male population. Recently, Naugler et al[37] identified a possible mechanism for this gender disparity in HCC. They found in a mouse model of HCC that administration of dieth-ylnitrosamine induced an increase in serum IL-6 in males compared to females. In wild type animals the incidence of HCC was 100% in males and only 13% in females. In contrast IL-6-/- males and females exhibited a similar very low incidence of HCC and longer survival[37]. The absence of IL-6 resulted in almost complete inhibition of diethylnitrosamine-induced hepatocarcinogenesis. Their study indicated that estrogen mediated suppression of IL-6 is crucial in preventing hepatocellular carcinoma. Perhaps, a similar mechanism is involved in esophageal tumorigenesis, and that is why males are affected by this disease more often than women.


JAK

Extracellular

Cytoplasm

IL6 IL6

JAK

STAT3

sIL6R

DNA

gp13

0

gp13

0

gp13

0

IL6

Bcl-xl, Mcl- -mycANG,VEGF

MAPKIL

-6R

IL-6

R

STAT3

Nucleus

STAT3

P

P

Extracellular

Cytoplasm

MAPK

Nucleus

Bcl-xl, Mcl-1, Tff3, c-mycANG, VEGF

STAT3

STAT3

STAT3

DNA

P

P

JAK JAK

IL-6 IL-6IL-6

IL-6

R

IL-6

R

sIL-6Rgp

130

gp13

0

gp13

0

Figure 1 Interleukin 6 signaling scheme of the interleukin 6/signal trans-ducer and activator of transcription 3 signaling pathway. IL-6: Interleukin 6; STAT3: Signal transducer and activator of transcription 3; sIL-6R: Soluble IL-6 receptor; IL-6R: IL-6 receptor; JAK: Janus kinase; MAPK: Mitogen-activated protein kinase; VEGF: Vascular endothelial growth factor; ANG: Angiopoietin.



Hydrophobic bile acids also generate ROS by activa-tion of nicotinamide adenine dinucleotide phosphate-oxidase, phospholipase A2, and by damaging mito-chondria[44]. Our studies showed that deoxycholic acid significantly increases levels of superoxide, hydrogen per-oxide and peroxynitrite[45]. Furthermore, we reported that human esophageal biopsies produce ROS after exposure to acidified medium containing bile acid cocktail[46]. It was shown that in esophageal cells ROS produced by bile acids directly activate the redox sensitive transcriptional factor NF-kB[47]. Consequently NF-kB upregulates pro-duction of different cytokines, such as IL-6, which leads to an increase in STAT3 signaling and expression of anti-apoptotic and prosurvival proteins. Indeed, a recent study showed that IL-6 and activated STAT3 were increased in transformed Barrett’s cells (transfected with H-ras and p53 siRNA)[17].

In addition, Quante et al[48] recently developed L2-IL-1b transgenic mouse model of BE/EAC. In this model human IL-1b is overexpressed in mouse esophagus and forestomach to mimic chronic esophageal inflammation. Furthermore, L2-IL-1b mice were fed 0.2% deoxycholic acid to accelerate the development of BE and EAC. In-terestingly, when these transgenic mice were crossed with IL-6-/- mice no metaplastic and/or dysplastic lesions were found[48]. These studies confirm our previous results indi-cating the importance of IL-6 in BE/EAC development.

DIsCUssION This review provides an evidence for a strong link be-tween chronic inflammation, IL-6, STAT3 activation and esophageal carcinogenesis. IL-6 is a cytokine that is frequently increased in different cancers. Bile and gastric acid in the refluxate are two of the major factors involved in the pathogenesis of BE. We hypothesize that repeated exposure of esophageal tissue to bile acids leads to IL-6 upregulation, increased activation of STAT3, apoptosis resistance and cancer development. This hypothesis is consistent with the studies demonstrating that tissue biopsies from BE patients (1) secrete large amounts of IL-6; (2) are resistant to apoptosis induced by bile ac-ids; and (3) express activated STAT3 and anti-apoptotic proteins regulated by IL-6/STAT3 signaling, Bcl-xL and Mcl-1[11,16,40].

RefeReNCes1 Falk GW. Barrett’s esophagus. Gastroenterology 2002; 122:

1569-1591 [PMID: 12016424]2 Pohl H, Welch HG. The role of overdiagnosis and reclas-

sification in the marked increase of esophageal adenocarci-noma incidence. J Natl Cancer Inst 2005; 97: 142-146 [PMID: 15657344]

3 Hur C, Choi SE, Rubenstein JH, Kong CY, Nishioka NS, Provenzale DT, Inadomi JM. The cost effectiveness of radio-frequency ablation for Barrett’s esophagus. Gastroenterology 2012; 143: 567-575 [PMID: 22626608]

4 Harrison RF, Perry I, Jankowski JA. Barrett’s mucosa: re-modelling by the microenvironment. J Pathol 2000; 192: 1-3 [PMID: 10951392]

BIle aCIDs aND apOpTOsIs ResIsTaNCe IN esOphageal CaNCeRAvoidance of apoptosis is one of the major character-istics of cancer[25]. The normal squamous epithelium is exposed to low pH and/or hydrophobic bile acids during esophageal reflux. Although a short-term effect of bile acids is the induction of apoptosis, a long-term effect of repeated exposures to bile acids is a selection for cells resistant to apoptosis[38]. These cells have a growth ad-vantage in the presence of agents that ordinarily induce apoptosis and they proliferate to form a field of apopto-sis resistant cells[39].

Our data suggest that epithelial cells of Barrett’s tis-sue are resistant to apoptosis induced by bile acids[40]. These results are consistent with the reported increase in the expression of Mcl-1 and Bcl-xL in BE[40] and studies suggesting that apoptosis resistance may lead to transfor-mation from BE to adenocarcinoma[41].

It is clear from many studies that bile acids activate both pro-survival and apoptotic pathways (Figure 2). The classic survival pathways induced by bile acids involve membrane perturbation, the activation of phospholipase A2 and the synthesis of prostaglandins and leukotrienes, catalyzed by cyclooxygenase and lipooxygenase, with re-active oxygen species (ROS) as a byproduct[42]. Bile acids also activate, in a ligand-independent manner, the epider-mal growth factor receptor (EGFR) and receptors of the tumor necrosis factor superfamily (e.g., FAS, TRAIL)[43]. Activation of the EGFR pathway is generally pro-surviv-al, whereas activation of the Fas and TRAIL pathways are pro-apoptotic.

Bile acids

Apoptosis

EGFRPLA2

FASRTRAILR

COXLOX

IKK

MAPK

ERKp38

NF-kB

ROS

Anti-apoptotic proteins

caspase-8

caspase-9

IL-6/STAT3 Mitochondrial damage

NADPH oxidase

Bile acids

NADPH oxidaseEGFRPLA2 FASR

TRAILR

ROS

Caspase-8MAPK

COXLOX

NF-kBIKK

ERKp38IL-6/STAT3

Anti-apoptotic proteins

Apoptosis

Caspase-9

Mitochondrial damage

Figure 2 Apoptosis and the signaling pathways activated by bile acids. EGFR: Epidermal growth factor receptor; MAPK: Mitogen-activated protein ki-nase; IL-6: Interleukin 6; STAT3: Signal transducer and activator of transcription 3; COX: Cyclooxygenase; LOX: Lipooxygenase; IKK: IκB kinase; ROS: Reac-tive oxygen species; NF-kB: Nuclear factor kappa B; PLA2: Phospholipase A2; NAPDH: Nicotinamide adenine dinucleotide phosphate; ERK: Extracellular-signal-regulated kinase; FASR: FAS receptor; TRAILR: TRAIL receptor.



5 Coussens LM, Werb Z. Inflammation and cancer. Nature 2002; 420: 860-867 [PMID: 12490959 DOI: 10.1038/nature-01322nature01322]

6 Bird-Lieberman EL, Fitzgerald RC. Barrett’s esophagus. Gas-troenterol Clin North Am 2008; 37: 921-942 [PMID: 19028325]

7 Abdel-Latif MM, O’Riordan JM, Ravi N, Kelleher D, Reyn-olds JV. Activated nuclear factor-kappa B and cytokine pro-files in the esophagus parallel tumor regression following neoadjuvant chemoradiotherapy. Dis Esophagus 2005; 18: 246-252 [PMID: 16128781]

8 Goldblum JR, Vicari JJ, Falk GW, Rice TW, Peek RM, Eas-ley K, Richter JE. Inflammation and intestinal metaplasia of the gastric cardia: the role of gastroesophageal reflux and H. pylori infection. Gastroenterology 1998; 114: 633-639 [PMID: 9516382]

9 O’Riordan JM, Abdel-latif MM, Ravi N, McNamara D, Byrne PJ, McDonald GS, Keeling PW, Kelleher D, Reynolds JV. Proinflammatory cytokine and nuclear factor kappa-B expression along the inflammation-metaplasia-dysplasia-adenocarcinoma sequence in the esophagus. Am J Gastroen-terol 2005; 100: 1257-1264 [PMID: 15929754]

10 Fitzgerald RC, Onwuegbusi BA, Bajaj-Elliott M, Saeed IT, Burnham WR, Farthing MJ. Diversity in the oesophageal phenotypic response to gastro-oesophageal reflux: im-munological determinants. Gut 2002; 50: 451-459 [PMID: 11889061]

11 Dvorakova K, Payne CM, Ramsey L, Holubec H, Sampliner R, Dominguez J, Dvorak B, Bernstein H, Bernstein C, Prasad A, Fass R, Cui H, Garewal H. Increased expression and se-cretion of interleukin-6 in patients with Barrett’s esophagus. Clin Cancer Res 2004; 10: 2020-2028 [PMID: 15041721]

12 Hurst SM, Wilkinson TS, McLoughlin RM, Jones S, Horiu-chi S, Yamamoto N, Rose-John S, Fuller GM, Topley N, Jones SA. Il-6 and its soluble receptor orchestrate a temporal switch in the pattern of leukocyte recruitment seen dur-ing acute inflammation. Immunity 2001; 14: 705-714 [PMID: 11420041]

13 Naugler WE, Karin M. The wolf in sheep’s clothing: the role of interleukin-6 in immunity, inflammation and cancer. Trends Mol Med 2008; 14: 109-119 [PMID: 18261959]

14 Kishimoto T, Akira S, Taga T. Interleukin-6 and its receptor: a paradigm for cytokines. Science 1992; 258: 593-597 [PMID: 1411569]

15 Grivennikov S, Karin E, Terzic J, Mucida D, Yu GY, Vallab-hapurapu S, Scheller J, Rose-John S, Cheroutre H, Eckmann L, Karin M. IL-6 and Stat3 are required for survival of intes-tinal epithelial cells and development of colitis-associated cancer. Cancer Cell 2009; 15: 103-113 [PMID: 19185845]

16 Dvorak K, Chavarria M, Payne CM, Ramsey L, Crowley-Weber C, Dvorakova B, Dvorak B, Bernstein H, Holubec H, Sampliner RE, Bernstein C, Prasad A, Green SB, Garewal H. Activation of the interleukin-6/STAT3 antiapoptotic path-way in esophageal cells by bile acids and low pH: relevance to barrett’s esophagus. Clin Cancer Res 2007; 13: 5305-5313 [PMID: 17875759]

17 Zhang HY, Zhang Q, Zhang X, Yu C, Huo X, Cheng E, Wang DH, Spechler SJ, Souza RF. Cancer-related inflamma-tion and Barrett’s carcinogenesis: interleukin-6 and STAT3 mediate apoptotic resistance in transformed Barrett’s cells. Am J Physiol Gastrointest Liver Physiol 2011; 300: G454-G460 [PMID: 21148399]

18 Łukaszewicz-Zając M, Mroczko B, Kozłowski M, Nikliński J, Laudański J, Szmitkowski M. Higher importance of inter-leukin 6 than classic tumor markers (carcinoembryonic an-tigen and squamous cell cancer antigen) in the diagnosis of esophageal cancer patients. Dis Esophagus 2012; 25: 242-249 [PMID: 21895853 DOI: 10.1111/j.1442-2050.2011.01242.x]

19 Gao SP, Mark KG, Leslie K, Pao W, Motoi N, Gerald WL, Travis WD, Bornmann W, Veach D, Clarkson B, Bromberg JF. Mutations in the EGFR kinase domain mediate STAT3

activation via IL-6 production in human lung adenocarcino-mas. J Clin Invest 2007; 117: 3846-3856 [PMID: 18060032 DOI: 10.1172/JCI31871]

20 Catlett-Falcone R, Landowski TH, Oshiro MM, Turkson J, Levitzki A, Savino R, Ciliberto G, Moscinski L, Fernández-Luna JL, Nuñez G, Dalton WS, Jove R. Constitutive activa-tion of Stat3 signaling confers resistance to apoptosis in hu-man U266 myeloma cells. Immunity 1999; 10: 105-115 [PMID: 10023775]

21 Grivennikov S, Karin M. Autocrine IL-6 signaling: a key event in tumorigenesis? Cancer Cell 2008; 13: 7-9 [PMID: 18167335]

22 Galizia G, Lieto E, De Vita F, Romano C, Orditura M, Cas-tellano P, Imperatore V, Infusino S, Catalano G, Pignatelli C. Circulating levels of interleukin-10 and interleukin-6 in gastric and colon cancer patients before and after surgery: relationship with radicality and outcome. J Interferon Cyto-kine Res 2002; 22: 473-482 [PMID: 12034030]

23 Wei LH, Kuo ML, Chen CA, Chou CH, Cheng WF, Chang MC, Su JL, Hsieh CY. The anti-apoptotic role of interleu-kin-6 in human cervical cancer is mediated by up-regulation of Mcl-1 through a PI 3-K/Akt pathway. Oncogene 2001; 20: 5799-5809 [PMID: 11593385]

24 Taga T, Kishimoto T. Gp130 and the interleukin-6 family of cytokines. Annu Rev Immunol 1997; 15: 797-819 [PMID: 9143707]

25 Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000; 100: 57-70 [PMID: 10647931]

26 Bromberg J, Darnell JE. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 2000; 19: 2468-2473 [PMID: 10851045]

27 Yu H, Jove R. The STATs of cancer--new molecular targets come of age. Nat Rev Cancer 2004; 4: 97-105 [PMID: 14964307]

28 Tselepis C, Morris CD, Wakelin D, Hardy R, Perry I, Lu-ong QT, Harper E, Harrison R, Attwood SE, Jankowski JA. Upregulation of the oncogene c-myc in Barrett’s adenocarci-noma: induction of c-myc by acidified bile acid in vitro. Gut 2003; 52: 174-180 [PMID: 12524396]

29 Bani-Hani K, Martin IG, Hardie LJ, Mapstone N, Briggs JA, Forman D, Wild CP. Prospective study of cyclin D1 overexpression in Barrett’s esophagus: association with in-creased risk of adenocarcinoma. J Natl Cancer Inst 2000; 92: 1316-1321 [PMID: 10944553]

30 Soslow RA, Remotti H, Baergen RN, Altorki NK. Sup-pression of apoptosis does not foster neoplastic growth in Barrett’s esophagus. Mod Pathol 1999; 12: 239-250 [PMID: 10102608]

31 Couvelard A, Paraf F, Gratio V, Scoazec JY, Hénin D, De-gott C, Fléjou JF. Angiogenesis in the neoplastic sequence of Barrett’s oesophagus. Correlation with VEGF expression. J Pathol 2000; 192: 14-18 [PMID: 10951394]

32 Greenhalgh CJ, Miller ME, Hilton DJ, Lund PK. Suppres-sors of cytokine signaling: Relevance to gastrointestinal function and disease. Gastroenterology 2002; 123: 2064-2081 [PMID: 12454862 DOI: 10.1053/gast.2002.37068]

33 Chung CD, Liao J, Liu B, Rao X, Jay P, Berta P, Shuai K. Specific inhibition of Stat3 signal transduction by PIAS3. Science 1997; 278: 1803-1805 [PMID: 9388184]

34 He B, You L, Uematsu K, Zang K, Xu Z, Lee AY, Costello JF, McCormick F, Jablons DM. SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci USA 2003; 100: 14133-14138 [PMID: 14617776 DOI: 10.1073/pnas.22327901002232790100]

35 Tischoff I, Hengge UR, Vieth M, Ell C, Stolte M, Weber A, Schmidt WE, Tannapfel A. Methylation of SOCS-3 and SOCS-1 in the carcinogenesis of Barrett’s adenocarcinoma. Gut 2007; 56: 1047-1053 [PMID: 17376806]

36 Brantley EC, Nabors LB, Gillespie GY, Choi YH, Palmer CA, Harrison K, Roarty K, Benveniste EN. Loss of protein inhibitors of activated STAT-3 expression in glioblastoma multiforme tumors: implications for STAT-3 activation and



gene expression. Clin Cancer Res 2008; 14: 4694-4704 [PMID: 18676737]

37 Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM, Karin M. Gender disparity in liver cancer due to sex dif-ferences in MyD88-dependent IL-6 production. Science 2007; 317: 121-124 [PMID: 17615358]

38 Jarpe MB, Widmann C, Knall C, Schlesinger TK, Gibson S, Yujiri T, Fanger GR, Gelfand EW, Johnson GL. Anti-apop-totic versus pro-apoptotic signal transduction: checkpoints and stop signs along the road to death. Oncogene 1998; 17: 1475-1482 [PMID: 9779994]

39 Bernstein C, Bernstein H, Payne CM, Dvorak K, Garewal H. Field defects in progression to gastrointestinal tract cancers. Cancer Lett 2008; 260: 1-10 [PMID: 18164807]

40 Dvorakova K, Payne CM, Ramsey L, Bernstein H, Holubec H, Chavarria M, Bernstein C, Sampliner RE, Riley C, Prasad A, Garewal H. Apoptosis resistance in Barrett’s esophagus: ex vivo bioassay of live stressed tissues. Am J Gastroenterol 2005; 100: 424-431 [PMID: 15667503]

41 Whittles CE, Biddlestone LR, Burton A, Barr H, Jankowski JA, Warner PJ, Shepherd NA. Apoptotic and proliferative activity in the neoplastic progression of Barrett’s oesopha-gus: a comparative study. J Pathol 1999; 187: 535-540 [PMID: 10398118]

42 Vanden Berghe W, Vermeulen L, De Wilde G, De Bosscher K, Boone E, Haegeman G. Signal transduction by tumor necrosis factor and gene regulation of the inflammatory cy-tokine interleukin-6. Biochem Pharmacol 2000; 60: 1185-1195 [PMID: 11007957]

43 Qiao L, Studer E, Leach K, McKinstry R, Gupta S, Decker R, Kukreja R, Valerie K, Nagarkatti P, El Deiry W, Molkentin J, Schmidt-Ullrich R, Fisher PB, Grant S, Hylemon PB, Dent P. Deoxycholic acid (DCA) causes ligand-independent activa-

tion of epidermal growth factor receptor (EGFR) and FAS receptor in primary hepatocytes: inhibition of EGFR/mi-togen-activated protein kinase-signaling module enhances DCA-induced apoptosis. Mol Biol Cell 2001; 12: 2629-2645 [PMID: 11553704]

44 Sokol RJ, Winklhofer-Roob BM, Devereaux MW, McKim JM. Generation of hydroperoxides in isolated rat hepato-cytes and hepatic mitochondria exposed to hydrophobic bile acids. Gastroenterology 1995; 109: 1249-1256 [PMID: 7557092]

45 Washo-Stultz D, Crowley-Weber CL, Dvorakova K, Bern-stein C, Bernstein H, Kunke K, Waltmire CN, Garewal H, Payne CM. Role of mitochondrial complexes I and II, reac-tive oxygen species and arachidonic acid metabolism in de-oxycholate-induced apoptosis. Cancer Lett 2002; 177: 129-144 [PMID: 11825660]

46 Dvorak K, Payne CM, Chavarria M, Ramsey L, Dvorakova B, Bernstein H, Holubec H, Sampliner RE, Guy N, Condon A, Bernstein C, Green SB, Prasad A, Garewal HS. Bile acids in combination with low pH induce oxidative stress and oxi-dative DNA damage: relevance to the pathogenesis of Bar-rett’s oesophagus. Gut 2007; 56: 763-771 [PMID: 17145738]

47 Jenkins GJ, Cronin J, Alhamdani A, Rawat N, D’Souza F, Thomas T, Eltahir Z, Griffiths AP, Baxter JN. The bile acid deoxycholic acid has a non-linear dose response for DNA damage and possibly NF-kappaB activation in oesophageal cells, with a mechanism of action involving ROS. Mutagen-esis 2008; 23: 399-405 [PMID: 18515815]

48 Quante M, Bhagat G, Abrams JA, Marache F, Good P, Lee MD, Lee Y, Friedman R, Asfaha S, Dubeykovskaya Z, Mah-mood U, Figueiredo JL, Kitajewski J, Shawber C, Lightdale CJ, Rustgi AK, Wang TC. Bile acid and inflammation acti-vate gastric cardia stem cells in a mouse model of Barrett-like metaplasia. Cancer Cell 2012; 21: 36-51 [PMID: 22264787]

P- Reviewers Bak YT, Cullen JJ S- Editor Huang XZ L- Editor A E- Editor Li JY


Is it worth investigating splenic function in patients with celiac disease?

Antonio Di Sabatino, Laura Brunetti, Gabriella Carnevale Maffè, Paolo Giuffrida, Gino Roberto Corazza

Antonio Di Sabatino, Laura Brunetti, Gabriella Carnevale Maffè, Paolo Giuffrida, Gino Roberto Corazza, Department of Internal Medicine, Celiac Centre, S. Matteo Hospital Foundation, University of Pavia, 27100 Pavia, ItalyAuthor contributions: All authors synthesized ideas and wrote the paper.Correspondence to: Dr. Antonio Di Sabatino, Department of Internal Medicine, Celiac Centre, S. Matteo Hospital Foundation, University of Pavia, Piazzale Golgi 5, 27100 Pavia, Italy. [email protected]: +39-382-501596 Fax: +39-382-502618Received: October 5, 2012 Revised: January 8, 2013Accepted: January 18, 2013Published online: April 21, 2013

AbstractCeliac disease, an immune-mediated enteropathy induced in genetically susceptible individuals by the ingestion of gluten, is the most frequent disorder asso-ciated with splenic hypofunction or atrophy. Defective splenic function affects more than one-third of adult patients with celiac disease, and it may predispose to a higher risk of infections by encapsulated bacteria and thromboembolic and autoimmune complications, particularly when celiac patients have concomitant pre-malignant and malignant complications (refractory celiac disease, ulcerative jejunoileitis and enteropathy-associated T-cell lymphoma). However, the clinical management of patients with celiac disease does not take into account the evaluation of splenic function, and in patients with high degree of hyposplenism or splenic atrophy the prophylactic immunization with specific vaccines against the polysaccharide antigens of encapsulated bacteria is not currently recommended. We critically re-evaluate clinical and diagnostic aspects of spleen dysfunction in celiac disease, and highlight new perspectives in the prophylactic management of infections in this condition.


Key words: Hyposplenism; Memory B cell; Pitted red cell; Pneumococcal vaccine; Splenic atrophy

Di Sabatino A, Brunetti L, Carnevale Maffè G, Giuffrida P, Coraz-za GR. Is it worth investigating splenic function in patients with celiac disease? World J Gastroenterol 2013; 19(15): 2313-2318 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2313.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2313

INTRODUCTIONFunctional hyposplenism has been regarded as an ac-quired disorder, potentially associated with several dis-eases, sometimes accompanied by a reduction in spleen size, and burdened by the same complications occurring in surgical asplenia[1,2]. The spleen, apart from acting as a phagocytic filter, thus removing ageing and damaged cells, is crucial in regulating immune homeostasis by linking innate and adaptive immunity, and in protecting against infections by encapsulated bacteria[3-5].

Removal of encapsulated bacteria in the course of initial infection requires natural antibodies produced by immunoglobulin M (IgM)-memory B cells, a unique B cell population resident in the marginal zone of the spleen, which, unlike switched-memory, are responsible for a T-independent response against bacteria[6-9]. The key role of the spleen in mounting an immune response against encapsulated bacteria is supported by the dramatic reduc-tion of the IgM-memory B cell pool following removal of the spleen[10,11]. An impairment of the immune function of the spleen results in (1) reduced number of IgM-mem-ory B cells and defective activity of opsonizing molecules, i.e., properdin and tuftsin, thus predisposing to infections caused by encapsulated bacteria (mainly Streptococcus pneu-moniae, Neisseria meningitidis and Haemophylus influenzae); and (2) decreased number of marginal zone B cells which pre-disposes to the emergence of autoreactive T-cell clones as a consequence of T-regulatory cells depletion, with

MINIREVIEWS





subsequent development of autoimmunity[8,9,12]. On the other hand, an impairment of the filtering function results in (1) reduced platelet sequestration, which predisposes to thromboembolism; and (2) defective removal of pits from erythrocytes with consequent increase of circulating Howell-Jolly bodies and pitted red cells (Figure 1)[1-3].

Detection of pitted red cells by phase-interference microscopy[13] is considered an accurate method to assess splenic function, quite easy to perform, less expensive and invasive than radioisotopic methods, and more ac-curate than Howell-Jolly bodies detection[14], particularly in the quantitation of mild degrees of hyposplenism[3]. The inverse correlation observed in asplenic and hyposplenic patients between pitted red cells and IgM-memory B cells suggests the possible use in clinical practice of flow cy-tometric B cell analysis as a quantitative alternative test[15]. The little we know about the natural history of hyposplen-ism leads us to believe that it evolves from a reversible mild impairment of splenic function - as occurs in responder Crohn’s disease patients after anti-tumor necrosis factor treatment with infliximab[16] - to an irreversible impairment of splenic function, up to severe splenic atrophy.

Among all the various diseases associated with hy-posplenism, celiac disease is the most frequent[2,17]. Hy-posplenism, assessed by pitted red cell counting, affects more than one-third of celiac patients[18]. Defective filtering function, measured by pitted red cell counting, is paralleled by a defect in the frequency of circulating IgM memory B cells and serum tuftsin activity, and both these parameters significantly correlate with the degree of splenic func-tion in untreated celiac disease[18,19]. Hyposplenism does not complicate celiac disease in infancy[20]; in adults its incidence correlates with the duration of pre-exposure to gluten as shown by the correlation with age at diagnosis[18], and a gluten-free diet is effective in restoring splenic func-

tion[21]. When the data are split according to clinical sever-ity, the prevalence of hyposplenism increases from 19% to 80% in celiacs with premalignant or malignant com-plications[19]. Both splenic atrophy and mesenteric lymph node cavitation are recognised as poor prognostic factors in celiac disease[19,22,23].

INFECTIONMajor infections have been reported in a number of hy-posplenic celiac patients in the last 25 years, variably as-sociated with spleen atrophy and mesenteric lymph node cavitation (Table 1)[23-29]. However, it was only in 2008 that two ad hoc studies highlighted the importance of this predisposition by showing a significantly higher relative risk of pneumococcal sepsis in adult celiacs, which is still significant when hospitalised patients are considered as reference individuals[30,31]. The absolute risk of sepsis turned out to be even higher than that of hip fracture and lymphoma in the celiac cohort[32]. These findings fit with the demonstration of an increased mortality due to infections (in particular septicemia) and respiratory dis-eases (mainly pneumonia) in the Swedish celiac cohort[33].

Although anti-pneumococcal vaccination has been shown to reduce the prevalence of major infections in asplenic patients[34-38], it is dramatically underused as shown by these data collected in England and Wales by examining 3584 patients with celiac disease or sickle cell anemia[39]. Vaccines currently used in patients at risk of pneumococcal infections are the 23-valent pneumococ-cal polysaccharide vaccine[40], whose protective action is based on the production of opsonising anti-capsular antibodies by means of a T-independent mechanism (it is actually recommended in asplenic/hyposplenic adults and children older than 5 years), and the 13-valent protein-


Di Sabatino A et al . Hyposplenism in celiac disease

Function Result of defective function Clinical consequences

↓ IgM-memory B cells↓ Tuftsin/properdin activity

↓ Marginal zone B cells

↓ Sequestration of platelets (Culling )

↓ Removal of pits from erythrocytes (Pitting )

Immune

Filtering

↓ Treg

Serious infections by encapsulated bacteria (Streptococcus pneumoniae, Neisseria meningitidis, Haemophylus influenzae )

Autoimmunity

Thromboembolism

↑ Circulating pitted erythrocytes and Howell-Jolly bodies

Figure 1 Schematic representation of immune and filtering function of the spleen. IgM: Immunoglobulin M; Treg: T-regulatory cells.

Ref. No. of cases Type of infection Supplementary findings

Corazza et al[23] 1 Pneumoccoccal pneumonia Splenic atrophy Matuchansky et al[24] 2 Pneumococcal pneumonia, infectious pericarditis Splenic atrophy, MLNC O’Donoghue[25] 1 Pneumococcal septicemia Splenic atrophy Logan et al[26] 2 Pneumococcal meningitis, septicemia by Salmonella Splenic atrophy Stevens et al[27] 3 Lung abscesses by Staphyloccus and Klebsiella Splenic atrophy Howat et al[28] 2 Fatal chest infection, septicemia Splenic atrophy, MLNC Harmon et al[29] 1 Septicemia by Klebsiella Splenic atrophy

Table 1 Case reports of hyposplenism-related infections in patients with celiac disease

MLNC: Mesenteric lymph node cavitation.

conjugate pneumococcal vaccine (PCV-13, Prevnar)[41], in which the CRM197 diphtheria protein changes the nature of the response from T-independent to T-dependent, making this vaccine particularly suitable in infants, espe-cially below the age of 2 years, when the splenic IgM-memory B cell pool is still immature (Table 2)[42-45]. Simi-larly, adult hyposplenic patients, in whom IgM-memory B cell are depleted, would benefit from PCV-13, as its T-dependent mechanism is supposed to bypass the im-munological impairment due to the lack of IgM-memory B cells. Nevertheless, Prevnar is recommended by current guidelines only in infancy (Table 2)[46].

AUTOIMMUNITYCeliac disease is frequently associated with a number of autoimmune disorders, including Hashimoto’s thyroiditis, insulin-dependent diabetes mellitus, Sjögren’s syndrome, Addison disease, systemic lupus erythematosus, rheuma-toid arthritis[47,48]. The evidence that autoantibodies may develop within months of splenectomy[49], together with the demonstration that celiac patients with blood film features of hyposplenism have a higher prevalence of au-toantibodies[50], have led to the hypothesis that defective splenic function might predispose the development of autoimmunity in celiac disease[51,52].

The nature of the link between hyposplenism and au-toimmune manifestations of celiac disease is not known, and it is not clear whether autoimmune disorders precede and cause splenic hypofunction or atrophy, or vice versa, or whether additional factors influence both conditions. The finding that hyposplenism in nonceliac patients with autoimmune disorders did not differ significantly from that of healthy controls supports the hypothesis that the higher risk for splenic hypofuncion in celiac patients with autoimmune disorders might be related to celiac disease, rather than to autoimmunity per se[19]. Of note, both hy-posplenism and autoimmune disorders increase their prevalence with the length of pre-exposure to gluten in celiac disease[18,53]. When we looked at the prevalence of celiac disease-associated hyposplenism, we found that it increases from 19% in uncomplicated patients to 59% in those with associated autoimmune diseases. More-over, patients with celiac disease-associated autoimmune disorders have a significantly lower percentage of IgM memory B cells in comparison to uncomplicated celiac patients[19]. This finding is quite interesting when consid-ering that memory B cells resident in the marginal zone

of the spleen play a role in the tolerance of autoantigens through the B cell receptor[54]. A similar role is exerted by marginal zone dendritic cells which internalise apoptotic leucocytes thus preventing autoantigens exposed on the surface of apoptotic bodies from causing autoantibody formation[55]. Moreover, both marginal zone B cells and dendritic cells may favour the expansion of regulatory T cells which maintain tolerance through the up-regulation of anti-inflammatory cytokines, such as transforming growth factor-β and interleukin-10[56]. The perturbation of these regulatory mechanisms have been shown to pre-dispose to the development of autoimmunity in splenect-omised or hyposplenic subjects[19,49,57].

THROMBOEMBOLISMImpaired spleen sequestration of circulating platelets and increased blood viscosity are supposed to be implicated in the development of thromboembolic events in splenect-omised patients or in other hyposplenism-associated dis-orders[58]. In the latter, the risk of thrombosis is difficult to assess as many of these disorders are associated with increased incidence of thrombosis per se. The hypervis-cosity secondary to defective splenic function may be the result in part of the persistence of aged and damaged red cells in the circulation as well as intracellular inclusions, such as Howell-Jolly bodies, siderotic granules, and Heinz bodies, all of which promote decreased erythrocyte de-formability[59]. An increased risk of thromboembolism has been recently demonstrated in celiac disease, where it correlates with the duration of pre-exposure to gluten[60]. However, in that study no data is available concerning the weight of the thromboembolic risk in the hyposplenic celiac patients, nor hyposplenism is mentioned among the possible factors predisposing to thromboembolism.

CONCLUSIONThere is a number of critical issues that remain to be elu-cidated to define the optimal management of hyposplenic celiac patients and to clarify the pathogenic mechanisms underlying spleen hypofunction[61,62]. We propose that splenic function is determined in patients with pre-malig-nant and malignant complications, concomitant autoim-mune disorders, old age at diagnosis, previous history of major infections/sepsis or thromboembolism, mesenteric lymph node cavitation and/or spleen atrophy (Table 3). As a diagnostic tool, pitted red cell counting remains an accu-


Vaccine Brand name Structure Mechanism Serotype Indication

PPV23 Pneumovax® Polysaccharide T-cell independent 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, 33F

Asplenic or hyposplenic adultsAsplenic or hyposplenic children > 5 yr

PCV13 Prevnar® Protein-conjugate (CRM197 protein)

T-cell dependent 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F Asplenic or hyposplenic children < 5 yr

Table 2 Traditional polysaccharide and new conjugate anti-pneumococcal vaccines used in the prophylactic management of asplenic/hyposplenic patients

PPV: Pneumococcal polysaccharide vaccine; PCV: Protein-conjugate pneumococcal vaccine.



2 William BM, Thawani N, Sae-Tia S, Corazza GR. Hy-posplenism: a comprehensive review. Part II: clinical mani-festations, diagnosis, and management. Hematology 2007; 12: 89-98 [PMID: 17454188]

3 Di Sabatino A, Carsetti R, Corazza GR. Post-splenectomy and hyposplenic states. Lancet 2011; 378: 86-97 [PMID: 21474172 DOI: 10.1016/S0140-6736(10)61493-6]

4 Mebius RE, Kraal G. Structure and function of the spleen. Nat Rev Immunol 2005; 5: 606-616 [PMID: 16056254]

5 Sills RH. Splenic function: physiology and splenic hy-pofunction. Crit Rev Oncol Hematol 1987; 7: 1-36 [PMID: 3304675]

6 Klein U, Rajewsky K, Küppers R. Human immunoglobulin (Ig)M+IgD+ peripheral blood B cells expressing the CD27 cell surface antigen carry somatically mutated variable region genes: CD27 as a general marker for somatically mu-tated (memory) B cells. J Exp Med 1998; 188: 1679-1689 [PMID: 9802980]

7 Shi Y, Agematsu K, Ochs HD, Sugane K. Functional analy-sis of human memory B-cell subpopulations: IgD+CD27+ B cells are crucial in secondary immune response by produc-ing high affinity IgM. Clin Immunol 2003; 108: 128-137 [PMID: 12921759]

8 Kruetzmann S, Rosado MM, Weber H, Germing U, Tournil-hac O, Peter HH, Berner R, Peters A, Boehm T, Plebani A, Quinti I, Carsetti R. Human immunoglobulin M memory B cells controlling Streptococcus pneumoniae infections are generated in the spleen. J Exp Med 2003; 197: 939-945 [PMID: 12682112]

9 Carsetti R, Rosado MM, Wardmann H. Peripheral develop-ment of B cells in mouse and man. Immunol Rev 2004; 197: 179-191 [PMID: 14962195]

10 Carsetti R, Pantosti A, Quinti I. Impairment of the antipoly-saccharide response in splenectomized patients is due to the lack of immunoglobulin M memory B cells. J Infect Dis 2006; 193: 1189-1190 [PMID: 16544264]

11 Wasserstrom H, Bussel J, Lim LC, Cunningham-Rundles C. Memory B cells and pneumococcal antibody after splenec-tomy. J Immunol 2008; 181: 3684-3689 [PMID: 18714044]

12 Weller S, Braun MC, Tan BK, Rosenwald A, Cordier C, Conley ME, Plebani A, Kumararatne DS, Bonnet D, Tournil-hac O, Tchernia G, Steiniger B, Staudt LM, Casanova JL, Reynaud CA, Weill JC. Human blood IgM “memory” B cells are circulating splenic marginal zone B cells harboring

rate, quantitative and inexpensive method, albeit observer-dependent[63]. Flow cytometric analysis of memory B cells could be an alternative quantitative test, although studies assessing its sensitivity and specificity are lacking[64]. We believe that protein-conjugate vaccines[65-68] should be rec-ommended in patients with major hyposplenism, defined -on the basis of data derived from asplenic patients- by a pitted red cells value higher than 10% and/or an IgM memory B cell frequency lower than 10%. Of note, most of the patients identified by these parameters are refrac-tory or have concomitant autoimmune disorders (Figure 2). Understanding the pathogenic mechanisms underly-ing spleen dysfunction in celiac disease requires a greater knowledge of the connections between gut and spleen. The demonstration that spleen function is crucial for the presence of IgA-producing plasma cells in the gut of both asplenic mice and patients[69], and that oral tolerance to gluten is predominantly mounted in the spleen[70] repre-sent preliminary attempts in this direction.

REFERENCES1 William BM, Corazza GR. Hyposplenism: a comprehensive

review. Part I: basic concepts and causes. Hematology 2007; 12: 1-13 [PMID: 17364987]

•

•

•

•••

•

•

••

•

• •

•

••

••

• •

••

••

••• ••••

•••

•• •

•

•• •

0 10 20 30 IgM-memory B cells (% total B cells)

Pitt

ed r

ed c

ells

(%

)

30

20

10

4

00 10 20 30 IgM-memory B cells (% total B cells)

Pitt

ed r

ed c

ells

(%

)

30

20

10

4

0

A B

Figure 2 Correlation between circulating pitted red cells and immunoglobulin M memory B cells in splenectomised patients (A) and hyposplenic celiac pa-tients (B). Among the latter, those affected by pre-malignant or malignant complications of celiac disease are indicated with a square, those affected by concomitant autoimmune disorders are indicated with a triangle. IgM: Immunoglobulin M.

Patients with complications (RCD, UJI, EATL, collagenous sprue) Patients with concomitant autoimmune disorders Patients with old age at diagnosis Patients with previous history of major infections/sepsis and/or thromboembolism Patients with mesenteric lymph node cavitation and/or splenic atrophy

Table 3 Celiac patients in whom splenic function should be assessed

EATL: Enteropathy-associated T-cell lymphoma; RCD: Refractory celiac disease; UJI: Ulcerative jejuno-ileitis.



a prediversified immunoglobulin repertoire. Blood 2004; 104: 3647-3654 [PMID: 15191950]

13 Corazza GR, Bullen AW, Hall R, Robinson PJ, Losowsky MS. Simple method of assessing splenic function in coeliac disease. Clin Sci (Lond) 1981; 60: 109-113 [PMID: 7237919]

14 Corazza GR, Ginaldi L, Zoli G, Frisoni M, Lalli G, Gasbarri-ni G, Quaglino D. Howell-Jolly body counting as a measure of splenic function. A reassessment. Clin Lab Haematol 1990; 12: 269-275 [PMID: 2125541]

15 Di Sabatino A, Rosado MM, Ciccocioppo R, Cazzola P, Morera R, Corazza GR, Carsetti R. Depletion of immuno-globulin M memory B cells is associated with splenic hypo-function in inflammatory bowel disease. Am J Gastroenterol 2005; 100: 1788-1795 [PMID: 16086716]

16 Di Sabatino A, Rosado MM, Cazzola P, Biancheri P, Tinozzi FP, Laera MR, Cantoro L, Vanoli A, Carsetti R, Corazza GR. Splenic function and IgM-memory B cells in Crohn’s disease patients treated with infliximab. Inflamm Bowel Dis 2008; 14: 591-596 [PMID: 18240280 DOI: 10.1002/ibd.20374]

17 Ferguson A, Hutton MM, Maxwell JD, Murray D. Adult co-eliac disease in hyposplenic patients. Lancet 1970; 1: 163-164 [PMID: 4189238]

18 Corazza GR, Zoli G, Di Sabatino A, Ciccocioppo R, Gasbarr-ini G. A reassessment of splenic hypofunction in celiac dis-ease. Am J Gastroenterol 1999; 94: 391-397 [PMID: 10022635]

19 Di Sabatino A, Rosado MM, Cazzola P, Riboni R, Biagi F, Carsetti R, Corazza GR. Splenic hypofunction and the spec-trum of autoimmune and malignant complications in celiac disease. Clin Gastroenterol Hepatol 2006; 4: 179-186 [PMID: 16469678]

20 Corazza GR, Lazzari R, Frisoni M, Collina A, Gasbarrini G. Splenic function in childhood coeliac disease. Gut 1982; 23: 415-416 [PMID: 7076019]

21 Corazza GR, Frisoni M, Vaira D, Gasbarrini G. Effect of gluten-free diet on splenic hypofunction of adult coeliac dis-ease. Gut 1983; 24: 228-230 [PMID: 6826107]

22 Di Sabatino A, Rosado MM, Miele L, Capolunghi F, Cazzo-la P, Biancheri P, Carsetti R, Gasbarrini G, Corazza GR. Im-pairment of splenic IgM-memory but not switched-memory B cells in a patient with celiac disease and splenic atrophy. J Allergy Clin Immunol 2007; 120: 1461-1463 [PMID: 17889288]

23 Corazza GR, Frisoni M, Vaira D, Gasbarrini G. Fatal pneu-monia in a patient with coeliac disease and splenic atrophy. Ital J Gastroenterol 1984; 16: 300-301

24 Matuchansky C, Colin R, Hemet J, Touchard G, Babin P, Eugene C, Bergue A, Zeitoun P, Barboteau MA. Cavitation of mesenteric lymph nodes, splenic atrophy, and a flat small intestinal mucosa. Report of six cases. Gastroenterology 1984; 87: 606-614 [PMID: 6745613]

25 O’Donoghue DJ. Fatal pneumococcal septicaemia in coeliac disease. Postgrad Med J 1986; 62: 229-230 [PMID: 3714613]

26 Logan RF, Rifkind EA, Turner ID, Ferguson A. Mortality in celiac disease. Gastroenterology 1989; 97: 265-271 [PMID: 2744350]

27 Stevens FM, Connolly CE, Murray JP, McCarthy CF. Lung cavities in patients with coeliac disease. Digestion 1990; 46: 72-80 [PMID: 2253825]

28 Howat AJ, McPhie JL, Smith DA, Aqel NM, Taylor AK, Cairns SA, Thomas WE, Underwood JC. Cavitation of mes-enteric lymph nodes: a rare complication of coeliac disease, associated with a poor outcome. Histopathology 1995; 27: 349-354 [PMID: 8847065]

29 Harmon GS, Lee JS. Splenic atrophy in celiac disease. Clin Gastroenterol Hepatol 2010; 8: A22 [PMID: 20601137 DOI: 10.1016/j.cgh.2010.06.009]

30 Ludvigsson JF, Olén O, Bell M, Ekbom A, Montgomery SM. Coeliac disease and risk of sepsis. Gut 2008; 57: 1074-1080 [PMID: 18270242 DOI: 10.1136/gut.2007.133868]

31 Thomas HJ, Wotton CJ, Yeates D, Ahmad T, Jewell DP, Gol-dacre MJ. Pneumococcal infection in patients with coeliac

disease. Eur J Gastroenterol Hepatol 2008; 20: 624-628 [PMID: 18679063 DOI: 10.1097/MEG.0b013e3282f45764]

32 Walters JR, Bamford KB, Ghosh S. Coeliac disease and the risk of infections. Gut 2008; 57: 1034-1035 [PMID: 18400879 DOI: 10.1136/gut.2008.151571]

33 Peters U, Askling J, Gridley G, Ekbom A, Linet M. Causes of death in patients with celiac disease in a population-based Swedish cohort. Arch Intern Med 2003; 163: 1566-1572 [PMID: 12860579]

34 Melles DC, de Marie S. Prevention of infections in hy-posplenic and asplenic patients: an update. Neth J Med 2004; 62: 45-52 [PMID: 15127830]

35 Bisharat N, Omari H, Lavi I, Raz R. Risk of infection and death among post-splenectomy patients. J Infect 2001; 43: 182-186 [PMID: 11798256]

36 Hansen K, Singer DB. Asplenic-hyposplenic overwhelming sepsis: postsplenectomy sepsis revisited. Pediatr Dev Pathol 2001; 4: 105-121 [PMID: 11178626]

37 Brigden ML, Pattullo AL. Prevention and management of overwhelming postsplenectomy infection--an update. Crit Care Med 1999; 27: 836-842 [PMID: 10321679]

38 Brigden ML, Pattullo A, Brown G. Pneumococcal vac-cine administration associated with splenectomy: the need for improved education, documentation, and the use of a practical checklist. Am J Hematol 2000; 65: 25-29 [PMID: 10936859]

39 Pebody RG, Hippisley-Cox J, Harcourt S, Pringle M, Painter M, Smith G. Uptake of pneumococcal polysaccharide vac-cine in at-risk populations in England and Wales 1999-2005. Epidemiol Infect 2008; 136: 360-369 [PMID: 17445314]

40 French N. Use of pneumococcal polysaccharide vaccines: no simple answers. J Infect 2003; 46: 78-86 [PMID: 12634068]

41 Durando P, Alicino C, De Florentiis D, Martini M, Icardi G. Improving the protection against Streptococcus pneumoniae with the new generation 13-valent pneumococcal conjugate vaccine. J Prev Med Hyg 2012; 53: 68-77 [PMID: 23240163]

42 Breukels MA, Zandvoort A, van Den Dobbelsteen GP, van Den Muijsenberg A, Lodewijk ME, Beurret M, Klok PA, Timens W, Rijkers GT. Pneumococcal conjugate vac-cines overcome splenic dependency of antibody response to pneumococcal polysaccharides. Infect Immun 2001; 69: 7583-7587 [PMID: 11705936]

43 Mikoluc B, Kayhty H, Bernatowska E, Motkowski R. Im-mune response to the 7-valent pneumococcal conjugate vaccine in 30 asplenic children. Eur J Clin Microbiol Infect Dis 2008; 27: 923-928 [PMID: 18584224 DOI: 10.1007/s10096-008-0523-5]

44 Musher DM, Ceasar H, Kojic EM, Musher BL, Gathe JC, Romero-Steiner S, White AC. Administration of protein-conjugate pneumococcal vaccine to patients who have inva-sive disease after splenectomy despite their having received 23-valent pneumococcal polysaccharide vaccine. J Infect Dis 2005; 191: 1063-1067 [PMID: 15747240]

45 Vernacchio L, Neufeld EJ, MacDonald K, Kurth S, Mu-rakami S, Hohne C, King M, Molrine D. Combined schedule of 7-valent pneumococcal conjugate vaccine followed by 23-valent pneumococcal vaccine in children and young adults with sickle cell disease. J Pediatr 1998; 133: 275-278 [PMID: 9709721]

46 Shatz DV. Vaccination considerations in the asplenic pa-tient. Expert Rev Vaccines 2005; 4: 27-34 [PMID: 15757471]

47 Di Sabatino A, Corazza GR. Coeliac disease. Lancet 2009; 373: 1480-1493 [PMID: 19394538 DOI: 10.1016/S0140-6736(09)60254-3]

48 Lewis NR, Holmes GK. Risk of morbidity in contempo-rary celiac disease. Expert Rev Gastroenterol Hepatol 2010; 4: 767-780 [PMID: 21108596 DOI: 10.1586/egh.10.72]

49 Robertson DA, Simpson FG, Gowland G, Losowsky MS. Splenectomy causes auto-antibody formation. J Clin Lab Im-munol 1983; 11: 63-65 [PMID: 6224018]

50 Bullen AW, Hall R, Gowland G, Rajah S, Losowsky MS.



Hyposplenism, adult coeliac disease, and autoimmunity. Gut 1981; 22: 28-33 [PMID: 7461474]

51 Corazza GR, Gasbarrini G. Defective splenic function and its relation to bowel disease. Clin Gastroenterol 1983; 12: 651-669 [PMID: 6193910]

52 Muller AF, Toghill PJ. Hyposplenism in gastrointestinal disease. Gut 1995; 36: 165-167 [PMID: 7883209]

53 Ventura A, Magazzù G, Greco L. Duration of exposure to gluten and risk for autoimmune disorders in patients with celiac disease. SIGEP Study Group for Autoimmune Disor-ders in Celiac Disease. Gastroenterology 1999; 117: 297-303 [PMID: 10419909]

54 Rathmell JC, Townsend SE, Xu JC, Flavell RA, Goodnow CC. Expansion or elimination of B cells in vivo: dual roles for CD40- and Fas (CD95)-ligands modulated by the B cell antigen receptor. Cell 1996; 87: 319-329 [PMID: 8861915]

55 Steinman RM, Pack M, Inaba K. Dendritic cells in the T-cell areas of lymphoid organs. Immunol Rev 1997; 156: 25-37 [PMID: 9176697]

56 Morelli AE, Larregina AT, Shufesky WJ, Zahorchak AF, Logar AJ, Papworth GD, Wang Z, Watkins SC, Falo LD, Thomson AW. Internalization of circulating apoptotic cells by splenic marginal zone dendritic cells: dependence on complement receptors and effect on cytokine production. Blood 2003; 101: 611-620 [PMID: 12393562]

57 Balsalobre B, Hernández-Godoy J, Planelles D. Autoan-tibodies in splenectomized patients as a consequence of abdominal trauma. J Investig Allergol Clin Immunol 1992; 2: 91-95 [PMID: 1342889]

58 Cappellini MD, Grespi E, Cassinerio E, Bignamini D, Fio-relli G. Coagulation and splenectomy: an overview. Ann N Y Acad Sci 2005; 1054: 317-324 [PMID: 16339680]

59 Crary SE, Buchanan GR. Vascular complications after splenectomy for hematologic disorders. Blood 2009; 114: 2861-2868 [PMID: 19636061]

60 Ludvigsson JF, Welander A, Lassila R, Ekbom A, Mont-gomery SM. Risk of thromboembolism in 14,000 individuals with coeliac disease. Br J Haematol 2007; 139: 121-127 [PMID: 17854316]

61 Davies JM, Lewis MP, Wimperis J, Rafi I, Ladhani S, Bolton-Maggs PH. Review of guidelines for the prevention and treatment of infection in patients with an absent or dysfunc-tional spleen: prepared on behalf of the British Committee for Standards in Haematology by a working party of the Hae-mato-Oncology task force. Br J Haematol 2011; 155: 308-317 [PMID: 21988145 DOI: 10.1111/j.1365-2141.2011.08843.x]

62 Castagnola E, Fioredda F. Prevention of life-threatening infections due to encapsulated bacteria in children with

hyposplenia or asplenia: a brief review of current recom-mendations for practical purposes. Eur J Haematol 2003; 71: 319-326 [PMID: 14667194]

63 de Porto AP, Lammers AJ, Bennink RJ, ten Berge IJ, Speel-man P, Hoekstra JB. Assessment of splenic function. Eur J Clin Microbiol Infect Dis 2010; 29: 1465-1473 [PMID: 20853172 DOI: 10.1007/s10096-010-1049-1]

64 Cameron PU, Jones P, Gorniak M, Dunster K, Paul E, Lewin S, Woolley I, Spelman D. Splenectomy associated changes in IgM memory B cells in an adult spleen registry cohort. PLoS One 2011; 6: e23164 [PMID: 21829713 DOI: 10.1371/journal.pone.0023164]

65 Croxtall JD, Dhillon S. Meningococcal quadrivalent (sero-groups A, C, W135 and Y) tetanus toxoid conjugate vaccine (Nimenrix™). Drugs 2012; 72: 2407-2430 [PMID: 23231026 DOI: 10.2165/11209580-000000000-00000]

66 Palmu AA, Jokinen J, Borys D, Nieminen H, Ruokokoski E, Siira L, Puumalainen T, Lommel P, Hezareh M, Moreira M, Schuerman L, Kilpi TM. Effectiveness of the ten-valent pneumococcal Haemophilus influenzae protein D conju-gate vaccine (PHiD-CV10) against invasive pneumococcal disease: a cluster randomised trial. Lancet 2013; 381: 214-222 [PMID: 23158882 DOI: 10.1016/S0140-6736(12)61854-6]

67 Gruber WC, Scott DA, Emini EA. Development and clini-cal evaluation of Prevnar 13, a 13-valent pneumocococcal CRM197 conjugate vaccine. Ann N Y Acad Sci 2012; 1263: 15-26 [PMID: 22830997 DOI: 10.1111/j.1749-6632.2012.06673.x]

68 Frenck RW, Gurtman A, Rubino J, Smith W, van Cleeff M, Jayawardene D, Giardina PC, Emini EA, Gruber WC, Scott DA, Schmöle-Thoma B. Randomized, controlled trial of a 13-valent pneumococcal conjugate vaccine administered concomitantly with an influenza vaccine in healthy adults. Clin Vaccine Immunol 2012; 19: 1296-1303 [PMID: 22739693 DOI: 10.1128/CVI.00176-12]

69 Di Sabatino A, Rosado MM, Carsetti R, Cascioli S, Giorda E, Scarsella M, Petrini S, Tinozzi FP, Brunetti L, Milito C, Do-nato G, Quinti I, Corazza GR. Depletion of circulating mem-ory B cells in splenectomised and common variable immune deficiency patients is associated with decreased IgA plasma cells in the gut mucosa. Intern Emerg Med 2011; 6 (Suppl 2): S142 [DOI: 10.1007/s11739-011-0737-x]

70 Du Pré MF, Kozijn AE, van Berkel LA, ter Borg MN, Linden-bergh-Kortleve D, Jensen LT, Kooy-Winkelaar Y, Koning F, Boon L, Nieuwenhuis EE, Sollid LM, Fugger L, Samsom JN. Tolerance to ingested deamidated gliadin in mice is main-tained by splenic, type 1 regulatory T cells. Gastroenterology 2011; 141: 610-620, 620.e1-2 [PMID: 21683079 DOI: 10.1053/j.gastro.2011.04.048]

P- Reviewer Ciaccio EJ S- Editor Jiang L L- Editor A E- Editor Li JY


Effect of biliary drainage on inducible nitric oxide synthase, CD14 and TGR5 expression in obstructive jaundice rats

Zi-Kai Wang, Jian-Guo Xiao, Xue-Fei Huang, Yi-Chun Gong, Wen Li

Zi-Kai Wang, Wen Li, Department of Gastroenterology and Hepatology, the General Hospital of the Chinese People’s Libera-tion Army, Beijing 100853, ChinaJian-Guo Xiao, Critical Care Medicine, the General Hospital of the Chinese People’s Liberation Army, Beijing 100853, ChinaXue-Fei Huang, Department of Cadre Health Care, the Navy General Hospital of the Chinese People’s Liberation Army, Bei-jing 100048, ChinaYi-Chun Gong, Intensive Care Unit, the 309th Hospital of the Chinese People’s Liberation Army, Beijing 100091, ChinaAuthor contributions: Li W designed the research; Wang ZK, Xiao JG, Huang XF and Gong YC performed the majority of ex-periments and contributed equally to this work; Wang ZK and Li W wrote the paper.Supported by National Natural Science Foundation of China, No. 30470790 and 30971355Correspondence to: Wen Li, MD, PhD, Department of Gastro-enterology and Hepatology, the General Hospital of the Chinese People’s Liberation Army, No. 28, Fuxing Road, Beijing 100853, China. [email protected]: +86-10-55499107 Fax: +86-10-88626386Received: June 28, 2012 Revised: December 19, 2012Accepted: March 6, 2013Published online: April 21, 2013

AbstractAIM: To investigate the effect of biliary drainage on inducible nitric oxide synthase (iNOS), CD14 and TGR5 expression in rats with obstructive jaundice (OJ).

METHODS: Male adult Sprague-Dawley rats were ran-domly assigned to four groups: OJ, sham operation (SH), internal biliary drainage (ID) and external biliary drain-age (ED). Rat models were successfully established by two operations and succumbed for extraction of Kupffer cells (KCs) and liver tissue collection on the 8th and 15th day. KCs were isolated by in situ hepatic perfusion and digested with collagen Ⅳ, density gradient centrifuged by percoll reagent and purified by cell culture attach-ment. The isolated KCs were cultured with the endo-

toxin lipopolysaccharide (LPS) with and without the ad-dition of ursodeoxycholic acid (UDCA). The expression of iNOS, CD14 and bile acid receptor-TGR5 protein in rat liver tissues was determined by immunohistochem-istry. The expression of iNOS and CD14 messenger RNA (mRNA) on the isolated KCs was detected by reverse transcription polymerase chain reaction (PCR) and the TGR5 mRNA level in KCs was measured by real-time quantitative PCR.

RESULTS: The iNOS protein was markedly expressed in the liver of OJ rats, but rare expressed in SH rats. After relief of OJ, the iNOS expression was decidedly suppressed in the ID group (ID vs OJ, P < 0.01), but obviously increased in rats of ED (ED vs OJ, P = 0.004). When interfered only with LPS, the expression of iNOS mRNA by KCs was increased in the OJ group compared with the SH group (P = 0.004). After relief of biliary obstruction, the iNOS mRNA expression showed slight changes in the ED group (ED vs OJ, P = 0.71), but dropped in the ID group (ID vs OJ, P = 0.001). Com-pared with the simple intervention with LPS, the expres-sions of iNOS mRNA were significantly inhibited in all four groups after interfered with both LPS and UDCA (P < 0.01, respectively). After bile duct ligation, the CD14 protein expression in rat liver was significantly strength-ened (OJ vs SH, P < 0.01), but the CD14 mRNA level by KCs was not up-regulated (OJ vs SH, P = 0.822). After relieving the OJ, the expression of CD14 protein was reduced in the ID group (ID vs OJ, P < 0.01), but not reduced in ED group (ED vs OJ, P = 0.591). And then the CD14 mRNA expression was aggravated by ED (ED vs OJ, P < 0.01), but was not significantly different between the ID group and the SH and OJ groups (ID vs SH, P = 0.944; ID vs OJ, P = 0.513, respectively). The expression of TGR5 protein and mRNA increased signifi-cantly in OJ rats (OJ vs SH, P = 0.001, respectively). Af-ter relief of OJ, ID could reduce the expression of TGR5 protein and mRNA to the levels of SH group (ID vs SH, P = 0.22 and P = 0.354, respectively), but ED could not (ED vs SH, P = 0.001, respectively).

ORIGINAL ARTICLE





CONCLUSION: ID could be attributed to the regula-tory function of activation of KCs and release of inflam-matory mediators.


Key words: Obstructive jaundice; Biliary drainage; Kupffer cells; CD14; TGR5; Ursodeoxycholic acid

Core tip: To date, there are still controversies over whether and how to perform preoperative biliary drain-age in patients with malignant or benign obstructive jaundice (OJ), even though the complication-related mortality rate for OJ patients was high after surgery. Internal biliary drainage could reverse the raised ex-pression of inducible nitric oxide synthase and CD14 both in protein and messenger RNA levels in obstruc-tive jaundice rat models, but external drainage could not. The mechanism of internal biliary drainage supe-rior to external drainage in relief of obstructive jaun-dice might be attributed to the regulatory function of activation of Kupffer cells and release of inflammatory mediators.

Wang ZK, Xiao JG, Huang XF, Gong YC, Li W. Effect of bili-ary drainage on inducible nitric oxide synthase, CD14 and TGR5 expression in obstructive jaundice rats. World J Gastroenterol 2013; 19(15): 2319-2330 Available from: URL: http://www.wjg-net.com/1007-9327/full/v19/i15/2319.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2319

INTRODUCTIONTo date, there are still controversies over whether and how to perform preoperative biliary drainage in patients with malignant or benign obstructive jaundice (OJ), even though the complication-related mortality rate for OJ patients was high after surgery. One of the controversies is the necessity of relieving biliary obstruction before surgery[1-4]. Some investigators suggested that preopera-tive biliary drainage should not be routinely performed in OJ patients planned for surgery due to the complica-tions associated with the procedure itself, which might outweigh the potential benefit of it[1,2]. On the contrary, other investigators confirmed the effect of preoperative biliary drainage in reducing the postoperative morbidity and mortality, complications of infection and hospital stay in patients with OJ[3,4]. The second debate is which is the appropriate drainage method, internal biliary drainage (ID) or external biliary drainage (ED)[5-8]? Some stud-ies suggested that ID (e.g., biliary stent endoprosthesis) could recover the enterohepatic circulation of bile acid, improve the intestinal barrier function and reduce endo-toxin-related complications more obviously than ED, and therefore, ID may contribute to the early recovery and improve the patients’ life quality compared with ED[5,6]. On the contrary, some systematic reviews reported that

ED (e.g., percutaneous transhepatic biliary drainage, en-doscopic nasobiliary drainage and T-tube drainage) was superior to ID, because ID could increase the risk of ret-rograde cholangitis and had lower diagnostic value than ED[7]. Moreover, ED is better than ID concerning the recovery of cellular immunity and liver inflammation in the short term after relief from biliary obstruction[8].

Kupffer cells (KCs) as the resident liver macrophages, constitute a vital component of the reticuloendothelial system, and KCs are critically involved in the pathogenesis of OJ by acting as antigen presenting cells and producing many endotoxin-related inflammatory mediators. So we carried out a series of experimental studies based on the immune function of KC in OJ rat model to address those questions. Our previous experimental studies found that KC from rats with OJ could produce large amounts of en-dotoxin-mediated nitric oxide and ID was superior to ED in reversing the distorted nitric oxide due to the regula-tion of inducible nitric oxide synthase (iNOS), messenger RNA (mRNA)[9,10]. ID could reverse the serum levels of endotoxin and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), but ED could not[10]. Although our earlier studies demonstrat-ed the necessity of relieving obstruction preoperatively and the advantages of ID in relief of OJ in contrast with ED in animal models, but the mechanism is still unclear.

Lipopolysaccharide (LPS, endotoxin) as an abundant component of the cell wall of gram-negative bacteria, could provoke a generalized pro- inflammatory response and stimulate the production of pro-inflammatory media-tors through the activation of KC in patients with OJ[11]. Recent investigations showed that CD14, one of the most important LPS receptors, could play an important role in the activation of KC and LPS-mediated liver injury[12,13]. We proposed a hypothesis that CD14 as a receptor of endotoxin might play an important role in the immune suppression in OJ, and related to the effects of biliary drainage.

Bile acids could successfully reduced endotoxin re-lated complications following surgery in patients with OJ, and the immunomodulatory function of bile acids is obtaining more attention[14,15]. Recently, the plasma membrane bound, G-protein coupled bile acid receptor TGR5 (Gpbar-1, M-Bar) has been first described by two separate research groups[16,17]. TGR5 is highly expressed in CD14-positive monocytes/macrophages[16]. Studies from Keitel et al[18] demonstrated that TGR5 was localized in the plasma membrane of isolated KC, and bile acids could alter macrophage function by affecting phagocytic activity and inhibiting LPS-induced cytokines expression in KC via TGR5-cAMP dependent pathways. The immu-noreactivity of TGR5 in KC was increased in rat livers following bile duct ligation, suggesting that TGR5 may play a protective role in OJ preventing excessive cytokine production, thereby reducing liver injury.

This study aims to detect the protein expression of iNOS, CD14 and TGR5 in liver and the mRNA expres-sion in isolated KCs, and to investigate the immunomod-


Wang ZK et al . iNOS, CD14 and TGR5 after relief of OJ

ulatory effect of ursodeoxycholic acid (UDCA) in terms of the expression of iNOS mRNA after relief of OJ by ID and ED in rats, in order to further explore the mecha-nism whether ID is superior to ED in relief of OJ.

MATERIALS AND METHODSAnimalsTwo hundred and forty adult male Sprague-Dawley rats weighing 270-350 g were used in the study. All animals were purchased from the Laboratory Animal Center of Academy of Military Medical Sciences [License: SCXK (Jun) 2007-004] and housed in the Experimental Animal Service Center of the Chinese People’s Liberation Army General Hospital. This study was carried out in strict ac-cordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal use protocol has been reviewed and approved by the Institutional Animal Care and Use Committee of the General Hospital of the Chinese People’s Liberation Army. Rats were fed with a standard diet of commercial rat chow and tap water ad libitum. The experiment was approved by the Animal Re-search Ethics Committee of the General Hospital of the Chinese People’s Liberation Army.

Animal modelsAnimal models were induced using a modified method in our previous study[19]. In brief, rats were randomly assigned to four groups: OJ, sham operation (SH), ID and ED groups. All procedures were performed under anesthesia with 1.5% isoflurane and 98.5% oxygen using a delivery and scavenging system designed in our labora-tory[19]. Rats were subjected to laparotomy twice every seven days. OJ was induced by common bile duct ligation and SH was produced by separating bile duct locally but not dividing. ID was performed by implanting a drainage tube between the dilated end of common bile duct and duodenum, while ED was performed by exteriorizing a drainage tube at the nape of the rat. The rat models were succumbed for extraction of KC and liver tissue collec-tion on the 8th and 15th day.

Hematoxylin and eosin stainingThe caudate lobe of the liver was removed and the blood vessels were tied off for facilitating the isolation of KC in site perfusion. Liver tissues were fixed immediately in 10% neutral buffered formalin and paraffin-embedded blocks were made. Serial sections 5 μm thick were stained with hematoxylin and eosin for evaluation of portal inflammation, hepatocellular necrosis and inflammatory cell infiltration. Sections were examined under a light mi-croscope (CMS800, Olympus, Tokyo, Japan).

Immunohistochemistry and morphometryThe immunohistochemical staining was performed on sections of liver samples. Briefly, 5 μm paraffin sec-tions were deparaffinized with xylene and rehydrated in

a gradient of ethanol solutions. Antigen retrieval was carried out by microwave heating the sections for 20 min in citric acid buffer, and then cooling for 15 min at room temperature (RT). Endogenous peroxidase activity was quenched with 3% hydrogen peroxide at RT for 10 min. Nonspecific binding was blocked by incubating the sections for 10-15 min in the normal goat serum (5%, 100-150 μL). The sections were incubated overnight at 4 ℃ with the anti-iNOS antibody (rabbit polyclonal antibody against iNOS; Santa Cruz, CA, United States) at a dilution of 1:200, the anti-CD14 antibody (rabbit polyclonal antibody against CD14, BA0719, Boster Bio-technology, Wuhan, China) at a dilution of 1:200 and the anti-TGR5 antibody (rabbit polyclonal antibody against TGR5, SC-98888, Santa Cruz, CA, United States) at a dilution of 1:100, respectively. Following several rinses in phosphate buffered solution, the sections were incubated with the biotinylated goat anti-rabbit immunoglobulin G antibody (Zhongshan Jinqiao Biotechnology, Beijing, China) for 30 min at 37 ℃. Finally, the sections were col-ored with DAB at RT for 1-15 min, counterstained with hematoxylin for 30 s, dehydrated through gradient etha-nol, cleared in xylene and then mounted with permount. Images were obtained using a light microscope (CMS800; Olympus, Tokyo, Japan). Immunoreactivity of iNOS, CD14 and TGR5 in rat liver was morphometrically iden-tified by the Image Pro Plus 6.0 image analysis software system (Media Cybernetics, MD, United States).

Isolation and treatment of KCs KCs were isolated and purified as previously described by a combination of Percoll gradient centrifuging and tra-ditional attachment method[9]. Briefly, non-parenchymal liver cells were dispersed by retrograde in situ collagenase perfusion from the inferior vena cava to the portal vein by Leffert’s solution with collagenase Ⅳ (0.2 mg/mL; Sigma, NY, United States). KCs were purified by centrifu-gation through the two bands of Percoll gradients, and suspended in RPMI-1640 culture media (Gibco, Carlsbad, CA, United States) containing 1% penicillin/streptomycin and 10% heat-inactivated fetal bovine serum. Moreover, KCs were inoculated into the cell culture dish (Corning, NY, United States) in a humidified incubator with 5% CO2 and 95% air at 37 ℃. After 3 h cell culture, the non-adherent cells were washed away with a warm Hanks bal-anced salt solution, and then KCs attached to the bottom of the dish were used for TGR5 mRNA measurement immediately, cultured continuously for 18 h with LPS at a final concentration of 10 ng/mL for CD14 mRNA de-tection, and cultured with LPS (10 ng/mL) and LPS (10 ng/mL) + UDCA (0.1 mmol/L) respectively for iNOS mRNA detection[20,21]. Viability of KCs was assessed with trypan blue exclusion test and purity was confirmed by peroxidase staining[9].

Reverse transcription polymerase chain reactionThe iNOS mRNA expression was measured as described in our previous experiment[10]. Briefly, after the isolated




CCATCTATGAGGGTTACGC-3’, β-actin-antisense: 5’-TTTAATGTCACG CACGATTTC-3’. The relative mRNA levels of TGR5 were measured according to the 2-ΔΔCT method.

Statistical analysisContinuous data were expressed as mean ± SD. The one-way analysis of variance, Student Newman Keuls-q test or nonparametric test of K independent sample were used for the continuous data. A P value less than 0.05 was considered statistically significant. All statistical analyses of the experimental data were performed with SPSS 17.0 software (Chicago, IL, United States).

RESULTSMorbidity and mortalityAfter bile duct ligation, the main cause of rat death was biliary leakage. During and after the biliary drainage procedures, hemorrhage and dehydration were the main death reasons. Finally, 126 rats were enrolled into this study and divided into four groups: OJ (n = 32), SH (n = 30), ID (n = 35) and ED (n = 29) groups. Rats were kept under veterinary care and body weights were measured on the 1st, 8th and 15th day before laparotomy (Table 1). After bile duct ligation, skin stained yellow and lethargy were observed in OJ rat models. OJ rats ate markedly less food and there was a slowly increasing trend of body weight between the 1st, 8th and 15th day (P = 0.155). On the contrary, weight gain was more significant in SH rats compared with that in OJ rats both on the 8th and 15th day (P < 0.01). After relief of OJ, the appetite of ID rats recovered and the body weight of ID rats on the 15th day was significantly higher than that on the 8th day (P < 0.01). On the contrary, weight loss was observed in ED rats and the body weight on day 15 was significantly lower than that on the 1st or 8th day (P < 0.05) (Figure 1). Moreover, the bile from ED could stimulate the neck wound and cause local skin inflammation.

Histopathological changes of liver tissuesAfter bile duct ligation for 7 d, the liver of OJ rats showed hepatocellular degeneration and mild bile duct prolifera-tion with acute inflammatory cell infiltration in the portal and periportal areas. Focal necrosis and mild fibrosis were present in the cholestatic liver, but liver cirrhosis did not

KCs were cultured with LPS (10 ng/mL) or LPS (10 ng/mL) + UDCA (0.1 mmol/L) in vitro for 18 h, the expres-sion levels of iNOS mRNA by KCs in these four groups were detected by reverse transcription polymerase chain reaction (RT-PCR).

Measurement of CD14 mRNASemiquantitative analysis of CD14 mRNA by KC was detected by RT-PCR after the isolated KCs were cultured with endotoxin (10 ng/mL) in vitro for 18 h. Total RNA was extracted by TRIzol reagent from Invitrogen and 1μg RNA was primed with oligo (dT) using a reverse tran-scriptase kit from Promega according to the manufac-turer’s instructions. The sequences of CD14 primer were derived from the published CD14 gene sequences: CD14 mRNA-sense: 5’-CTCAACCTAGAGCCGTTTCT-3’, CD14 mRNA-antisense: 5’-CAGGA TTGTCAGA-CAGGTCT-3’; β-actin-sense: 5’-ATCATGTTGAGA-CCTTCAACA -3’, β-actin-antisense: 5’-CATCTCTT-GCTCGAAGTCCA-3’[11]. Two μL cDNA production from RT-PCR reaction system was amplified in an au-tomated thermocycler from Eppendorf. The conditions for amplification were as follows: pre-denaturation for 5 min at 94 ℃ for 1 cycle; denaturation for 1 min at 94 ℃, annealing for 1 min at 58 ℃ and extension for 1 min at 72 ℃ for a total of 35 cycles of PCR, followed by a final extension for 7 min at 72 ℃ for 1 cycle. The PCR prod-ucts were electrophoresed in 1.5% agarose gels contain-ing ethidium bromide and reviewed under the ultraviolet light with the gel documentation system (UVP, Cold-spring, Wilmington, DE, United States). Band intensity of each sample was determined using Glow Discharge Spectroscopy image analysis software (Coldspring, Wilm-ington, DE, United States).

Measurement of TGR5 mRNAQuantitative analysis of TGR5 mRNA was performed by RTQ-PCR. Total RNA from KCs was extracted us-ing TRIzol reagent (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions. The quality and quantity of RNA were assessed using 1% agarose gel electrophoresis and spectrophotometric analysis of 260/280 ratios, and then RNA was stored at -70 ℃ prior to analysis. RNA was reversely transcribed with oligo (dT) primer using a reverse transcriptase kit (Promega, Madison, WI, United States). The resulting cDNA was detected using SYBR Green I dye (Qiagen GmbH, Hilden, Germany) and amplified using the BIO-ER Linegene-3320 system (Hangzhou Bioer Technology, China). Thermocycling conditions for RTQ-PCR were 1 cycle at 95 ℃ for 2 min and 45 cycles at 95 ℃ for 20 s, 60 ℃ for 25 s and 72 ℃ for 30 s. The primers were designed by Primer Premier 5.0 and Oligo 6.0 based on GeneBank and β-actin was used as an internal refer-ence gene to normalize the transcript levels. The primer sequences were as follows: TGR5-sense: 5’-CCTG-GACCGCCACTTACG-3’, TGR5-antisense: 5’-CCCT-GTGAGTAGCCCAGCTAGT-3’; β-actin-sense: 5’-C

Day Body weight

OJ (n = 32) SH (n = 30) ID (n = 35) ED (n = 29)

D1 297.65 ± 13.95 296.90 ± 20.04 300.60 ± 19.29 301.90 ± 20.65 D8 299.70 ± 17.95 326.10 ± 30.16 307.60 ± 19.38 306.90 ± 29.89 D15 312.10 ± 30.11 360.20 ± 20.27 333.65 ± 28.12 281.15 ± 29.99

Table 1 Changes of body weight after operation in the four groups (g) (mean ± SD)

D1: The 1st day; D8: The 8th day; D15: The 15th day; ED: External biliary drainage; ID: Internal biliary drainage; OJ: Obstructive jaundice; SH: Sham operation.



occur in OJ rats on the 8th day. However, following bile duct ligation for 14 d, the liver showed moderate to severe bile duct proliferation and fibrous expansion of the portal tracts with severe fibrosis and signs of early cirrhosis in the liver (Figure 2). After sham operation for 7 d, histo-logic study revealed a normal liver lobular architecture and no pathological changes in livers from SH rats. After 7 d of biliary drainage by ID and ED, the liver displayed nor-mal morphological features of hepatocytes and preserved lobular architecture with only mild bile duct proliferation. Furthermore, the progression of fibrosis and cirrhosis stopped and reversal of the progression of cirrhosis and inflammation was observed (Figure 2).

Expression of iNOS in rat liver tissuesThere was rare expression of iNOS protein in SH rats, but the liver of OJ rats markedly expressed iNOS protein in terms of the mean optical density (0.296 ± 0.055). After relief of OJ by ID, the expression of iNOS was noticeably suppressed (0.204 ± 0.029) when compared with the higher expression observed in OJ rat models (ID vs OJ, P < 0.01). However, the expression of liver iNOS obviously increased in rats of ED (0.399 ± 0.086) (ED vs OJ, P = 0.004) (Figure 3).

Expression of iNOS mRNA interfered with LPS and LPS + UDCAWhen interfered only with LPS, the expression of iNOS mRNA by KC was stronger in the OJ group (0.58 ± 0.13) than in SH group (0.38 ± 0.07) (OJ vs SH, P = 0.004). After relief of biliary obstruction, iNOS mRNA expres-sion showed slight changes in the ED group (0.59 ± 0.12) (ED vs OJ, P = 0.71), but dropped in the ID group (0.45 ± 0.12) as compared with ED and OJ groups (ID vs ED, P = 0.004; ID vs OJ, P = 0.001). When interfered with LPS and UDCA, inhibited iNOS mRNA expressions by KC were seen in all four groups (Figure 4).

Expression of CD14 in rat liver tissuesThe immunoreactivity of CD14 protein was mainly detected in the membrane of KCs on the edge of liver sinusoid and portal areas. Moreover, in some sinusoidal liver endothelial cells and hepatic stellate cells, the expres-

sion of CD14 was also detected, and even a small quan-tity of positive expression was located on the surface of hepatocytes. Slight intrahepatic expression of CD14 was observed in SH rats (0.0014 ± 0.0008), but after bile duct ligation, the expression of CD14 protein in OJ rats was significantly stronger (0.0156 ± 0.0021) (OJ vs SH, P < 0.01). The expression of CD 14 protein in liver tis-sues reduced in ID rats (0.0015 ± 0.001) compared with OJ rats (ID vs OJ, P < 0.01), but not reduced in ED rats (0.0086 ± 0.0019) (ED vs OJ, P = 0.591) (Figure 5).

Expression of CD14 mRNA by KCUnder the stimulation of LPS, the expression of CD14 mRNA by KC was not strengthened in OJ group (1.998 ± 0.74) compared with that in SH group (1.388 ± 0.683) (OJ vs SH, P = 0.822). After relieving the OJ, the expres-sion of CD14 mRNA was aggravated by ED (6.104 ± 2.171) (ED vs OJ, SH and ID, P < 0.01, respectively), but the expression of CD14 mRNA in ID group (1.018 ± 0.489) was not significantly different compared with that in SH and OJ groups (ID vs SH, P = 0.944; ID vs OJ, P = 0.513, respectively) (Figure 6).

Expression of TGR5 in rat liver tissuesTGR5 was mainly located in the plasma membrane of KCs, and in the cell wall of some sinusoidal endothelial cells and biliary epithelial cells. The expression of TGR5 protein in rat liver was significantly stronger in OJ group (0.513 ± 0.07) than in SH group (0.305 ± 0.01) (P = 0.001). ID could substantially down-regulate the expres-sion level of TGR5 protein (0.356 ± 0.051) (ID vs OJ, P = 0.001) and there was no difference between ID and SH groups (ID vs SH, P = 0.22). On the contrary, the ex-pression of TGR5 protein could not be inhibited by ED (0.439 ± 0.078) (ED vs OJ, P = 0.062) (Figure 7).

Expression of TGR5 mRNA by KCsThe expression of TGR5 mRNA by KCs was consider-ably stronger in OJ group (1.024 ± 0.325) (2-ΔΔCT) than in SH group (0.133 ± 0.045) (P = 0.001). There was no significant difference between ID group (0.320 ± 0.115) and SH group (P = 0.354). It was significantly stronger in ED group (0.632 ± 0.233) than in SH group (P = 0.001),

Rat

body

wei

ght

(g)

400

350

300

250

200

150 D1 D8 D15

b

c c

f

ff

SHOJIDED

A B

Rat

body

wei

ght

(g)

400

360

320

280

240

200 SH OJ ID ED

D1D8D15

gghh

Figure 1 Changes of rat body weight with time following operations among the four groups. A: Obstructive jaundice (OJ) rats ate markedly less food and there was a slowly increasing trend of body weight between the 1st, 8th and 15th day (P = 0.155). On the contrary, weight gain was more significant in sham operation (SH) rats compared with that in OJ rats on the 8th and 15th day. After relief of OJ, the appetite of internal biliary drainage (ID) rats recovered and the body weight of ID rats on the 15th day became significantly higher than that on the 8th day. bP < 0.01 vs OJ; cP < 0.05 vs SH; fP < 0.01 vs external biliary drainage (ED); B: Weight loss was observed in ED rats and the body weight on day 15 was significantly lower than that on the 1st or 8th day. gP < 0.05, hP < 0.01 vs D15.



and there was significant difference between ED and OJ group (P = 0.003) (Figure 8).

DISCUSSIONPatients with malignant or benign OJ carry an increased risk of postoperative complications and a high mortality

rate. Whether preoperative biliary drainage is still neces-sary for OJ patients planned for surgery is questioned by many experts[1,4]. Another debate focuses on whether ID is superior to ED in terms of reducing the postoperative mortality and some associated complications[5,6]. During the past decades, many clinical studies have been carried out to address the two controversies, but it is difficult to

Figure 2 Micrograph of liver sections from rats of sham operation, obstructive jaundice, internal and external biliary drainage groups (the pathological changes were marked by black arrows). A, B: There was almost no pathological changes in the liver of sham operation (SH) rats, the liver lobular architecture was intact; C, D: After bile duct ligation for 7 d, the liver showed focal necrosis and mild bile duct proliferation with acute inflammatory cell infiltration in the portal and peri-portal areas, but the lobular architecture was still intact in the cholestatic liver; E, F: After bile duct ligation for 14 d, the liver showed striking liver fibrosis and prominent bile duct proliferation in the portal tracts; G, H: Following 7 d of internal biliary drainage (ID), the liver displayed preserved lobular architecture with only mild bile duct proliferation, and the progression of liver fibrosis and cirrhosis stopped; I, J: After external biliary drainage (ED), lobular architecture was preserved with only mild bili-ary proliferation, but the degree of liver fibrosis was still at a high level. HE: Hematoxylin and eosin; OJ: Obstructive jaundice.

A B C

D E F

G H

J

I

SH, HE, ×100 SH, HE, ×200 OJ 7 d, HE, ×100

OJ 7 d, HE, ×200 OJ 14 d, HE, ×100 OJ 14 d, HE, ×200

ID, HE, ×100 ID, HE, ×200 ED, HE, ×100

ED, HE, ×200



A B

C D

SH, IHC, ×400 OJ, IHC, ×400

ID, IHC,×400 ED, IHC, ×400

E

Figure 3 Representative immunohistochemical analysis of inducible nitric oxide synthase in rat liver of sham operation, obstructive jaundice, internal and external biliary drainage groups. A: There was rare expression of inducible nitric oxide synthase (iNOS) in sham operation (SH) group; B: 14 d after bile duct ligation, the iNOS-immunoreactivity became stronger as compared with SH group; C: After relief of obstructive jaundice (OJ) by internal biliary drainage (ID), the expression of iNOS was markedly suppressed; D: The expression of iNOS obviously increased in rat liver of external biliary drainage (ED); E: Comparison of mean absorbance values of iNOS in rat liver tissues among the four groups. IHC: Immunohistochemical.

Mea

n ab

sorb

ance

val

ues

of iN

OS

0.5

0.4

0.3

0.2

0.1

0.0

P = 0.004P < 0.01

P < 0.01

OJ ED ID SH

iNOS mRNA

β-actin

500 bp

100 bp

500 bp

100 bp

M ID SH ED OJ

A

B

iNO

S m

RN

A/β-

actin

mRN

A

C 1.2

1.0

0.8

0.6

0.4

0.2

0.0 OJ ED ID SH

LPS LPS + UDCA

Figure 4 Ethidium bromide-stained agarose gel of inducible nitric oxide synthase reverse transcription polymerase chain reaction products, expression of inducible nitric oxide synthase messenger RNA on Kupffer cell interfered with lipopolysaccharide + ursodeoxycholic acid. A: Lane M, 100 bp molecular marker. The 138 bp-inducible nitric oxide synthase (iNOS) band; B: The 300 bp-β-action products; C: Expression of iNOS messenger RNA (mRNA) interfered with lipopolysaccharide (LPS) as compared with LPS + ursodeoxycholic acid (UDCA). aP < 0.05, bP < 0.01 vs LPS + UDCA. M: Marker; ID: Internal biliary drainage; SH: Sham operation; ED: External biliary drainage; OJ: Obstructive jaundice.

bb

a

a





A B

C D

SH, IHC, ×400 OJ, IHC, ×400

ID, IHC,×400 ED, IHC, ×400

E

0.020

0.016

0.012

0.008

0.004

0.000Mea

n ab

sorb

ance

val

ues

of C

D14 P = 0.591

P < 0.01

P < 0.01

OJ ED ID SH

Figure 5 Representative immunohistochemical analysis of CD14 in rat liver tissues of sham operation, obstructive jaundice, internal and external biliary drainage groups. A: CD14-immunoreactivity was detected mainly in the membrane of Kupffer cell on the edge of liver sinusoid and portal areas. There was slight expression of CD14 in sham operation (SH) rats; B: 14 d after bile duct ligation, the CD14-immunoreactivity became stronger as compared to SH rats; C: After relief of obstructive jaundice (OJ) by internal biliary drainage (ID), the expression of CD14 was markedly suppressed; D: The expression of CD14 in external biliary drainage (ED) rats was still at a high level; E: Comparison of mean absorbance values of CD14 in liver tissues among the four groups. IHC: Immunohistochemical.

CD14 mRNA

β-actin

100 bp

500 bp

100 bp

500 bp

M ED OJ ID SH

A

B

Figure 6 Ethidium bromide-stained agarose gel of CD14 reverse transcription polymerase chain reaction products products. A: Lane M, 100 bp molecular marker. The 267 bp-CD14 band; B: The 300 bp-β-actin reverse transcription polymerase chain reaction products products; C: Comparison of CD14 messenger RNA (mRNA) expression by Kupffer cell interfered with lipopolysaccharide. CD14 mRNA levels were standardized using β-actin mRNA. M: Marker; ID: Internal biliary drain-age; SH: Sham operation; ED: External biliary drainage; OJ: Obstructive jaundice.

C

CD14

mRN

A/β-

actin

mRN

A

9876543210

OJ ED ID SH

P = 0.822

P < 0.01P = 0.513

P = 0.944

P < 0.01P < 0.01



reach a consensus. So we have performed a series of ex-perimental studies based on the immune function of KCs to present some preliminary perspectives about these questions[9,10,19].

In the present study, we observed that the expres-sion of iNOS protein was markedly enhanced 14 d after bile duct ligation, but rarely expressed in SH rat models, which was in agreement with the results observed in other previous studies[22,23]. Moreover, we found that ID could suppress the expression of iNOS while the expres-sion of iNOS protein was promoted by ED. Our earlier studies have confirmed that KCs from rats with OJ pro-duced large amounts of endotoxin-mediated NO[9]. ID was better than ED in reversing the distorted NO pro-duction by KCs based on the activities of iNOS mRNA

under the stimulation of LPS[10]. Altogether, these find-ings underlined that the production of NO in OJ rats could be induced by iNOS in both protein and mRNA levels, and ID was superior to ED in depressing the ex-pression of iNOS.

The major pathogenic role of LPS in the progression of OJ has been supported in previous studies[24,25]. LPS as a substantial component of the outer membrane of gram-negative bacteria, could stimulate the production of pro-inflammatory cytokines (e.g., TNF-α, IL-6) and other mediators (e.g., ROS, NO, iNOS) via CD14/toll-like receptor pathway[23,26,27]. CD14 as one of the most im-portant LPS recognition receptors is responsible for the activation of KCs by pathophysiological concentrations of LPS[12,13]. The data presented here show that the CD14

Figure 7 Representative immunohistochemical analysis of TGR5 in rat liver tissues of sham operation, obstructive jaundice, internal and external biliary drainage groups. TGR5-immunoreactivity was detected mainly in the plasma membrane of Kupffer cell and its intracellular compartments, and also localized in some sinusoidal endothelial cells and biliary epithelial cells, but merely in hepatocytes. A: There was slight expression of TGR5 in rats of sham operation (SH); B: After bile duct ligation, the TGR5-immunoreactivity became stronger as compared to SH rats; C: After relief of jaundice by internal biliary drainage (ID), the expression of TGR5 was markedly suppressed; D: The expression of TGR5 in external biliary drainage (ED) rats was still at a high level; E: Comparison of mean absorbance values of TGR5 in rat liver tissues among the four groups. OJ: Obstructive jaundice; IHC: Immunohistochemical.

A B

C D

SH, IHC, ×400 OJ, IHC, ×400

ID, IHC,×400 ED, IHC, ×400

E

Mea

n ab

sorb

ance

val

ues

of T

GR5 0.7

0.6

0.5

0.4

0.3

0.2

0.1

0.0

P = 0.001P = 0.001

P = 0.062P = 0.001

P = 0.018P = 0.220

OJ ED ID SH



protein expression in rat liver was substantially up-regu-lated in the OJ group compared with the SH group. After relieving the OJ by ID, the expression of CD14 protein in liver tissues was significantly reduced, but could not by ED. We investigated whether the induction of CD14 protein expression was correlated with the CD14 mRNA level, and found that the expression of CD14 mRNA by KC was not strengthened on OJ rats compared with SH rats, because the rat models receiving bile duct ligation for 14 d could develop severe fibrosis and cirrhosis in the liver, which influenced the isolation of KCs and the fol-lowing analysis for CD14 mRNA. ID could decrease the expression of CD14 mRNA in rats with OJ and regu-lated the sensibility of CD14 gene to endotoxin, but ED enhanced the expression of CD14 mRNA. In addition, our previous studies have already found that the levels of serum endotoxin, TNF-α and IL-6, the production of NO and the expression of iNOS by KCs were increased in OJ rats, and ID could entirely reverse the changes, but external drainage could not[9,10]. Taken together, our results indicated that the LPS receptor-CD14 on the membrane of KCs could play an important role in the immune suppression in OJ, and related to the effects of biliary drainage.

The essential difference between ID and ED may be associated with the re-establishment of enterohepatic circulation of bile acids. Although ED could partially re-cover damaged liver function, it could not set up normal enterohepatic circulation[19]. A large amount of bile lost through ED resulting in malabsorption of fat, loss of some immune substances as well as imbalance of water and electrolytes. Several studies have confirmed the im-munomodulatory function of bile acids, for instance, oral or intravenous administration of UDCA could re-duce endotoxin-related complications in OJ[14,15,28]. The anti-inflammatory effect of UDCA is attributed to the inhibition of the production of endotoxin induced pro-inflammatory mediators[20,21,29,30]. In the present study, we found that the expression level of iNOS mRNA by isolated KCs was lower under the stimulation with LPS +

UDCA compared with simple stimulation of LPS among the four groups. The consequence confirmed that UDCA had the suppressive effect on the endotoxin.

Recently, the bile acid receptor-TGR5 as a mem-ber of the G protein coupled receptors localized at the plasma membrane and internalized into the cytoplasm in response to its activation, has been identified as the first cell surface receptor for bile acids by two different groups respectively[16,17]. TGR5 is highly expressed in CD14 positive monocytes and macrophages[16-18]. KC as the CD14-positive and liver resident macrophages, has a higher expression level of TGR5 mRNA compared with other white blood cells[17]. Several studies have re-ported that bile acids could inhibit LPS-induced pro-inflammatory cytokine expression in KC via TGR5-dependent pathway[17,18]. The present study found that the immunoreactivity of TGR5 was mainly detected in the plasma membrane of KC and SEC, and also local-ized in some intracellular compartments, but merely in hepatocytes. There was slight expression of TGR5 in SH rats, but stronger expression in OJ rats. Keitel et al[31] have confirmed that TGR5 staining was not strong in SEC of OJ rats, so the high expression level of TGR5 in OJ rats was specific for KC. After relief of OJ, the TGR5-immunoreactivity could be reversed by ID, but not by ED. We also found that the induction of TGR5 protein expression was correlated with the expression level of TGR5 mRNA. Bile duct ligation could result in higher expression of TGR5 mRNA compared with sham opera-tion. Likewise, ID could down-regulate the expression of TGR5 mRNA, but ED could not. Keitel et al[18] demon-strated the direct link between the protein and gene ex-pression levels of TGR5 and the gene expression of pro-inflammatory cytokines by KCs. Based on our results, the variation of TGR5 was in accordance with the changes of serum endotoxin and pro-inflammatory cytokines among these four groups[9,10]. Altogether, activation of TGR5 in KC could prevent excessive cytokine produc-tion, thereby alleviating liver injury, which indicated that the ID was superior to ED in relief of OJ, and the mech-anism may be based on the regulation process of TGR5 in both protein and gene levels.

Besides the dysfunction of liver KC leading to the diminished clearance of endotoxin and the production of large amounts of pro-inflammatory cytokines, lack of bile acids in intestine through bile duct ligation could result in the disruption of the epithelial barrier, transloca-tion of bacteria and endotoxin across the mucosa into lymph nodes and remote organ systems, and sometimes could cause lethal endotoxemia[32]. Inagaki et al[33] have confirmed that the farnesoid X receptor (FXR), a nuclear receptor for bile acids, could induce genes involved in neuroprotection and inhibited bacterial overgrowth and mucosal injury in ileum caused by bile duct ligation. Bile acid receptors such as FXR and TGR5, mainly exerting in the lipid and cholesterol metabolism, are increasingly recognized as one of the new frontiers of immunology. These receptors expressed in liver and gut might play

Figure 8 Effect of biliary drainages on TGR5 messenger RNA expression by Kupffer cell (2-ΔΔCT). ID: Internal biliary drainage; SH: Sham operation; ED: External biliary drainage; OJ: Obstructive jaundice; KC: Kupffer cell; mRNA: Messenger RNA.

TGR5

mRN

A ex

pres

sion

by

KC (

2-ΔΔC

T )

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0.0

P = 0.001

P = 0.001

P = 0.001

P = 0.003

P = 0.026

P = 0.354

OJ ED ID SH



an important role in the reaction to inflammation in en-terohepatic tissues. Our study demonstrated that ID was superior to ED in relief of OJ, which might be based on the regulation process of TGR5 by KCs, further inves-tigations derived from intestinal macrophages are neces-sary to elucidate the immunoregulatory role of bile acid receptor.

In conclusion, we found that internal biliary drainage could reverse the raised expression of iNOS and CD14 in both protein and mRNA levels in obstructive jaundice rat models, but external drainage could not. In addition, UDCA could protect KCs from the endotoxin of LPS related to the down-regulation of iNOS mRNA expres-sion. The up-regulation of TGR5 in protein and gene levels in obstructive jaundice could play a protective role in alleviating the inflammatory reaction. The mechanism of internal biliary drainage superior to external drainage in relief of obstructive jaundice might be attributed to the regulatory function of activation of KCs and release of inflammatory mediators.

COMMENTSBackgroundTo date, there are still some controversies over whether and how to perform preoperative biliary drainage in patients with malignant or benign obstructive jaundice (OJ), even though the complication-related mortality rate is high for OJ patients followed by surgery. Research frontiersDuring the past decades, many clinical studies have been performed to ad-dress the two controversies, but it is difficult to reach a consensus. The authors performed a series of experimental studies based on the immune function of Kupffer cell (KC) in an attempt to offer some preliminary perspectives about these questions.Innovations and breakthroughsThe authors found that internal biliary drainage could reverse the raised expres-sion of inducible nitric oxide synthase (iNOS) and CD14 in both protein and messenger RNA levels in obstructive jaundice rat models, but external drainage could not. The mechanism of internal biliary drainage superior to external drain-age in relief of obstructive jaundice might be attributed to the regulatory function of activation of KC and release of inflammatory mediators.Peer reviewThis is an experimental study concerning superiority of internal biliary drain-age to external biliary drainage. Internal biliary drainage could reverse the high expression of iNOS, CD14, and TGR5 in rats with obstructive jaundice, but ex-ternal drainage could not. The mechanism might be attributed to the regulatory function of activation of KCs and release of inflammatory mediators. The manu-script itself is interesting and includes some new insights of biliary drainage.

REFERENCES1 van der Gaag NA, Rauws EA, van Eijck CH, Bruno MJ, van

der Harst E, Kubben FJ, Gerritsen JJ, Greve JW, Gerhards MF, de Hingh IH, Klinkenbijl JH, Nio CY, de Castro SM, Busch OR, van Gulik TM, Bossuyt PM, Gouma DJ. Preop-erative biliary drainage for cancer of the head of the pan-creas. N Engl J Med 2010; 362: 129-137 [PMID: 20071702 DOI: 10.1056/NEJMoa0903230]

2 Eshuis WJ, van der Gaag NA, Rauws EA, van Eijck CH, Bruno MJ, Kuipers EJ, Coene PP, Kubben FJ, Gerritsen JJ, Greve JW, Gerhards MF, de Hingh IH, Klinkenbijl JH, Nio CY, de Castro SM, Busch OR, van Gulik TM, Bossuyt PM, Gouma DJ. Therapeutic delay and survival after surgery for cancer of the pancreatic head with or without preopera-

tive biliary drainage. Ann Surg 2010; 252: 840-849 [PMID: 21037440 DOI: 10.1097/SLA.0b013e3181fd36a2]

3 Cho HC, Lee JK, Lee KH, Lee KT, Paik S, Choo SW, Do YS, Choo IW. Are endoscopic or percutaneous biliary drainage effective for obstructive jaundice caused by hepatocellular carcinoma? Eur J Gastroenterol Hepatol 2011; 23: 224-231 [PMID: 21228705 DOI: 10.1097/MEG.0b013e3283436ff6]

4 van der Gaag NA, Kloek JJ, de Castro SM, Busch OR, van Gulik TM, Gouma DJ. Preoperative biliary drainage in pa-tients with obstructive jaundice: history and current status. J Gastrointest Surg 2009; 13: 814-820 [PMID: 18726134 DOI: 10.1007/s11605-008-0618-4]

5 Kawakami H, Kuwatani M, Onodera M, Haba S, Eto K, Ehira N, Yamato H, Kudo T, Tanaka E, Hirano S, Kondo S, Asaka M. Endoscopic nasobiliary drainage is the most suitable preoperative biliary drainage method in the man-agement of patients with hilar cholangiocarcinoma. J Gas-troenterol 2011; 46: 242-248 [PMID: 20700608 DOI: 10.1007/s00535-010-0298-1]

6 Mok KT, Wang BW, Chang HC, Lin SL. External biliary drainage plus bile acid feeding is not equal to internal drainage in preserving the cellular immunity following pro-longed obstructive jaundice. Dig Dis Sci 2001; 46: 1864-1870 [PMID: 11575437]

7 Kamiya S, Nagino M, Kanazawa H, Komatsu S, Mayumi T, Takagi K, Asahara T, Nomoto K, Tanaka R, Nimura Y. The value of bile replacement during external biliary drainage: an analysis of intestinal permeability, integrity, and micro-flora. Ann Surg 2004; 239: 510-517 [PMID: 15024312]

8 Mizuguchi K, Ajiki T, Onoyama H, Tomita M, Kuroda Y. Short-term effects of external and internal biliary drainage on liver and cellular immunity in experimental obstruc-tive jaundice. J Hepatobiliary Pancreat Surg 2004; 11: 176-180 [PMID: 15235890 DOI: 10.1007/s00534-003-0886-z]

9 Li W, Chan AC, Lau JY, Lee DW, Ng EK, Sung JJ, Chung SC. Superoxide and nitric oxide production by Kupffer cells in rats with obstructive jaundice: effect of internal and exter-nal drainage. J Gastroenterol Hepatol 2004; 19: 160-165 [PMID: 14731125]

10 Meng Y, Gong YC, Dou Y, Li W. Changes of serum cy-tokines and expression of inducible nitric oxide synthase mRNA by Kupffer cells after relief from obstructive jaun-dice in rats. J Gastroenterol Hepatol 2009; 24: 1064-1069 [PMID: 19220682 DOI: 10.1111/j.1440-1746.2008.05746.x]

11 Gong JP, Wu CX, Liu CA, Li SW, Shi YJ, Yang K, Li Y, Li XH. Intestinal damage mediated by Kupffer cells in rats with endotoxemia. World J Gastroenterol 2002; 8: 923-927 [PMID: 12378643]

12 Su GL, Goyert SM, Fan MH, Aminlari A, Gong KQ, Klein RD, Myc A, Alarcon WH, Steinstraesser L, Remick DG, Wang SC. Activation of human and mouse Kupffer cells by lipopolysaccharide is mediated by CD14. Am J Physiol Gas-trointest Liver Physiol 2002; 283: G640-G645 [PMID: 12181178 DOI: 10.1152/ajpgi.00253.2001]

13 Dobrovolskaia MA, Vogel SN. Toll receptors, CD14, and macrophage activation and deactivation by LPS. Microbes Infect 2002; 4: 903-914 [PMID: 12106783]

14 Cahill CJ. Prevention of postoperative renal failure in pa-tients with obstructive jaundice--the role of bile salts. Br J Surg 1983; 70: 590-595 [PMID: 6626919]

15 Pain JA, Bailey ME. Prevention of endotoxaemia in obstruc-tive jaundice--a comparative study of bile salts. HPB Surg 1988; 1: 21-27 [PMID: 3153772]

16 Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, Fukusumi S, Habata Y, Itoh T, Shintani Y, Hinuma S, Fujisawa Y, Fujino M. A G protein-coupled receptor re-sponsive to bile acids. J Biol Chem 2003; 278: 9435-9440 [PMID: 12524422 DOI: 10.1074/jbc.M209706200]

17 Maruyama T, Miyamoto Y, Nakamura T, Tamai Y, Okada H, Sugiyama E, Nakamura T, Itadani H, Tanaka K. Identi-

COMMENTS



fication of membrane-type receptor for bile acids (M-BAR). Biochem Biophys Res Commun 2002; 298: 714-719 [PMID: 12419312]

18 Keitel V, Donner M, Winandy S, Kubitz R, Häussinger D. Expression and function of the bile acid receptor TGR5 in Kupffer cells. Biochem Biophys Res Commun 2008; 372: 78-84 [PMID: 18468513 DOI: 10.1016/j.bbrc.2008.04.171]

19 Li W, Chung SC. An improved rat model of obstructive jaundice and its reversal by internal and external drainage. J Surg Res 2001; 101: 4-15 [PMID: 11676548 DOI: 10.1006/jsre.2001.6240]

20 Invernizzi P, Salzman AL, Szabó C, Ueta I, O’Connor M, Setchell KD. Ursodeoxycholate inhibits induction of NOS in human intestinal epithelial cells and in vivo. Am J Physiol 1997; 273: G131-G138 [PMID: 9252519]

21 Ma J, Nakajima T, Iida H, Iwasawa K, Terasawa K, Oonuma H, Jo T, Morita T, Imuta H, Suzuki Ji, Hirose K, Okuda Y, Yamada N, Nagai R, Omata M. Inhibitory effects of urso-deoxycholic acid on the induction of nitric oxide synthase in vascular smooth muscle cells. Eur J Pharmacol 2003; 464: 79-86 [PMID: 12620498]

22 Arriero MM, López-Farré A, Fryeiro O, Rodríguez-Feo JA, Velasco S, García-Durán M, Fortes J, De La Pinta JC, Muñoz LE, Celdrán A. Expression of inducible nitric oxide synthase in the liver of bile duct-ligated Wistar rats with modulation by lymphomononuclear cells. Surgery 2001; 129: 255-266 [PMID: 11231453]

23 Cağlikülekci M, Pata C, Apa DD, Dirlik M, Tamer L, Yay-lak F, Kanik A, Aydin S. The effect of N-acetylcysteine (NAC) on liver and renal tissue inducible nitric oxide synthase (iNOS) and tissue lipid peroxidation in obstructive jaundice stimulated by lipopolysaccharide (LPS). Pharmacol Res 2004; 49: 227-238 [PMID: 14726217]

24 Assimakopoulos SF, Scopa CD, Zervoudakis G, Mylonas PG, Georgiou C, Nikolopoulou V, Vagianos CE. Bombesin and neurotensin reduce endotoxemia, intestinal oxidative stress, and apoptosis in experimental obstructive jaundice. Ann Surg 2005; 241: 159-167 [PMID: 15622004]

25 Yorganci K, Baykal A, Kologlu M, Saribaş Z, Hascelik G, Sayek I. Endotoxin challenge causes a proinflammatory state in obstructive jaundice. J Invest Surg 2004; 17: 119-126 [PMID: 15204955 DOI: 10.1080/08941930490446892]

26 Bemelmans MH, Gouma DJ, Greve JW, Buurman WA. Cytokines tumor necrosis factor and interleukin-6 in ex-perimental biliary obstruction in mice. Hepatology 1992; 15: 1132-1136 [PMID: 1592352]

27 Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000; 406: 782-787 [PMID: 10963608 DOI: 10.1038/35021228]

28 Hori Y, Ohyanagi H. Protective effect of the intravenous ad-ministration of ursodeoxycholic acid against endotoxemia in rats with obstructive jaundice. Surg Today 1997; 27: 140-144 [PMID: 9017991]

29 Greve JW, Gouma DJ, Buurman WA. Bile acids inhibit en-dotoxin-induced release of tumor necrosis factor by mono-cytes: an in vitro study. Hepatology 1989; 10: 454-458 [PMID: 2777206]

30 Yoshikawa M, Tsujii T, Matsumura K, Yamao J, Matsumura Y, Kubo R, Fukui H, Ishizaka S. Immunomodulatory effects of ursodeoxycholic acid on immune responses. Hepatology 1992; 16: 358-364 [PMID: 1639344]

31 Keitel V, Reinehr R, Gatsios P, Rupprecht C, Görg B, Sel-bach O, Häussinger D, Kubitz R. The G-protein coupled bile salt receptor TGR5 is expressed in liver sinusoidal endothe-lial cells. Hepatology 2007; 45: 695-704 [PMID: 17326144 DOI: 10.1002/hep.21458]

32 Ding JW, Andersson R, Soltesz V, Willén R, Bengmark S. The role of bile and bile acids in bacterial translocation in obstructive jaundice in rats. Eur Surg Res 1993; 25: 11-19 [PMID: 8482301]

33 Inagaki T, Moschetta A, Lee YK, Peng L, Zhao G, Downes M, Yu RT, Shelton JM, Richardson JA, Repa JJ, Mangelsdorf DJ, Kliewer SA. Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor. Proc Natl Acad Sci USA 2006; 103: 3920-3925 [PMID: 16473946 DOI: 10.1073/pnas.0509592103]

P- Reviewers Endo I, Kumar A S- Editor Gou SX L- Editor Ma JY E- Editor Li JY


Special AT-rich sequence-binding protein 1 promotes cell growth and metastasis in colorectal cancer

Xue-Feng Fang, Zhi-Bo Hou, Xin-Zheng Dai, Cong Chen, Jing Ge, Hong Shen, Xiao-Feng Li, Li-Ke Yu, Ying Yuan

Xue-Feng Fang, Hong Shen, Xiao-Fang Li, Ying Yuan, De-partment of Medical Oncology, Second Affiliated Hospital, Zheji-ang University College of Medicine, Hangzhou 310000, Zhejiang Province, China Zhi-Bo Hou, Li-Ke Yu, First Department of Respiratory Medi-cine, Nanjing Chest Hospital, Nanjing 210029, Jiangsu Province, ChinaXin-Zheng Dai, Liver Transplantation Center, First Affiliated Hospital of Nanjing Medical University, Key Laboratory of Liv-ing Donor Liver Transplantation, Ministry of Public Health, Nan-jing 210029, Jiangsu Province, ChinaCong Chen, Department of Gynecology of Traditional Chinese Medicine, Jiangsu Provincial Hospital of Traditional Chinese Medicine Affiliated to Nanjing University of Traditional Chinese Medicine, Nanjing 210029, Jiangsu Province, China Jing Ge, Department of Endocrinology, Jiangsu Provincial Hospital of Traditional Chinese Medicine Affiliated to Nanjing University of Traditional Chinese Medicine, Nanjing 210029, Jiangsu Province, ChinaAuthor contributions: Fang XF, Hou ZB and Dai XZ contrib-uted equally to this work; Hou ZB, Dai XZ and Chen C carried out the molecular genetic studies; Chen C, Ge J and Li XF par-ticipated in the animal study; Hou ZB, Chen C and Ge J analyzed final data; Fang XF, Hou ZB and Shen H drafted the manuscript; Yuan Y designed this research; all authors read and approved the final manuscript.Supported by The National Natural Science Foundation of China, No. 81101580Correspondence to: Dr. Ying Yuan, Department of Medical Oncology, Second Affiliated Hospital, Zhejiang University Col-lege of Medicine, 88 Jiefang Road, Hangzhou 310000, Zhejiang Province, China. [email protected]: +86-571-87784795 Fax: +86-571-87767088Received: December 2, 2012 Revised: January 13, 2013Accepted: February 2, 2013Published online: April 21, 2013

AbstractAIM: To evaluate the expression of special AT-rich sequence-binding protein 1 (SATB1) gene in colorectal cancer and its role in colorectal cancer cell proliferation and invasion.

METHODS: Immunohistochemistry was used to detect the protein expression of SATB1 in 30 colorectal cancer (CRC) tissue samples and pair-matched adjacent non-tumor samples. Cell growth was investigated after en-hancing expression of SATB1. Wound-healing assay and Transwell assay were used to investigate the impact of SATB1 on migratory and invasive abilities of SW480 cells in vitro . Nude mice that received subcutaneous implantation or lateral tail vein were used to study the effects of SATB1 on tumor growth or metastasis in vivo .

RESULTS: SATB1 was over-expressed in CRC tissues and CRC cell lines. SATB1 promotes cell proliferation and cell cycle progression in CRC SW480 cells. SATB1 overex-pression could promote cell growth in vivo . In addition, SATB1 could significantly raise the ability of cell migration and invasion in vitro and promote the ability of tumor metastasis in vivo. SATB1 could up-regulate matrix me-talloproteases 2, 9, cyclin D1 and vimentin, meanwhile SATB1 could down-regulate E-cadherin in CRC.

CONCLUSION: SATB1 acts as a potential growth and metastasis promoter in CRC. SATB1 may be useful as a therapeutic target for CRC.


Key words: Special AT-rich sequence-binding protein 1; Colorectal cancer; Proliferation; Migration; Invasion

Fang XF, Hou ZB, Dai XZ, Chen C, Ge J, Shen H, Li XF, Yu LK, Yuan Y. Special AT-rich sequence-binding protein 1 promotes cell growth and metastasis in colorectal cancer. World J Gastroenterol 2013; 19(15): 2331-2339 Available from: URL: http://www.wjg-net.com/1007-9327/full/v19/i15/2331.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2331

INTRODUCTIONThe special AT-rich sequence-binding protein 1 (SATB1),

ORIGINAL ARTICLE





which locates at human chromosome 3p23, is a thymo-cyte-specific matrix association region-binding protein that links specific DNA elements to its unique cage-like network[1]. Phosphorylation of SATB1 serves as a molecular switch in determining whether it acts as a transcriptional activator or repressor[2]. SATB1 is pre-dominantly expressed in thymocytes and regulates the spatiotemporal expression of numerous genes that involved in T cell proliferation, development, and dif-ferentiation[3]. SATB1 has recently attracted considerable attention in cancer research and its overexpression is a frequent event in various cancers, such as breast cancer, laryngeal cancer, gastric cancer and liver cancer[4-9]. Fur-thermore, accumulating evidence showed that SATB1 is also associated with tumor growth and metastasis[4-6,8-10]. Han et al[5] found that SATB1 up-regulated the expression of matrix metalloproteases (MMP)2, MMP9 and down-regulated E-cadherin in breast cancer. On the other hand, SATB1 depletion blocks the up-regulation of E-cadherin and extracellular matrix (ECM) protein vimentin. Meng et al[11] showed that SATB1 plays a pivotal role in epithelial to mesenchymal transition (EMT) process and promotes liver cancer invasion. Only one study suggested that SATB1 is over-expressed in human rectal cancer and the expression of SATB1 is associated with clinicopathologi-cal parameters, including invasive depth and tumor-node-metastasis (TNM) stage in rectal cancer. Despite its im-portance, the roles and mechanisms of SATB1 in growth and metastasis of human colorectal cancer (CRC) remain poorly understood.

CRC is the third most common malignancy and the fourth cause of cancer mortality in the world[12-14]. Although novel molecule-based therapies including monoclonal antibodies are currently widely used in the treatment of CRC, many patients with CRC still die from disease recurrence and metastasis[15,16]. Consequently, fur-ther elucidation of the molecular mechanisms of CRC will be beneficial for developing novel therapeutic strate-gies to conquer this disease.

In this study, we analyzed the expression of SATB1 in CRC tissues and found that it was over-expressed in the cancerous tissue samples compared with the normal adja-cent tissue samples. We also carried out in vitro and in vivo functional analysis of SATB1 by ectopical SATB1 expres-sion in SW480 CRC cells. Further investigations focused on the regulation of SATB1 in potential downstream molecules MMPs (MMP2, MMP9), cyclin D1 (CCND1), E-cadherin and vimentin.

MATERIALS AND METHODSCell lines and plasmidsHuman CRC cell lines SW480, SW620, RKO, HT29, HCT116 and Lovo were obtained from Shanghai Insti-tute of Cell Biology (Shanghai, China) and were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, United States), supplemented with 10% fetal bovine serum. The pcDNA3.1 (Invitrogen, Carlsbad, CA, United States)

was used to construct a SATB1 over-expressing plasmid. DNA fragment with mature SATB1 or a negative control sequence was inserted to this vector. Stable transfection of the plasmids was carried out using Lipofectamine2000 (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instruction.

Immunohistochemistry and immunoblot analysisParaffin-embedded tumors and paired normal tissue samples were obtained from 30 CRC patients with the approval from the Ethics Committee of the Second Hos-pital of Zhejiang University Medical College. Immuno-histochemical (IHC) analyses were performed on 3-μm, formalin-fixed and paraffin-embedded sections. Primary antibodies for SATB1 were diluted at 1:250 (BD Biosci-ences, California, United States) for IHC[17,18]. For im-munoblot analysis, 20 g total cellular protein was loaded per lane, separated by 4%-12% SDS-polyacrylamide gel electrophoresis, and then transferred to nitrocellulose (Invitrogen, Carlsbad, CA, United States) by electroblot-ting. The membranes were incubated with either SATB1 antibody (diluted 1:1000; BD Biosciences, California, United States) or α-tubulin antibody (diluted 1:200; Santa Cruz Biotechnology) at 4 ℃ overnight[19].

Cell proliferation assay and colony formation assayCell proliferation assay was determined by standard 3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assays. Briefly, the cells were seeded at a density of 2 × 103 cells per well in 96-well culture plates (Costar). Cell proliferation was assessed 24, 48 and 72 h later. One-tenth volume of 5 mg/mL MTT was added to each well, and the plate was further incubated at 37 ℃ for another 4 h; thereafter, the medium was replaced and the formazan crystals formed were dissolved in 150 μL dimethyl suophoxide with oscillation for 10 min. The optical density was determined with a multiwell spec-trophotometer (BioTek, VT, United States) at 570 nm. Absorbance values were presented as percentages relative to untreated controls. The MTT assays were repeated at least three times[20]. For colony formation assay, cells were trypsinized and counted. One hundred cells were seeded in six-well plates. After 2 wk of growth, colonies with a diameter greater than 4 mm were counted. Experiments were performed in quadruplicate[21].

Scratch wound healing assayScratch wound healing assay was performed as previously described. Briefly, transfected cells in 6-well plates were cultured until cells reached confluence and starved over-night. Cell layers were wounded using a 200 μL pipette tip and cultured for another 48 h. Photographs were taken at time 0, 48 and 72 h[22].

Cell migration and invasion assayA transwell cell migration and Matrigel invasion assay was used to investigate the impact of SATB1 on migratory and invasive ability of SW480 cells. For migration detec-


Fang XF et al . Role of SATB1 in CRC

tion, transfected cells were placed in transwell Chamber at 2 × 104 cells/well. The lower transwell chamber contained 10% fetal bovine serum for use as a chemoattractant. For invasion assay, the bottom of the culture inserts (8-mm pores) were coated with 30 μL of the mixture containing serum-free RPMI-1640 and Matrigel (1:8; BD Biosciences, Bedford, MA, United States). The Matrigel was allowed to solidify at 37 ℃ overnight. After solidification, cells (2 × 104 cells/well) were reseeded onto the upper chamber. Twenty-four hours later, the cells that had migrated or in-vaded through the membrane were fixed with 95% alcohol and stained with crystal violet. The number of migrated cells or invaded cells was quantified by counting 5 inde-pendent symmetrical visual fields under microscope[23].

Xenograft studiesCells of 2 × 104 were harvested, washed and resuspended in 200 mL phosphate-buffered saline, and was subcuta-neously injected into the flanks of 5-wk-old female nude mice. Animal experimental procedures were performed strictly in accordance with the related ethics regulations of our university. Tumor sizes were measured in two di-mensions with calipers every week. Tumor volumes (mm3) were calculated using the following formula: V = (length × width2)/2[24]. For in vivo metastasis assays, SW480-SATB1 cells or SW480-negtive control (SW480-NC) cells were transplanted into nude mice (5-wk-old BALB/c-nu/nu, ten per group, 1 × 106 cells for each mice) through the lateral tail vein. Mice were killed after 10 wk. The lungs were dissected and subjected to hematoxylin and eosin staining. The numbers of metastases in the lungs were examined histologically.

Real-time polymerase chain reaction analysisTotal RNA was extracted from cells expressing SATB1 and negative control cells with Trizol (Invitrogen, Carlsbad, CA, United States). The expression of CCND1, E-cadherin, vimentin, MMP2 and MMP9 was detected by quantitative real-time polymerase chain reaction (PCR). The primers are as follows: CCND1, the forward primer 5’-TATT-GCGCTGCTACCGTTGA-3’ and the reverse primer 5’-CCAATAGCAGCAAACAATGTGAAA-3’; MMP2, the forward primer TCTTCAAGGACCGGTTCATTTG and the reverse primer GATGCTTCCAAACTTCAC-GCTC; MMP9, the forward primer CACTGTC-CACCCCTCAGAGC and the reverse primer GCCACTT-GTCGGCGATAAGG; E-cadherin, the forward primer 5’-TGCCCAGAAAATGAAAAAGG-3’ and the reverse primer 5’-GTGTATGTGGCAATGCGTTC-3’; Vimentin, the forward primer 5’-TGGCCGACGCCATCAACACC-3’ and the reverse primer 5’-CACCTCGACGCGGGCTTT-GT-3’; β-actin was used as an internal control. The primers for β-actin were 5’-TGACGGGGTCACCCACACTGT-GCCCATCT-3’ and 5’-GAAGTAGTAAGTGGGAACC-GTGT-3’. Real-time PCR was performed using the SYBR® Green (Invitrogen) dye detection method on ABI PRISM 7900 HT Sequence Detection System under default con-ditions: 95 ℃ for 10 min, and 35 cycles of 95 ℃ for 15 s

and 55 ℃ for 1 min. Comparative Ct method was used for quantification of the transcripts[25].

Statistical analysisEach experiment was repeated at least 3 times. All results were expressed as mean ± SD. The difference between means was analyzed with Student’s t test or the χ 2 test. All statistical analysis were performed using SPSS 16.0 software (Chicago, IL, United States). Differences were considered significant when P < 0.05[26].

RESULTSExpression of SATB1 increased in CRC tissue samplesTo assess the role of SATB1 in CRC, we examined the protein expression of SATB1 in 30 human CRC tissue samples and pair-matched adjacent non-tumor tissue samples by IHC. We observed positive immunoreactivi-ties in CRC in 53% (16 of 30) of cancer tissue samples, compared with only 10% (3 of 30) in the adjacent mu-cosa tissue cells. The representative examples of IHC staining results are shown in Figure 1A. Statistical analysis using Pearson χ 2 (df = 1, two-sided) indicates that the difference in SATB1 expression between cancer and ad-jacent tissues was significant (P < 0.01) (Table 1). West-ern blot analysis of SATB1 in established CRC cell lines showed that the expression level of SATB1 in SW620 was higher in the SW480 (Figure 1B). SW480 and SW620 were a matched pair of primary and metastatic popula-tion of cells from the same patient[27]. SW620 cells were derived from the metastasis lymph node of Dukes’ type C colorectal adenocarcinoma.

SATB1 expression promotes CRC cell proliferation in vitroIn order to investigate the role of SATB1 in CRC car-cinogenesis, we tested the effect of SATB1 on the pro-liferation of SW480 cells. We established stable SATB1 expressing CRC cells. As shown in Figure 2A, SATB1 levels were higher in cells stably expressing SATB1 than the negative control cells. MTT assay showed that intro-duction of SATB1 caused a remarkable promotion of cell proliferation in SW480 cells (P < 0.05; Figure 2B). Furthermore, expression of SATB1 in SW480 cells sig-nificantly enhanced the numbers of colony formation. As shown in Figure 2C, the colony number for the negative control cells was 55.3 ± 5.0, while that for the SATB1 overexpression was 23.7 ± 3.2 (P = 0.018). To clarify the mechanisms underlying growth promotion by SATB1 in CRC cell lines, we performed cell-cycle analysis using flow cytometry on the cells stained with propidium io-dide. SW480-SATB1 cells showed a higher proportion of cells in S phase (17.59%), compared with the control cells (13.02% for SW480-NC cells) (Figure 2D).

SATB1 promotes tumorigenesis potential in vivo In order to assess the role of SATB1 on CRC tumorigen-esis in vivo , equal numbers of SW480-SATB1 cells and




the effects of SATB1 on the migration and invasion of SW480 cells using a Transwell cell migration and Matrigel invasion assay. The data demonstrated that the overex-pression of SATB1 markedly promoted the migration and invasion of SW480 cells. The number of SW480-SATB1 cells (307 ± 20, P < 0.0001) that had migrated through the membrane without Matrigel was significantly higher than that of SW480-NC cells (104 ± 20) (Figure 3B). A simi-lar result was found with the invaded cells; the number of SW480-SATB1 cells (237 ± 19, P < 0.0001) passing through the Matrigel was significantly higher than that of SW480-NC cells (82 ± 10) (Figure 3B). To further explore the effects of SATB1 on tumor metastasis in vivo, SW480-SATB1 cells or SW480-NC cells were transplanted into nude mice through the lateral tail vein. Histological analy-sis of the lung of mice confirmed that SATB1 could promote lung metastasis formation. Lung metastasis of SW480 cells was apparent in mice injected with SW480-SATB1 cells (Figure 3C). In contrast, few metastatic tumors were detected in mice injected with SW480-NC cells (Figure 3C). Our results indicate that SATB1 could promote CRC cell metastasis in vivo.

SW480-NC cells were implanted onto flanks of 5-wk-old female nude mice, and the growth of the implanted tumors was measured at weeks 1-4. The results indicated that SW480 cells with enhanced SATB1 expression could promote the growth of subcutaneous tumors (Figure 2E) (P < 0.01).

SATB1 promotes CRC cell migration and invasion in vitro and in vivo Wound-healing assay was performed to examine the ef-fect of SATB1 expression on cell migration. We found that SW480-SATB1 cells healed the scratch wound earlier than negative controls cells (Figure 3A). We also estimated

A

B

CRC Normal rectal tissues

SW480 SW620 RKO HT29 HCT116 LoVo

SATB1

α-tubulin

Figure 1 Upregulation of special AT-rich sequence-binding protein 1 in human colorectal cancer. A: Immunostaining for SATB1 protein in tissue of carcinomas and adjacent normal tissue mucosa. Top: Representative pictures of carcinomas (left) and normal tissue (right); B: Western blot detection of SATB1 protein in different colorectal cancer cell lines. SATB1: Special AT-rich sequence-binding protein 1; CRC: Colorectal cancer.

Cancer tissues Normal tissues

Total number of samples 30 30 Samples with SATB1 expression in nucleus

16 3

Table 1 Summary of the immunohistochemistry findings

SATB1: Special AT-rich sequence-binding protein 1.



SATB1 induces proliferation and metastasis related gene expression change in SW480 cells We detected the potential downstream molecules regulated by SATB1 via real-time PCR analysis to probe into the possible mechanism that SATB1 promotes CRC cell pro-liferation and metastasis. The results showed that the ex-

pression of CCND1 was up-regulated in SW480 cells with enhanced SATB1 expression. We also found that MMP2 and MMP9, the major MMPs that have a key role in the proteolytic cascade-leading ECM cleavage during metas-tasis in colon carcinoma, were up-regulated in SW480-SATB1 cells (Figure 3D). In addition, the expression of

SATB1

α-tubulin

A

SW480-NC SW480-SATB1

B SW480-SATB1

SW480-NC

24 48 72 96 h

1.0

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0.0

Abso

rban

ce b

b

C

SW480-SATB1 SW480-NC

P = 0.018880

60

40

20

0Co

lony

num

bers

0 30 60 90 120 150 Channels (FL2-A)

SW480-SATB1S phase: 17.59%

320

240

160

80

0

Num

ber

DebrisAggregatesDip G1Dip G2Dip S

0 60 90 120 150 Channels (FL2-A)

SW480-NCS phase: 13.02%

500

400

300

200

100

0

Num

ber

DebrisAggregatesDip G1Dip G2Dip S

E

D

SW480-SATB1

SW480-NC

1 2 3 4 Time after inoculation of cells (wk)

1800

1600

1400

1200

1000

800

600

400

200

0

Tum

or v

olum

e (m

m3 )

Figure 2 Special AT-rich sequence-binding protein 1 promotes cell growth and in vivo tumorigenesis potential in SW480 cells. A: Western blot analysis of special AT-rich sequence-binding protein 1 (SATB1) protein expression in colorectal cancer (CRC) cells that stably expressing SATB1 and SW480 negative control (NC) cells; B: Effect of SATB1 overexpression on cell proliferation by 3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay. bP < 0.01 vs NC cells; C: Colony formation assays for SW480-SATB1 cells and NC cells. Data are representatives of three independent experiments; D: Growth rates of SW480-SATB1 cells and negative control cells in an in vivo mouse model. Volumes of tumors were monitored every week. Bottom: Representative pictures of tumor samples. bP < 0.01 vs NC cells.

b

b



SW48

0-N

CSW

480-

SATB

1

0 h late 48 h late 72 h lateA

B


Mig

ratio

nIn

vasi

on


P < 0.0001400

300

200

100

0

Cell

num

bers


P < 0.0001300

200

100

0

Cell

num

bers

C


D

E-cadherin Vimentin CCND1 MMP2 MMP3

7

6

5

4

3

2

1

0Nor

mal

ized

rel

ativ

e ex

pres

sion

leve

ls SW480-controlSW480-SATB1

Figure 3 Special AT-rich sequence-binding protein 1 promotes migratory property of SW480 cell in vitro and in vivo metastasis potential. A: A wound-healing assay of SW480-special AT-rich sequence-binding protein 1 (SATB1) cells and negative control (NC) cells. Photographs were taken at the time of 0, 48 and 72 h. Representative photos from one of three replicate experiments are shown (40× original magnification); B: Representative photo-micrographs of Transwell results for SW480-SATB1 cells and NC cells were taken (40× original magnification). The number of SW480-SATB1 cells passing through the membrane with or without Matrigel was significantly lower than that of NCs; C: Representative hematoxylin and eosin stained sections of the lung tissues isolated from mice implanted with SW480-SATB1 cells and NC cells through the lateral tail vein. The data shown are the number of lung metastases from each group; D: A bar chart showing downstream mol-ecules regulated by SATB1 using real-time polymerase chain reaction in SW480-SATB1 cells and NC cells. MMP: Matrix metalloproteases; CCND1: Cyclin D1.



EMT related gene vimentin was increased and E-cadherin was decreased in SW480-SATB1 cells (Figure 3D).

DISCUSSIONPrevious studies have suggested the important role of SATB1 in tumor growth and metastasis. But there have been few researches on the relationship between SATB1 and CRC. More recently, Meng et al[11] reported that high level of SATB1 expression was closely correlated with invasive depth and TNM stage in 93 paired samples of human rectal cancer. However, the effects of SATB1 on CRC remain poorly understood. In this study, we showed that overexpression of SATB1 in CRC tissue samples and cell lines could promote cell growth in vitro and in vivo. In addition, SATB1 could significantly increase the ability of cell migration and invasion in vitro and promote the ability of tumor metastasis in vivo. We further showed that SATB1 could up-regulate MMPs 2, 9 and vimentin, meanwhile SATB1 could down-regulate E-cadherin in CRC. The data from the current study suggested that SATB1 acts as a potential growth and metastasis pro-moter in CRC.

Immunohistochemical results showed that the SATB1 protein was overexpressed in CRC tissues and was lo-calized in the nuclei of cancer cells. We also found that SATB1 was overexpressed in cell lines derived from CRC. Our finding is consistent with a recent report showing that the expression of SATB1 was increased in rectal can-cer and cell lines[11]. These data prompted us to analyze the functional effects of SATB1 in CRC cells. We found that SATB1 promotes cell proliferation and cell cycle progression in CRC SW480 cells. In addition, SATB1 ex-pression could promote cell growth in vivo. These results suggested that SATB1 may play a tumor promoter role in CRC carcinogenesis.

Invasion and metastasis are the most influential fac-tors for clinical outcome of CRC. Recent studies have shown that SATB1 contributes to tumor metastasis in many types of tumors, such as breast cancer, gastric can-cer, and liver cancer[5,7-9]. Up to date, there was only one report about SATB1 expression and clinical feature in rectal cancer which found that high levels of SATB1 ex-pression were closely correlated with invasive depth and TNM stage in human rectal cancer samples[11]. This re-port suggested that SATB1 may facilitate CRC metastasis. In this study, we found that ectopical SATB1 expression endows the non-aggressive SW480 cells with a capability of migration and invasion in vitro and metastasis in vivo. So we consider that SATB1 may play a crucial role in promoting cancer invasion and metastasis in CRC.

MMP2 and 9, which degrade ECM and promote tu-mor invasion[28,29], were up-regulated in the SW480-SATB1 cells that ectopically expressed SATB1. We also found up-regulation of vimentin and down-regulation of E-cadherin in mRNA level in the SW480-SATB1 cells. As a genome organizer, SATB1 recruits chromatin remodeling factors and regulates the spatiotemporal expression of numer-

ous genes involving tumor growth and metastasis. SATB1 has been found to promote breast tumor metastasis and reprograms the genome to change the expression profiles consistent with invasive tumors[5]. MMP2 and MMP9 are gelatinases that belong to multigene family of proteolytic enzymes[30]. MMP2 and MMP9 are capable of degrading essentially all the ECM components and the basal mem-brane, both of which play an crucial role in preventing the migration of cancer cells[31]. In this sense, MMP2 and MMP9 play an important role in the proteolytic cascade-leading ECM degradation during metastasis in colon carci-noma[32,33]. E-cadherin is an adherent junction protein and tumor suppressor. Low E-cadherin and high vimentin are traditional markers currently accustomed to discern cells that have undergone a EMT process[34]. EMT is a process that epithelial cells lose polarity, cell-to-cell contacts, and cytoskeletal integrity contributing to the dissemination of carcinoma cells from epithelial tumors[35,36]. EMT is thought to be responsible for seeding distant dissemina-tion, eventually leading to cancer-related mortality[34]. Han et al[5] firstly reported that SATB1 regulated EMT related gene such as E-cadherin, vimentin, fibronectin, N-cad-herin, SNAIL and SIP1, and SATB1 depletion restores cell polarity and reduces aggressive phenotypes of breast cancer MDA-MB-231 cells in vitro. Another link between SATB1 and EMT was emphasized by Tu et al[9], suggest-ing that SATB1 mainly induces EMT concomitant with increased expression of Snail1, Slug, Twist and vimentin and decreased expression of E-cadherin, tight junction protein ZO-1 and desmoplakin in liver cancer cell lines. The data from the current study suggest that SATB1 can promote CRC metastasis by degrading ECM and inducing EMT in part.

In conclusion, this study demonstrated that SATB1 is over-expressed in CRC and can promote the growth and metastasis of CRC cells in vitro and in vivo. We thus have found a new potential promoting factor for the develop-ment and progression of CRC.

COMMENTSBackgroundElucidation of the molecular mechanisms of colorectal cancer (CRC) is ben-eficial for developing novel therapeutic strategies to conquer this disease and in this study the authors analyzed the role of special AT-rich sequence-binding protein 1 (SATB1) in CRC carcinogenesis.Research frontiersOnly one study suggested that the expression of SATB1 is associated with clini-copathological parameters in CRC. But the roles and mechanisms of SATB1 in growth and metastasis of human CRC remain poorly understood.Innovations and breakthroughsSATB1 promotes CRC cell growth, migration and invasion in vitro and the ability of tumor metastasis in vivo.ApplicationsSATB1 acts as a potential growth and metastasis promoter in CRC. SATB1 may be useful as a therapeutic target for CRC.TerminologySATB1 gene locates at human chromosome 3p23, and is a thymocyte-specific matrix association region-binding protein. SATB1 is predominantly expressed in thymocytes and could regulate the spatiotemporal expression of numerous genes that involved in T cell proliferation, development, and differentiation.

COMMENTS



SATB1 has recently attracted considerable attention in cancer research and its overexpression is a frequent event in various cancers. Furthermore, accumu-lating evidence showed that SATB1 is also associated with tumor growth and metastasis.Peer reviewThe manuscript is well written and the findings are important in its field of inves-tigation.

REFERENCES1 Dickinson LA, Joh T, Kohwi Y, Kohwi-Shigematsu T. A

tissue-specific MAR/SAR DNA-binding protein with un-usual binding site recognition. Cell 1992; 70: 631-645 [PMID: 1505028]

2 Pavan Kumar P, Purbey PK, Sinha CK, Notani D, Limaye A, Jayani RS, Galande S. Phosphorylation of SATB1, a global gene regulator, acts as a molecular switch regulating its transcriptional activity in vivo. Mol Cell 2006; 22: 231-243 [PMID: 16630892 DOI: 10.1016/j.molcel.2006.03.010]

3 Alvarez JD, Yasui DH, Niida H, Joh T, Loh DY, Kohwi-Shi-gematsu T. The MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes during T-cell development. Genes Dev 2000; 14: 521-535 [PMID: 10716941 DOI: 10.1101/gad.14.5.521]

4 Iorns E, Hnatyszyn HJ, Seo P, Clarke J, Ward T, Lippman M. The role of SATB1 in breast cancer pathogenesis. J Natl Can-cer Inst 2010; 102: 1284-1296 [PMID: 20595686 DOI: 10.1093/jnci/djq243]

5 Han HJ, Russo J, Kohwi Y, Kohwi-Shigematsu T. SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis. Nature 2008; 452: 187-193 [PMID: 18337816 DOI: 10.1038/nature06781]

6 Zhao XD, Ji WY, Zhang W, He LX, Yang J, Liang HJ, Wang LL. Overexpression of SATB1 in laryngeal squamous cell carcinoma. ORL J Otorhinolaryngol Relat Spec 2010; 72: 1-5 [PMID: 20110741 DOI: 10.1159/000264777]

7 Lu X, Cheng C, Zhu S, Yang Y, Zheng L, Wang G, Shu X, Wu K, Liu K, Tong Q. SATB1 is an independent prognostic marker for gastric cancer in a Chinese population. Oncol Rep 2010; 24: 981-987 [PMID: 20811679 DOI: 10.3892/or_00000945]

8 Cheng C, Lu X, Wang G, Zheng L, Shu X, Zhu S, Liu K, Wu K, Tong Q. Expression of SATB1 and heparanase in gastric cancer and its relationship to clinicopathologic features. APMIS 2010; 118: 855-863 [PMID: 20955458 DOI: 10.1111/j.1600-0463.2010.02673.x]

9 Tu W, Luo M, Wang Z, Yan W, Xia Y, Deng H, He J, Han P, Tian D. Upregulation of SATB1 promotes tumor growth and metastasis in liver cancer. Liver Int 2012; 32: 1064-1078 [PMID: 22583549 DOI: 10.1111/j.1478-3231.2012.02815.x]

10 Patani N, Jiang W, Mansel R, Newbold R, Mokbel K. The mRNA expression of SATB1 and SATB2 in human breast cancer. Cancer Cell Int 2009; 9: 18 [PMID: 19642980 DOI: 10.1186/1475-2867-9-18]

11 Meng WJ, Yan H, Zhou B, Zhang W, Kong XH, Wang R, Zhan L, Li Y, Zhou ZG, Sun XF. Correlation of SATB1 over-expression with the progression of human rectal cancer. Int J Colorectal Dis 2012; 27: 143-150 [PMID: 21870058 DOI: 10.1007/s00384-011-1302-9]

12 Tenesa A, Dunlop MG. New insights into the aetiology of colorectal cancer from genome-wide association studies. Nat Rev Genet 2009; 10: 353-358 [PMID: 19434079 DOI: 10.1038/nrg2574]

13 Zheng X, Wang L, Zhu Y, Guan Q, Li H, Xiong Z, Deng L, Lu J, Miao X, Cheng L. The SNP rs961253 in 20p12.3 is as-sociated with colorectal cancer risk: a case-control study and a meta-analysis of the published literature. PLoS One 2012; 7: e34625 [PMID: 22509336 DOI: 10.1371/journal.pone.0034625]

14 Gezen C, Kement M, Altuntas YE, Okkabaz N, Seker M, Vural S, Gumus M, Oncel M. Results after multivisceral re-sections of locally advanced colorectal cancers: an analysis on clinical and pathological t4 tumors. World J Surg Oncol 2012; 10: 39 [PMID: 22336589 DOI: 10.1186/1477-7819-10-39]

15 Meyerhardt JA, Li L, Sanoff HK, Carpenter W, Schrag D. Effectiveness of bevacizumab with first-line combination chemotherapy for Medicare patients with stage IV colorectal cancer. J Clin Oncol 2012; 30: 608-615 [PMID: 22253466 DOI: 10.1200/JCO.2011.38.9650]

16 Van Cutsem E, Köhne CH, Láng I, Folprecht G, Nowacki MP, Cascinu S, Shchepotin I, Maurel J, Cunningham D, Tejpar S, Schlichting M, Zubel A, Celik I, Rougier P, Ciardi-ello F. Cetuximab plus irinotecan, fluorouracil, and leucovo-rin as first-line treatment for metastatic colorectal cancer: updated analysis of overall survival according to tumor KRAS and BRAF mutation status. J Clin Oncol 2011; 29: 2011-2019 [PMID: 21502544 DOI: 10.1200/JCO.2010.33.5091]

17 Fang X, Yu W, Li L, Shao J, Zhao N, Chen Q, Ye Z, Lin SC, Zheng S, Lin B. ChIP-seq and functional analysis of the SOX2 gene in colorectal cancers. OMICS 2010; 14: 369-384 [PMID: 20726797 DOI: 10.1089/omi.2010.0053]

18 Lin B, Madan A, Yoon JG, Fang X, Yan X, Kim TK, Hwang D, Hood L, Foltz G. Massively parallel signature sequenc-ing and bioinformatics analysis identifies up-regulation of TGFBI and SOX4 in human glioblastoma. PLoS One 2010; 5: e10210 [PMID: 20419098 DOI: 10.1371/journal.pone.0010210]

19 Foltz G, Ryu GY, Yoon JG, Nelson T, Fahey J, Frakes A, Lee H, Field L, Zander K, Sibenaller Z, Ryken TC, Vibhakar R, Hood L, Madan A. Genome-wide analysis of epigenetic silencing identifies BEX1 and BEX2 as candidate tumor suppressor genes in malignant glioma. Cancer Res 2006; 66: 6665-6674 [PMID: 16818640 DOI: 10.1158/0008-5472.CAN-05-4453]

20 Hou Z, Xie L, Yu L, Qian X, Liu B. MicroRNA-146a is down-regulated in gastric cancer and regulates cell proliferation and apoptosis. Med Oncol 2012; 29: 886-892 [PMID: 21347720 DOI: 10.1007/s12032-011-9862-7]

21 Fang X, Yoon JG, Li L, Yu W, Shao J, Hua D, Zheng S, Hood L, Goodlett DR, Foltz G, Lin B. The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expres-sion microarray, and microRNA analysis. BMC Genomics 2011; 12: 11 [PMID: 21211035 DOI: 10.1186/1471-2164-12-11]

22 Hou Z, Yin H, Chen C, Dai X, Li X, Liu B, Fang X. mi-croRNA-146a targets the L1 cell adhesion molecule and suppresses the metastatic potential of gastric cancer. Mol Med Rep 2012; 6: 501-506 [PMID: 22711166 DOI: 10.3892/mmr.2012.946]

23 Zhou HM, Dong TT, Wang LL, Feng B, Zhao HC, Fan XK, Zheng MH. Suppression of colorectal cancer metastasis by nigericin through inhibition of epithelial-mesenchymal transition. World J Gastroenterol 2012; 18: 2640-2648 [PMID: 22690072 DOI: 10.3748/wjg.v18.i21.2640]

24 Chen Y, Shi L, Zhang L, Li R, Liang J, Yu W, Sun L, Yang X, Wang Y, Zhang Y, Shang Y. The molecular mechanism governing the oncogenic potential of SOX2 in breast cancer. J Biol Chem 2008; 283: 17969-17978 [PMID: 18456656 DOI: 10.1074/jbc.M802917200]

25 Ozden SA, Ozyurt H, Ozgen Z, Kilinc O, Oncel M, Gul AE, Karadayi N, Serakinci N, Kan B, Orun O. Prognostic role of sensitive-to-apoptosis gene expression in rectal cancer. World J Gastroenterol 2011; 17: 4905-4910 [PMID: 22171132 DOI: 10.3748/wjg.v17.i44.4905]

26 Shen H, Yuan Y, Hu HG, Zhong X, Ye XX, Li MD, Fang WJ, Zheng S. Clinical significance of K-ras and BRAF mutations in Chinese colorectal cancer patients. World J Gastroenterol 2011; 17: 809-816 [PMID: 21390154 DOI: 10.3748/wjg.v17.i6.809]

27 Kubens BS, Zänker KS. Differences in the migration ca-





pacity of primary human colon carcinoma cells (SW480) and their lymph node metastatic derivatives (SW620). Cancer Lett 1998; 131: 55-64 [PMID: 9839620 DOI: 10.1016/S0304-3835(98)00201-8]

28 Jimenez RE, Hartwig W, Antoniu BA, Compton CC, War-shaw AL, Fernández-Del Castillo C. Effect of matrix metal-loproteinase inhibition on pancreatic cancer invasion and metastasis: an additive strategy for cancer control. Ann Surg 2000; 231: 644-654 [PMID: 10767785 DOI: 10.1097/00000658-200005000-00004]

29 Horikawa T, Yoshizaki T, Sheen TS, Lee SY, Furukawa M. Association of latent membrane protein 1 and matrix me-talloproteinase 9 with metastasis in nasopharyngeal carci-noma. Cancer 2000; 89: 715-723 [PMID: 10951332]

30 Egeblad M, Werb Z. New functions for the matrix metal-loproteinases in cancer progression. Nat Rev Cancer 2002; 2: 161-174 [PMID: 11990853 DOI: 10.1038/nrc745]

31 Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev 2006; 25: 9-34 [PMID:

16680569 DOI: 10.1007/s10555-006-7886-9]32 Yoon SO, Park SJ, Yun CH, Chung AS. Roles of matrix

metalloproteinases in tumor metastasis and angiogenesis. J Biochem Mol Biol 2003; 36: 128-137 [PMID: 12542983 DOI: 10.5483/BMBRep.2003.36.1.128]

33 John A, Tuszynski G. The role of matrix metalloproteinases in tumor angiogenesis and tumor metastasis. Pathol Oncol Res 2001; 7: 14-23 [PMID: 11349215]

34 Roussos ET, Keckesova Z, Haley JD, Epstein DM, Weinberg RA, Condeelis JS. AACR special conference on epithelial-mesenchymal transition and cancer progression and treat-ment. Cancer Res 2010; 70: 7360-7364 [PMID: 20823151 DOI: 10.1158/0008-5472.CAN-10-1208]

35 Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002; 2 : 442-454 [PMID: 12189386 DOI: 10.1038/nrc822]

36 Guarino M, Rubino B, Ballabio G. The role of epithelial-mes-enchymal transition in cancer pathology. Pathology 2007; 39: 305-318 [PMID: 17558857 DOI: 10.1080/00313020701329914]

P- Reviewer Fabio G S- Editor Jiang L L- Editor Ma JY E- Editor Li JY


Depletion of telomerase RNA inhibits growth of gastrointestinal tumors transplanted in mice

Xue-Cheng Sun, Jing-Yi Yan, Xiao-Lei Chen, Ying-Peng Huang, Xian Shen, Xiao-Hua Ye

Xue-Cheng Sun, Xiao-Hua Ye, Department of Gastroenterol-ogy and Hepatology, the First Affiliated Hospital of Wenzhou Medical College, Wenzhou 325000, Zhejiang Province, ChinaJing-Yi Yan, Xiao-Lei Chen, Ying-Peng Huang, Xian Shen, Department of Gastroenterology and General Surgery, the First Affiliated Hospital of Wenzhou Medical College, Wenzhou 325000, Zhejiang Province, ChinaAuthor contributions: Sun XC and Yan JY performed the major-ity of experiments; Huang YP and Shen X provided vital reagents and analytical tools; Ye XH was involved in editing the manu-script; Chen XL designed the study and wrote the manuscript.Supported by The Natural Science Foundation of Zhejiang Province, No. Y201016273Correspondence to: Jing-Yi Yan, Associate Chief Physician, Department of Gastroenterology and General Surgery, the First Affiliated Hospital of Wenzhou Medical College, No 2 Fuxue Road, Wenzhou 325000, Zhejiang Province, China. [email protected]: +86-577-88069555 Fax: +86-577-88069555Received: December 13, 2012 Revised: February 14, 2013 Accepted: March 22, 2013Published online: April 21, 2013

AbstractAIM: To explore effects of telomerase RNA-targeting phosphorothioate antisense oligodeoxynucleotides (PS-ASODN) on growth of human gastrointestinal stro-mal tumors transplanted in mice.

METHODS: A SCID mouse model for transplanta-tion of human gastrointestinal stromal tumors (GISTs) was established using tumor cells from a patient who was diagnosed with GIST and consequently had been treated with imatinib. GIST cells cultured for 10 pas-sages were used for inoculation into mice. Transfection of PS-ASODN was carried out with Lipotap Liposo-mal Transfection Reagent. GISTs that subsequently developed in SCID mice were subjected to intra-tumoral injection once daily from day 7 to day 28 post-inoculation, and mice were divided into the following

four groups according to treatment: PS-ASODN group (5.00 μmoL/L of oligonucleotide, each mouse received 0.2 mL once daily); imatinib group (0.1 mg/g body weight); liposome negative control group (0.01 mL/g); and saline group (0.01 mL/g). On day 28, the mice were sacrificed, and tumor attributes including weight and longest and shortest diameters were measured. Tumor growth was compared between treatment groups, and telomerase activ-ity was measured by enzyme-linked immunosorbent assay. Apoptosis was examined by flow cytometry. Real-time polymerase chain reaction was used to detect expres-sion of the mRNA encoding the apoptosis inhibition B-cell leukemia/lymphoma 2 (bcl-2 ) gene.

RESULTS: In the PS-ASODN group, tumor growth was inhibited by 59.437%, which was markedly higher than in the imatinib group (11.071%) and liposome negative control group (2.759%) [tumor inhibition = (mean tumor weight of control group - mean tumor weight of treatment group)/(mean tumor weight of control group) × 100%]. Telomerase activity was significantly lower (P < 0.01) in the PS-ASODN group (0.689 ± 0.158) compared with the imatinib group (1.838 ± 0.241), liposome negative control group (2.013 ± 0.273), and saline group (2.004 ± 0.163). Flow cytometry revealed that the apoptosis rate of tumor cells treated with PS-ASODN was 20.751% ± 0.789%, which was higher (P < 0.01) than that of the imatinib group (1.163% ± 0.469%), liposome negative control group (1.212% ± 0.310%), and saline group (1.172% ± 0.403%). Expression of bcl-2 mRNA in the transplanted GISTs was markedly downregulated (P < 0.01) in the PS-ASODN group (7.245 ± 0.739) com-pared with the imatinib group (14.153 ± 1.618) and lipo-some negative control group (16.396 ± 1.351).

CONCLUSION: PS-ASODN can repress GIST growth, mediated perhaps by inhibition of telomerase activity and downregulation of bcl-2 expression.


ORIGINAL ARTICLE





Key words: Gastrointestinal stromal tumor; Phospho-rothioate antisense oligonucleotides; Imatinib; Tumor inhibitory rate; Telomerase activity

Core tip: Gastrointestinal stromal tumors (GISTs) are low-grade malignant mesenchymal tumors of the gas-trointestinal tract. In our study, telomerase activity was repressed and the level of B-cell leukemia/lymphoma 2 mRNA markedly downregulated in SCID mice carrying transplanted human GISTs and treated with telomerase RNA-targeting phosphorothioate antisense oligodeoxy-nucleotides (PS-ASODN). Therefore, the therapeutic ef-fect of PS-ASODN on GISTs is remarkable.

Sun XC, Yan JY, Chen XL, Huang YP, Shen X, Ye XH. Deple-tion of telomerase RNA inhibits growth of gastrointestinal tumors transplanted in mice. World J Gastroenterol 2013; 19(15): 2340-2347 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2340.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2340

INTRODUCTIONGastrointestinal stromal tumor (GIST) is a recently rec-ognized tumor entity. It is now evident that GIST is a distinct tumor type and the most common sarcoma of the gastrointestinal tract in humans[1]. GISTs account for 2.2% of morbidity associated with malignant tumors of the gastrointestinal tract[2]. GISTs occur at a median age of 60 years, with a slight male predominance. Ap-proximately 60% and 30% of GISTs arise in the stomach and small intestine, respectively. GISTs have a high pro-pensity for metastatic relapse, specifically in the liver and peritoneum, after initial surgery for localized disease[3,4]. GISTs are currently categorized based on cell morphol-ogy, namely spindle cell, epithelioid, or occasionally pleo-morphic; the tumors generally arise in the gastrointestinal tract and usually express the protein KIT. GISTs are generally resistant to conventional cancer chemotherapy and are associated with poor outcome; in 2001, however, an adjuvant therapy with the tyrosine kinase inhibitor imatinib was found to be highly effective against GIST[5]. Although imatinib has revolutionized the treatment of advanced GISTs, clinical resistance to this drug has proved to be a substantial problem requiring prolonged treatment[6,7].

Zamecnik et al[8] originally proposed the concept and therapeutic application of antisense nucleic acids. Anti-sense oligodeoxyribonucleotides are short DNA sequenc-es that hybridize to complementary mRNA sequences by Watson-Crick base pairing. Antisense oligodeoxyribo-nucleotides do not form hybrids with noncomplementary RNAs encoded by other genes, and thus each individual oligodeoxyribonucleotide targets a unique RNA se-quence, thereby effectively blocking the expression of the associated gene while transcription from other genes remains unaffected[9]. The antisense approach has been

extensively applied in oncology research. Indeed, research has suggested that antisense oligodeoxyribonucleotides, which typically are approximately 20 nucleotides long, can preferentially penetrate tumor vessels because tumor ves-sels are leakier than normal vessels[10,11]. Thus, antisense oligodeoxyribonucleotides show tremendous potential as drug candidates that can selectively downregulate and effectively block oncogene expression[9]. In our present study, we used liposome-assisted transfection to inves-tigate the therapeutic efficacy of delivering telomerase RNA-targeting phosphorothioate antisense oligodeoxy-nucleotides (PS-ASODN) to human GISTs transplanted into mice, with the goal of inhibiting tumor growth and enhancing tumor-cell apoptosis. Our results suggest a po-tential new therapeutic intervention for GISTs.

MATERIALS AND METHODSSample collection GIST samples were obtained from a 51-year-old female patient upon admission to the First Affiliated Hospital of Wenzhou Medical College. Standard resection of GISTs in the small intestine was performed on the patient in June 2004, and treatment with a 400-mg daily dose of imatinib was applied for the postoperative period. The patient underwent surgery again in 2006 owing to GIST recurrence, and the daily dose of imatinib was increased to 800 mg postoperatively. A third surgical resection was carried out in 2009 owing again to GIST recurrence, and tumor tissues were resected and used to establish cell lines after obtaining informed consent.

Primary culture of GIST cellsGIST samples were washed twice with Hanks Balanced Salt Solution and cut into cubes of about 1-2 mm3 before 1 mL 0.1% collagenase type Ⅰ (Gibco, Carlsbad, CA, United States) was added. Each sample was again incu-bated with another 5 mL of 0.1% collagenase type Ⅰ in RPMI-1640 culture medium at 37 ℃ under sterile condi-tions. The tissues were pipetted 50 times with a slender-tip pipette, and then specimens were incubated for 1 h at 37 ℃ with gentle shaking every 20 min. The resultant cell suspensions were pipetted 20 times and centrifuged at 1000 × g for 5 min at room temperature, and the su-pernatant was discarded. Each pellet was resuspended in 5 mL RPMI-1640, and larger cell clumps were removed by filtration through a 200-μm mesh nylon gauze. Cells in the filtrate were placed in 4 mL RPMI-l640 complete medium containing 10% fetal bovine serum (Gibco), 100 U/mL penicillin, and 100 U/L streptomycin and incu-bated at 37 ℃ in an atmosphere of 5% CO2 in air. The medium was renewed after 24 h and thereafter renewed every 2 d. After 10 d of culture, trypsin (Sigma, St. Louis, United States) at 0.25% was applied to partially digest the cells, and the cells were purified by differential adhesion. The cells that were most adherent were then subcultured twice a week. GIST cells of different generations were preserved in liquid nitrogen for subsequent experimenta-


Sun XC et al . Depletion of telomerase RNA in tumors

tion. This cell line was named GIST867 (Figure 1A and B).

AnimalsFemale SCID mice (7-wk old, 22 ± 2 g) were purchased from Shanghai Experimental Animal Center of the Na-tional Academy of Sciences, Shanghai, China. All mice were fed standard laboratory chow and water ad libitum. All procedures were performed in accordance with the Guidelines for Animal Experiments of Wenzhou Medical College, Wenzhou, China.

Synthesis and transfection of PS-ASODNPS-ASODN with the sequence 5’-CTCAGTTAGGGT-TAGACA-3’, which is a complementary region of the templating RNA of telomerase, was synthesized by Shanghai Biotechnology Engineering Company (Shang-hai, China). Transfection of PS-ASODN was carried out with Lipotap Liposomal Transfection Reagent (Beyotime, Shanghai, China). This oligonucleotide was used directly without further purification, and all pipettes and tubes were autoclaved prior to use. The oligonucleotide was first diluted to a final concentration of 100 μmol/L with 550 μL deionized H2O and stored at -20 ℃. The Lipotap reagent was diluted with serum-free RPMI-1640 before transfection. PS-ASODN at a final concentration of 5.00 μmol/L was then added and incubated for 15 min with diluted Lipotap reagent in Dulbecco’s modified Eagle’s medium without antibiotics or glutamine at various tem-peratures ranging from 15 ℃ to 25 ℃.

Subcutaneous implantation of GIST867 cells and drug administrationFor inoculation into SCID mice, GIST cells of the tenth

generation were digested with 0.25% trypsin and subcul-tured in RPMI-1640. Centrifugation yielded a single cell suspension having a density of 1.0 × 107 viable cells per 1 mL serum-free medium. A dose of 0.25 mL of single cell suspension was injected subcutaneously into the flank skin of each of two female SCID mice. The two mice were fed under sterile conditions, and at 28-d post-inoculation the diameter of the resultant tumor was 1-2 cm in each mouse. These two mice were anaesthetized and decapitated to obtain the tumors, which subsequently were cut into cubes of 1 mm3 in 10% fetal bovine serum. The tumor cubes were placed subcutaneously into the left flank skin of 40 female SCID mice, and after 1 wk tumors were successfully induced in all mice (Figure 1C and D). The 40 tumor-bearing SCID mice were randomly divided into four groups (10 mice per group): the PS-ASODN group (5.00 μmol/L, each mouse received 0.2 mL by intra-tumor injection once daily); imatinib group (0.1 mg/g body weight, imatinib obtained from Novartis Pharma, Basel, Switzerland); liposome negative control group (0.01 mL/g); and saline group (0.01 mL/g). The mice in each group received the relevant treatment by intra-tumor injection once daily from day 7 to day 28 after implantation. After 28 d, the mice were sacrificed, and tumor weight and longest and shortest diameters were measured by electronic scale and vernier caliper, re-spectively. Inhibition of tumor growth was calculated as follows: inhibition of growth = (mean tumor weight of control group - mean tumor weight of treatment group)/(mean tumor weight of control group) × 100%. Aliquots of the tumor specimens were frozen in liquid nitrogen for further use.


Figure 1 General characteristics of gastrointestinal stro-mal tumors. A, B: Morphological features of gastrointestinal stromal tumor cells as observed under inverted microscope; C: Tumors developed at the site of human tumor implantation in mice (arrow); D: Representative solid tumor removed from a mouse.

A B

C D



Apoptosis as measured by flow cytometry Apoptosis was assessed by flow cytometry. Tumor speci-mens were cut into cubes of 1 mm3, homogenized in 2 mL PBS, and filtered through 200-μm mesh nylon gauze. The filtrate was left for 10 min in the dark and was then centrifuged at 2500 × g for 7 min at room temperature. The pellet was resuspended in 200 μL Binding Buffer (10 mmol/L HEPES, 140 mmol/L NaCl, 2.5 mmol/L CaCl2, pH 7.4) and labeled with 10 μL annexin V-FITC and 5 μL propidium iodide from the annexin V-FITC Apoptosis Detection kit (eBioscience, San Diego, CA, United States). Apoptosis was assayed by flow cytometry (BD FACSCalibur CellSorting System, Becton Dickinson, Franklin Lakes, NJ, United States). The samples were tested in sextuplicate, and mean values were calculated.

Statistical analysisAll data are presented as the mean ± SD deviation. Statis-tical analysis was carried out with SPSS 13.0 software (SPSS, Chicago, IL, United States). Statistically significant differ-ences between groups were established using Fisher’s least significant difference test. P < 0.05 was considered to be statistically significant.

RESULTSInhibition of tumor growth in PS-ASODN-treated mice Tumor volume and weight were significantly lower in the PS-ASODN group compared with the liposome nega-tive control and saline groups (P < 0.01, Figure 2A and B). Tumor volume and weight in the imatinib group were slightly lower than in the liposome negative control and saline groups, but the difference was not significant (P > 0.05). Inhibition of tumor growth in the PS-ASODN group (59.437%) was significantly greater than in the imatinib (11.071%) and liposome negative control groups (2.759%) (all relative to tumor growth observed in the saline control group, Figure 2C).

Effect of PS-ASODN on telomerase activityTelomerase activity was significantly repressed in the PS-ASODN group compared with the imatinib and lipo-some negative control groups (P < 0.01, Figure 3). As expected, administration of imatinib did not significantly

Real-time polymerase chain reaction analysisTotal RNA was extracted using Trizol reagent (Beyo-time), and the concentration and purity of RNA were determined by measuring the absorbance at 260 nm and 280 nm (2.0 > A260, and A280 > 1.7). Real-time poly-merase chain reaction (PCR) analysis was performed using an ABI PRISM 7500 Real-Time PCR System (Applied Biosystems Inc., Carlsbad, CA, United States). Each well (20 μL volume) contained 10 μL Power SYBR Green PCR master mix (Applied Biosystems), 1 μL of each primer (5 μmol/L) and 1 μL template. Primer sequences were designed by PrimerExpress 5.0 and synthesized by the Shanghai Biotechnology Cor-poration (Shanghai, China); the sequences were (5’-3’): B-cell leukemia/lymphoma 2 (bcl-2) gene (235 bp): for-ward CAGCTGCACCTGACGCCCTT and reverse CCCAGCCTCCGTTATCCTGGA; β -actin (99 bp): for-ward CCACACTGTGCCCATCTACG and reverse AG-GATCTTCATGAGGTAGTCAGTCAG.

Telomerase activity assayTelomerase activity was assayed by enzyme-linked immu-nosorbent assay following the procedure recommended by the manufacturer (Boehringer, Mannheim, Germany). The absorbance value in each well was read at 490 nm with a microtiter plate reader (BIO-TEK ELX800, Win-ooski, Vermont, CA, United States).

Control Saline Imatinib PS-ASODN

1600

1200

800

400

0Tum

or v

olum

e (m

m3 )A

B

C


8

6

4

2

0

Tum

or w

eigh

t (g

)

b

b

Inhi

bitio

n of

tum

or

grow

th (

%)

100

50

0Control Imatinib PS-ASODN

b

Figure 2 Phosphorothioate antisense oligodeoxynucleotides mediated inhibition of tumor growth in human gastrointestinal stromal tumors (n = 10 tumors per group). Daily intra-tumor injection of phosphorothioate antisense oligodeoxynucleotides (PS-ASODN) and other reagents commenced on post-inoculation day 7 and continued to day 28. A: Tumor volume; B: Tumor weight; C: Inhibition of tumor growth. bP < 0.01 vs liposome negative control and imatinib groups. Each bar represents the mean ± SD.

Telo

mer

ase

activ

ity


b

3

2

1

0

Figure 3 Effect of phosphorothioate antisense oligodeoxynucleotides and other reagents on telomerase activity in gastrointestinal stromal tumors tissues (n = 10 tumors per group). bP < 0.01 vs tumors treated with phospho-rothioate antisense oligodeoxynucleotides (PS-ASODN) and imatinib.



affect telomerase activity compared with the liposome negative control group (P > 0.05).

Effect of PS-ASODN on tumor cell apoptosisThe percentage of apoptotic cells in tumors was de-termined by flow cytometry on day 28 after tumor im-plantation. Apoptosis was significantly higher in the PS-ASODN group (20.751% ± 0.789%) compared with the imatinib (1.637% ± 0.469%), liposome negative control, and saline groups (P < 0.01, Figure 4). There was no sig-nificant difference (P > 0.05) between the imatinib group and the liposome negative control and saline groups.

Effect of PS-ASODN on bcl-2 expression OR the level of bcl-2 mRNAAgarose gel electrophoresis was used to verify the lengths of the PCR amplification fragments, namely 235 bp for bcl-2 (encoding B-cell lymphoma protein 2) and 99 bp for β -actin (Figure 5). The level of bcl-2 mRNA was sig-nificantly downregulated (P < 0.01) in the PS-ASODN group compared with the liposome negative control group (Figure 5).

DISCUSSIONGISTs are the most common mesenchymal neoplasms of the gastrointestinal tract, and the worldwide incidence of GISTs has been estimated to be 14-20 per million people. GISTs are low-grade malignant tumors that are believed to originate from neoplastic transformation of the inter-stitial cells of Cajal[12-14]. The overall 5-year survival rate for GIST patients is about 45% in the United States[15]. Nearly 50% of GISTs treated with imatinib ultimately demonstrate resistance in the first 2 years post-treatment,

100 101 102 103 104

Annexin V-FITC

PI

104

103

102

101

100

100 101 102 103 104

Annexin V-FITC PI

104

103

102

101

100

100 101 102 103 104

Annexin V-FITC

PI

104

103

102

101

100

Apop

tosi

s (%

)


b

30

20

10

0

Figure 4 Effect of phosphorothioate antisense oligodeoxynucleotides and other reagents on tumor cell apoptosis (n = 10 tumors per group). bP < 0.01 vs liposome negative control and imatinib groups. 1: Liposome negative control group; 2: Imatinib group; 3: Phosphorothioate antisense oligodeoxynucleotides (PS-ASODN) group. PI: Propidium iodide; FITC: Fluorescein isothiocyanate.

1 2 3

M 1 2 3

2000 bp

200 bp

100 bp

bcl-2 mRNA

β-actin

Rela

tive

bcl-2

mRN

A le

vel

Imatinib PS-ASODN Control

b

20

15

10

5

0

Figure 5 B-cell leukemia/lymphoma 2 mRNA expression in tumor samples as detected by real time-polymerase chain reaction (n = 10 mice per group). bP < 0.01 vs control and imatinib groups. Each bar represents the mean ± SD. M: Marker, 100-2000 bp; 1: Imatinib-treated group; 2: Phosphorothioate antisense oligodeoxynucleotides (PS-ASODN)-treated group; Lane 3: Control group. bcl-2: B-cell leukemia/lymphoma 2.



and thus a new treatment strategy and/or more effective drug is needed.

There are at least two different mechanisms for the immortalization of tumor cells: reactivation of telom-erase, and the inactivation of tumor suppressor genes such as p53 and pRB that control cellular senescence[16]. Human telomerase, which contains an RNA component, telomerase-associated protein and a catalytic subunit[17-20], is activated in 80%-90% of carcinomas derived from var-ious organs such as stomach, colon, lung and breast[21-23]. The rate of telomere DNA shortening is regulated by telomerase expression and activity[24-26]. In our study, we evaluated telomerase activity in GISTs and found that telomerase activity was markedly elevated, consistent with findings for other tumor types.

Controlling the levels of the anti-apoptotic bcl-2 family proteins is critical for regulating cell growth and apoptosis. bcl-2 localizes to cellular membranes, par-ticularly in mitochondria, and can inhibit mitochondrial release of substances involved in signaling either the onset or execution of apoptosis[27], and higher levels of bcl-2 promote the development and progression of many tumors[28]. bcl-2 promotes cell survival by inhib-iting adapters needed for activation of the proteases (caspases) that dismantle the cell. Therefore, bcl-2 and related cytoplasmic proteins are key inhibitory factors of apoptosis, which indeed is critical for development, tissue homeostasis, and protection against pathogens[29-31]. Here, we found that the level of bcl-2 mRNA was significantly upregulated in GISTs, consistent with its established role in promoting tumorigenesis.

The drug resistance of a malignant tumor is an im-portant issue for conventional clinical therapies such as chemotherapy, radiotherapy, and immunotherapy. If telomerase activity and/or expression is inhibited in can-cer cells, the cells may become relatively more vulnerable to these conventional therapies[32].

In this study, transfection with PS-ASODN signifi-cantly inhibited telomerase activity and induced apoptosis compared with the imatinib and control groups. Recently, research has shown that cells with long telomeres possess the ability to proliferate in the absence of telomerase, which demonstrates that telomerase activity does not require basic replicative functions of these cells; rather, maintaining a minimum telomere length seemingly re-quires telomerase activity[33]. Other studies have shown that cells with high telomerase activity were more resis-tant to apoptosis than those with low telomerase activ-ity[34,35]. Kondo et al[32] found that inhibition of telomerase with an antisense telomerase expression vector not only decreased telomerase activity but also increased the sus-ceptibility to cisplatin-induced apoptotic cell death in cisplatin-resistant U251-MG cells. Research suggests that bcl-2 is a regulator of programmed cell death, and its overexpression has been implicated in pathogenesis of some lymphomas. In our study, the SCID mice treated with PS-ASODN had significantly downregulated expres-sion of bcl-2 mRNA compared with the liposome nega-

tive control and saline groups. In conclusion, our study demonstrates that a synthetic

antisense oligonucleotide can reduce both telomerase activity and bcl-2 mRNA expression and increase apop-tosis of human GIST cells in vivo. The therapeutic effect of PS-ASODN on GISTs is remarkable, and the use of synthetic antisense oligonucleotides has the advantage of therapeutic convenience and flexibility. Our data clearly show the potential efficacy of antisense oligonucleotides for the treatment of human GISTs.

COMMENTSBackgroundGastrointestinal stromal tumor (GIST) is a distinct tumor type and the most common sarcoma of the gastrointestinal tract in humans, and it has a high propensity for metastatic relapse, specifically in the liver and peritoneum, after initial surgery for localized disease. Previous research has shown that antisense oligodeoxyribonucleotides, which can target a unique sequence of a single gene and block its expression while other genes are transcribed without interruption, have tremendous potential as promising drugs that can selectively downregulate oncogene expression.Research frontiersGISTs are low-grade malignant mesenchymal tumors of the gastrointestinal tract, and the overall 5-year survival rate for GIST patients is about 45% in the United States. The authors found telomerase activity was markedly elevated in GISTs. Therefore, telomerase may be reactivated at a certain stage in GIST progression, enabling cancer cells to escape telomere shortening and continue proliferating. B-cell leukemia/lymphoma 2 (bcl-2) is a key regulator of apoptosis and the level of bcl-2 mRNA is significantly upregulated in GISTs. Innovations and breakthroughsDrug resistance of a malignant tumor is an important challenge for conventional clinical therapies such as chemotherapy, radiotherapy, and immunotherapy. This study is the first to report a new viewpoint on GIST pathogenesis and the poten-tial therapeutic effect of telomerase RNA-targeting phosphorothioate antisense oligodeoxynucleotides (PS-ASODN) on GIST. ApplicationsThe authors measured telomerase activity and the level of bcl-2 mRNA in mice carrying transplanted human GISTs. The results provide new insight into the pathogenesis of GIST and suggest an efficacious therapy for GIST.TerminologyGISTs are low-grade malignant mesenchymal tumors of the gastrointestinal tract and are believed to originate from neoplastic transformation of the in-terstitial cells of Cajal. Antisense oligodeoxyribonucleotides are short DNA sequences that do not form hybrids with noncomplementary RNAs encoded by other genes, and thus each individual oligodeoxyribonucleotide targets a unique RNA sequence, thereby effectively blocking the expression of the associated gene while transcription from other genes remains unaffected.Peer reviewThe authors of this study investigated the pathogenesis of GISTs. The results are interesting and suggest that telomerase activity was repressed and the level of bcl-2 mRNA significantly downregulated in SCID mice treated with PS-ASODN. They investigated the effect of PS-ASODN on proliferation, apoptosis, and telomerase activity of tumor cells in mouse transplanted GISTs, with the goal of attaining a new viewpoint on GIST pathogenesis and providing a new therapeutic intervention.

REFERENCES1 Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida

T, Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G, Matsuzawa Y, Kanakura Y, Shino-mura Y, Kitamura Y. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science 1998; 279: 577-580 [PMID: 9438854 DOI: 10.1126/science.279.5350.577]

COMMENTS



2 Nishida T, Hirota S. Biological and clinical review of stro-mal tumors in the gastrointestinal tract. Histol Histopathol 2000; 15: 1293-1301 [PMID: 11005253]

3 Rubin BP, Fletcher JA, Fletcher CD. Molecular Insights into the Histogenesis and Pathogenesis of Gastrointestinal Stro-mal Tumors. Int J Surg Pathol 2000; 8: 5-10 [PMID: 11493959 DOI: 10.1177/106689690000800105]

4 Fletcher CD, Berman JJ, Corless C, Gorstein F, Lasota J, Longley BJ, Miettinen M, O’Leary TJ, Remotti H, Rubin BP, Shmookler B, Sobin LH, Weiss SW. Diagnosis of gas-trointestinal stromal tumors: A consensus approach. Hum Pathol 2002; 33: 459-465 [PMID: 12094370 DOI: 10.1053/hupa.2002.123545]

5 Joensuu H, Roberts PJ, Sarlomo-Rikala M, Andersson LC, Tervahartiala P, Tuveson D, Silberman S, Capdeville R, Dimitrijevic S, Druker B, Demetri GD. Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastro-intestinal stromal tumor. N Engl J Med 2001; 344: 1052-1056 [PMID: 11287975 DOI: 10.1056/NEJM200104053441404]

6 Verweij J, Casali PG, Zalcberg J, LeCesne A, Reichardt P, Blay JY, Issels R, van Oosterom A, Hogendoorn PC, Van Glabbeke M, Bertulli R, Judson I. Progression-free survival in gastrointestinal stromal tumours with high-dose ima-tinib: randomised trial. Lancet 2004; 364: 1127-1134 [PMID: 15451219 DOI: 10.1016/S0140-6736(04)17098-0]

7 Heinrich MC, Corless CL, Demetri GD, Blanke CD, von Mehren M, Joensuu H, McGreevey LS, Chen CJ, Van den Abbeele AD, Druker BJ, Kiese B, Eisenberg B, Roberts PJ, Singer S, Fletcher CD, Silberman S, Dimitrijevic S, Fletcher JA. Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol 2003; 21: 4342-4349 [PMID: 14645423 DOI: 10.1200/JCO.2003.04.190]

8 Zamecnik PC, Stephenson ML. Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligo-deoxynucleotide. Proc Natl Acad Sci USA 1978; 75: 280-284 [PMID: 75545 DOI: 10.1073/pnas.75.1.280]

9 Kausch I, Böhle A. Antisense oligonucleotide therapy for urologic tumors. Curr Urol Rep 2003; 4: 60-69 [PMID: 12537941 DOI: 10.1007/s11934-003-0059-2]

10 Jain RK. Delivery of novel therapeutic agents in tumors: physiological barriers and strategies. J Natl Cancer Inst 1989; 81: 570-576 [PMID: 2649688 DOI: 10.1093/jnci/81.8.570]

11 Plenat F, Klein-Monhoven N, Marie B, Vignaud JM, Duprez A. Cell and tissue distribution of synthetic oligonucleotides in healthy and tumor-bearing nude mice. An autoradio-graphic, immunohistological, and direct fluorescence microscopy study. Am J Pathol 1995; 147: 124-135 [PMID: 7604874]

12 Goh BK, Chow PK, Ong HS, Wong WK. Gastrointestinal stromal tumor involving the second and third portion of the duodenum: treatment by partial duodenectomy and Roux-en-Y duodenojejunostomy. J Surg Oncol 2005; 91: 273-275 [PMID: 16121353 DOI: 10.1002/jso.20311]

13 Agaimy A, Wünsch PH. Gastrointestinal stromal tumours: a regular origin in the muscularis propria, but an extremely diverse gross presentation. A review of 200 cases to critical-ly re-evaluate the concept of so-called extra-gastrointestinal stromal tumours. Langenbecks Arch Surg 2006; 391: 322-329 [PMID: 16402273 DOI: 10.1007/s00423-005-0005-5]

14 Kwon SH, Cha HJ, Jung SW, Kim BC, Park JS, Jeong ID, Lee JH, Nah YW, Bang SJ, Shin JW, Park NH, Kim DH. A gas-trointestinal stromal tumor of the duodenum masquerading as a pancreatic head tumor. World J Gastroenterol 2007; 13: 3396-3399 [PMID: 17659684]

15 Tran T, Davila JA, El-Serag HB. The epidemiology of ma-lignant gastrointestinal stromal tumors: an analysis of 1,458 cases from 1992 to 2000. Am J Gastroenterol 2005; 100: 162-168 [PMID: 15654796 DOI: 10.1111/j.1572-0241.2005.40709.x]

16 Shay JW. Telomerase in human development and cancer. J

Cell Physiol 1997; 173: 266-270 [PMID: 9365534]17 Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu

CP, Adams RR, Chang E, Allsopp RC, Yu J. The RNA com-ponent of human telomerase. Science 1995; 269: 1236-1241 [PMID: 7544491 DOI: 10.1126/science.7544491]

18 Harrington L, McPhail T, Mar V, Zhou W, Oulton R, Bass MB, Arruda I, Robinson MO. A mammalian telomerase-as-sociated protein. Science 1997; 275: 973-977 [PMID: 9020079 DOI: 10.1126/science.275.5302.973]

19 Nakamura TM, Morin GB, Chapman KB, Weinrich SL, Andrews WH, Lingner J, Harley CB, Cech TR. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997; 277: 955-959 [PMID: 9252327 DOI: 10.1126/sci-ence.277.5328.955]

20 Meyerson M, Counter CM, Eaton EN, Ellisen LW, Steiner P, Caddle SD, Ziaugra L, Beijersbergen RL, Davidoff MJ, Liu Q, Bacchetti S, Haber DA, Weinberg RA. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 1997; 90: 785-795 [PMID: 9288757 DOI: 10.1016/S0092-8674(00)80538-3]

21 Nouso K, Urabe Y, Higashi T, Nakatsukasa H, Hino N, Ashida K, Kinugasa N, Yoshida K, Uematsu S, Tsuji T. Telomerase as a tool for the differential diagnosis of human hepatocellular carcinoma. Cancer 1996; 78: 232-236 [PMID: 8673997]

22 Hiyama E, Gollahon L, Kataoka T, Kuroi K, Yokoyama T, Gazdar AF, Hiyama K, Piatyszek MA, Shay JW. Telomerase activity in human breast tumors. J Natl Cancer Inst 1996; 88: 116-122 [PMID: 8537972 DOI: 10.1093/jnci/88.2.116]

23 Sommerfeld HJ, Meeker AK, Piatyszek MA, Bova GS, Shay JW, Coffey DS. Telomerase activity: a prevalent marker of malignant human prostate tissue. Cancer Res 1996; 56: 218-222 [PMID: 8548767]

24 Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW. Specific association of human telomerase activity with im-mortal cells and cancer. Science 1994; 266: 2011-2015 [PMID: 7605428 DOI: 10.1126/science.7605428]

25 Counter CM, Avilion AA, LeFeuvre CE, Stewart NG, Gre-ider CW, Harley CB, Bacchetti S. Telomere shortening asso-ciated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 1992; 11: 1921-1929 [PMID: 1582420]

26 Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990; 345: 458-460 [PMID: 2342578 DOI: 10.1038/345458a0]

27 Green DR, Reed JC. Mitochondria and apoptosis. Sci-ence 1998; 281: 1309-1312 [PMID: 9721092 DOI: 10.1016/S0962-8924(98)01273-2]

28 Gautschi O, Tschopp S, Olie RA, Leech SH, Simões-Wüst AP, Ziegler A, Baumann B, Odermatt B, Hall J, Stahel RA, Zangemeister-Wittke U. Activity of a novel bcl-2/bcl-xL-bi-specific antisense oligonucleotide against tumors of diverse histologic origins. J Natl Cancer Inst 2001; 93: 463-471 [PMID: 11259472 DOI: 10.1093/jnci/93.6.463]

29 Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998; 281: 1322-1326 [PMID: 9735050 DOI: 10.1126/science.281.5381.1322]

30 Chen GQ, Zhu J, Shi XG, Ni JH, Zhong HJ, Si GY, Jin XL, Tang W, Li XS, Xong SM, Shen ZX, Sun GL, Ma J, Zhang P, Zhang TD, Gazin C, Naoe T, Chen SJ, Wang ZY, Chen Z. In vitro studies on cellular and molecular mechanisms of arse-nic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with down-regulation of Bcl-2 expression and modulation of PML-RAR alpha/PML proteins. Blood 1996; 88: 1052-1061 [PMID: 8704214]

31 He ZG, Zhang Y. Effect of antisense oligodeoxynucleotide of bcl-2 on drug sensitivity of leukemic cells. Zhongguo Bingli Shengli Zazhi 1998; 14: 591-595



32 Kondo S, Kondo Y, Li G, Silverman RH, Cowell JK. Tar-geted therapy of human malignant glioma in a mouse model by 2-5A antisense directed against telomerase RNA. Oncogene 1998; 16: 3323-3330 [PMID: 9681832 DOI: 10.1038/sj.onc.1201885]

33 Zhang X, Mar V, Zhou W, Harrington L, Robinson MO. Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev 1999; 13: 2388-2399 [PMID: 10500096 DOI: 10.1101/gad.13.18.2388]

34 Fu W, Begley JG, Killen MW, Mattson MP. Anti-apoptotic role of telomerase in pheochromocytoma cells. J Biol Chem 1999; 274: 7264-7271 [PMID: 10066788 DOI: 10.1074/jbc.274.11.7264]

35 Yashima K, Milchgrub S, Gollahon LS, Maitra A, Saboorian MH, Shay JW, Gazdar AF. Telomerase enzyme activity and RNA expression during the multistage pathogenesis of breast carcinoma. Clin Cancer Res 1998; 4: 229-234 [PMID: 9516976]

P- Reviewers Andrei S, Kanda T S- Editor Zhai HH L- Editor Logan S E- Editor Li JY




United States-based practice patterns and resource utilization in advanced neuroendocrine tumor treatment

Jonathan Strosberg, Roman Casciano, Lee Stern, Rohan Parikh, Maruit Chulikavit, Jacob Willet, Zhimei Liu, Xufang Wang, Krzysztof J Grzegorzewski

Jonathan Strosberg, H Lee Moffitt Cancer Center and Research Institute, Gastrointestinal Tumor Department, Tampa, FL 33612, United StatesRoman Casciano, Lee Stern, Rohan Parikh, Maruit Chuli-kavit, Jacob Willet, LA-SER Analytica, New York, NY 10018, United StatesZhimei Liu, Xufang Wang, Krzysztof J Grzegorzewski, No-vartis Oncology, Florham Park, NJ 07932, United StatesAuthor contributions: Strosberg J, Casciano R, Stern L, Parikh R, Chulikavit M, Liu Z, Wang X and Grzegorzewski KJ contrib-uted to the study design and manuscript review; Willet J contrib-uted to the writing, development, and editing of the manuscript.Supported by Novartis Pharmaceuticals Corporation, Florham Park, NJ 07932, to Liu Z, Wang X and Grzegorzewski KJ; LA-SER Analytica, to Casciano R, Stern L, Parikh R, Chulikavit M and Willet JCorrespondence to: Lee Stern, MS, LA-SER Analytica, 24 West 40th Street, Floor 8, New York, NY 10018, United States. [email protected]: +1-212-6864100 Fax: +1-212-6868601 Received: September 14, 2012 Revised: November 20, 2012 Accepted: November 24, 2012Published online: April 21, 2013

AbstractAIM: To assess advanced neuroendocrine tumor (NET) treatment patterns and resource utilization by tumor progression stage and tumor site in the United States.

METHODS: United States Physicians meeting eligibil-ity criteria were provided with online data extraction forms to collect patient chart data on recent NET pa-tients. Resource utilization and treatment pattern data were collected over a baseline period (after diagnosis and before tumor progression), as well as initial and secondary progression periods, with progression de-fined according to measureable radiographic evidence of tumor progression. Resource categories used in the analysis include: Treatments (e.g. , surgery, chemo-

therapy, radiotherapy, targeted therapies), hospitaliza-tions and physician visits, diagnostic tests (biomarkers, imaging, laboratory tests). Comparisons between cat-egories of resource utilization and tumor progression status were examined using univariate (by tumor site) and multivariate analyses (across all tumor sites).

RESULTS: Fifty-five physicians were included in the study and completed online data extraction forms us-ing the charts of 110 patients. The physician sample showed a relatively even distribution for those affiliated with academic versus community hospitals (46% vs 55%). Forty (36.3%) patients were reported to have pancreatic NET (pNET), while 70 (63.6%) patients had gastrointestinal tract (GI)/Lung as the primary NET site. Univariate analysis showed the proportion of patients hospitalized increased from 32.7% during baseline to 42.1% in the progression stages. While surgeries were performed at similar proportions overall at baseline and progression, pNET patients, were more likely than GI/Lung NET patients to have undergone surgery during the baseline (33.3% vs 25.0%) and any progression pe-riods (26.7% vs 23.4%). While peptide-receptor radio-nuclide and targeted therapy utilization was low across NET types and tumor stages, GI/Lung types exhibited greater utilization of these technologies compared to pNET. Chemotherapy utilization was also greater among GI/Lung types. Multivariate analysis results demonstrat-ed that patients in first progression period were over 3 times more likely to receive chemotherapy when com-pared to baseline (odds ratio: 3.31; 95%CI: 1.46-7.48, P = 0.0041). Further, progression was associated with a greater likelihood of having a study physician visit [rela-tive risk (RR): 1.54; 95%CI: 1.10-2.17, P = 0.0117], and an increased frequency of other physician visits (RR: 1.84; 95%CI: 1.10-3.10, P = 0.0211).

CONCLUSION: Resource utilization in advanced NET in the United States is significant overall and data sug-gests progression has an impact on resource utilization

BRIEF ARTICLE





regardless of NET tumor site.


Key words: Gastrointestinal cancers; Neuroendocrine tumors; Resource utilization; Health economics; Clini-cal practice patterns

Strosberg J, Casciano R, Stern L, Parikh R, Chulikavit M, Willet J, Liu Z, Wang X, Grzegorzewski KJ. United States-based prac-tice patterns and resource utilization in advanced neuroendocrine tumor treatment. World J Gastroenterol 2013; 19(15): 2348-2354 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2348.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2348

INTRODUCTIONNeuroendocrine tumors (NET) are a group of diverse neoplasms, commonly originating in the gastrointestinal tract (GI), lungs, and pancreas. The prevalence of NET is estimated to be 35.0 per 100000 in the United States, and the age-adjusted incidence of NET has increased from an estimated 1.1 per 100000 persons in 1973 to 5.3 per 100000 persons in 2004[1]. The specific factors respon-sible for this rise in incidence are not know; however, improved classification of tumors and widespread use of endoscopy as a screening tool are likely contributors to this increase[1].

Pancreatic NET (pNET) are often classified based on hormone produced (e.g., gastrinoma, insulinoma)[2]. GI and lung NET types have traditionally been classified by site of origin, and morphologic pattern. Newer classifica-tions, however, have been formulated to reflect the con-siderable variability in histopathology and presentation within each site of origin[3]. Patients with ileocecal NET typically present with carcinoid syndrome, which results from an over production of serotonin. Symptoms and complications include diarrhea, hot flashes, bronchocon-striction, and right-sided valvular heart disease[3]. NET is commonly perceived as indolent[1]; however, due to the variability and uncertainty of symptoms associated with the disease, NET is often diagnosed in an advanced stage whereby the prognosis is poor (65% 5-year mortality rate). This is particularly true of pNET, where the 5-year mortality rate has been reported to be as high as 73%[1].

Patients with localized NETs and those with resectable oligometastases are often managed surgically. Advanced unresectable tumors are often treated with somatostatin analogs (SSA), either for control of symptoms or inhibi-tion of tumor growth[4]. Other treatment options include streptozocin or temozolomide-based chemotherapy, or targeted therapies such as sunitinib or everolimus[5,6]. Plati-num and etoposide-based regiments are typically used for poorly differentiated tumors. While guidelines to aid treatment decisions have been published[5,6], little is known about how disease progression and tumor type influence NET treatment decisions among United States physicians

in a real-world setting. Therefore, the aim of the current study is to assess advanced NET treatment patterns and resource utilization by tumor progression stage and tumor site in the United States.

MATERIALS AND METHODSStudy design In a United States-based sub-analysis of a global study (details of which have been published elsewhere[7]) Physi-cians (gastroenterologists, endocrinologists, and oncolo-gists) were contacted to take part in the research from December 2010 to January 2011. A total of 4100 physi-cians were identified in a market research database, and were recruited via an online invitation. A convenience sampling method was applied in order to achieve a fi-nal global study sample of 197 physicians, with a target sample of 55 physicians in the United States sub-study. Eligibility criteria included the following: practicing medi-cine for at least 3 years (but no more than 30 years) prior to the study date, spending at least 50% of one’s working time on patient care, treating at least 3 NET patients in the past year, and specializing in gastroenterology, endo-crinology, or oncology.

Physicians were instructed to complete internet-based data extraction forms, referring to clinical charts of pa-tients. They were asked to refer only to charts on their most recent patients who were diagnosed with advanced NET of the GI tract, lung, or pancreas - at least one patient must have experienced tumor progression. Ad-ditionally, selected patients had to have confirmed well - to moderately-differentiated tumor histology, assessed as per the 2000 World Health Organization criteria[8]. Data regarding patients with poorly differentiated tumors were not selected for this study. Proportions, frequencies, and means (respectively) were compared by NET progression stage and tumor site for the following measures:

NET progression: The main variable of interest was 3-level tumor progression stage. The baseline period, or first stage, was defined as the time between diagnosis of NET and diagnosis of tumor progression with measur-able or radiographic evidence as reported by physicians. Initial progression, or second stage, was defined as the time period during which tumor progression was first diagnosed and treated. Secondary progression, or third stage, was defined as the time point when further mea-surable or radiographic evidence for progression was found, and the following period of treatment. Since not all patients had a second progression, physicians were asked to project resource use during this period, assum-ing a duration of 12 mo for all patients. The date of the last resource use served as a proxy for patients who had no recorded first progression or second progression date. Initial and secondary progression, in aggregate, were re-ferred to as any progression (i.e., the any progression pe-riod encompasses both the initial and secondary progres-sion period, assessing resources accrued in both; Figure 1).


Strosberg J et al . United States resource utilization in advanced NET

NET type: The patient sample was further stratified into two groups, one with primary NET location as either the lung or GI, and the other with primary NET location as the pancreas. It should be noted that no pre-specified dis-tribution among NET sub-types was implemented; physi-cians were asked only to report data on their most recent patients.

Patient baseline attributes: Include age, site of metas-tasis, ECOG performance status, tumor histology and grade, performance status, comorbidities, and tumor symptoms.

Physician attributes: Include primary specialty, whether they practiced in an academic or community hospital, number of years of training and practice, and proportion of time spent in direct patient care.

Medical resources: Chemotherapy, peptide-receptor ra-dionuclide therapy (PRRT), SSA, and other pharmaceuti-cal therapies including targeted therapies; as well as study-physician and other physician visits, hospitalizations, surgical procedures such as radiofrequency ablation, microwave ablation, cryoablation, radiotherapy, hepatic arterial embolization, and transplant; Biomarker tests including neuron specific enolase, chromogranin A, pan-creatic polypeptide, neurotensin, plasma serotonin, vaso-active intestinal polypeptide, Ghrelin, human chorionic gonadotropin, Ki-67, 5-hydroxyndoleacetic acid, plasma substance P, total and free T4; other lab tests including CBC, BUN, serum glucose, Darkfield microscopy, serum creatinine, and lipid profile; and imaging test including ultrasounds, computed tomography (CT) scans, helical scans, and others.

Statistical analysisProportions and frequencies (for dichotomous) as well as means and medians (for count outcomes) were as-sessed for the study resource use categories (listed above) were compared according to NET progression stage and tumor site. Resources were assessed for any progression and any time. Any progression was measured at an event level, where first progression and second progression were considered as separate events. Thus, it included both first progression and second progression resource-use information, which may have resulted in multiple

events per patient. For any progression, utilization rates were reported as a proportion of patients per event for each specific resource. Any time included resources used at least once during baseline, first progression, or second progression. A given patient is counted only once if a particular resource is received in two or more time peri-ods. Practice patterns for any time were analyzed as the proportion of patients utilizing each resource.

Post-hoc statistical analysisMultivariable models were conducted to compare re-source use across disease progression stages. As the study was not powered to ascertain statistically significant dif-ferences, these analyses were considered secondary. Some patients did not have baseline or first progression data (Measures), and repeated measurement of outcomes over tumor stage progression produced correlated outcomes. Therefore generalized estimating equations (GEE) were employed. GEE are generalized linear models which estimate the average response over the population, as opposed to predicting responses for individuals. Utiliz-ing such an approach, models were computed for binary (yes/no) outcomes assuming a binomial distribution. For count outcomes a Poisson distribution was assumed. All models adjusted for the following covariates: primary NET location, age, country, physician specialty, tumor histology, ECOG performance status, and patient follow-up time. It should be noted that the resource use category study physician visits was assessed as a binary outcome (i.e., did a patient have ≥ 1 visit or not); however, due to the issue of convergence, a Poisson distribution was assumed for this variable rather than a binomial distribu-tion. A Bonferroni correction on P value was calculated to determine an appropriate alpha value for the statistical significance threshold (0.05/9 = 0.0055).

RESULTSPatient and physician characteristics Out of the total sample of physicians (n = 55), 13% (n = 7) primarily practiced medical oncology, 29% (n = 16) hematology/oncology, 29% (n = 16) gastroenterology, and 29% (n = 16) endocrinology. The physician sample showed a relatively even distribution for those affiliated with academic versus community hospitals (46% vs 55%). Each physician reported data on 2 patients (n = 110 to-tal). Baseline data were not available for 6 United States patients because their date of diagnosis of advanced NET and first progression were the same; however, 61 patients had at least initial progression.

Forty (36.3%) patients were reported to have pNET, while 70 (63.6%) patients had GI/Lung as the primary NET site (GI/Lung NET). The mean duration of base-line period was found to be 14.0 mo for pNET, 13.3 mo for GI/Lung, and 13.6 mo for both tumor types. The mean duration of initial progression was 5.7 mo for pNET, 7.9 mo for GI/Lung, and 7.1 mo for both tumor types. Sixty three (57.3%) patients had well differentiated


Baseline period Initial progression period

Second progression period

Diagnosis of advanced NET

Diagnostic period

Diagnosis of initial progression

Diagnosis of second progression

Watch and wait period (optional)

Figure 1 Advanced neuroendocrine tumor patient study timeline. Second progression period resource utilization data was derived from physician projec-tions. NET: Neuroendocrine tumor.



between the two groups: SSA (80.0% vs 77.1%), targeted therapy (5.0% vs 7.1%), hospitalization (55.0% vs 57.1%), helical scans (37.5% vs 38.6%), other imaging tests (57.5% vs 58.6%), and biomarker tests (65.0% vs 67.1%; Table 1).

Resource utilization by progression state and by tu-mor site is summarized in Table 2. First, chemotherapy utilization followed markedly different patterns between pNET and GI/Lung NET patients. No chemotherapy use was observed among pNET patients at baseline; however, it increased to greater than 26.7% during pro-gression. Doxorubicin, streptozocin, and temozolomide were the most frequently used chemotherapies. Among GI/Lung NET patients chemotherapy use gradually in-creased from baseline to second progression; cisplatin, 5-fluorouracil, etoposide and doxorubicin being the most frequently used chemotherapies. Second, targeted thera-pies were not widely used among pNET patients (2.8% at baseline; 1.7% during progression). GI/Lung NET patients showed marginally higher use of targeted thera-pies, with increased utilization during second progression (5.7%) over baseline (2.9%) and initial progression (2.4%). Third, PRRT was not utilized among pNET patients; however, a small number of GI/Lung NET patients received PRRT (4.4% during baseline, 4.5% during pro-gression).

Similar SSA use was observed among both pNET and GI/Lung NET patients. At baseline 63.5% of all NET patients received SSA. Utilization at first progression was marginally lower (62.3%), while second progression utilization decreased to 40.9%, with an average of 48.5% at any progression. The proportion of patients who were hospitalized increased between baseline and any pro-gression periods (32.7%-42.1% overall). Proportions of patients utilizing CT Scans increased upon progression. Ultrasound, biomarker, laboratory tests and other imag-ing decreased upon progression. Lastly, surgeries were performed at similar proportions overall at baseline and progression. pNET patients, however, were more likely than GI/Lung NET patients to have undergone surgery during the baseline (33.3% vs 25.0%) and any progression periods (26.7% vs 23.4%).

Post-hoc statistical results across tumor progression stages Patients in first progression were observed to be over 3 times more likely to receive chemotherapy when compared to baseline (odds ratio: 3.31; 95%CI: 1.46-7.48; Table 3). Patients in first progression were also more likely to have a study physician visit [relative risk (RR): 1.54; 95%CI: 1.10-2.17], as well as an increased frequency of other phy-sician visits (RR: 1.84; 95%CI: 1.10-3.10; Table 4).

DISCUSSIONThe aim of this study was to assess the resource utiliza-tion and treatment patterns of NET by tumor progres-sion stage and by tumor site. The results suggest that there is significant resource utilization associated with

tumor histology, while 47 (42.7%) patients had mod-erately differentiated tumors. Furthermore, 63 (57.3%) patients were found to have symptoms and 47 (42.7%) showed no symptoms. ECOG Performance varied as follows: 44 (40.0%) patients showed a score of 0-1, 24 showed a score of 2, 12 showed a score of 3, 5 showed a score of 4, and 25 patients had no recorded score.

Resource utilization and practice patternsResource utilization at any time and across all NET sub-types shows SSAs to be the treatment used in the highest proportion of patients (78.2%), followed by surgery and chemotherapy (used in 45.5% and 38.2% of patients, respectively). Any time resource utilization also indicates high proportions of patients undergoing hospitalization (56.4%) as well as diagnostics such as CT scans (71.8%), biomarkers (66.4%) and other lab tests (63.6%). pNET patients were proportionately less likely than GI/Lung NET patients to receive chemotherapy (30.0% vs 42.9%), CT scans (65.0% vs 75.7%), and PRRT (0.0% vs 8.6%). pNET patients were more likely to have received ul-trasound (50.0% vs 31.4%) and other laboratory tests (72.5% vs 58.6%), and to have undergone surgery (50.0% vs 42.9%), when compared to GI/Lung NET patients. Utilization of other resources were found to be similar

All NET (n = 110)

GI/lung NET (n = 70)

pNET (n = 40)

Treatments Surgery 50 (45.45) 30 (42.86) 20 (50.00) Chemotherapy2 42 (38.18) 30 (42.86) 12 (30.00) PRRT 6 (5.45) 6 (8.57) 0 (0.00) Somatostatin 86 (78.18) 54 (77.14) 32 (80.00) Targeted therapy3 7 (6.36) 5 (7.14) 2 (5.00) Resources Hospitalizations 62 (56.36) 40 (57.14) 22 (55.00) Ultrasounds 42 (38.18) 22 (31.43) 20 (50.00) CT scans 79 (71.82) 53 (75.71) 26 (65.00) Helical scans 42 (38.18) 27 (38.57) 15 (37.50) Other imaging tests4 64 (58.18) 41 (58.57) 23 (57.50) Bio marker5 73 (66.36) 47 (67.14) 26 (65.00) Other lab tests6 70 (63.64) 41 (58.57) 29 (72.50) Physician visit 109 (99.09) 40 (100.00) 69 (98.57)

Table 1 Any time resource utilization by neuroendocrine tumor type1 n (%)

1A patient was counted (once) if that individual utilized a resource at any stage of their disease; 2Chemotherapy includes 5-fluorouracil, actinomycin-D, capecitabine, carboplatin, cisplatin, cyclophosphamide, dacarbazine, doxorubicin, etoposide, gemcitabine, irinotecan, mitotane, oxaliplatin, streptozocin, temozolomide and vincristine; 3Targeted therapy includes everolimus, sunitinib, imatinib, and bevacizumab; the data collec-tion form captured these therapies under the heading “other treatments”; 4Other imaging includes positron emission tomography, stereotactic radiosurgery, metaiobenzylguanidine, magnetic resonance imaging, and chest X-ray; 5Biomarkers include neurotensin, chromogranin A, pancreatic polypeptide, neurotensin, plasma serotonin, vasoactive intestinal polypep-tide, ghrelin, human chorionic gonadotropin, Ki-67, 5-hydroxyndoleacetic acid, plasma substance P, total and free T4; 6Other lab tests include serum glucose, complete blood count, blood urea nitrogen, serum creatinine, and lipid profile were captured. PRRT: Peptide-receptor radionuclide therapy; NET: Neuroendocrine tumor; pNET: Pancreatic NET; GI: Gastrointestinal tract; CT: Computed tomography.



United States NET patients regardless of tumor site, particularly with respect to hospitalizations, surgeries, im-aging and lab tests, chemotherapy, and SSA (Table 1). As may be expected, disease progression is associated with a decrease in utilization rates for certain diagnostics in-cluding ultrasound, biomarker, laboratory tests and other imaging. However, disease progression is associated with an increase in other resources, such as other (non-study) physician visits, hospitalizations, chemotherapy, and CT scans (Table 2). In keeping with these results, the multi-variate analysis demonstrates that NET patients are more likely to receive chemotherapy and visit physicians when

disease progresses.While overall resource utilization increases with dis-

ease progression irrespective of tumor site, there were variations in practice patterns depending on whether patients had GI/Lung or pNET. For instance, pNET pa-tients were found to be less likely than GI/Lung patients to be administered targeted, chemo-, or peptide-receptor radionuclide therapies, and more likely to have under-gone surgical procedures than the GI/Lung patients. Although the heterogeneous nature of NET makes inferences about whether physicians treated patients ac-cording to current guidelines difficult, some comparisons

Baseline Any progression

All NET GI/Lung pNET All NET GI/Lung pNET

Treatments Chemotherapy1 17 (16.4) 17 (25.0) 0 (0.0) 46 (26.9) 30 (27.0) 16 (26.7) Targeted therapies2 3 (2.9) 2 (2.9) 1 (2.8) 6 (3.5) 5 (4.5) 1 (1.7) PRRT 3 (2.9) 3 (4.4) 0 (0.0) 39 (6.1) 5 (4.5) 0 (0.0) Somatostatin analogs 66 (63.5) 43 (63.2) 23 (63.9) 83 (48.5) 52 (46.9) 31 (51.7) Surgery 29 (27.9) 17 (25.0) 12 (33.3) 42 (24.6) 26 (23.4) 16 (26.7) Resources Hospitalizations 34 (32.7) 23 (33.8) 11 (30.6) 72 (42.1) 44 (39.6) 28 (46.7) Ultrasound 38 (36.5) 20 (29.4) 18 (50.0) 34 (19.9) 22 (19.8) 12 (20.0) CT scans (conventional) 62 (59.6) 43 (63.2) 19 (52.8) 109 (63.7) 72 (64.9) 37 (61.8) CT scans (helical or spiral) 23 (22.1) 15 (22.1) 8 (22.2) 51 (29.8) 33 (29.7) 18 (30.0) Other imaging3 51 (49.0) 31 (45.6) 20 (55.6) 52 (30.5) 33 (29.7) 19 (31.7) Biomarkers4 66 (63.4) 44 (64.7) 22 (61.1) 84 (49.1) 55 (49.6) 29 (48.3) Lab tests5 61 (58.7) 36 (52.9) 25 (69.4) 84 (49.1) 50 (45.1) 34 (56.7) Study physician visit 102 (98.08) 66 (97.06) 36 (100.00) 165 (96.49) 107 (96.40) 58 (96.67) Other physician visit 77 (74.04) 50 (73.53) 27 (75.00) 143 (83.62) 92 (82.88) 51 (85.00)

Table 2 Resource utilization by progression state n (%)

1Chemotherapy includes 5-fluorouracil, actinomycin-D, capecitabine, carboplatin, cisplatin, cyclophos-phamide, dacarbazine, doxorubicin, etoposide, gemcitabine, irinotecan, mitotane, oxaliplatin, strepto-zocin, temozolomide and vincristine; 2Targeted Therapy includes everolimus, sunitinib, imatinib, and bevacizumab; the data collection form captured these therapies under the heading “other treatments”; 3Other imaging includes positron emission tomography, stereotactic radiosurgery, metaiobenzylgua-nidine, magnetic resonance imaging, and chest X-ray; 4Biomarkers include neurotensin, chromogranin A, pancreatic polypeptide, neurotensin, plasma serotonin, vasoactive intestinal polypeptide, ghrelin, human chorionic gonadotropin, Ki-67, 5-hydroxyndoleacetic acid, plasma substance P, total and free T4; 5Other lab tests include serum glucose, complete blood count, blood urea nitrogen, serum creatinine, and lipid profile were captured. PRRT: Peptide-receptor radionuclide therapy; NET: Neuroendocrine tumor; pNET: Pancreatic NET; GI: Gastrointestinal tract; CT: Computed tomography.

Resource1 Beta Odds 95%CI P

estimate ratio Lower bound Upper bound value Chemotherapy 1.1962 3.3074 1.4625 7.4795 0.00412

Somatostatin analogs

0.5298 1.6986 0.8038 3.5892 0.1652

Surgery 0.4551 1.5763 0.7632 3.2556 0.2188 Hospitalization 0.3227 1.3808 0.6920 2.7550 0.3599 Other physician visit

0.7336 2.0826 0.9185 4.7221 0.0790

Table 3 Multivariate analysis for resource use prevalence among patients at first progression vs baseline1

1Generalized estimating equations model (assuming binomial distribu-tion and unstructured covariance structure) while controlling for primary neuroendocrine tumor location, age, Eastern Cooperative Oncology Group status, tumor histology, physician specialty and follow-up time; 2Value denotes statistical significance.

Resource Beta Rate 95%CI P

estimate ratio Lower bound Upper bound value

Study physician visit1

0.4346 1.5444 1.1014 2.1656 0.0117

Hospitalizations2 -0.0617 0.9402 0.2648 3.3379 0.9240 Study physician visits2

0.1321 1.1412 0.8330 1.5635 0.4108

Other physician visits2

0.6116 1.8433 1.0961 3.0999 0.0211

Table 4 Multivariate analysis for patient hospitalization and physician visit frequency at first progression vs baseline

1Generalized estimating equations model (assuming binomial distribu-tion and unstructured covariance structure) while controlling for primary neuroendocrine tumor location, age, Eastern Cooperative Oncology Group status, tumor histology, physician specialty and follow-up time; 2Value denotes statistical significance.



can be made with caution[5,6]. The high utilization of surgical procedures and SSA observed here is consistent with NCCN guidelines[5]. It is possible that utilization of targeted therapies (everolimus and sunitinib) in pNET was low because of their novelty, limited availability, and restricted reimbursement by managed care organizations during the patient data collection time period (December 2010-January 2011). Furthermore, recent clinical trial data supporting the use of these therapies were not available when the study was conducted[9,10]. Inferences regarding the observed differences in utilization of targeted and PRRT therapies between pNET and GI/Lung types are inconclusive.

The low use of targeted therapies overall should be considered more closely. Recent clinical trial data sug-gest sunitinib and everolimus improve progression-free survival by 6-7 mo compared to placebo plus best supportive care[9-11]. While more research is necessary to elucidate differences in adverse event reporting (and quality of life more generally) between patients receiving chemotherapy versus targeted agents, these trials suggest that targeted therapies are associated with relatively low rates of adverse events, and may be more tolerable than chemotherapy[9,11].

Rates of chemotherapy use are higher than one might expect (42.86% in GI/Lung NET and 30.00% in pNET); especially given that chemotherapy is approved only in well- to moderately-differentiated pNET. While the reasons for these relatively high rates cannot be known for certain, it is possible that physicians are using chemotherapy regimens off-label, as a result of having few alternative treatments available for the advanced GI/Lung and pancreatic NET populations.

Interestingly, we found similar baseline durations for GI/Lung and pNET types; with marginally shorter first progression duration in pNET (secondary progression duration could not be ascertained). As pNET has been re-ported to have a more aggressive disease course[1], caution should be taken in interpreting these results. It is plausible that the operational definition of disease progression in the current study is not sensitive to changes in the tumor pathology which lead to the mean differences in survival and progression, generally observed elsewhere[1].

In comparison to results from a global analysis[7], this United States-specific sub-analysis shows several differences in resource utilization and practice patterns. Specifically, cross-sectional resource utilization is lower in the United States for certain categories including chemo-therapy, PRRT, and notably hospitalizations. Multivariate analyses are in line with those from the global analysis, showing an increase in chemotherapy and physician visits associated with progression. However, while the global analysis also showed an increase in SSA use with progres-sion, the United States sub-analysis data do not.

LimitationsDue to possible selection bias and the exclusion criteria used to identify physicians for study eligibility, the sample

of participating physicians may differ from the general population of physicians in ways that may differentially affect the study results. Some patients are missing base-line data (n = 6), and for those patients with initial pro-gression data but not secondary progression data, hypo-thetical resource use projections were made by the study physicians. Because of the cross-sectional nature of the study, recall bias may have affected the observed results. Additionally, the self-reported nature of the data limited the ability to assess the variety of symptoms associated with NET clinical syndromes, ancillary treatments used to palliate hormonal symptoms. Targeted therapy utiliza-tion was likely under-reported due to the structure of the data collection form, which relied on open-ended re-sponses for this treatment category. As noted above, the study findings show high rates of chemotherapy usage. While the reported results may represent off-label usage, it is also possible that patients with poorly-differentiated NET were included, as etoposide- and cisplatin- based regimens are approved in this indication.

Overall study results confirm that advanced NET in the United States is associated with significant resource use regardless of tumor site. Resource utilization fol-lows a consistent pattern across NET tumor types as the disease progresses, suggesting progression has an impact on resource utilization regardless of tumor site. Targeted therapy use (everolimus and sunitinib) was reported to be relatively low compared to other treatments, likely due to pending regulatory approval at the time of the study. However, with the regulatory approvals in place, targeted therapy use is expected to increase in the future. Further research involving larger patient populations is warranted to fully depict the nature of NET resource utilization and related treatment patterns and to define the real world economic impact of NET disease progression.

ACKNOWLEDGMENTSEditorial assistance was provided by Jan-Samuel Wagner, who received compensation from LA-SER Analytica for his work.

COMMENTSBackgroundNeuroendocrine tumors (NET) are a group of diverse neoplasms, commonly originating in the gastrointestinal tract, lungs, and pancreas. The prevalence of NET is estimated to be 35.0 per 100000 in the United States.Research frontiersWhile guidelines to aid treatment decisions have been published, little is known about how disease progression and tumor type influence NET treatment deci-sions among United States physicians in a real-world setting.Innovations and breakthroughsThis study assessed the resource utilization and treatment patterns of NET by tumor progression stage and by tumor site. Overall study results confirm that advanced NET in the United States is associated with significant resource use regardless of tumor site.ApplicationsFurther research involving larger patient populations is warranted to fully depict the nature of NET resource utilization and related treatment patterns and to

COMMENTS



define the real world economic impact of NET disease progression.TerminologyResource categories used in the resource utilization analysis include: Treat-ments (e.g., surgery, chemotherapy, radiotherapy, targeted therapies), hospital-izations and physician visits, diagnostic tests (biomarkers, imaging, laboratory tests).Peer reviewThis is a well-written article summarizing resource utilization of treatments for neuroendocrine tumors in the United States based on anonymous physician surveys. While such a study is inherently subject to recall bias, the manuscript lists this potential pitfall in the discussion section.

REFERENCES1 Yao JC, Hassan M, Phan A, Dagohoy C, Leary C, Mares

JE, Abdalla EK, Fleming JB, Vauthey JN, Rashid A, Evans DB. One hundred years after “carcinoid”: epidemiology of and prognostic factors for neuroendocrine tumors in 35,825 cases in the United States. J Clin Oncol 2008; 26: 3063-3072 [PMID: 18565894 DOI: 10.1200/JCO.2007.15.4377]

2 Batcher E, Madaj P, Gianoukakis AG. Pancreatic neuroen-docrine tumors. Endocr Res 2011; 36: 35-43 [PMID: 21226566 DOI: 10.3109/07435800.2010.525085]

3 Pinchot SN, Holen K, Sippel RS, Chen H. Carcinoid tu-mors. Oncologist 2008; 13: 1255-1269 [PMID: 19091780 DOI: 10.1634/theoncologist.2008-0207]

4 Rinke A, Müller HH, Schade-Brittinger C, Klose KJ, Barth P, Wied M, Mayer C, Aminossadati B, Pape UF, Bläker M, Harder J, Arnold C, Gress T, Arnold R. Placebo-controlled, double-blind, prospective, randomized study on the effect of octreotide LAR in the control of tumor growth in patients with metastatic neuroendocrine midgut tumors: a report from the PROMID Study Group. J Clin Oncol 2009; 27: 4656-4663 [PMID: 19704057 DOI: 10.1200/JCO.2009.22.8510]

5 NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines): Neuroendocrine Tumors Version 1.2011. Na-tional Comprehensive Cancer Network (NCCN), 2011

6 Kulke MH, Anthony LB, Bushnell DL, de Herder WW, Goldsmith SJ, Klimstra DS, Marx SJ, Pasieka JL, Pommier RF, Yao JC, Jensen RT. NANETS treatment guidelines: well-differentiated neuroendocrine tumors of the stomach and pancreas. Pancreas 2010; 39: 735-752 [PMID: 20664472 DOI: 10.1097/MPA.0b013e3181ebb168]

7 Casciano R, Wang X, Stern L, Parikh R, Chulikavit M, Willet J, Liu Z, Strosberg J, Cadiot G, Riechelmann R. International Practice Patterns and Resource Utilization in the Treatment of Neuroendocrine Tumors. Pancreas 2013 Jan 25; Epub ahead of print [PMID: 23357923]

8 Bodei L, Ferone D, Grana CM, Cremonesi M, Signore A, Dierckx RA, Paganelli G. Introduction: Neuroendocrine Tumors. 2009. Available from: URL: http: //dissertations.ub.rug.nl/FILES/faculties/medicine/2009/l.bodei/01c1.pdf

9 Yao JC, Shah MH, Ito T, Bohas CL, Wolin EM, Van Cutsem E, Hobday TJ, Okusaka T, Capdevila J, de Vries EG, Tomassetti P, Pavel ME, Hoosen S, Haas T, Lincy J, Lebwohl D, Öberg K. Everolimus for advanced pancreatic neuroendocrine tu-mors. N Engl J Med 2011; 364: 514-523 [PMID: 21306238 DOI: 10.1056/NEJMoa1009290]

10 Raymond E, Dahan L, Raoul JL, Bang YJ, Borbath I, Lom-bard-Bohas C, Valle J, Metrakos P, Smith D, Vinik A, Chen JS, Hörsch D, Hammel P, Wiedenmann B, Van Cutsem E, Patyna S, Lu DR, Blanckmeister C, Chao R, Ruszniewski P. Sunitinib malate for the treatment of pancreatic neuro-endocrine tumors. N Engl J Med 2011; 364: 501-513 [PMID: 21306237 DOI: 10.1056/NEJMoa1003825]

11 Kulke MH, Bendell J, Kvols L, Picus J, Pommier R, Yao J. Evolving diagnostic and treatment strategies for pancreatic neuroendocrine tumors. J Hematol Oncol 2011; 4: 29 [PMID: 21672194 DOI: 10.1186/1756-8722-4-29]

P- Reviewer Strosberg J S- Editor Gou SX L- Editor A E- Editor Li JY


Patient comfort and quality in colonoscopy

Vivian E Ekkelenkamp, Kevin Dowler, Roland M Valori, Paul Dunckley

Vivian E Ekkelenkamp, Kevin Dowler, Roland M Valori, Paul Dunckley, Department of Gastroenterology, Gloucestershire Hospitals NHS Trust, Gloucester GL1 3NN, United KingdomVivian E Ekkelenkamp, Department of Gastroenterology and Hepatology, Erasmus University Medical Center, 3000 CA Rot-terdam, The NetherlandsAuthor contributions: Ekkelenkamp VE and Dowler K contrib-uted to conception and design, analysis and interpretation of the data, drafting of the article, final approval of the article; Valori RM contributed to conception and design, critical revision of the article for important intellectual content, final approval of the ar-ticle; Dunckley P contributed to conception and design, analysis and interpretation of the data, critical revision of the article for important intellectual content, final approval of the article.Correspondence to: Vivian E Ekkelenkamp, MD, Department of Gastroenterology and Hepatology, Erasmus University Medi-cal Center, PO Box 2040, 3000 CA Rotterdam, The Netherlands. [email protected]: +31-10-7032983 Fax: +31-10-7034682Received: October 25, 2012 Revised: December 19, 2012Accepted: January 17, 2013Published online: April 21, 2013

AbstractAIM: To explore the relationship of patient comfort and experience to commonly used performance indica-tors for colonoscopy.

METHODS: All colonoscopies performed in our four endoscopy centres are recorded in two reporting sys-tems that log key performance indicators. From 2008 to 2011, all procedures performed by qualified en-doscopists were evaluated; procedures performed by trainees were excluded. The following variables were measured: Caecal intubation rate (CIR), nurse-report-ed comfort levels (NRCL) on a scale from 1 to 5, polyp detection rate (PDR), patient experience of the proce-dure (worse than expected, as expected, better than expected), and use of sedation and analgesia. Pearson’s correlation coefficient was used to identify relation-ships between performance indicators.

RESULTS: A total of 17027 colonoscopies were per-formed by 23 independent endoscopists between 2008 and 2011. Caecal intubation rate varied from 79.0% to 97.8%, with 18 out of 23 endoscopists achieving a CIR of > 90%. The percentage of patients experiencing significant discomfort during their procedure (defined as NRCL of 4 or 5) ranged from 3.9% to 19.2% with an average of 7.7%. CIR was negatively correlated with NRCL-45 (r = -0.61, P < 0.005), and with poor patient experience (r = -0.54, P < 0.01). The average dose of midazolam (mean 1.9 mg, with a range of 1.1 to 3.5 mg) given by the endoscopist was negatively correlated with CIR (r = -0.59, P < 0.01). CIR was positively correlated with PDR (r = 0.44, P < 0.05), and with the numbers of procedures performed by the endoscopists (r = 0.64, P < 0.01).

CONCLUSION: The best colonoscopists have a higher CIR, use less sedation, cause less discomfort and find more polyps. Measuring patient comfort is valuable in monitoring performance.


Key words: Endoscopy; Colonoscopy; Quality; Comfort; Performance

Ekkelenkamp VE, Dowler K, Valori RM, Dunckley P. Patient comfort and quality in colonoscopy. World J Gastroenterol 2013; 19(15): 2355-2361 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2355.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2355

INTRODUCTIONColonoscopy is a very common procedure performed to investigate colonic symptoms and screen for cancer and polyps[1]. It has always been known that colonoscopy can cause harm and even death, but poor quality colonos-copy has only been linked to other important outcomes in the last decade. Back-to-back colonoscopies identified

BRIEF ARTICLE





important missed lesions[2], fast withdrawal times were as-sociated with lower adenoma detection rates[3,4], and low adenoma detection rates are associated with higher rates of missed cancer[5]. Several studies have shown that colo-noscopy misses, and fails to “protect” individuals from, cancer[6-10]. Thus there has been increasing attention on the quality of colonoscopy[11,12], especially in the context of colorectal cancer screening where there is potential for causing harm to otherwise healthy people.

In order to assess quality, the British Society of Gas-troenterology (BSG) has defined a set of indicators and auditable outcomes for colonoscopy[13]. Important key performance indicators are an unadjusted caecal intuba-tion rate (CIR) of > 90% and an adenoma detection rate of > 10%. CIR is globally recognised as the main mea-sure of competence in colonoscopy in a non-screening setting and is one of the key measures used in a colorec-tal cancer screening. It is an absolute requirement for total colonoscopy, and poor completion rates may be one reason why colonoscopy does not prevent cancer in the right colon[14-16]. However, there are several factors that can influence the CIR and thus the performance of an endoscopist[17].

A possible consequence of having CIR as a prime in-dicator of quality is that individuals with poor technique may push harder and persist for longer to achieve the standard. This could lead to more pain and the adminis-tration of more sedation. Clearly this could cause unnec-essary harm to patients, including more perforations and sedation related complications[18].

To prevent this eventuality the BSG proposed that other key performance indicators should be sedation and comfort[13]. Standards were set for sedation, particularly for older patients, but there is no standard for comfort so it was designated an essential “auditable outcome”: a standard that should be measured, reviewed and acted upon, but not one for which an absolute performance level could be defined.

Various studies have addressed patient pain or dis-comfort during colonoscopy, and identified predictive factors of pain[19-22]. However, none have explored the use of sedation and patient comfort as measures of per-formance.

This study aims to analyse the different factors affect-ing an individual’s performance in diagnostic colonos-copy and to explore the use of patient comfort scores as performance indicators for colonoscopy.

MATERIALS AND METHODSAll colonoscopies performed in the four endoscopy units in one healthcare organisation are recorded on two electronic endoscopy reporting systems (SQL scope and Unisoft), which log the key performance indicators defined by the BSG: CIR; polyp detection rate (PDR) (adenomatous and hyperplastic); and sedation (invariably opiates and midazolam). Colonoscopies performed by all independently practicing endoscopists during the four

year period of 2008 to 2011 were included in the analy-sis. Throughout the United Kingdom (and in this study) an unadjusted CIR is used: the rate is not adjusted at all, even for obstructions and poor bowel preparation.

Comfort is assessed using nurse-reported comfort levels (NRCL) on a 5-point scale, which is shown in Ta-ble 1. The attending endoscopy nurses assess the comfort of the patient during the procedure without discussing it with the endoscopist, and record it immediately. For this study, significant discomfort was defined as a NRCL of either level 4 or 5 (NRCL-45).

The patient experience (PE) is captured by the recov-ery nurse before the patient leaves the unit. Patients are asked whether their experience was: better than expected, as expected, or worse than expected. Both the comfort scores and the PE are recorded on the hospital adminis-tration system. The colonoscopists are identified in the reporting system so that all data can be linked to indi-viduals.

The influence of midazolam and opiate analgesia on NRCL and worse patient experience (PE-W) was also ex-plored. A further variable used in this analysis was PDR. The dataset for PDR was less complete as our endoscop-ic reporting systems did not mandate the input of PDR until September 2010.

A complete dataset was not available for all variables. Table 2 lists the numbers of colonoscopies where data was not documented.

Statistical analysisRelationships of CIR to comfort (NRCL-45), sedation and PE-W were explored using Pearson’s correlation coefficient. The relationship between the number of procedures performed per year and CIR was also studied using Pearson’s correlation coefficient. Only endoscopists performing colonoscopies for the full four year period were included in this analysis. A Mann-Whitney U test was used to assess whether there was a difference in the number of colonoscopies performed by those with a higher CIR.

RESULTSDuring the four year period from 1 January 2008 to 28 December 2011, 17027 colonoscopies were performed by 23 colonoscopists; 88.8% of procedures were performed


Ekkelenkamp VE et al . Patient comfort and quality in colonoscopy

Nurse-reported comfort levels Descriptors

No discomfort Talking/comfortable throughout Minimal discomfort 1 or 2 episodes of mild discomfort with

no distress Mild discomfort More than 2 episodes of discomfort

without distress Moderate discomfort Significant discomfort experienced

several times with some distress Severe discomfort Frequent discomfort with significant

distress

Table 1 Five-point scale of nurse-reported comfort levels

on service lists; 11.2% of procedures were performed on bowel cancer screening lists. Data is reported as perfor-mance data for these colonoscopists.

Colonoscopy completionCIR varied from 79.0% to 97.8%, with 18 out of 23 endoscopists achieving > 90%. Four endoscopists com-pleted colonoscopy in 85%-89% of the procedures and 1 locum endoscopist in 79%. The effect of the number of colonoscopies performed on CIR was studied. Only endoscopists performing colonoscopy during the whole period were included in this analysis alone (n = 16). CIR was positively correlated with the average number of procedures performed per annum (r = 0.64, P < 0.01) (Figure 1A). The average CIR for these 16 endoscopists was 94.3%. Endoscopists with a CIR of less than 94.3% performed an average of 139.9 colonoscopies per year whereas those with a CIR of greater than 94.3% per-

formed an average of 245.9 procedures (P < 0.05).

Patient comfortThe percentage of patients experiencing significant dis-comfort during their procedure (defined as NRCL of 4 or 5) ranged from 3.9% to 19.2% with an average of 7.7%. There was significant negative correlation between NRCL-45 and CIR (r = -0.61, P < 0.005) (Figure 1B).

Patient experienceA worse than expected patient experience (PE-W) was recorded in 4.3% of procedures (1.2%-12.0%). PE-W correlated negatively with CIR (r = -0.54, P < 0.01) (Figure 1C). There was strong correlation between NRCL-45 and PE-W (r = 0.92, P < 0.0001). Only 2% of patients with a NRCL of 1, 2 or 3 rated the procedure as worse than expected compared to 28% of patients with a NRCL of 4 or 5.

SedationThe sedation used in our endoscopy units for colonosco-py is usually a combination of an opiate (either pethidine or fentanyl) and midazolam. An increasing proportion of procedures are done without sedation.

The average amount of midazolam used per proce-dure was 1.9 mg, varying from 1.1 mg to 3.5 mg. Average dose of midazolam was negatively correlated with CIR (r = -0.59, P < 0.01). To assess whether this was due to higher doses of midazolam being used by colonoscopists with worse CIRs or to a higher rate of no sedation being used by those with better CIRs, the analysis was repeated for the sedated colonoscopies only. In this sedated group


Variable Total number of colonoscopies with missing data

Percent of colonoscopies with complete data

CIR 0 100% NRCL 520 95% PE 1647 84% Midazolam 62 99% Opiates 65 99% Polyp detection 3863 71%

Table 2 Data completeness on colonoscopies performed from 2008-2011

CIR: Caecal intubation rate; NRCL: Nurse-reported comfort levels; PE: Pa-tient experience.

85 90 95 100 CIR (%)

500

400

300

200

100

0

No.

of

colo

ns p

er a

nnum

75 80 85 90 95 100 CIR (%)

25

20

15

10

5

0

NRCL

-45

(%)

75 80 85 90 95 100 CIR (%)

60

50

40

30

20

10

0

PDR (

%)

75 80 85 90 95 100 CIR (%)

14

12

10

8

6

4

2

0

PE-W

(%

)

A B

C D

Figure 1 The figure shows correlations of caecal intubation rate with number of annual colonoscopies (A), nurse-reported comfort level of 4-5 (B), patient experience worse than expected (C) and polyp detection rate (D). CIR: Caecal intubation rate; NRCL: Nurse-reported comfort levels; PE-W: Worse patient experi-ence; PDR: Polyp detection rate.



pears they are more vigilant, identifying more polyps than those with lower intubation rates. The results also show that better colonoscopists perform more colonoscopies. In this study, colonoscopists with a CIR of greater than 94.3% performed an average of 245.9 procedures per annum compared with 139.9 for the endoscopists with a CIR lower than 94.3%. This is consistent with previously published data[23]. This study adds further weight to the argument that there should be a minimum number of procedures performed by an endoscopist per annum to maintain their skills.

There are very large variations in the use of sedation across the world ranging from virtually none in Scandi-navian countries to increasing use of deep sedation with propofol in Australia, France, Germany and the United States. The use of sedation is still not as safe as we would like[24]. In the United States, it is now common to perform a colonoscopy with propofol and it has been shown that patient satisfaction is higher than with other types of se-dation[25,26]. Conversely, a Scandinavian study showed that high sedation rates were not associated with less painful colonoscopies[21]. Another Scandinavian group showed that sedation is not necessary for screening individuals, and an American group clearly believes unsedated colo-noscopy has a place and has coined the phrase “sedation-risk-free colonoscopy”[27].

In our study, the average midazolam dose used was negatively correlated with CIR: the more often the cae-cum was reached, the less midazolam was used and, fur-thermore, patients did not experience more discomfort. These findings demonstrate that colonoscopy can be performed without deep sedation and without significant discomfort in the majority of patients.

Sedation alters the perception and recollection of discomfort experienced during colonoscopy. Thus the patient cannot necessarily provide an accurate guide of pain during the procedure. An alternative to the patient assessing discomfort is for the endoscopist or endoscopy nurse to make the assessment. We ask the nurse to make this assessment because they are more likely to be objec-tive and have the benefit of observing all colonoscopists perform colonoscopy. Our comfort scale has not been formally validated but it assesses three components of discomfort: severity, frequency and the extent to which it is distressing the patient. Interestingly there was strong correlation of this nurse-assessed scale with patient re-ports (r = 0.92, P < 0.0001). Only 2% of patients with a NRCL of 1, 2 or 3 rated the experience as worse than expected. It is likely that different nurses rate discomfort differently but that discrepancy would be applied to all colonoscopists. There are always two nurses in the pro-cedure room during a colonoscopy and the nurses are encouraged to discuss the comfort score with each other before making a final decision.

The assessment of patient experience is different from that of discomfort by a health professional. Because of the effect of sedation on experience and recall, we chose not to ask patients to rate comfort but to rate their experience of the procedure compared to what they expected. This mea-

(n = 14870) there was a significant correlation between average midazolam usage and CIR (r = -0.60, P < 0.005). The percentage of colonoscopies performed without sedation was not significantly correlated with CIR (r = 0.30, P = 0.13). There was also a correlation between midazolam dose and NRCL-45 (r = 0.54, P < 0.01) but not for midazolam and PE-W (r = 0.37, P = 0.08). In unsedated patients, there was no correlation between CIR with either NRCL-45 (r = -0.09, P > 0.05) or PE-W (r = -0.01, P > 0.05). However, the numbers were smaller in this group, especially for colonoscopists who rarely performed colonoscopy without sedation. Furthermore, the more uncomfortable procedures would have led to patients being given sedation thereby introducing bias.

There were 4 endoscopists who used fentanyl and 19 who used pethidine as their opiate of preference. To ensure uniformity, the endoscopists using fentanyl were excluded from the analysis on analgesia. There was no significant correlation between average pethidine dose, and CIR (r = -0.39, P > 0.05), NRCL-45 (r = 0.17, P > 0.05) or PE-W (r = 0.06, P > 0.05).

Polyp detectionIn this study, the average PDR (including both hyper-plastic and adenomatous polyps) was 31.8% (range 9.2%-51.9%). There was a positive correlation between PDR and CIR (r = 0.44; P < 0.05) (Figure 1D).

Performance indicators over timeTable 3 shows data on the CIR, NRCL-45, PE-W, mid-azolam usage and PDR for each year. A consistent im-provement is seen in all variables between 2008 and 2011.

DISCUSSIONIn this study, we explored factors that predict high per-formance in colonoscopy. Ideally a colonoscopy should be safe, complete and comfortable. It should also detect and remove safely and completely all important lesions. The CIR has become the most universally recognised per-formance indicator. While striving to achieve and exceed target CIRs there is a potential danger that a colonosco-pist will cause more discomfort, or put the patient at risk of perforation and excessive sedation. The results of this study indicate the reverse: those colonoscopists with the highest CIR use less sedation, cause less discomfort and achieve a better patient experience. Furthermore, it ap-

Year CIR NRCL-45 PE-W Midazolam, mg (mean dose) PDR

2008 93.3% 10.0% 5.6% 2.3 29.6% 2009 93.4% 7.8% 4.2% 2.0 27.4% 2010 94.6% 7.6% 4.1% 1.8 31.9% 2011 95.9% 5.8% 3.7% 1.7 37.7%

Table 3 Improvements in key performance indicators between 2008-2011

CIR: Caecal intubation rate; NRCL: Nurse-reported comfort levels; PE-W: Worse patient experience; PDR: Polyp detection rate.



sure was chosen on the assumption that a worse experience than expected was unacceptable and a better or as expected experience was acceptable. Clearly a patient’s rating will be affected by the way they are prepared for the procedure and hearsay. It is possible that the patients of a colonoscopist who routinely tells them that they will experience terrible pain will rarely report the experience worse than expected. We cannot control or assess this possibility. It seems very unlikely that the colonoscopists with high CIR tell their pa-tients that they will have a bad experience when the nurses rate them as causing less pain than their colleagues.

Sedation practice varies but the majority use a combi-nation of opiates and sedatives, and an increasing number use no sedation. It is therefore difficult to make meaning-ful comparisons. However, whichever way the data was examined the same conclusion was drawn: colonoscopists with high CIR use less sedation (midazolam). One argu-ment against using CIR (especially an unadjusted rate) as a performance indicator is that endoscopists may use exces-sive force to ensure that the caecum is intubated. How-ever, data from this study shows that comfort scores were better in colonoscopists with a higher CIR and there was no evidence that they were using more opiate analgesia.

A possible bias in this study is case mix. It is pos-sible that the colonoscopists with the highest CIR were colonoscoping the easiest patients. Previous studies have identified factors that predict lower CIR: female sex, older patient and the presence of diverticular disease[19,28]. Until recently our reporting system was not capturing diagno-ses according to a recognised coding system so it is not possible to determine the proportion of patients with diverticular disease in each of the colonoscopist cohorts. About 30% of patients listed for colonoscopy are pooled and listed with the endoscopist that is first available. This sharing of patients reduces the likelihood that an indi-vidual will be scoping a particularly difficult group of pa-tients. Furthermore, colonoscopists with a higher CIR are often asked to scope “difficult” patients meaning case mix is more likely to affect them adversely. Another possible source of case mix bias is bowel cancer screening (FOBT positive) patients because only accredited colonoscopists are allowed to colonoscope them. These patients are usu-ally asymptomatic and may therefore be easier to colo-noscope; there is however no data available on this topic. They certainly have more polyps than other patients, which may bias polyp detection data. Whilst only 10% of all colonoscopies are performed on screen positive patients, up to 50% of the procedures performed by the bowel cancer screening colonoscopists are on screened patients. However, only 2 of the 23 colonoscopists for the majority of the study period were screening accredited and several of the high performing (high CIR, low seda-tion, low discomfort) colonoscopists were not screening colonoscopists. Another possible confounder is the use of unadjusted CIR instead of the CIR being adjusted for poor bowel preparation or obstruction. CIR would invari-ably have been higher if adjusted. We chose to use unad-justed CIR as this is standard practice in the United King-

dom for quality assessment. The number of cases with poor bowel preparation or obstruction was probably low and there is no reason to believe that one endoscopist was exposed to all those cases especially as the bowel prepara-tion was standardised across all four units. Therefore, we feel that it is unlikely that the use of adjusted CIR would influence the main findings in this study.

Adenoma detection rate is a key performance indica-tor and has been shown to be related to the chance of post colonoscopy colorectal cancer[5]. Ideally, adenoma detection rate should be recorded but linking endoscopic with pathology databases is difficult, and late entry of pa-thology data into an endoscopic database is fraught with problems. In view of this difficulty, we have used polyp rather than adenoma detection in this study whilst recog-nising the limitations of this approach. However, recent studies have shown that PDR can be used as a marker for ADR because they are highly correlated[29,30]. A recent study of colonoscopies performed on the United King-dom Bowel Cancer Screening programme also found a positive correlation between adenoma detection rate and caecal intubation rate[31].

In each of the endoscopy units included in this study there is a robust quality assurance process for colonos-copy. All colonoscopists are fed back their performance indicators on a quarterly basis. If any colonoscopist underperforms, the endoscopy lead will discuss this with them and, if appropriate, offer further support and training. Furthermore most of the colonoscopists in this study have completed a training the trainer course during which there is detailed discussion of colonoscopy tech-nique and ways to improve it. These approaches are likely to have contributed to the consistent improvements in CIR, patient comfort/experience and PDR. One aspect of quality assurance we did not address in this study is occurrence of complications in colonoscopy. Our study explores the intubation performance, not performance of therapy. There were no diagnostic perforations during the period of this study and no procedure related deaths. Literature tells us that less than 1:1000 patients will suffer from a complication of colonoscopy without biopsies or polypectomy[32]. A much larger sample size would be required to test the relationship of key performance indi-cators and complication rates.

In conclusion, this study demonstrates that the best colonoscopists are doing more colonoscopies per year, get to the caecum more often, use less sedation, cause less discomfort, achieve a better patient experience and find more polyps. We believe that measurement of pa-tient comfort and experience, use of sedation, together with CIR, could provide a richer picture of a colonosco-pist’s performance, at least of intubation skills.

This study shows that the best colonoscopists, i.e., the ones that have the highest CIR and PDR, also have the best comfort scores, despite using less sedation. Measure-ment of patient comfort during sedated or non sedated colonoscopy may provide useful information on endos-copist performance.



COMMENTSBackgroundCaecal intubation rate (CIR), use of sedation and adenoma detection rate are key performance indicators for colonoscopy. CIR is the most widely recognised measure of performance. Patient comfort is not routinely assessed; it is un-known whether higher intubation rates are achieved at the expense of greater patient discomfort, deeper sedation and possibly higher risk. Research frontiersQuality in colonoscopy is an important topic, especially with the introduction of bowel cancer screening programs in different countries. Caecal intubation rate is a key performance indicator of quality. Patient comfort is an auditable out-come, but there are little data on the topic.Innovations and breakthroughsMeasuring patient comfort through nurse assessment provides valuable infor-mation about performance of endoscopists. Performing colonoscopies under deep sedation is not necessary to achieve good patient comfort. The colonos-copists that get to the caecum most often and see and remove the most polyps, have the best patient comfort scores.ApplicationsMeasuring patient comfort through nurse assessment is a valuable addition in measuring performance. Nurse assessment correlates well with patient experi-ence. People believe that, in the future, assessment of patient comfort, next to CIR and ADR, could be a good performance indicator. TerminologyNurse-reported comfort level: assessment of patient comfort during the proce-dure by endoscopy nurses. Patient experience: the patient’s experience of the procedure, assessed by the patient himself directly after the colonoscopy.Peer reviewThe paper about patient comfort and quality in colonoscopy is very interesting. Questions were raised on influence of using adjusted CIR on the results, and on the relationship of age, gender and previous surgical procedures with the nurse-reported comfort levels and patient experience.

REFERENCES1 Lieberman DA, Weiss DG, Bond JH, Ahnen DJ, Garewal

H, Chejfec G. Use of colonoscopy to screen asymptomatic adults for colorectal cancer. Veterans Affairs Cooperative Study Group 380. N Engl J Med 2000; 343: 162-168 [PMID: 10900274 DOI: 10.1056/NEJM200007203430301]

2 Rex DK, Cutler CS, Lemmel GT, Rahmani EY, Clark DW, Helper DJ, Lehman GA, Mark DG. Colonoscopic miss rates of adenomas determined by back-to-back colonoscopies. Gastroenterology 1997; 112: 24-28 [PMID: 8978338]

3 Barclay RL, Vicari JJ, Greenlaw RL. Effect of a time-dependent colonoscopic withdrawal protocol on adenoma detection during screening colonoscopy. Clin Gastroenterol Hepatol 2008; 6: 1091-1098 [PMID: 18639495 DOI: 0.1016/j.cgh.2008.04.018]

4 Barclay RL, Vicari JJ, Doughty AS, Johanson JF, Greenlaw RL. Colonoscopic withdrawal times and adenoma detec-tion during screening colonoscopy. N Engl J Med 2006; 355: 2533-2541 [PMID: 17167136]

5 Kaminski MF, Regula J, Kraszewska E, Polkowski M, Wojciechowska U, Didkowska J, Zwierko M, Rupinski M, Nowacki MP, Butruk E. Quality indicators for colonoscopy and the risk of interval cancer. N Engl J Med 2010; 362: 1795-1803 [PMID: 20463339]

6 Bressler B, Paszat LF, Chen Z, Rothwell DM, Vinden C, Rabeneck L. Rates of new or missed colorectal cancers af-ter colonoscopy and their risk factors: a population-based analysis. Gastroenterology 2007; 132: 96-102 [PMID: 17241863 DOI: 10.1053/j.gastro.2006.10.027]

7 Ferrández A, Navarro M, Díez M, Sopena F, Roncalés P, Polo-Tomas M, Sáinz R, Lanas A. Risk factors for advanced lesions undetected at prior colonoscopy: not always poor preparation. Endoscopy 2010; 42: 1071-1076 [PMID: 20960390]

8 Singh H, Nugent Z, Demers AA, Bernstein CN. Rate and predictors of early/missed colorectal cancers after colonos-copy in Manitoba: a population-based study. Am J Gastroen-terol 2010; 105: 2588-2596 [PMID: 20877348]

9 Pohl H, Robertson DJ. Colorectal cancers detected after colonoscopy frequently result from missed lesions. Clin Gastroenterol Hepatol 2010; 8: 858-864 [PMID: 20655393 DOI: 10.1016/j.cgh.2010.06.028]

10 Leung K, Pinsky P, Laiyemo AO, Lanza E, Schatzkin A, Schoen RE. Ongoing colorectal cancer risk despite surveil-lance colonoscopy: the Polyp Prevention Trial Continued Follow-up Study. Gastrointest Endosc 2010; 71: 111-117 [PMID: 19647250 DOI: 10.1016/j.gie.2009.05.010]

11 Faigel DO, Pike IM, Baron TH, Chak A, Cohen J, Deal SE, Hoffman B, Jacobson BC, Mergener K, Petersen BT, Petrini JL, Rex DK, Safdi MA. Quality indicators for gastrointesti-nal endoscopic procedures: an introduction. Am J Gastro-enterol 2006; 101: 866-872 [PMID: 16635230 DOI: 10.1111/j.1572-0241.2006.00673.x]

12 de Jonge V, Sint Nicolaas J, Cahen DL, Moolenaar W, Ou-wendijk RJ, Tang TJ, van Tilburg AJ, Kuipers EJ, van Leer-dam ME. Quality evaluation of colonoscopy reporting and colonoscopy performance in daily clinical practice. Gastroin-test Endosc 2012; 75: 98-106 [PMID: 21907986 DOI: 10.1016/j.gie.2011.06.032]

13 Valori R, Barton R. BSG Quality and safety indicators for endoscopy. Available from: URL: http://www.thejag.org.uk/downloads%5CUnit%20Resources%5CBSG%20Quality%20and%20Safety%20Indicators.pdf

14 Leaper M, Johnston MJ, Barclay M, Dobbs BR, Frizelle FA. Reasons for failure to diagnose colorectal carcinoma at colo-noscopy. Endoscopy 2004; 36: 499-503 [PMID: 15202045 DOI: 10.1055/s-2004-814399]

15 Lieberman DA, Weiss DG. One-time screening for colorec-tal cancer with combined fecal occult-blood testing and examination of the distal colon. N Engl J Med 2001; 345: 555-560 [PMID: 11529208 DOI: 10.1056/NEJMoa010328]

16 Neerincx M, Terhaar sive Droste JS, Mulder CJ, Räkers M, Bartelsman JF, Loffeld RJ, Tuynman HA, Brohet RM, van der Hulst RW. Colonic work-up after incomplete colonoscopy: significant new findings during follow-up. Endoscopy 2010; 42: 730-735 [PMID: 20669092 DOI: 10.1055/s-0030-1255523]

17 Radaelli F, Meucci G, Sgroi G, Minoli G. Technical perfor-mance of colonoscopy: the key role of sedation/analgesia and other quality indicators. Am J Gastroenterol 2008; 103: 1122-1130 [PMID: 18445096 DOI: 10.1111/j.1572-0241.2007.01778.x]

18 Arrowsmith JB, Gerstman BB, Fleischer DE, Benjamin SB. Results from the American Society for Gastrointestinal En-doscopy/U.S. Food and Drug Administration collaborative study on complication rates and drug use during gastro-intestinal endoscopy. Gastrointest Endosc 1991; 37: 421-427 [PMID: 1833259]

19 Chung YW, Han DS, Yoo KS, Park CK. Patient factors pre-dictive of pain and difficulty during sedation-free colonos-copy: a prospective study in Korea. Dig Liver Dis 2007; 39: 872-876 [PMID: 17652041 DOI: 10.1016/j.dld.2007.04.019]

20 Kim WH, Cho YJ, Park JY, Min PK, Kang JK, Park IS. Fac-tors affecting insertion time and patient discomfort during colonoscopy. Gastrointest Endosc 2000; 52: 600-605 [PMID: 11060182 DOI: 10.1067/mge.2000.109802]

21 Seip B, Bretthauer M, Dahler S, Friestad J, Huppertz-Hauss G, Høie O, Kittang E, Nyhus S, Pallenschat J, Sandvei P, Stallemo A, Svendsen MV, Hoff G. Patient satisfaction with on-demand sedation for outpatient colonoscopy. En-doscopy 2010; 42: 639-646 [PMID: 20669075 DOI: 10.1055/s-0030-1255612]

22 Eckardt AJ, Swales C, Bhattacharya K, Wassef WY, Phelan NP, Zubair S, Martins N, Patel S, Moquin B, Anwar N, Leung K, Levey JM. Open access colonoscopy in the training

COMMENTS



setting: which factors affect patient satisfaction and pain? Endoscopy 2008; 40: 98-105 [PMID: 18253904 DOI: 10.1055/s-2007-995469]

23 Harewood GC. Relationship of colonoscopy completion rates and endoscopist features. Dig Dis Sci 2005; 50: 47-51 [PMID: 15712636]

24 Bell GD, Quine A. Preparation, premedication, and surveil-lance. Endoscopy 2006; 38: 105-109 [PMID: 16479415 DOI: 10.1055/s-2004-814117]

25 Lichtenstein DR, Jagannath S, Baron TH, Anderson MA, Banerjee S, Dominitz JA, Fanelli RD, Gan SI, Harrison ME, Ikenberry SO, Shen B, Stewart L, Khan K, Vargo JJ. Sedation and anesthesia in GI endoscopy. Gastrointest Endosc 2008; 68: 815-826 [PMID: 18984096 DOI: 10.1016/j.gie.2008.06.002]

26 Cohen LB, Delegge MH, Aisenberg J, Brill JV, Inadomi JM, Kochman ML, Piorkowski JD. AGA Institute review of en-doscopic sedation. Gastroenterology 2007; 133: 675-701 [PMID: 17681185 DOI: 10.1053/j.gastro.2007.06.002]

27 Thiis-Evensen E, Hoff GS, Sauar J, Vatn MH. Patient toler-ance of colonoscopy without sedation during screening ex-amination for colorectal polyps. Gastrointest Endosc 2000; 52: 606-610 [PMID: 11060183 DOI: 10.1067/mge.2000.109804]

28 Aslinia F, Uradomo L, Steele A, Greenwald BD, Raufman JP. Quality assessment of colonoscopic cecal intubation: an analysis of 6 years of continuous practice at a univer-sity hospital. Am J Gastroenterol 2006; 101: 721-731 [PMID: 16494586 DOI: 10.1111/j.1572-0241.2006.00494.x]

29 Francis DL, Rodriguez-Correa DT, Buchner A, Harewood GC, Wallace M. Application of a conversion factor to esti-mate the adenoma detection rate from the polyp detection rate. Gastrointest Endosc 2011; 73: 493-497 [PMID: 21353846 DOI: 10.1016/j.gie.2011.01.005]

30 Williams JE, Le TD, Faigel DO. Polypectomy rate as a qual-ity measure for colonoscopy. Gastrointest Endosc 2011; 73: 498-506 [PMID: 20970795 DOI: 10.1016/j.gie.2010.08.008]

31 Lee TJ, Rutter MD, Blanks RG, Moss SM, Goddard AF, Chil-ton A, Nickerson C, McNally RJ, Patnick J, Rees CJ. Colo-noscopy quality measures: experience from the NHS Bowel Cancer Screening Programme. Gut 2012; 61: 1050-1057 [PMID: 21940723 DOI: 10.1136/gutjnl-2011-300651]

32 Levin TR, Zhao W, Conell C, Seeff LC, Manninen DL, Sha-piro JA, Schulman J. Complications of colonoscopy in an integrated health care delivery system. Ann Intern Med 2006; 145: 880-886 [PMID: 17179057]

P- Reviewers Figueiredo P, Chamberlain SM S- Editor Song XX L- Editor A E- Editor Li JY


ferences were found in the receiver operating charac-teristic area under the curve (ROC-AUC) for age group or sex. The ROC-AUC of the left colon was significantly lower than that of the right colon (0.81 vs 0.96, P = 0.02). Colonoscopy identified 486 colonic diverticula, while barium enema identified 1186. The detection ra-tio for the entire colon was therefore 0.41 (486/1186). The detection ratio in the left colon (0.32, 189/588) was significantly lower than that of the right colon (0.50, 297/598) (P < 0.01).

CONCLUSION: Compared with barium enema, only half the number of colonic diverticula can be detected by colonoscopy in the entire colon and even less in the left colon.


Key words: Colonoscopic diagnosis; Colonic diverticu-losis; Colonic diverticular bleeding; Barium enema; Re-ceiver operating characteristic area under the curve

Core tip: We identified the diagnostic value of colonos-copy for colonic diverticulosis as determined by barium enema. The only half the number of colonic diverticula can be detected in the entire colon and even less in the left colon. By revealing the diagnostic value of colonos-copy for colonic diverticula, it may contribute to further therapeutic interventions strategies for the treatment of colonic diverticular disease.

Niikura R, Nagata N, Shimbo T, Akiyama J, Uemura N. Colonos-copy can miss diverticula of the left colon identified by barium enema. World J Gastroenterol 2013; 19(15): 2362-2367 Avail-able from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2362.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2362

INTRODUCTIONColonic diverticulosis is a common disease that occurs

Colonoscopy can miss diverticula of the left colon identified by barium enema

Ryota Niikura, Naoyoshi Nagata, Takuro Shimbo, Junichi Akiyama, Naomi Uemura

Ryota Niikura, Naoyoshi Nagata, Takuro Shimbo, Junichi Akiyama, Naomi Uemura, Department of Gastroenterology and Hepatology, National Center for Global Health and Medicine, Shinjuku, Tokyo 162-8655, JapanTakuro Shimbo, Department of Clinical Research and Informat-ics, National Center for Global Health and Medicine, Shinjuku, Tokyo 162-8655, JapanNaomi Uemura, Department of Gastroenterology and Hepatol-ogy, Kohnodai Hospital, National Center for Global Health and Medicine, Ichikawa, Chiba 272-8516, JapanAuthor contributions: Niikura R collected the clinical informa-tion and was the main author of the manuscript; Shimbo T per-formed the statistical analysis; Nagata N and Akiyama J edited the manuscript; Nagata N and Uemura N designed the study.Supported by A grant from the National Center for Global Health and MedicineCorrespondence to: Dr. Naoyoshi Nagata, Department of Gas-troenterology and Hepatology, National Center for Global Health and Medicine, 1-21-1 Toyama, Shinjuku, Tokyo 162-8655, Japan. [email protected]: +81-3-32027181 Fax: +81-3-32071038Received: November 1, 2012 Revised: February 27, 2013Accepted: March 6, 2013Published online: April 21, 2013

AbstractAIM: To identify the diagnostic value of colonoscopy for diverticulosis as determined by barium enema.

METHODS: A total of 65 patients with hematochezia who underwent colonoscopy and barium enema were analyzed, and the diagnostic value of colonoscopy for diverticula was assessed. The receiver operating charac-teristic area under the curve was compared in relation to age (< 70 or ≥ 70 years), sex, and colon location. The number of diverticula was counted, and the detec-tion ratio was calculated.

RESULTS: Colonic diverticula were observed in 46 patients with barium enema. Colonoscopy had a sensi-tivity of 91% and specificity of 90%. No significant dif-

BRIEF ARTICLE





in approximately one third of the population older than 45 years and in up to two thirds of the population older than 85 years in the United States[1,2]. In Asia, the preva-lence of colonic diverticula is 28% and is increasing[3]. The prevalence of diverticulitis and diverticular bleeding has also been increasing[4].

Diverticulosis of the colon is often diagnosed dur-ing routine screening colonoscopy. In clinical practice, severe diverticulosis anatomically increases the risk of perforation because of fixed angulations, deep folds, and peristalsis of the colon[5-7]. Therefore, the true lumen can sometimes be confused with diverticulosis when multiple large diverticular orifices are encountered. Moreover, circular muscular atrophy with severe diverticula can also create deep crevices in the colonic wall, making polyp detection more difficult[8]. Colonoscopy is usually used to diagnose colonic diverticular bleeding[9,10]. Identification of the bleeding site of colonic diverticula on colonos-copy enables endoscopic treatment with clips[11], epi-nephrine injection, heat probing[10], and ligation[12]. These modalities can circumvent complications such as hemor-rhagic shock and rebleeding[10]. Therefore, identifying the diagnostic value of colonoscopy for colonic diverticula is important but has remained unclear.

By contrast, barium enema can clearly detect colonic diverticula[3] because barium fills the entire colon in di-verticulosis. Consequently, we evaluated the diagnostic value of colonoscopy for colonic diverticula in patients with hematochezia who underwent both colonoscopy and barium enema. In addition, differences in diagnostic value with regard to age, sex, and colonic location were assessed.

MATERIALS AND METHODSPatientsWe retrospectively selected 436 patients from the elec-tronic endoscopic database who had undergone colonos-copy for hematochezia from 2008 to 2011 at the National Center for Global Health and Medicine. We excluded 355 patients who did not receive barium enema and 16 who did not undergo total colonoscopy. After exclusion, 65 patients were enrolled.

Colonoscopic assessmentIntestinal lavage for endoscopic examination was per-formed using 2 L of a solution containing polyethylene glycol. An electronic video endoscope (high-resolution scope, model CFH260; Olympus Optical, Tokyo, Japan) was used for the diagnosis of hematochezia by expert endoscopists. The results of the endoscopic examination were saved in the electronic database. Upon detecting diverticula, the location (cecum and ascending, trans-verse, descending, and sigmoid colon) and number were recorded (Figure 1).

Barium enema examinationBarium enema is a diagnostic imaging modality of the colon that has been used previously to evaluate diver-ticula[13,14]. Barium enema was indicated for patients with colorectal cancer or to prevent recurrence of colonic di-verticular bleeding[6,15,16] and was performed within three days after colonoscopy. Intestinal lavage for the barium enema examination was performed using sodium picosul-fate (1 mL) and magnesium citrate (250 mL) the day be-


Niikura R et al . The left colon has low diagnostic yield

Figure 1 Colonic diverticula in the left colon on endoscopy. The colon location was classified as the right colon (cecum and ascending and transverse colon) or the left colon (descending colon and sigmoid colon). A: Sigmoid-descending colon junction; B: Proximal sigmoid colon; C: Sigmoid top; D: Distal sigmoid colon. Arrows show colonic diverticula determined by colonoscopy.

A B

C D

fore the assessment and bisacodyl suppositories (10 mg) on the day of assessment. The barium solution (200-400 mL) was 70%-200%. Barium was injected from the anus to the cecum in all patients to visualize the entire colon tract in different positions. The presence, location, and number of colonic diverticula were determined by radi-ography (Figure 2).

EthicsThis study was approved by the institutional review board of the National Center for Global Health and Medicine (approval number: 765).

Statistical analysisThe gold standard for detecting colonic diverticula is bar-ium enema radiography. To identify the diagnostic value of colonoscopy for colonic diverticula, we calculated the sensitivity, specificity, receiver operating characteristic area under the curve (ROC-AUC), positive likelihood ratio (PLR), and negative likelihood ratio (NLR). In a subgroup analysis, we assessed the diagnostic value of colonoscopy with regard to age, sex, and colonic location. Subjects were divided into two groups according to age: ≥ 70 years old and < 70 years old. The colon location was classified as the left colon (descending and sigmoid colon) and the right colon (cecum and ascending and transverse colon). Differences in the ROC-AUCs were compared in relation to age, sex, and location.

The receiver operating characteristic is a diagnostic test that presents its results as a plot of sensitivity vs 1-speci-ficity (often called the false-positive rate). The ROC-AUC indicates the probability of a measure or predicted risk being higher for patients with disease than for those with-out disease[17-19]. The detection ratio (colonoscopy/barium enema) of colonic diverticula was assessed and also com-pared between the left and right colon using the χ 2 test. A P value < 0.05 was considered significant. All statistical analyses were performed using Stata version 10 software (StataCorp, College Station, TX, United States).

RESULTSPatient characteristicsSufficient imaging by colonoscopy and barium enema

was obtained for all patients due to adequate stool clean-ing. No patients experienced perforation during air insuf-flation to expand the colon, and none showed a worsened condition such as abdominal pain or nausea after colo-noscopy or barium enema. The median age was 73 years, and many patients were elderly men (Table 1). The causes of hematochezia included colonic diverticular bleeding, colonic cancer, and rectal cancer.

Diagnostic value of colonoscopy for colonic diverticulaColonic diverticula were observed in 46 patients (71%) using barium enema. The number of colonic diverticula identified by colonoscopy was 486, whereas that by bar-ium enema was 1186. Colonoscopy had a sensitivity of 91%, a specificity of 90%, a PLR of 8.7, and an NLR of 0.097 for the diagnosis of colonic diverticula (Table 2).

In a subgroup analysis, no significant differences were found in the ROC-AUCs between age groups and sex. However, the ROC-AUC of the left colon was significantly lower than that of the right colon (0.96 vs 0.81, P = 0.02).

Detection ratio (colonoscopy/barium enema) of colonic diverticulaThe detection ratio for the entire colon was 0.41 (486/1186) (Figure 3). The detection ratio for the left colon (0.32, 189/588) was significantly lower than that of the right co-lon (0.50, 297/598) (P < 0.01).

DISCUSSIONNo previous study has reported the diagnostic value of colonoscopy for colonic diverticulosis. Colonoscopy has been used worldwide as a standard tool for the screen-ing of colonic cancer and the diagnosis of other lower gastrointestinal tract diseases[20]. Colonic diverticulosis is a common disease in Asia, Europe, and the United States[2], occurring in approximately one third of the population older than 45 years[1]. The prevalence of colonic diverticu-losis increases with age, and serious complications with diverticulitis and diverticular bleeding have been on the rise in recent years[1]. To address these problems, we in-vestigated the diagnostic value of colonoscopy in colonic diverticulosis.

While the detection rate for diverticula with colo-


Figure 2 Colonic diverticula in the left colon on radiography with barium en-ema. The colonic location was classified as the right colon (cecum and ascending and transverse colon) or the left colon (descending colon and sigmoid colon).

Sex (male/female) 40/25 Mean age (IQR) 73 (66–78) Median duration (IQR) between the onset of hematochezia and colonoscopy

4 (2–8)

Cause of hematochezia Colonic diverticular bleeding 30 Colon cancer (cecum/ascending/transverse/sigmoid colon)

19 (3/8/2/6)

Rectal cancer 14 Unknown 2

Table 1 Patient characteristics (n = 65)

IQR: Interquartile range.



In addition, the sigmoid colon, which accounts for one third of the left colon and is not supported by the mesen-tery, bends sharply[22]. Intestinal bending not only creates blind spots for colonoscopy but also complicates distin-guishing diverticula from the true lumen[5,23], thus greatly affecting the accuracy of diagnosis with colonoscopy.

Although the present study also investigated other fac-tors such as age and sex in addition to anatomical factors, no significant differences were observed. Sadahiro et al[22]

investigated age- and sex-related differences in the sur-face area of the large intestine with barium enema. They found that the mean surface area of the large intestine in men aged ≥ 70 years was 1569.4 cm2, while that in men aged ≤ 69 years was 1566 cm2, with no significant differ-ence. The mean surface area in women aged ≥ 70 years was 1575.4 cm2, while that in women aged ≤ 69 years was 1628 cm2. These results support our finding that the anatomy of the colon is rarely influenced by age or sex. In a previous study on the detection of colonic polyps, it was reported that the degree of bowel preparation[24] and observation time[25] were associated with missed colonic polyps. Although we were unable to evaluate this issue in the present study, we plan to investigate it in the future.

We believe the present findings will influence the diagnosis and treatment of colonic diverticulosis and complications including diverticular bleeding. Knowing the areas of the colon where it is easy to overlook the presence of diverticula or to confuse a diverticulum with a true lumen may help endoscopists perform proper screening colonoscopy and reduce the risk of perfora-tion[5,7,23]. It is important to identify the stigmata of recent hemorrhage (SRH) when diagnosing or treating diver-ticular bleeding[23]. To date, diagnosis and treatment have been conducted under the assumption that colonoscopy will identify all colonic diverticula regardless of the ana-tomical factors of the colon. However, our study showed that colonoscopy detected only 32% of all diverticula in the left colon. This suggests that the SRH were over-looked, which is supported by a previous study reporting that colonoscopy identified the SRH in only one third of patients with colonic diverticular bleeding[23].

Here, we evaluated colonic diverticula using static

noscopy was acceptable, our results showed that the diagnostic value decreased significantly for detection in the left colon. In addition to detecting the presence of diverticula, we counted the number of diverticula in 65 patients and found that colonoscopy detected only one third of the diverticula in the left colon identified by bar-ium enema. The detection rate for diverticula by colonos-copy was higher than that reported previously[21], and this is presumably because a different group of patients was used in this study; Song et al[21] enrolled patients screened by colonoscopy, while the present study investigated pa-tients with hematochezia.

We believe these results were influenced greatly by anatomical factors of the colon, and we thus propose two hypotheses for the poor diagnostic value of colonoscopy in the left colon. First, the diameters of the ascending and transverse colons on the right side of the body are report-edly 4.9 and 4.2 cm, respectively[22]. However, the diam-eters of the descending and sigmoid colons constituting the left colon are both 3.3 cm, notably narrower than the right colon[22]. Because of the narrower diameter, the field of view in colonoscopy is expected to be lower in the left colon, making the detection of diverticula more difficult.

Number1 Sens, % (95%CI) Spec, % (95%CI) LR (+) (95%CI) LR (-) (95%CI) ROC-AUC (95%CI) P value

All (44/21) 91 (79-98) 90 (67-99) 8.7 (2.3-32) 0.097 (0.038-0.52) 0.90 (0.82-0.99) Age (yr) < 70 (18/9) 90 (67-99) 88 (47-100) 7.2 (1.1-45) 0.12 (0.032-0.46) 0.89 (0.74-1) ≥ 70 (26/12) 93 (76-99) 91 (59-100) 10 (1.6-66) 0.082 (0.021-0.31) 0.92 (0.82-1) 0.68 Sex Female (13/12) 100 (72-100) 86 (57-98) 5.8 (1.8-18) 0.05 (0.0033-0.76) 0.93 (0.83-1) Male (31/9) 89 (73-97) 100 (48-100) 11 (0.74-150) 0.14 (0.056-0.33) 0.94 (0.89-1) 0.47 Location Right colon (40/25) 95 (84-99) 96 (79-100) 23 (3.4-156) 0.051 (0.013-0.20) 0.96 (0.90-1) Left colon (26/39) 66 (49-80) 96 (81-100) 18 (2.6-123) 0.36 (0.23-0.56) 0.81 (0.73-0.90) 0.02

Table 2 Diagnostic value of colonoscopy for colonic diverticula in 65 patients

1With/without diverticulosis. P values were calculated using the receiver operating characteristic curve area under the curve (ROC-AUC) for comparisons in this category. Sens: Sensitivity; Spec: Specificity; LR: Likelihood ratio.

0.41(488/1186)

0.50(297/598)

0.32a

(189/588)

1.0

0.8

0.6

0.4

0.2

0.0All Right colon Left colon

Figure 3 Detection ratio (colonoscopy/barium) of colonic diverticula in 65 patients. Right colon denotes the cecum, ascending colon, and transverse colon. Left colon denotes the descending colon and sigmoid colon. aP < 0.05 by χ 2 test. Error bars show the 95%CI of the detection ratio.

Det

ectio

n ra

tioNiikura R et al . The left colon has low diagnostic yield


images, but it proved difficult to determine the exact number of colonic diverticula using these images. We therefore plan to perform a prospective study of colonic diverticula using video of live endoscopy procedures.

In the present study, the diagnostic value of colonos-copy for the left colon was relatively low, revealing only one third of the diverticula observed by barium enema. The diagnosis and treatment of colonic diverticulosis and complications, such as diverticular bleeding, should be per-formed with consideration of the findings of this study.

COMMENTSBackgroundColonic diverticulosis is a common disease, and the prevalence of diverticu-litis and diverticular bleeding has been increasing. Colonoscopy is useful for diagnosing colonic diverticula and colonic diverticular bleeding. However, the diagnostic value of colonoscopy has remained unclear.Research frontiersColonoscopy is often used to diagnose colonic diverticular bleeding and therefore can be useful for subsequent endoscopic treatment if the bleeding site can be identified. Determining the diagnostic value of colonic diverticula is important. In this study, the authors revealed the diagnostic value of colonic diverticula by colonoscopy.Innovations and breakthroughsPrevious reports have highlighted the prevalence of diverticula by barium en-ema. The authors identified the diagnostic value of colonoscopy for colonic di-verticulosis as determined by barium enema. The only half the number of colonic diverticula can be detected in the entire colon and even less in the left colon.ApplicationsBy revealing the diagnostic value of colonoscopy for colonic diverticula, the results of this study may contribute to future therapeutic intervention strategies for the treatment of patients with colonic diverticular disease.TerminologyThe receiver operating characteristic is a diagnostic testing modality that presents its results as a plot of sensitivity vs 1-specificity (often called the false-positive rate). The receiver operating characteristic area under the curve indicates the probability of a measure or predicted risk being higher for patients with disease than for those without disease.Peer reviewThe authors evaluated the diagnostic value of colonic diverticula by colonos-copy compared with barium enema. This study revealed that threefold more diverticula can be detected by barium enema than by colonoscopy.

REFERENCES1 Roberts P, Abel M, Rosen L, Cirocco W, Fleshman J, Leff E,

Levien D, Pritchard T, Wexner S, Hicks T. Practice param-eters for sigmoid diverticulitis. The Standards Task Force American Society of Colon and Rectal Surgeons. Dis Colon Rectum 1995; 38: 125-132 [PMID: 7851165]

2 WELCH CE, ALLEN AW, DONALDSON GA. An appraisal of resection of the colon for diverticulitis of the sigmoid. Ann Surg 1953; 138: 332-343 [PMID: 13080959 DOI: 10.1097/00000658-195309000-00005]

3 Miura S, Kodaira S, Shatari T, Nishioka M, Hosoda Y, Hisa TK. Recent trends in diverticulosis of the right colon in Ja-pan: retrospective review in a regional hospital. Dis Colon Rectum 2000; 43: 1383-1389 [PMID: 11052515 DOI: 10.1007/BF02236634]

4 Strate LL, Liu YL, Aldoori WH, Syngal S, Giovannucci EL. Obesity increases the risks of diverticulitis and diverticu-lar bleeding. Gastroenterology 2009; 136: 115-122.e1 [PMID: 18996378 DOI: 10.1053/j.gastro.2008.09.025]

5 Kavin H, Sinicrope F, Esker AH. Management of perfora-

tion of the colon at colonoscopy. Am J Gastroenterol 1992; 87: 161-167 [PMID: 1734693]

6 Koperna T, Kisser M, Reiner G, Schulz F. Diagnosis and treatment of bleeding colonic diverticula. Hepatogastroenter-ology 2001; 48: 702-705 [PMID: 11462907]

7 Brayko CM, Kozarek RA, Sanowski RA, Howells T. Di-verticular rupture during colonoscopy. Fact or fancy? Dig Dis Sci 1984; 29: 427-431 [PMID: 6425026 DOI: 10.1007/BF01296218]

8 Hale WB. Colonoscopy in the diagnosis and management of diverticular disease. J Clin Gastroenterol 2008; 42: 1142-1144 [PMID: 18936654 DOI: 10.1097/MCG.0b013e3181862ab1]

9 Rossini FP, Ferrari A, Spandre M, Cavallero M, Gemme C, Loverci C, Bertone A, Pinna Pintor M. Emergency colonos-copy. World J Surg 1989; 13: 190-192 [PMID: 2658365 DOI: 10.1007/BF01658398]

10 Jensen DM, Machicado GA, Jutabha R, Kovacs TO. Urgent colonoscopy for the diagnosis and treatment of severe di-verticular hemorrhage. N Engl J Med 2000; 342: 78-82 [PMID: 10631275 DOI: 10.1056/NEJM200001133420202]

11 Strate LL, Naumann CR. The role of colonoscopy and ra-diological procedures in the management of acute lower in-testinal bleeding. Clin Gastroenterol Hepatol 2010; 8: 333-343; quiz e44 [PMID: 20036757 DOI: 10.1016/j.cgh.2009.12.017]

12 Ishii N, Setoyama T, Deshpande GA, Omata F, Matsuda M, Suzuki S, Uemura M, Iizuka Y, Fukuda K, Suzuki K, Fujita Y. Endoscopic band ligation for colonic diverticular hemor-rhage. Gastrointest Endosc 2012; 75: 382-387 [PMID: 21944311 DOI: 10.1016/j.gie.2011.07.030]

13 Halligan S, Saunders B. Imaging diverticular disease. Best Pract Res Clin Gastroenterol 2002; 16: 595-610 [PMID: 12406453 DOI: 10.1053/bega.2002.0323]

14 Vosse-Matagne G. [Radiologic and endoscopic diagnosis of diverticulosis]. Rev Med Liege 1980; 35: 43-46 [PMID: 7394425]

15 Matsuhashi N, Akahane M, Nakajima A. Barium impaction therapy for refractory colonic diverticular bleeding. AJR Am J Roentgenol 2003; 180: 490-492 [PMID: 12540457]

16 Adams JT. Therapeutic barium enema for massive divertic-ular bleeding. Arch Surg 1970; 101: 457-460 [PMID: 5311678 DOI: 10.1001/archsurg.1970.01340280009003]

17 Hanley JA. Receiver operating characteristic (ROC) meth-odology: the state of the art. Crit Rev Diagn Imaging 1989; 29: 307-335 [PMID: 2667567]

18 Hanley JA, McNeil BJ. The meaning and use of the area un-der a receiver operating characteristic (ROC) curve. Radiology 1982; 143: 29-36 [PMID: 7063747]

19 Greiner M, Pfeiffer D, Smith RD. Principles and practical application of the receiver-operating characteristic analysis for diagnostic tests. Prev Vet Med 2000; 45: 23-41 [PMID: 10802332 DOI: 10.1016/S0167-5877(00)00115-X]

20 Schoen RE, Pinsky PF, Weissfeld JL, Yokochi LA, Church T, Laiyemo AO, Bresalier R, Andriole GL, Buys SS, Crawford ED, Fouad MN, Isaacs C, Johnson CC, Reding DJ, O’Brien B, Carrick DM, Wright P, Riley TL, Purdue MP, Izmirlian G, Kramer BS, Miller AB, Gohagan JK, Prorok PC, Berg CD. Colorectal-cancer incidence and mortality with screening flexible sigmoidoscopy. N Engl J Med 2012; 366: 2345-2357 [PMID: 22612596 DOI: 10.1056/NEJMoa1114635]

21 Song JH, Kim YS, Lee JH, Ok KS, Ryu SH, Lee JH, Moon JS. Clinical characteristics of colonic diverticulosis in Korea: a prospective study. Korean J Intern Med 2010; 25: 140-146 [PMID: 20526386 DOI: 10.3904/kjim.2010.25.2.140]

22 Sadahiro S, Ohmura T, Yamada Y, Saito T, Taki Y. Analy-sis of length and surface area of each segment of the large intestine according to age, sex and physique. Surg Radiol Anat 1992; 14: 251-257 [PMID: 1440190 DOI: 10.1007/BF01794949]

23 Kozarek RA, Earnest DL, Silverstein ME, Smith RG. Air-

COMMENTS



pressure-induced colon injury during diagnostic colonos-copy. Gastroenterology 1980; 78: 7-14 [PMID: 7350038]

24 Marmo R, Rotondano G, Riccio G, Marone A, Bianco MA, Stroppa I, Caruso A, Pandolfo N, Sansone S, Gregorio E, D’Alvano G, Procaccio N, Capo P, Marmo C, Cipolletta L. Ef-fective bowel cleansing before colonoscopy: a randomized study of split-dosage versus non-split dosage regimens of

high-volume versus low-volume polyethylene glycol solu-tions. Gastrointest Endosc 2010; 72: 313-320 [PMID: 20561621 DOI: 10.1016/j.gie.2010.02.048]

25 Barclay RL, Vicari JJ, Doughty AS, Johanson JF, Greenlaw RL. Colonoscopic withdrawal times and adenoma detec-tion during screening colonoscopy. N Engl J Med 2006; 355: 2533-2541 [PMID: 17167136 DOI: 10.1056/NEJMoa055498]

P- Reviewers Rajendran VM, Blank G S- Editor Huang XZ L- Editor A E- Editor Li JY


Ultrasound-guided vs endoscopic ultrasound-guided fine-needle aspiration for pancreatic cancer diagnosis

Masato Matsuyama, Hiroshi Ishii, Kensuke Kuraoka, Seigo Yukisawa, Akiyoshi Kasuga, Masato Ozaka, Sho Suzuki, Kouichi Takano, Yuko Sugiyama, Takao Itoi

Masato Matsuyama, Hiroshi Ishii, Kensuke Kuraoka, Seigo Yukisawa, Akiyoshi Kasuga, Masato Ozaka, Sho Suzuki, Kouichi Takano, Department of Gastroenterology, Cancer Insti-tute Hospital, Tokyo 135-8550, JapanYuko Sugiyama, Department of Gynecology, Cancer Institute Hospital, Tokyo 135-8550, JapanTakao Itoi, Department of Gastroenterology and Hepatology, Tokyo Medical University, Tokyo 160-0023, JapanAuthor contributions: Matsuyama M and Ishii H performed most of the examinations; Kuraoka K, Yukisawa S, Kasuga A, Ozaka M, Suzuki S and Takano K managed the patients; Sugi-yama Y supported the cytopathology; Matsuyama M, Ishii H and Itoi T wrote the paper. Correspondence to: Masato Matsuyama, MD, PhD, Depart-ment of Gastroenterology, Cancer Institute Hospital, 3-8-31, Ariake, Koto-ku, Tokyo 135-8550, Japan. [email protected]: +81-3-35200111 Fax: +81-3-35700111Received: December 9, 2012 Revised: January 23, 2013Accepted: February 5, 2013Published online: April 21, 2013

AbstractAIM: To clarify the effectiveness and safety of endo-scopic ultrasound-guided fine-needle aspiration (EUS-FNA) for the diagnosis of pancreatic cancer (PC).

METHODS: Patients who were diagnosed with unre-sectable, locally advanced or metastatic PC between February 2006 and September 2011 were selected for this retrospective study. FNA biopsy for pancreatic tumors had been performed percutaneously under ex-tracorporeal ultrasound guidance until October 2009; then, beginning in November 2009, EUS-FNA has been performed. We reviewed the complete medical records of all patients who met the selection criteria for the fol-lowing data: sex, age, location and size of the targeted tumor, histological and/or cytological findings, details

of puncture procedures, time from day of puncture until day of definitive diagnosis, and details of severe adverse events.

RESULTS: Of the 121 patients who met the selec-tion criteria, 46 had a percutaneous biopsy (Group A) and 75 had an EUS-FNA biopsy (Group B). Adequate cytological specimens were obtained in 42 Group A pa-tients (91.3%) and all 75 Group B patients (P = 0.0192), and histological specimens were obtained in 41 Group A patients (89.1%) and 65 Group B patients (86.7%). Diagnosis of malignancy by cytology was positive in 33 Group A patients (78.6%) and 72 Group B patients (94.6%) (P = 0.0079). Malignancy by both cytology and pathology was found in 43 Group A (93.5%) and 73 Group B (97.3%) patients. The mean period from the puncture until the cytological diagnosis in Group B was 1.7 d, which was significantly shorter than that in Group A (4.1 d) (P < 0.0001). Severe adverse events were experienced in two Group A patients (4.3%) and in one Group B patient (1.3%).

CONCLUSION: EUS-FNA, as well as percutaneous nee-dle aspiration, is an effective modality to obtain cytopa-thological confirmation in patients with advanced PC.


Key words: Endoscopic ultrasound-guided fine needle aspiration; Percutaneous needle aspiration; Pancreatic cancer

Matsuyama M, Ishii H, Kuraoka K, Yukisawa S, Kasuga A, Ozaka M, Suzuki S, Takano K, Sugiyama Y, Itoi T. Ultrasound-guided vs endoscopic ultrasound-guided fine-needle aspiration for pancreatic cancer diagnosis. World J Gastroenterol 2013; 19(15): 2368-2373 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2368.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2368

BRIEF ARTICLE





INTRODUCTIONPancreatic cancer (PC) is currently the fifth leading cause of cancer-related mortality in Japan. Although complete surgical removal of the tumor is the only chance of cure, almost all PC patients are initially diagnosed as having ad-vanced unresectable disease despite recent improvements in diagnostic techniques. In recent decades, techniques were developed to obtain proof of cancer from the primary tumor in PC patients. Pancreatic juice cytology via endoscopic retrograde pancreatography was initially developed to meet this challenge; however, in practical settings the positive rate for cancer cells has remained low, indicating the presence of false-negative results[1,2]. Ultrasonography-guided fine-needle aspiration (US-FNA) biopsy or computed tomography (CT)-guided FNA bi-opsy appears to provide a more definitive diagnosis of PC[3,4]. US-FNA is convenient but its usefulness is limited for masses in the pancreatic tail. In contrast, CT-guided FNA is the biopsy procedure of choice to assess pancre-atic lesions. However, this technique is time-consuming and is limited by a substantial false-negative rate of ap-proximately 20%[5]. In addition, there have been concerns about percutaneous cancer seeding[6,7]. Recently, endo-scopic ultrasound-guided fine needle aspiration (EUS-FNA) has been developed as a more feasible method to obtain definitive specimens for cytological and/or histo-logical examinations for diagnosis of PC[8-12]. Three years ago, we began to perform EUS-FNA although until that time US-FNA was the standard technique at our institute.

In the current study, we retrospectively examined the diagnostic ability of EUS-FNA for PC compared with US-FNA.

MATERIALS AND METHODSPatientsThe inclusion criteria were: (1) the patient underwent US-FNA between February 2006 and October 2009 or EUS-FNA between November 2009 and September 2011 at the Cancer Institute Hospital, Tokyo, Japan for suspected PC; and (2) the patient was subsequently diagnosed as having clinical stage Ⅲ or Ⅳ PC. Unresectable PC, which was indicated by International Union Against Cancer clinical stage Ⅲ (locally advanced disease: T4N0-1 and M0) or Ⅳ (metastatic disease: T1-4N0-1 and M1), was diagnosed by CT.

The exclusion criteria were: (1) a contraindication for EUS (esophageal stenosis, duodenal stenosis, ileus, or perforation of the digestive tract); and (2) a contraindica-tion for EUS-FNA and US-FNA (severe cardiovascular disease or respiratory disease, poor performance status, difficulty in visualization of the target, bleeding tendency, or impossibility of ensuring the puncture route).

Patients who met the selection criteria were identified from the database in our division, which was updated daily.

US- and EUS-FNA procedures A short admission, usually for one or two nights, was mandatory according to the protocol for FNA biopsy of a suspected pancreatic tumor in our division. FNA biopsy for pancreatic tumors had been performed percu-taneously under extracorporeal ultrasound guidance (US-FNA) until October 2009; then, beginning in November 2009, FNA biopsies have been performed under EUS guidance (EUS-FNA). In general, FNA examinations were performed and managed by Ishii H until October 2009 and by Matsuyama M since November 2009. Writ-ten informed consent was obtained from each patient before the examination.

US-FNA was performed using SSA-550A (Toshiba, Tokyo, Japan) as the ultrasound device and SONOPSY C1 21G (Hakko, Osaka, Japan) as the ultrasound-guided biopsy needle. After systemic premedication and percu-taneous local anesthesia, FNA was performed 1-3 times repeatedly until adequate material was obtained. Patho-logical examination of the obtained materials and cyto-logical examination of the needle-washing water were done. There was no on-site cytotechnologist during the performance of US-FNA.

EUS-FNA was performed using EU-ME1 and UCT240-AL5 (Olympus, Tokyo, Japan) as the EUS system and the Echo-Tip ULTRA 22G (Wilson-Cook, Bloomington, IN, United States) as the ultrasound-guided biopsy needle. After systemic premedication and pharyn-geal local anesthesia, FNA was performed endoscopically via the stomach or duodenum. Aspiration puncture was repeated until an on-site cytology screener confirmed that adequate materials had been obtained.

After the examination, patients stayed in the hospital overnight and were discharged the following morning if no problems were revealed by physical examination, complete blood count tests and biochemistry tests that included serum amylase level. Three to 7 d later, the pa-tients came to the outpatient clinic for an explanation of the results of the biopsy and examination for late adverse events, and were then able to start chemotherapy.

The final diagnosis was based on pathology results or clinical follow-up of > 6 mo.

Statistical analysisWe reviewed the complete medical records of all patients who met the selection criteria for the following data: sex, age, location and size of the targeted tumor, histological and/or cytological findings of the obtained specimens, details of puncture procedures, time from day of punc-ture until the day of definitive diagnosis, and details of severe adverse events, if any. The tumor status (location and size) was determined by dynamic CT before puncture. Frequency analysis was performed with Fisher’s exact test for 2 × 2 tables, χ 2 test for 3 × 2 tables, and Mann-Whit-ney test. All analysis were performed using the statistical software SPSS 11.0J for Windows. Statistical significance was defined as a two-sided P value ≤ 0.05.


Matsuyama M et al . Fine-needle aspiration for pancreatic cancer

RESULTSUS-FNA was performed in 48 patients from February 2006 until October 2009. Two cases (renal cell carcinoma and malignant lymphoma) were excluded from the analy-sis of US-FNA because the patients did not have primary PC. EUS-FNA was attempted in 125 cases and was suc-cessfully performed in 123 cases from November 2009 until September 2011. Among these, 48 patients did not meet the selection criteria (lymph node metastasis, 34 cases; other pancreatic tumor, 10 cases; other abdominal tumor, three cases, and mediastinum tumor, one case). EUS-FNA could not be performed in two patients be-cause of difficulty of visualization due to total gastrec-tomy in one case, and impossibility of ensuring the punc-ture route in the other. Thus, 46 patients who underwent US-FNA (Group A) and 75 who underwent EUS-FNA (Group B) were eligible for analysis.

Table 1 shows the characteristics of the study sub-jects. The distribution of the target tumor in the pancreas differed significantly between the two groups, with the tumor location more frequent in the pancreatic head/tail than in the pancreatic body in Group B. The maximum diameter of the target tumor ranged from 18 to 111 mm (median, 44.8 mm) in Group A and from 7 to 70 mm (median, 25.5 mm) in Group B. A significantly larger number of target tumors were < 40 mm in Group B than in Group A (P = 0.0007).

Table 1 shows a comparison of the results of per-cutaneous biopsy with those of EUS-FNA. Adequate cytological and histological specimens were obtained in 42 (91.3%) and 41 (89.1%) Group A patients (n = 46), respectively, and in 75 (100%) and 65 (86.7%) Group B patients (n = 75).

Results of cytology indicated the presence of cancer cells in 33 Group A patients (78.6%) and in 72 Group B patients (94.6%). Histological studies showed cancer tissue in 33 (80.5%) and 51 (78.4%) patients in Group A and Group B, respectively. In total, a cancer diagnosis was made in 43 Group A (93.5%) and 73 Group B (97.3%) patients by cytology and/or histology. These 116 patients were diagnosed with pancreatic adenocarcinoma by cytol-ogy/histology as well as by imaging and their subsequent clinical course. The final diagnosis of PC in the remain-ing five patients for whom there was no cytological or histological proof was confirmed by the clinical course until April 2012. The positive cytology/histology rate did not differ between the two groups.

Total puncture procedures per patient varied from one to five, with a median of 3. The frequency of mul-tiple punctures, that is, > 2, was significantly higher in Group B than in Group A. Time from the day of punc-ture until the day of the final cytological diagnosis varied from 0 to 8 d (median, 4.1 d) in Group A and from 0 to 5 d (median, 1.7 d) in Group B. The period was signifi-cantly shorter in Group B than in Group A. The time from the day of puncture until the day of the final histo-logical diagnosis varied from 2 to 7 d (median, 4.0 d) in Group A and 2 to 10 d (median, 3.2 d) in Group B, with no significant difference between the two groups.

Severe adverse events occurred in two Group A patients (4.3%) and in one Group B patient (1.3%). In Group A, one patient developed a high fever, which re-quired hospitalization but resolved with only symptom-atic treatment. The other Group A patient experienced upper gastrointestinal bleeding, which was confirmed by endoscopy to be related to the needle biopsy. This patient was treated by blood transfusion and antiulcer medication and was hospitalized for 1 wk without surgical interven-tion. The adverse event in Group B was an abdominal abscess that required surgical drainage. The patient expe-rienced continuous abdominal pain one night after EUS-FNA, and dynamic CT demonstrated an abscess in front of the pancreatic body tumor, which was clearly related to the EUS-FNA puncture. Fortunately, she recovered af-ter surgery and antibiotic therapy and could receive che-motherapy thereafter. There was no cancer seeding event up to 6 mo from the time of puncture in any patient in either group.

DISCUSSIONThe aim of the current study was to investigate the re-sults of two different approaches to obtain pancreatic biopsy specimens, which are a percutaneous approach and EUS-FNA, because this issue has seldom been ad-


Percutaneous biopsy EUS-FNAP value

Group A Group B Patients 46 75 Site of puncture Pancreas 46 74 > 0.9999 Head/body/tail 12/32/2 34/31/9 0.0114 Sex (male/female) 25/21 39/36 > 0.8525 Age, yr > 0.8466 ≥ 65 28 48 < 65 18 27 Tumor diameter, mm (range) 44.8 (18-111) 25.5 (7-70) ≥ 40 30 25 0.0007 < 40 16 50 Passes (range) 2.26 (1-4) 2.85 (2-5) < 0.0001 Adequate specimens obtained1 n (%) Cytology 42 (91.3) 75 (100) 0.0192 Histology 41 (89.1) 65 (86.7) 0.7812 Positivity for cancer n (%) Cytology 33 (78.6) 72 (94.6) 0.0079 Histology 33 (80.5) 51 (78.4) > 0.9999 Total n (%) 43 (93.5) 73 (97.3) 0.3672 Complications n (%) 2 (4.3) 1 (1.3) > 0.5567

Fever1 Peritonitis1

Bleeding1

Time from puncture to definitive diagnosis Cytology, d (range) 4.05 (0-8) 1.65 (0-5) < 0.0001 Histology, d (range) 3.95 (2-7) 3.18 (2-10) 0.7066

Table 1 Characteristics of patients and comparison of results of percutaneous biopsy with those of endoscopic ultrasound-guided fine-needle aspiration

1An on-site pathologist was available for endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) but not for ultrasonography-guided-FNA.



what et al[12]. In the present study, there was no analysis of accuracy in the two groups, because our institution is an oncology hospital and we rarely perform biopsies of benign cases.

The benefits of EUS-FNA might be maximized to make a pathological diagnosis in patients with an abdomi-nal tumor of an uncertain type. The definite merit of our EUS-FNA procedure was thought to be rapid cytological results, but perhaps success in this regard was mainly due to the contribution of an on-site cytotechnologist and not to the EUS-FNA procedure itself. Iglesias-Garcia et al[28] have claimed that on-site cytological evaluation im-proves the diagnostic yield of EUS-guided FNA for the cytological diagnosis of solid pancreatic masses. Savoy et al[29] have pointed out that even trained endosonog-raphers have variable and, in some cases, inferior abili-ties in interpreting on-site cytology in comparison with cytotechnologists. In the present study, we had adequate specimens for all cases in the EUS-FNA group. This is natural because we continued the examination until we obtained a sufficient quantity of specimens that were checked by the on-site cytotechnologist. On the contrary, there was no difference in the rate of adequate specimens obtained for histological examination between the EUS-FNA and US-FNA groups, because the collected tissue was checked by the examiner’s naked eye in both groups. The presence of an on-site cytotechnologist to accom-pany EUS-FNA is considered to be necessary, at least, in high-volume centers.

In the present study, the positivity rate for malignancy was higher for EUS-FNA cytology than for histology. Supporting the current results, another study has shown that the positivity rate for malignancy in EUS-FNA cytol-ogy of the pancreas was higher than that in histology[30].

As previously reported, EUS-needle core biopsy is useful for histological and cytological diagnosis in terms of sample volume[31]. In addition, the combined results of EUS-FNA cytology and EUS-needle core biopsy have been reported to improve diagnosis[32-34]. However, to con-firm the malignancy, EUS-FNA cytology is more useful than EUS-needle core biopsy[35]. This result is similar to the results of our study, indicating that cytology might be more useful than histology for the diagnosis of malignancy.

In the current study, there was no cancer seeding in any patient in either group. As previously reported, there were rare cases of seeding among patients who under-went US-guided FNA[36]. With regard to the puncture route, we suggest that there is less possibility of seeding in patients who undergo EUS-FNA than in patients who undergo US-FNA, although some recent studies have shown the possibility of seeding in patients who undergo EUS-FNA[37-39]. We did inform patients who were sched-uled to undergo EUS-FNA about the possibility of this complication.

The limitations of our study included its retrospec-tive nature. Furthermore, there were no cases of benign pancreatic conditions to enable an evaluation of US and EUS-FNA for accurate differentiation between malignant

dressed[12]. Our results confirmed the usefulness of EUS-FNA, especially with regard to cytology. The National Comprehensive Cancer Network Guidelines (2012) require that cytological or histological confirmation is needed for the diagnosis of unresectable pancreatic carcinoma[13]. In patients with stage Ⅳ PC, a biopsy of the metastatic lesion is preferred for proof of cancer. However, in those with stage Ⅲ PC and some patients with stage Ⅳ PC in whom it is difficult to access meta-static sites for biopsy procedures, the primary tumor of the pancreas must be targeted to obtain proof of cancer. Pancreatic juice cytology was developed in the early 1980s and is still being performed; however, cancer cells cannot easily be observed by collection of pancreatic juice[1,2,14]. Percutaneous needle biopsy was developed with the ex-pectation of a more definitive method to obtain proof of cancer from the primary pancreatic tumor[3,15,16]. Our institute then used percutaneous needle biopsy under extracorporeal US guidance as the standard for histo-logical confirmation of the pancreatic primary tumor. Recently, EUS-FNA was introduced and was used mainly in high-volume cancer centers in Japan[17-22]. As a result of the risk of cancer seeding as well as other risks with percutaneous biopsy, we adopted EUS-FNA beginning in November 2009 in place of percutaneous biopsy. We expected that EUS-FNA would have advantages over a percutaneous procedure with regard to efficacy in confir-mation of cancer and avoiding adverse reactions before administering chemotherapy to patients with PC.

Our results demonstrated that EUS-FNA is effec-tive and feasible for obtaining proof of cancer in can-didates for PC chemotherapy. In fact, EUS-FNA might have merits with regard to obtaining specimens from small tumors or tumors in the pancreatic tail, for which performance of percutaneous biopsy is difficult[2,23-27]. In this study, the location of the target tumor was most frequent at the body of the pancreas in Group A. In ad-dition, the target tumors were larger in Group A than in Group B. These findings suggest that patients might have been excluded from Group A in which difficulty could be expected in making a puncture because the tumor was either small or difficult to delineate. In these cases, endo-scopic retrograde cholangiopancreatography or liver bi-opsy might have been performed to obtain confirmation of malignancy, if possible.

Horwhat et al[12] have performed a randomized con-trolled trial of EUS-FNA and percutaneous biopsy of the pancreas (US- and CT-guided) in 2006. Although there was no statistically significant difference in accuracy between the two methods, the results showed that EUS-FNA had the advantage in the diagnosis of pancreatic malignancy. In our study, the diameters of the target tumors in the EUS-FNA group (Group B) were smaller than those in the US-FNA group (Group A) and the deviation of distribution around the puncture site was smaller in the EUS-FNA than the US-FNA group. Our results indicated high performance through the use of EUS-FNA and are not inconsistent with those of Hor-



and benign diseases.In conclusion, EUS-FNA, as well as percutaneous

needle aspiration, is an effective modality to obtain cyto-pathological confirmation in patients with advanced PC. EUS-FNA cytology was able to detect malignancy at a high rate. We believe that EUS-FNA has advantages for smaller tumors located deeply and for tumors in which the diagnosis is uncertain by various other imaging modalities.

ACKNOWLEDGMENTSWe thank the cytotechnologist team at Cancer Institute Hospital of the Japanese Foundation for Cancer Research for making this study possible.

COMMENTSBackgroundUltrasonography-guided fine-needle aspiration (US-FNA) biopsy or computed tomography (CT)-guided FNA biopsy was used for histological/cytological diag-nosis of pancreatic cancer (PC). US-FNA is limited to masses in the pancreatic tail. CT-guided FNA is time-consuming and limited by a substantial false-nega-tive rate. There have been concerns about percutaneous cancer seeding and difficulty in puncturing for small tumors. Endoscopic ultrasound (EUS)-guided FNA has been developed as a more feasible method of obtaining definitive specimens for the diagnosis of PC. Studies on the results of the two different approaches to obtain pancreatic biopsy specimens, which are the percutaneous approach and EUS-FNA, have rarely been conducted.Research frontiersThe benefits of EUS-FNA might be maximized to be able to make a pathologi-cal diagnosis in patients with an abdominal tumor of an uncertain type.Innovations and breakthroughsEUS-FNA is effective and feasible for obtaining proof of cancer in PC chemo-therapy candidates. In fact, EUS-FNA might have advantages with regard to obtaining specimens from small tumors or tumors in the pancreatic tail, for which performance of percutaneous biopsy is difficult.ApplicationsThe results suggest that EUS-FNA is the best method of obtaining cytological samples for diagnosis of unresectable PC. This method can be used for other types of cancer. TerminologyOn-site cytotechnologist: An on-site cytotechnologist should attend the puncture examination to confirm quickly the existence of atypical cells. The information of the cytotechnologist is more appropriate than that of the endoscopist. Peer reviewThis is a good descriptive study in which EUS-FNA is a feasible and safe tech-nique to acquire pancreatic specimens. The results are interesting in that the advantages of EUS-FNA over the percutaneous procedure are time between examination and diagnosis, the possibility of puncture of small tumors, and tumors in the tail of the pancreas.

REFERENCES1 Goodale RL, Gajl-Peczalska K, Dressel T, Samuelson J. Cy-

tologic studies for the diagnosis of pancreatic cancer. Cancer 1981; 47: 1652-1655 [PMID: 7272915 DOI: 10.1002/1097-0142(19810315)47]

2 Nakaizumi A, Tatsuta M, Uehara H, Yamamoto R, Tak-enaka A, Kishigami Y, Takemura K, Kitamura T, Okuda S. Cytologic examination of pure pancreatic juice in the diag-nosis of pancreatic carcinoma. The endoscopic retrograde intraductal catheter aspiration cytologic technique. Cancer 1992; 70: 2610-2614 [PMID: 1423189]

3 Di Stasi M, Lencioni R, Solmi L, Magnolfi F, Caturelli E, De Sio I, Salmi A, Buscarini L. Ultrasound-guided fine needle

biopsy of pancreatic masses: results of a multicenter study. Am J Gastroenterol 1998; 93: 1329-1333 [PMID: 9707060 DOI: 10.1111/j.1572-0241.1998.443]

4 Kocjan G, Rode J, Lees WR. Percutaneous fine needle aspi-ration cytology of the pancreas: advantages and pitfalls. J Clin Pathol 1989; 42: 341-347 [PMID: 2541174 DOI: 10.1136/jcp.42.4.341]

5 Bret PM, Nicolet V, Labadie M. Percutaneous fine-needle aspiration biopsy of the pancreas. Diagn Cytopathol 1986; 2: 221-227 [PMID: 3533479 DOI: 10.1002/dc.2840020309]

6 Kosugi C, Furuse J, Ishii H, Maru Y, Yoshino M, Kinoshita T, Konishi M, Nakagohri T, Inoue K, Oda T. Needle tract implantation of hepatocellular carcinoma and pancreatic carcinoma after ultrasound-guided percutaneous puncture: clinical and pathologic characteristics and the treatment of needle tract implantation. World J Surg 2004; 28: 29-32 [PMID: 14648043 DOI: 10.1007/s00268-003-7003-y]

7 Smith EH. Complications of percutaneous abdominal fine-needle biopsy. Review. Radiology 1991; 178: 253-258 [PMID: 1984314]

8 Erturk SM, Mortelé KJ, Tuncali K, Saltzman JR, Lao R, Sil-verman SG. Fine-needle aspiration biopsy of solid pancre-atic masses: comparison of CT and endoscopic sonography guidance. AJR Am J Roentgenol 2006; 187: 1531-1535 [PMID: 17114547]

9 Harewood GC, Wiersema MJ. Endosonography-guided fine needle aspiration biopsy in the evaluation of pancre-atic masses. Am J Gastroenterol 2002; 97: 1386-1391 [PMID: 12094855 DOI: 10.1111/j.1572-0241.2002.05777.x]

10 Yoshinaga S, Suzuki H, Oda I, Saito Y. Role of endoscopic ultrasound-guided fine needle aspiration (EUS-FNA) for di-agnosis of solid pancreatic masses. Dig Endosc 2011; 23 Suppl 1: 29-33 [PMID: 21535197 DOI: 10.1111/j.1443-1661.2011.01112.x]

11 Itoi T, Tsuchiya T, Itokawa F, Sofuni A, Kurihara T, Tsuji S, Ikeuchi N. Histological diagnosis by EUS-guided fine-needle aspiration biopsy in pancreatic solid masses without on-site cytopathologist: a single-center experience. Dig En-dosc 2011; 23 Suppl 1: 34-38 [PMID: 21535198 DOI: 10.1111/j.1443-1661.2011.01142.x]

12 Horwhat JD, Paulson EK, McGrath K, Branch MS, Baillie J, Tyler D, Pappas T, Enns R, Robuck G, Stiffler H, Jowell P. A randomized comparison of EUS-guided FNA versus CT or US-guided FNA for the evaluation of pancreatic mass le-sions. Gastrointest Endosc 2006; 63: 966-975 [PMID: 16733111 DOI: 10.1016/j.gie.2005.09.028]

13 NCCN. Clinical Practice Guidelines in Oncology (NCCN Guidelines®) Pancreatic cardinoma Version 2. 2012

14 Hatfield AR, Smithies A, Wilkins R, Levi AJ. Assessment of endoscopic retrograde cholangio-pancreatography (ERCP) and pure pancreatic juice cytology in patients with pan-creatic disease. Gut 1976; 17: 14-21 [PMID: 1269975 DOI: 10.1136/gut.17.1.14]

15 Gress F, Gottlieb K, Sherman S, Lehman G. Endoscopic ul-trasonography-guided fine-needle aspiration biopsy of sus-pected pancreatic cancer. Ann Intern Med 2001; 134: 459-464 [PMID: 11255521]

16 Matsubara J, Okusaka T, Morizane C, Ikeda M, Ueno H. Ultrasound-guided percutaneous pancreatic tumor biopsy in pancreatic cancer: a comparison with metastatic liver tu-mor biopsy, including sensitivity, specificity, and complica-tions. J Gastroenterol 2008; 43: 225-232 [PMID: 18373165 DOI: 10.1007/s00535-007-2142-9]

17 Tada M, Komatsu Y, Kawabe T, Sasahira N, Isayama H, Toda N, Shiratori Y, Omata M. Quantitative analysis of K-ras gene mutation in pancreatic tissue obtained by endoscopic ultrasonography-guided fine needle aspira-tion: clinical utility for diagnosis of pancreatic tumor. Am J Gastroenterol 2002; 97: 2263-2270 [PMID: 12358243 DOI: 10.1111/j.1572-0241.2002.05980.x]

18 Itoi T, Takei K, Sofuni A, Itokawa F, Tsuchiya T, Kurihara T,

COMMENTS



Nakamura K, Moriyasu F, Tsuchida A, Kasuya K. Immuno-histochemical analysis of p53 and MIB-1 in tissue specimens obtained from endoscopic ultrasonography-guided fine needle aspiration biopsy for the diagnosis of solid pancre-atic masses. Oncol Rep 2005; 13: 229-234 [PMID: 15643503]

19 Kitoh H, Ryozawa S, Harada T, Kondoh S, Furuya T, Kawauchi S, Oga A, Okita K, Sasaki K. Comparative ge-nomic hybridization analysis for pancreatic cancer speci-mens obtained by endoscopic ultrasonography-guided fine-needle aspiration. J Gastroenterol 2005; 40: 511-517 [PMID: 15942717 DOI: 10.1007/s00535-005-1577-0]

20 Imaoka H, Yamao K, Bhatia V, Shimizu Y, Yatabe Y, Koshi-kawa T, Kinoshita Y. Rare pancreatic neoplasms: the utility of endoscopic ultrasound-guided fine-needle aspiration-a large single center study. J Gastroenterol 2009; 44: 146-153 [PMID: 19214677 DOI: 10.1007/s00535-008-2282-6]

21 Sakamoto H, Kitano M, Komaki T, Noda K, Chikugo T, Dote K, Takeyama Y, Das K, Yamao K, Kudo M. Prospective comparative study of the EUS guided 25-gauge FNA needle with the 19-gauge Trucut needle and 22-gauge FNA needle in patients with solid pancreatic masses. J Gastroenterol Hepatol 2009; 24: 384-390 [PMID: 19032453 DOI: 10.1111/j.1440-1746.2008.05636.x]

22 Yamao K, Mizuno N, Takagi T, Hara K. How I do it and when I use (and do not use) EUS-FNA. Gastrointest En-dosc 2009; 69: S134-S137 [PMID: 19179139 DOI: 10.1016/j.gie.2008.12.020]

23 Sugiyama M, Hagi H, Atomi Y, Saito M. Diagnosis of portal venous invasion by pancreatobiliary carcinoma: value of en-doscopic ultrasonography. Abdom Imaging 1997; 22: 434-438 [PMID: 9157867 DOI: 10.1007/s002619900227]

24 Gress FG, Hawes RH, Savides TJ, Ikenberry SO, Cum-mings O, Kopecky K, Sherman S, Wiersema M, Lehman GA. Role of EUS in the preoperative staging of pancre-atic cancer: a large single-center experience. Gastrointest Endosc 1999; 50: 786-791 [PMID: 10570337 DOI: 10.1016/S0016-5107(99)70159-8]

25 Ainsworth AP, Rafaelsen SR, Wamberg PA, Durup J, Pless TK, Mortensen MB. Is there a difference in diagnostic ac-curacy and clinical impact between endoscopic ultraso-nography and magnetic resonance cholangiopancreatogra-phy? Endoscopy 2003; 35: 1029-1032 [PMID: 14648416 DOI: 10.1055/s-2003-44603]

26 DeWitt J, Devereaux B, Chriswell M, McGreevy K, Howard T, Imperiale TF, Ciaccia D, Lane KA, Maglinte D, Kopecky K, LeBlanc J, McHenry L, Madura J, Aisen A, Cramer H, Cum-mings O, Sherman S. Comparison of endoscopic ultrasonog-raphy and multidetector computed tomography for detect-ing and staging pancreatic cancer. Ann Intern Med 2004; 141: 753-763 [PMID: 15545675]

27 Ardengh JC, Rosenbaum P, Ganc AJ, Goldenberg A, Lobo EJ, Malheiros CA, Rahal F, Ferrari AP. Role of EUS in the preoperative localization of insulinomas compared with spi-ral CT. Gastrointest Endosc 2000; 51: 552-555 [PMID: 10805840 DOI: 10.1016/S0016-5107(00)70288-4]

28 Iglesias-Garcia J, Dominguez-Munoz JE, Abdulkader I, Larino-Noia J, Eugenyeva E, Lozano-Leon A, Forteza-Vila J. Influence of on-site cytopathology evaluation on the di-agnostic accuracy of endoscopic ultrasound-guided fine needle aspiration (EUS-FNA) of solid pancreatic masses. Am

J Gastroenterol 2011; 106: 1705-1710 [PMID: 21483464 DOI: 10.1038/ajg.2011.119]

29 Savoy AD, Raimondo M, Woodward TA, Noh K, Pungpa-pong S, Jones AD, Crook J, Wallace MB. Can endosonogra-phers evaluate on-site cytologic adequacy? A comparison with cytotechnologists. Gastrointest Endosc 2007; 65: 953-957 [PMID: 17531627 DOI: 10.1016/j.gie.2006.11.014]

30 Binmoeller KF, Thul R, Rathod V, Henke P, Brand B, Ja-busch HC, Soehendra N. Endoscopic ultrasound-guided, 18-gauge, fine needle aspiration biopsy of the pancreas using a 2.8 mm channel convex array echoendoscope. Gastrointest Endosc 1998; 47: 121-127 [PMID: 9512275 DOI: 10.1016/S0016-5107(98)70343-8]

31 Săftoiu A, Vilmann P, Guldhammer Skov B, Georgescu CV. Endoscopic ultrasound (EUS)-guided Trucut biopsy adds significant information to EUS-guided fine-needle aspira-tion in selected patients: a prospective study. Scand J Gastro-enterol 2007; 42: 117-125 [PMID: 17190771 DOI: 10.1080/00365520600789800]

32 Storch I, Jorda M, Thurer R, Raez L, Rocha-Lima C, Vernon S, Ribeiro A. Advantage of EUS Trucut biopsy combined with fine-needle aspiration without immediate on-site cyto-pathologic examination. Gastrointest Endosc 2006; 64: 505-511 [PMID: 16996340 DOI: 10.1016/j.gie.2006.02.056]

33 Itoi T, Itokawa F, Sofuni A, Nakamura K, Tsuchida A, Yamao K, Kawai T, Moriyasu F. Puncture of solid pancre-atic tumors guided by endoscopic ultrasonography: a pilot study series comparing Trucut and 19-gauge and 22-gauge aspiration needles. Endoscopy 2005; 37: 362-366 [PMID: 15824948 DOI: 10.1055/s-2004-826156]

34 Varadarajulu S, Fraig M, Schmulewitz N, Roberts S, Wildi S, Hawes RH, Hoffman BJ, Wallace MB. Comparison of EUS-guided 19-gauge Trucut needle biopsy with EUS-guided fine-needle aspiration. Endoscopy 2004; 36: 397-401 [PMID: 15100946 DOI: 10.1055/s-2004-814316]

35 Stewart CJ, Coldewey J, Stewart IS. Comparison of fine needle aspiration cytology and needle core biopsy in the diagnosis of radiologically detected abdominal lesions. J Clin Pathol 2002; 55: 93-97 [PMID: 11865001 DOI: 10.1136/jcp.55.2.93]

36 Fornari F, Civardi G, Cavanna L, Di Stasi M, Rossi S, Sbolli G, Buscarini L. Complications of ultrasonically guided fine-needle abdominal biopsy. Results of a multicenter Italian study and review of the literature. The Cooperative Italian Study Group. Scand J Gastroenterol 1989; 24: 949-955 [PMID: 2688068]

37 Paquin SC, Gariépy G, Lepanto L, Bourdages R, Raymond G, Sahai AV. A first report of tumor seeding because of EUS-guided FNA of a pancreatic adenocarcinoma. Gastrointest Endosc 2005; 61: 610-611 [PMID: 15812422]

38 Chong A, Venugopal K, Segarajasingam D, Lisewski D. Tu-mor seeding after EUS-guided FNA of pancreatic tail neo-plasia. Gastrointest Endosc 2011; 74: 933-935 [PMID: 21951481 DOI: 10.1016/j.gie.2010.10.020]

39 Katanuma A, Maguchi H, Hashigo S, Kaneko M, Kin T, Yane K, Kato R, Kato S, Harada R, Osanai M, Takahashi K, Shinohara T, Itoi T. Tumor seeding after endoscopic ultrasound-guided fine-needle aspiration of cancer in the body of the pancreas. Endoscopy 2012; 44 Suppl 2 UCTN: E160-E161 [PMID: 22622721 DOI: 10.1055/s-0031-1291716]

P- Reviewer Michalski C S- Editor Gou SX L- Editor Kerr C E- Editor Li JY


Seroprevalence of celiac disease among healthy adolescents in Saudi Arabia

Abdulrahman M Aljebreen, Majid A Almadi, Alwaleed Alhammad, Faleh Z Al Faleh

Abdulrahman M Aljebreen, Majid A Almadi, Faleh Z Al Faleh, Gastroenterology Division, King Khalid University Hos-pital, King Saud University, Riyadh 11461, Saudi ArabiaMajid A Almadi, Gastroenterology Division, McGill University Health Center, Montreal General Hospital, McGill University, Montreal H3G 1A4, CanadaAlwaleed Alhammad, Immunology Unit, Department of Pathol-ogy, King Saud University, Riyadh 11461, Saudi ArabiaAuthor contributions: Aljebreen AM designed the study, ana-lyzed the data and wrote the paper; Almadi MA analyzed the data and wrote the paper; Alhammad A conducted the blood test and revised the paper; Al Faleh FZ designed the study and wrote the paper.Correspondence to: Abdulrahman M Aljebreen, FRCPC, FACP, Associate Professor of Internal Medicine, Consultant of Gastroenterology, Gastroenterology Division, King Khalid Uni-versity Hospital, King Saud University, PO Box 2925, Riyadh 11461, Saudi Arabia. [email protected]: +966-1-4671215 Fax: +966-1-4671217Received: December 6, 2012 Revised: January 22, 2013Accepted: February 5, 2013Published online: April 21, 2013

AbstractAIM: To identify the seroprevalence of celiac disease among healthy Saudi adolescents.

METHODS: Between December 2007 and January 2008, healthy students from the 10th to 12th grades were randomly selected from three regions in Saudi Arabia. These regions included the following: (1) As-eer region, with a student population of 25512; (2) Madinah, with a student population of 23852; and (3) Al-Qaseem, with a student population of 16067. De-mographic data were recorded, and a venous blood sample (5-10 mL) was taken from each student. The blood samples were tested for immunoglobulin A and immunoglobulin G endomysial antibodies (EMA) by in-direct immunofluorescence.

RESULTS: In total, 1167 students (614 males and 553 females) from these three regions were randomly selected. The majority of the study population was classified as lower middle class (82.7%). There were 26 (2.2%) students who had a positive anti-EMA test, including 17 females (3.1%) and 9 males (1.5%). Al-Qaseem region had the highest celiac disease preva-lence among the three studied regions in Saudi Arabia (3.1%). The prevalence by region was as follows: Aseer 2.1% (10/479), Madinah 1.8% (8/436), and Al-Qaseem 3.2% (8/252). The prevalence in Madinah was significantly lower than the prevalence in Aseer and Al-Qaseem (P = 0.02).

CONCLUSION: Our data suggest celiac disease preva-lence might be one of the highest in the world. Further studies are needed to determine the real prevalence.


Key words: Celiac disease; Saudi Arabia; Prevalence; Antiendomysial antibody; Epidemiology

Core tip: The celiac disease (CD) prevalence has pro-gressively increased and, recently, it was proposed that it might be higher than 1 in 100. Until the 1990s, the prevalence of CD in Middle Eastern and North African countries was considered low. In this cohort of 1167 healthy young Saudi students who had anti-endomysial antibodies (EMA) test, the seroprevalence of celiac dis-ease was 2.2% (1 in 45) and as high as 3.1% among females. Although intestinal biopsies were not available in our study, the high specificity of immunoglobulin A anti-EMA might indicate the celiac disease prevalence in Saudi Arabia might be one of the highest celiac dis-ease prevalence rates in the world.

Aljebreen AM, Almadi MA, Alhammad A, Al Faleh FZ. Serop-revalence of celiac disease among healthy adolescents in Saudi

BRIEF ARTICLE





Arabia. World J Gastroenterol 2013; 19(15): 2374-2378 Avail-able from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2374.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2374

INTRODUCTIONCeliac disease (CD) is a chronic systemic autoimmune disorder induced by gluten proteins present in wheat, barley, and rye. Genetically susceptible individuals de-velop autoimmune injury to the gut, skin, liver, joints, uterus, brain, heart, and other organs. The classical defi-nition of CD includes gastrointestinal manifestations (chronic diarrhea, failure to thrive, weight loss, vomiting, abdominal pain, bloating, distention, and constipation) confirmed by a small bowel biopsy, with findings of vil-lous atrophy, crypt hyperplasia, and normalization of the villous architecture in response to a gluten-free diet[1]. Celiac disease has been classified into 4 phenotypes: classic, atypical, silent and latent. “Latent” celiac disease describes asymptomatic individuals with currently nor-mal histological findings on a gluten-sufficient diet who subsequently develop celiac disease or those with a prior diagnosis of celiac disease who responded to a gluten free diet and retained normal mucosal histological find-ings despite the long-term ingestion of gluten[2]. Until the 1980s, CD was considered to be a rare disease, but in the 1990s, it became clear that CD was a frequent condition. In 1995, it was suggested that the prevalence of CD in the general population could be approximately 1 in 250 individuals[3]. This prevalence has progressively increased and, recently, it was proposed that it might be higher than 1 in 100. This increase is mainly due to the increased use of assays that detect celiac antibodies to identify affected individuals[4,5]. Until the 1990s, the prevalence of CD in Middle Eastern and North African countries was consid-ered low. However, with the introduction of antigliadin antibodies, anti-endomysial antibody (EMA), and tissue transglutaminase antibodies testing, CD has been more readily reported from these regions[6], and its prevalence appears similar to that of North American and European countries[6-9]. There are scarce data regarding the preva-lence of celiac disease in Saudi Arabia[10]. A recent study has shown a seroprevalence of 1.5% among 204 healthy blood donors[11].

The aim of this study was to identify the seropreva-lence of celiac disease among a healthy adolescent popu-lation in three regions of Saudi Arabia.

MATERIALS AND METHODSStudy populationSaudi Arabia is comprised of 13 regions. The first region in our study, Aseer, is located in the southwestern part of Saudi Arabia and is a mountainous area with mild weath-er throughout the year. The population of this region is estimated to be 1.75 million people. Madinah, where the second holy city is located, is in the western part of Saudi

Arabia and has a population of 1.61 million people. The third region, Al-Qaseem, is located in central Saudi Ara-bia, with a total population of approximately 1.07 million people. Al-Qaseem is considered an agricultural region. The three regions comprise approximately 18.5% of the Saudi population. These data were taken from the last population census in Saudi Arabia conducted in 2007.

To test for the prevalence rate of celiac disease us-ing anti-EMA, we used blood samples that had been collected for a previous study[12]. The samples had been collected from a population of students in the 10th to 12th grades (corresponding to the ages of 16 to 18 years) in three regions of Saudi Arabia. The composition of the student population was as follows: Aseer region, with a total school population of 25512 (13996 males and 11516 females); Madinah region, with a total school popula-tion of 23852 (12133 males and 11719 females); and Al-Qaseem region, with a total school population of 16067 (7974 males and 8093 females).

The sample was selected using a stratified random sampling technique, where the Kingdom was stratified into three strata. A proportional allocation method was used to determine the recruited number of students in each stratum.

Within each stratum, the sample was proportionally allocated according to sex. In every region, the schools served as the sampling units. It is worth noting that the schooling system in Saudi Arabia depends on segregating males and females in different schools, and this situation was taken in consideration for sampling. From the list of schools in the region, one or more male schools and one or more female schools that satisfied the required sample size were randomly selected. A total of 1358 students (679 males and 679 females) from these regions were randomly selected. The socioeconomic status (SES) of this population was stratified as lower, middle, and upper class. The SES of a student was taken to be representa-tive of that of the father and ⁄or mother and was classi-fied from the socioeconomic score derived from the type of house, the number of rooms per house, the number of cohabiting family members, parents’ educational lev-els, and parents’ occupations. The SES of students was measured using a point scale of 1-21 as follows: housing, 3 points; education of parents, 6 points; type of work of parents, 6 points; number of family members, 3 points; and number of rooms in the house, 3 points. Students who scored 17-21 points were classified as upper class, 15-16 as upper middle class, 11-14 as lower middle class, and 10 or less as lower class[12].

The protocol of this study has been approved previ-ously by King Abdulaziz City for Science and Technol-ogy, and informed consent was obtained from the par-ents and the participating students. All participants were offered further medical evaluation by a gastroenterologist in case of a positive EMA test.

Data collection, blood sampling and testingThe fieldwork for this study was undertaken in December


Aljebreen AM et al . Seroprevalence of celiac disease in Saudi Arabia

2007 and January 2008. Demographic data were record-ed, and a venous blood sample (5-10 mL) was taken from each student. The serum was separated by centrifuga-tion, coded, and stored at -70˚C. The blood samples were tested for immunoglobulin A (IgA) and immunoglobulin G anti-EMA by indirect immunofluorescence (IMMCO Diagnostics, Inc., Buffalo, NY, United States).

Statistical analysisData were entered into electronic databases and analyzed using Stata Version 10 (Stata Corporation, College Sta-tion, TX, United States). Descriptive statistics (propor-tional) were used to summarize categorical variables. The chi-square test, followed by an analysis of residuals, was used to calculate the statistical association between two categorical variables. The chi-square test for trends was used to calculate the significance of proportions of variables with three or more categories. A P value of < 0.05 was considered statistically significant. Based on a general prevalence of 1% in various populations and an estimated prevalence of 3% in the Saudi population, we determined the sample size at P value (alpha) = 0.05 and power = 0.70 and a standard deviation of 0.25, the esti-mated sample size would be 965 individuals.

RESULTSBlood samples of 1167 students (614 males and 553 fe-males) were available for testing, while 191 samples were either missing or insufficient for analysis. The mean age for the study population was 16.6 ± 0.6 years. There were no differences in the sex distribution among the three regions (P = 0.08). The majority of the study population was classified as lower middle class (82%).

There were 26 (2.2%) students who had a positive anti-EMA test, including 17 females (3.1%) and 9 males (1.5%). Al-Qaseem region had the highest CD prevalence among the three studied regions in Saudi Arabia (3.1%) (Table 1).

The prevalence by region was as follows: Aseer 2.1% (10/479), Madinah 1.8% (8/436), and Al-Qaseem 3.2% (8/252). The prevalence in Madinah was significantly lower than the prevalence in Aseer and Al-Qaseem (P = 0.02). There was no statistically significant difference in prevalence between Aseer and Al-Qaseem.

DISCUSSIONTwo decades ago, celiac disease was considered a com-paratively uncommon disorder, with prevalence rates of 1 in 1000 or lower[13,14]. CD was even thought to be rare or nonexistent among native Africans, Japanese or Chinese populations[14]. Several recent population based studies, however, have shown a much higher prevalence, and it is now estimated that celiac disease may affect between 1 in 100 to 200 individuals[4,15].

The seroprevalence rate of 2.2% (1 in 45) found in our study might be one of the highest seroprevalence

rates of celiac disease in the world. Although the preva-lence of diagnosed CD varied widely, the estimates of combined undiagnosed and diagnosed (or silent and ac-tive) CD were remarkably similar at 0.7%-2.0% in most other populations, including the United States. The prevalence of childhood CD has been reported to be between 1:285 and 1:77 in Sweden[16] and 1:230 and 1:106 in Italian school aged children[17]. Generally, similar rates have been reported for non-European white populations, such as New Zealand[18], Australia[19], Brazil[20] and Argen-tina[21]. Recent epidemiological studies of CD prevalence rates for North Africa (reported as 0.53% in Egypt, 0.79% in Libya, and 0.6% in Tunisia), the Middle East (0.88% in Iran and 0.6% in Turkey), and India (0.7%) show prevalence rates that overlap with the European data[22]. A recent study among 204 healthy Saudi blood donors showed a celiac seroprevalence of 1.5%[11].

A recently published large international, multicenter study investigated a large population sample in four dif-ferent European countries; on average, the overall preva-lence of CD was 1%, with large variations among the studied countries (2.0% in Finland, 1.2% in Italy, 0.9% in Northern Ireland, and 0.3% in Germany). This study confirmed that many CD cases would remain undetected without active serological screening[23].

Of 3654 students (age range, 7 to 16 years) from Fin-land who had been screened for anti-endomysial and tis-sue transglutaminase antibodies, Mäki et al[15] found that 1 in 66 students (1.5%) had positive antibody tests. Of the 36 students from that study with positive antibody assays who agreed to undergo biopsy, 27 had evidence of celiac disease on biopsy. Thus, the estimated biopsy proved prevalence was 1 case in 99 (1%) children. In our study, we have only used a single serological marker (EMA) without duodenal biopsy. The diagnostic standard in celiac serolo-gies remains the anti-endomysial IgA antibodies. These markers are highly specific for celiac disease, with nearly 100% accuracy, which is a crucial point when we use them to study populations at low risk of CD[24]. Of 20190 Turk-ish students, Dalgic et al[25] found 489 (2.4%) patients with positive antibodies (IgA-tTG and IgA-EMA). Among 215 patients who underwent an intestinal biopsy, there were only 95 children who were consistent with CD, with an estimated biopsy proven prevalence of 1:212 (0.47%) children. Hogen Esch et al[26] demonstrated that mass screening unavoidably reveals some false-positive and/or false-negative test results, regardless of the type of celiac antibody test. The predictive value of a diagnostic test de-pends on the prevalence of the disease and the sensitivity and specificity of the test[27]. In low-risk populations (such


Aseer (479) Madinah (436) Al-Qaseem (252) Total (1167)

Male (614) 4/250 (1.6) 1/244 (0.4) 4/120 (3.4) 9/614 (1.5) Female (553) 6/229 (2.6) 7/192 (3.6) 4/132 (3.0) 17/553 (3.1) Total (1167) 10/479 (2.1) 8/436 (1.8) 8/252 (3.2) 26/1167 (2.2)

Table 1 Seroprevalence according to regions and sex n (%)



coeliac disease and medical audit. Arch Dis Child 1991; 66: 561 [PMID: 2031627 DOI: 10.1136/adc.66.4.561]

2 Rostom A, Murray JA, Kagnoff MF. American Gastroen-terological Association (AGA) Institute technical review on the diagnosis and management of celiac disease. Gastroen-terology 2006; 131: 1981-2002 [PMID: 17087937 DOI: 10.1053/j.gastro.2006.10.004]

3 Hill ID, Horvath K, Fasano A. Epidemiology of celiac dis-ease. Am J Gastroenterol 1995; 90: 163-164 [PMID: 7801932]

4 Green PH, Cellier C. Celiac disease. N Engl J Med 2007; 357: 1731-1743 [PMID: 17960014 DOI: 10.1056/NEJMra071600]

5 Vilppula A, Kaukinen K, Luostarinen L, Krekelä I, Patri-kainen H, Valve R, Mäki M, Collin P. Increasing prevalence and high incidence of celiac disease in elderly people: a population-based study. BMC Gastroenterol 2009; 9: 49 [PMID: 19558729 DOI: 10.1186/1471-230X-9-49]

6 Rostami K, Malekzadeh R, Shahbazkhani B, Akbari MR, Catassi C. Coeliac disease in Middle Eastern countries: a challenge for the evolutionary history of this complex dis-order? Dig Liver Dis 2004; 36: 694-697 [PMID: 15506671 DOI: 10.1016/j.dld.2004.05.010]

7 Akbari MR, Mohammadkhani A, Fakheri H, Javad Zahedi M, Shahbazkhani B, Nouraie M, Sotoudeh M, Shakeri R, Malekzadeh R. Screening of the adult population in Iran for coeliac disease: comparison of the tissue-transglutaminase antibody and anti-endomysial antibody tests. Eur J Gastro-enterol Hepatol 2006; 18: 1181-1186 [PMID: 17033439 DOI: 10.1097/01.meg.0000224477.51428.32]

8 Ben Hariz M, Kallel-Sellami M, Kallel L, Lahmer A, Halioui S, Bouraoui S, Laater A, Sliti A, Mahjoub A, Zouari B, Makni S, Maherzi A. Prevalence of celiac disease in Tunisia: mass-screening study in schoolchildren. Eur J Gastroenterol Hepatol 2007; 19: 687-694 [PMID: 17625439 DOI: 10.1097/MEG.0b013e328133f0c1]

9 Tatar G, Elsurer R, Simsek H, Balaban YH, Hascelik G, Ozcebe OI, Buyukasik Y, Sokmensuer C. Screening of tissue transglutaminase antibody in healthy blood donors for ce-liac disease screening in the Turkish population. Dig Dis Sci 2004; 49: 1479-1484 [PMID: 15481323]

10 Al Attas RA. How common is celiac disease in Eastern Saudi Arabia? Ann Saudi Med 2002; 22: 315-319 [PMID: 17146251]

11 Khayyat YM. Serologic markers of gluten sensitivity in a healthy population from the western region of Saudi Ara-bia. Saudi J Gastroenterol 2012; 18: 23-25 [PMID: 22249088 DOI: 10.4103/1319-3767.91733]

12 Al Faleh F, Al Shehri S, Al Ansari S, Al Jeffri M, Al Mazrou Y, Shaffi A, Abdo AA. Changing patterns of hepatitis A preva-lence within the Saudi population over the last 18 years. World J Gastroenterol 2008; 14: 7371-7375 [PMID: 19109871 DOI: 10.3748/wjg.14.7371]

13 Feighery C. Fortnightly review: coeliac disease. BMJ 1999; 319: 236-239 [PMID: 10417090 DOI: 10.1136/bmj.319.7204.236]

14 Trier JS. Celiac sprue. N Engl J Med 1991; 325: 1709-1719 [PMID: 1944472 DOI: 10.1056/NEJM199112123252406]

15 Mäki M, Mustalahti K, Kokkonen J, Kulmala P, Haapalahti M, Karttunen T, Ilonen J, Laurila K, Dahlbom I, Hansson T, Höpfl P, Knip M. Prevalence of Celiac disease among chil-dren in Finland. N Engl J Med 2003; 348: 2517-2524 [PMID: 12815137 DOI: 10.1056/NEJMoa021687]

16 Carlsson AK, Axelsson IE, Borulf SK, Bredberg AC, Ivars-son SA. Serological screening for celiac disease in healthy 2.5-year-old children in Sweden. Pediatrics 2001; 107: 42-45 [PMID: 11134432 DOI: 10.1542/peds.107.1.42]

17 Tommasini A, Not T, Kiren V, Baldas V, Santon D, Trevisiol C, Berti I, Neri E, Gerarduzzi T, Bruno I, Lenhardt A, Zamu-ner E, Spanò A, Crovella S, Martellossi S, Torre G, Sblattero D, Marzari R, Bradbury A, Tamburlini G, Ventura A. Mass screening for coeliac disease using antihuman transglu-taminase antibody assay. Arch Dis Child 2004; 89: 512-515 [PMID: 15155392 DOI: 10.1136/adc.2003.029603]

as groups undergoing mass screening), the positive predic-tive value of the serological tests is always lower than in symptomatic patients or at-risk groups[28]. However, IgA EMA has an approximately 100% specificity and is the best among all celiac serologies.

Another important finding of our study is the higher prevalence of celiac disease among female compared to male students, which is a finding that was observed in most of the celiac disease epidemiological studies. In ad-dition, there was a significant variation of celiac disease seroprevalence from region to region in Saudi Arabia.

The high prevalence of celiac disease found in our study might be attributed to the high levels of consan-guinity and the heavy gluten ingestion in our population. The Saharawi population of Arab-Berber origin living in Algeria has the highest prevalence of CD (5.6%) among all world populations[29]. The reason for such a frequency of the “celiac trait” in this population is not clear but is likely to be related to their genetic background.

In conclusion, our study provides evidence of a high seroprevalence of CD in a group of school-aged children in 3 regions of Saudi Arabia. Although intestinal biopsies were not available in our study, the high specificity of IgA anti-EMA might indicate one of the highest celiac disease prevalence rates in the world. Further seropreva-lence studies with larger samples combined with multiple duodenal biopsies are highly recommended to determine the true celiac disease prevalence in our country.

COMMENTSBackgroundThe celiac disease (CD) prevalence has progressively increased and, recently, it was proposed that it might be higher than 1 in 100. This increase is mainly due to the increased use of assays that detect celiac antibodies to identify af-fected individuals. Until the 1990s, the prevalence of CD in Middle Eastern and North African countries was considered low. However, with the introduction of celiac antibodies, CD has been more readily reported from these regions, and its prevalence appears similar to that of North American and European countries. A recent study has shown a seroprevalence of 1.5% among 204 healthy Saudi blood donors. The aim of this study was to identify the seroprevalence of celiac disease among a healthy adolescent population in three regions of Saudi Arabia.Research frontiersThere are scarce data regarding the prevalence of celiac disease in Saudi Arabia. A recent study has shown a seroprevalence of 1.5% among 204 healthy blood donors.Innovations and breakthroughsThe results suggest a very high seroprevalence of celiac disease among healthy young Saudi students. Although intestinal biopsies were not available in this study, the high specificity of immunoglobulin A anti-endomysial antibody might indicate one of the highest celiac disease prevalence rates in the world. ApplicationsFurther seroprevalence studies with larger samples combined with multiple du-odenal biopsies are highly recommended to determine the true celiac disease prevalence in Saudi Arabia.Peer reviewThe manuscript underlines the seroprevalence of the celiac disease in Saudi Arabia.

REFERENCES1 Riordan FA, Davidson DC. Revised criteria for diagnosis of

COMMENTS



18 Cook HB, Burt MJ, Collett JA, Whitehead MR, Frampton CM, Chapman BA. Adult coeliac disease: prevalence and clinical significance. J Gastroenterol Hepatol 2000; 15: 1032-1036 [PMID: 11059933 DOI: 10.1046/j.1440-1746.2000.02290.x]

19 Hovell CJ, Collett JA, Vautier G, Cheng AJ, Sutanto E, Mal-lon DF, Olynyk JK, Cullen DJ. High prevalence of coeliac disease in a population-based study from Western Austra-lia: a case for screening? Med J Aust 2001; 175: 247-250 [PMID: 11587254]

20 Oliveira RP, Sdepanian VL, Barreto JA, Cortez AJ, Carvalho FO, Bordin JO, de Camargo Soares MA, da Silva Patrício FR, Kawakami E, de Morais MB, Fagundes-Neto U. High prevalence of celiac disease in Brazilian blood donor volun-teers based on screening by IgA antitissue transglutaminase antibody. Eur J Gastroenterol Hepatol 2007; 19: 43-49 [PMID: 17206076 DOI: 10.1097/01.meg.0000250586.61232.a3]

21 Gomez JC, Selvaggio GS, Viola M, Pizarro B, la Motta G, de Barrio S, Castelletto R, Echeverría R, Sugai E, Vazquez H, Mauriño E, Bai JC. Prevalence of celiac disease in Argentina: screening of an adult population in the La Plata area. Am J Gastroenterol 2001; 96: 2700-2704 [PMID: 11569698 DOI: 10.1111/j.1572-0241.2001.04124.x]

22 Lionetti E, Catassi C. New clues in celiac disease epidemiol-ogy, pathogenesis, clinical manifestations, and treatment. Int Rev Immunol 2011; 30: 219-231 [PMID: 21787227 DOI: 10.3109/08830185.2011.602443]

23 Mustalahti K, Catassi C, Reunanen A, Fabiani E, Heier M, McMillan S, Murray L, Metzger MH, Gasparin M, Bravi E, Mäki M. The prevalence of celiac disease in Europe: results

of a centralized, international mass screening project. Ann Med 2010; 42: 587-595 [PMID: 21070098 DOI: 10.3109/07853890.2010.505931]

24 Biagi F, Klersy C, Balduzzi D, Corazza GR. Are we not over-estimating the prevalence of coeliac disease in the general population? Ann Med 2010; 42: 557-561 [PMID: 20883139 DOI: 10.3109/07853890.2010.523229]

25 Dalgic B, Sari S, Basturk B, Ensari A, Egritas O, Bukulmez A, Baris Z. Prevalence of celiac disease in healthy Turk-ish school children. Am J Gastroenterol 2011; 106: 1512-1517 [PMID: 21691340 DOI: 10.1038/ajg.2011.183]

26 Hogen Esch CE, Csizmadia GD, van Hoogstraten IM, Sch-reurs MW, Mearin ML, von Blomberg BM. Childhood coeli-ac disease: towards an improved serological mass screening strategy. Aliment Pharmacol Ther 2010; 31: 760-766 [PMID: 20047580 DOI: 10.1111/j.1365-2036.2009.04226.x]

27 Scoglio R, Di Pasquale G, Pagano G, Lucanto MC, Magazzù G, Sferlazzas C. Is intestinal biopsy always needed for diag-nosis of celiac disease? Am J Gastroenterol 2003; 98: 1325-1331 [PMID: 12818277 DOI: 10.1111/j.1572-0241.2003.07455.x]

28 van der Windt DA, Jellema P, Mulder CJ, Kneepkens CM, van der Horst HE. Diagnostic testing for celiac disease among patients with abdominal symptoms: a systematic review. JAMA 2010; 303: 1738-1746 [PMID: 20442390 DOI: 10.1001/jama.2010.549]

29 Catassi C, Rätsch IM, Gandolfi L, Pratesi R, Fabiani E, El Asmar R, Frijia M, Bearzi I, Vizzoni L. Why is coeliac disease endemic in the people of the Sahara? Lancet 1999; 354: 647-648 [PMID: 10466670 DOI: 10.1016/S0140-6736(99)02609-4]

P- Reviewer Esrefoglu M S- Editor Gou SX L- Editor A E- Editor Li JY


Factors influencing clinical outcomes of Histoacryl® glue injection-treated gastric variceal hemorrhage

Varayu Prachayakul, Pitulak Aswakul, Tanyaporn Chantarojanasiri, Somchai Leelakusolvong

Varayu Prachayakul, Pitulak Aswakul, Tanyaporn Chantaro-janasiri, Somchai Leelakusolvong, Division of Gastroenter-ology, Department of Internal Medicine, Faculty of Medicine, Mahidol University, Siriraj Hospital, Bangkok 10700, ThailandPitulak Aswakul, Liver and Digestive Institute, Samitivej Sukhumvit Hospital, Bangkok 10700, ThailandAuthor contributions: Chantarojanasiri T acquired the data; Leelakusolvong S critically assessed the manuscript’s intellectual content; Aswakul P conceptualized and designed the study, ana-lyzed and interpreted the data, drafted and revised the manuscript; Prachayakul V conceptualized and designed the study, analyzed and interpreted the data, and critically assessed and revised the manuscript’s intellectual content.Correspondence to: Dr. Varayu Prachayakul, Division of Gastroenterology, Department of Internal Medicine, Faculty of Medicine, Mahidol University, Siriraj Hospital, 2 Prannok road, Siriraj, Bangkok Noi, Bangkok 10700, Thailand. [email protected]: +66-2-4121088 Fax: +66-2-4199610Received: November 19, 2012 Revised: January 3, 2013 Accepted: January 23, 2013Published online: April 21, 2013

AbstractAIM: To determine the factors associated with clinical outcomes and complications of Histoacryl® glue injec-tion for acute gastric variceal hemorrhage.

METHODS: Patients who presented to the Siriraj Gastrointestinal Endoscopy Center with active gastric variceal bleeding and were admitted for treatment between April 2008 and October 2011 were selected retrospectively for study inclusion. All bleeding varices were treated by injection of Histoacryl® tissue glue (B. Braun Melsungen AG, Germany) through a 21G or 23G catheter primed with lipiodol to prevent premature glue solidification. Data recorded for each patient in-cluded demographic and clinical characteristics, endo-scopic findings, clinical outcomes in terms of early and late re-bleeding, mortality, and procedure-related com-

plications. Data from admission (baseline) and post-treatment were comparatively analyzed using stepwise logistic regression analysis to determine the correlation between factors and clinical outcomes.

RESULTS: A total of 90 patients underwent Histoacryl® injection to treat bleeding gastric varices. The mean age was 55.9 ± 13.9 (range: 15-88) years old, and 74.4% of the patients were male. The most common presentations were hematemesis (71.1%), melena (12.2%), and coffee ground emesis (8.9%). Initial he-mostasis was experienced in 97.8% of patients, while re-bleeding within 120 h occurred in 10.0%. The pres-ence of ascites was the only factor associated with early and late re-bleeding [odds ratio (OR) = 10.67, 95%CI: 1.27-89.52, P = 0.03 and OR = 4.15, 95%CI: 1.34-12.86, P = 0.01, respectively]. Early procedure-related complications developed in 14.4% of patients, and were primarily infections and non-fatal systemic embolization. Late re-bleeding was significantly cor-related with early procedure-related complications by univariate analysis (OR = 4.01, 95%CI: 1.25-12.87, P = 0.04), but no factors were significantly corre-lated by multivariate analysis. The overall mortality rate was 21.1%, the majority of which were related to infections. The factors showing strong association with higher mortality risk were elevated total bilirubin (OR = 16.71, 95%CI: 3.28-85.09, P < 0.01), a large amount of transfused fresh frozen plasma (OR = 1.001, 95%CI: 1.000-1.002, P = 0.03), and late re-bleeding (OR = 10.99, 95%CI: 2.15-56.35, P = 0.02).

CONCLUSION: Histoacryl® injection is a safe and ef-fective hemostatic method for treating gastric variceal hemorrhage. Patients with compromised liver, including ascites, have a higher risk of re-bleeding.


Key words: Histoacryl; Gastric varices; Clinical outcome; Complications; Hemorrhage

BRIEF ARTICLE





commonly used treatment for initial acute gastric varices, with TIPS or B-RTO applied subsequent to Histoacryl® injection failure. The preference for Histoacryl® injection is largely due to liver status-related contraindications af-fecting TIPS and B-RTO, as well as their inconvenience for application in emergency care clinical settings[1-10].

Since its introduction in 1984[3], widespread use of Histoacryl® has shown that this agent can successfully resolve bleeding gastric varices. Recent evaluation of the accumulated reports of complications arising in Histo-acryl®-treated patients, such as systemic embolization, end-organ infarction, visceral fistula, and bacteremia, have also indicated this adhesive is relatively safe and effective[1,9-13]. A few small case series from Germany, the United Kingdom, Italy and Uruguay have shown 88%-98% initial hemostasis with only a 1% rate of severe complications, such as systemic embolization, and a re-bleeding rate of 10%-29%[4-10]. Studies from China and Korea reported 95%-100% success rates but a similar range of re-bleeding rates at 1-year follow-up[6-13]. How-ever, no studies to date have identified the factors related to clinical outcome of gastric variceal hemorrhage fol-lowing Histoacryl® treatment. Therefore, we performed the current retrospective analysis to evaluate the correla-tion of clinical and/or demographic characteristics to clinical outcome and procedure-related complications.

MATERIALS AND METHODSPatient selection and clinical proceduresThe medical records of the Siriraj Gastrointestinal En-doscopy Center were searched to identify all patients who presented with active gastric variceal bleeding and under-went Histoacryl® injection treatment between April 2008 and October 2011. Data recorded at admission (baseline) and during the subsequent hospitalization and follow-up examinations were recorded, including demographic and clinical characteristics, endoscopic procedures and find-ings, and clinical outcomes in terms of early and late re-bleeding, mortality, and procedure-related complications. The study was carried out with pre-approval by the Siriraj Institutional Review Board (No. Si001/2012).

Each gastric varices case was classified as GOV1, GOV2, IGV1 or IGV2, according to the strategy described by Marques et al[13]. All of the cases were diagnosed as acute gastric variceal bleeding. The clinical setting was classified as emergency when the procedure was carried out within 24 h of the bleeding episode, and as urgent in the case of self-limited bleeding. All patients underwent the treat-ment procedure within the initial admission period, and no patient was released and re-admitted for the treatment. Achievement of initial hemostasis was defined by stable vi-tal signs and absence of re-bleeding within 24 h. Re-bleed-ing was defined by the presence of active bleeding from the treated varices directly observed by endoscopy (using forward-viewing gastroscopes GIF 1T145, GIF XTQ 160, or GIF Q180; Olympus, Tokyo, Japan) or indicated by me-lena/or hematemesis with concurrent hemoglobin decrease of > 2 mg/dL. Re-bleeding was defined as early if it oc-


Prachayakul V et al . Gastric variceal hemorrhage treatment outcomes

Core tip: Acute gastric variceal hemorrage is associ-ated with a high mortality rate which accounts for one third of the patients. Histoacryl® injection has been reported as one of the effective procedures for treating this condition. The present study investigated patients presenting with acute gastric variceal hemorrage and found that Histoacryl® injection was a safe and highly effective hemostatic method for treating gastric vari-ceal hemorrhage with 97.8% initial hemostasis; only a 10% early re-bleeding rate and a 14.4% procedure-related complication rate were found. The risk factors for re-bleeding were compromised liver status and presence of ascites.

Prachayakul V, Aswakul P, Chantarojanasiri T, Leelakusolvong S. Factors influencing clinical outcomes of Histoacryl® glue injec-tion-treated gastric variceal hemorrhage. World J Gastroenterol 2013; 19(15): 2379-2387 Available from: URL: http://www.wjg-net.com/1007-9327/full/v19/i15/2379.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2379

INTRODUCTIONBleeding from esophagogastric varices is the second most frequent etiology of upper gastrointestinal hemorrhage and is associated with high rates of mortality, even up to five years after the initial episode. In addition, the clinical management procedures used to resolve the bleeding can themselves cause complications, such as infection or tis-sue injury, that increase the patient’s risk of re-bleeding episodes and mortality. The condition and its treatment can be further complicated by the presence of underly-ing or concomitant diseases. In fact, more than 80% of reported cases have concomitant liver disease, including portal hypertension and cirrhosis[1-5].

Variceal band ligation is regarded as the most effec-tive standard treatment for bleeding esophageal varices. However, this procedure has proven largely ineffective in treating gastric varices, producing a low rate of hemosta-sis (reports range from 26%-71%) but having a high rate of re-bleeding (from 60%-90%)[1-5]. While bleeding gas-tric varices are substantially less common than those in-volving the esophageal tissues (accounting for only about 20% of cirrhotic patients), they are invariably related to massive hemorrhaging and significant complications. Moreover, the mortality rate for bleeding gastric varices is about 30%. Other treatment procedures, such as endo-scopic sclerotherapy, have shown equally unsatisfactory outcomes; endoscopic band ligation is reported to pro-duce hemostasis in only 45% of cases and to have a 31% re-bleeding rate[1]. The available hemostatic modalities with the best rates of successful application are: Histo-acryl® tissue adhesive (2-N-butyl-cyanoacrylate; B. Braun Dexon, Spangenberg, Germany) injection, transarterial intrahepatic portosystemic shunting (TIPS), and balloon-occluded retrograde transvenous obliteration (B-RTO). Of these three, Histoacryl® injection represents the most

curred within 120 h after the index procedure, and as late if it occurred within two weeks after the index procedure.

A standardized Histoacryl® injection method was used according to the recommendations of Seewald et al[14]. A working solution of Histoacryl® was generated by mixing 0.5 mL with 0.8 mL of lipiodol (Guerbert, Roissy, France). The injection catheter (21G or 23G InterjectTM; Boston Scientific, Spencer, IN, United States) was first primed with 0.8-1.2 mL of lipiodol to prevent premature solidifi-cation of the Histoacryl®. Then, the bleeding gastric varix was punctured and the working solution was injected, fol-lowed immediately by 1.0-2.0 mL of sterile distilled water to ensure delivery of the entire working solution volume into the varix. The needle was retracted and immediately flushed with sterile distilled water to maintain patency. Then, the varix was probed with the injection catheter and if it was found to have remained soft, an additional 1.3 mL injection was initiated to achieve complete oblitera-tion (defined as absolute firmness of the injected varix). All of these procedures were carried out without the aid of fluoroscopic monitoring. All procedures were carried out by experienced gastroenterologists or by second-year gastroenterologist trainees under the supervision of an experienced gastroenterologist.

Post-operative monitoring included clinical and labo-ratory examinations to identify development of compli-cations. Most patients received continuous intravenous infusion of vasopressors (Octreotide, Sandostatin®) for three to five days following the procedure. Complications identified during routine examinations, and not based on clinical symptoms and signs, were classified as minor, and included abdominal pain, chest discomfort, or em-bolization. Complications identified upon examination in response to clinical signs and symptoms were classi-fied as major, and included systemic embolization; major complications required further treatment and extended hospitalization by about three days. Furthermore, compli-cations that occurred within 24 h of the procedure were classified as early, while those that occurred within two weeks of the procedure were classified as late.

Statistical analysisStatistical analysis were carried out by the SPSS software, version 13.0 (SPSS, Inc., Chicago, IL, United States). Descriptive data are reported as mean ± SD or as per-centage. The Student’s t test and the χ 2 test were used to assess differences between groups. Forward stepwise logistic regression analyses, both univariate and multivari-ate, and receiver operating characteristic curve (ROC) analysis were used to determine the correlation between factors and clinical outcomes. A two-tailed P value > 0.05 was considered as statistically significant.

RESULTSA total of 90 cases of gastric variceal hemorrhage treated by Histoacryl® injection were analyzed. The majority of the cases were male (n = 62, 74.4%). The average pa-

tient age was 55.9 ± 13.9 (range: 15-88) years old. The most frequent clinical presentations were hematemesis (71.1%), melena (12.2%), coffee ground vomiting (8.9%), and hematochezia (6.7%). One-third of the patients presented with concomitant hypotension, while one-fifth had clinical signs of hepatic encephalopathy and about one-third had concurrent hepatocellular carcinoma (HCC). According to Child-Pugh classification, 20.0% of patients had class A liver status, while 46.7% and 32.2% had class B and C liver status, respectively. According to scoring for model of end-stage liver disease (MELD), the median MELD score for all patients was 10 and the scores ranged from 6 to 28. Nearly all cases of portal hypertension were caused by cirrhosis related to various etiologies, including alcoholism (34.4%), chronic hepatitis B infection (28.9%), chronic hepatitis C infection (14.4%), non-alcoholic steatohepatitis (2.2%), cryptogenic factors (12.2%), and other factors (7.8%). Only one patient had non-cirrhotic portal hypertension.

Ninety percent of the total patients with bleeding gas-tric varices required blood transfusion prior to endoscopy or during hospital admission. Seventy-three percent of the procedures were carried out as emergency endoscopic treatments. The gastric varices cases represented GOV1 (44.4%), GOV2 (33.3%), IGV1 (21.2%) and IGV2 (1.1%). Two-thirds of the patients had concurrent esophageal varices, but no cases showed evidence of esophageal in-dex bleeding.

The mean volume of Histoacryl® working solution delivered per procedure was 3.12 mL. Initial hemostasis was achieved in 97.8% of the procedures. The average hospital stay was nine days. Early re-bleeding occurred in 10.0% of the total patients, but 21.1% of patients ex-perienced late re-bleeding. Early complications occurred in 14.4% of the total cases, and included subclinical sys-temic embolization (4.4%), aspiration pneumonia (5.5%), spontaneous bacterial peritonitis (1.1%), and other infec-tion (3.3%). A total of 19 patients died during the follow-up period, and 80.0% of the deaths were attributed to HCC or advanced cirrhosis (all of which had been treat-ed conservatively). The remaining deaths were related to the gastric varices re-bleeding.

The patients’ baseline characteristics are shown in Table 1, and data related to the procedure and clinical outcome, including complications, are shown in Table 2. The first clinical outcome considered in univariate and multivariate analyses was re-bleeding, and both early and late episodes were analyzed. As shown in Tables 3 and 4, the factors associated with early re-bleeding by univari-ate analysis were presence of ascites [odds ratio (OR) = 10.90, 95%CI: 1.30-91.51, P = 0.01] and concurrent HCC along with a large volume of transfused packed red cells (PRC) (6.89 ± 3.85 units, P < 0.01) (OR = 4.95, 95%CI: 1.14-21.50, P = 0.05). The factors correlated with late re-bleeding by univariate analysis were presence of ascites (OR = 4.25, 95%CI: 1.37-13.17, P = 0.01) and concur-rent HCC in general (OR = 2.98, 95%CI: 1.05-8.46, P = 0.04). However, multivariate analysis identified only the




tions. As shown in Table 6, univariate analysis identified only one factor as correlated with procedure-related complications: late re-bleeding (OR = 4.01, 95%CI: 1.25-12.87, P = 0.04). However, the multivariate analysis did not identify any factors as significantly correlated with this clinical outcome.

ROC analysis of total bilirubin correlation with mor-tality indicated that the cut-off level was > 4.5 mg/dL (area under the curve was 0.926). Classification of the patients into two groups according to this cut-off level followed by multivariate analysis identified total bilirubin > 4.5 mg/dL as significantly correlated with mortality (OR = 7.25, 95%CI: 2.39-22.02, P < 0.01).

DISCUSSIONIn our study, the majority of patients with gastric variceal hemorrhage had underlying decompensated liver cirrho-sis and presented with hematemesis. Surprisingly, only one-third of the patients presented with active bleeding

presence of ascites as correlated with early re-bleeding (OR = 10.67, 95%CI: 1.27-89.52, P = 0.03) and late re-bleeding (OR = 4.15, 95%CI: 1.34-12.86, P = 0.01).

The second clinical outcome considered in univariate and multivariate analyses was mortality at the last follow-up. As shown in Table 5, the factors significantly correlat-ed with mortality by univariate analysis were presence of ascites (OR = 3.09, 95%CI: 1.05-9.12, P = 0.04), elevated total bilirubin (8.50 ± 6.71 mg/dL, P < 0.01) (OR = 16.7, 95%CI: 3.28-85.09), concurrent HCC (OR = 2.98, 95%CI: 1.05-8.47, P = 0.03), high volume of transfused PRC (5.68 ± 3.32 units, P < 0.01) or fresh frozen plasma (1934.0 ± 1850.78 mL, P < 0.01), emergency endoscopic setting (OR = 0.17, 95%CI: 0.01-0.92, P = 0.02), high volume of His-toacryl® injection (4.13 ± 1.99 mL, P < 0.01) (OR = 2.28, 95%CI: 2.32-108.72, P < 0.01), early re-bleeding (OR = 20.12, 95%CI: 3.72-108.32, P < 0.01) and late re-bleeding (OR = 10.32, 95%CI: 3.35-34.91, P < 0.01). Multivariate analysis showed correlations with mortality only for total bilirubin (OR = 16.71, 95%CI: 3.28-85.09, P < 0.01), large volume of transfused fresh frozen plasma (OR = 1.001, 95%CI: 1.000-1.002, P = 0.03), and late re-bleeding (OR = 10.99, 95%CI: 2.15-56.35, P = 0.02).

The last clinical outcome considered in univariate and multivariate analyses was procedure-related complica-

Clinical factor n = 90 mean ± SD

Age, yr 55.9 ± 13.9 Male sex 67 (74.4) Clinical presentations Hematemesis 64 (71.1) Melena 11 (12.2) Hematochezia 6 (6.7) Coffee ground 8 (8.9) Not reported 1 (1.1) Vital signs at presentation Normal 49 (54.4) Tachycardia 7 (7.8) Hypotension 34 (37.8) Etiology of cirrhosis Alcoholism 31 (34.4) Chronic hepatitis B 26 (28.9) Chronic hepatitis C 13 (14.4) Nonalcoholic steatohepatitis 2 (2.2) Cryptogenic 11 (12.2) Other 7 (7.8) Liver status by Child-Pugh classification Class A 18 (20.0) Class B 42 (46.7) Class C 29 (32.2) Concurrent hepatocellular carcinoma Yes 29 (32.2) Blood transfusion Yes 81 (90.0) Transfusion volume Packed red cells, units 3.5 ± 2.8 Fresh frozen plasma, mL 890.9 ± 1183.4 Endoscopic setting Emergency 66 (73.3) Urgent 24 (26.7)

Table 1 Patient baseline characteristics and clinical presenta-tion n (%)

Procedures and clinical factors n = 90 mean ± SD

Type of gastric varix GOV1 40 (44.4) GOV2 30 (33.3) IGV1 18 (20.0) IGV2 1 (1.1) Combination of variceal type 1 (1.1) Size of gastric varices, cm 2.1 ± 0.9 Concurrent esophageal varix No 28 (31.1) Yes 62 (68.9) Bleeding stigmata observed by endoscopy Yes 71 (78.9) Initial hemostasis Yes 88 (97.8) Early re-bleeding Yes 9 (10.0) Late re-bleeding Yes 19 (21.1) Early complications No 77 (85.6) Non-significant systemic embolization 4 (4.4) Pneumonia 4 (4.4) Spontaneous bacterial peritonitis 1 (1.1) Infection elsewhere 3 (3.3) Late complications No 88 (97.8) Infection elsewhere 1 (1.2) Mean aliquot used/procedure 3.0 ± 1.7 Follow-up clinical status Dead 19 (21.1) Worsening 3 (3.3) Stable 8 (8.9) Improved 60 (66.7) Causes of death (n = 19) Bleeding-related 4 (4.4) Infection 9 (10.0) Liver failure 1 (1.1) Cardiovascular diseases 2 (2.2) Renal failure 1 (1.1) Bowel gangrene 2 (2.2)

Table 2 Procedures, clinical outcomes, and complications n (%)



and as hemodynamically unstable. This examination of 90 cases treated by Histoacryl® injection revealed that almost all patients required blood transfusion prior to the endoscopic procedure or during the subsequent hospital admission, and that the most common types of gastric varices were GOV1 and GOV2. Moreover, concurrent esophageal varices and HCC were frequently present in these patients. In 2005, Noophun et al[15] reported a simi-lar retrospective study of 24 Thai patients who presented with gastric variceal hemorrhage and were treated with Histoacryl® injection. In that study population, initial hemostasis was achieved in 58% of patients and 29% ex-

perienced re-bleeding; however, these findings were quite different from the other studies in the literature, which were reporting success rates as high as 90%-100%[2-17]. In our present study population, initial hemostasis was achieved in 97.8%. However, the rates of early and late re-bleeding were lower than those reported in the previ-ous studies (10% and 20%, respectively, vs 12%-54%)[2-5]. One previous study by Wang et al[7] had reported that about 10% of Histoacryl® extrusion occurs within the first week after injection, and suggested that this phe-nomenon might be related to re-bleeding of the gastric varices. Therefore, we hypothesize that the early re-

Factors

Early re-bleeding

Univariate Multivariate

Yes (n = 9) No (n = 81) P value 95%CI OR P value 95%CI OR Decompensated liver diseases Yes 9 62 0.19 MELD score > 12 3 19 0.69 Encephalopathy 3 24 0.33 Ascites 8 33 0.011 1.30-91.51 10.9 0.031 1.27-89.52 10.67 Concurrent HCC Yes 6 23 0.05 1.14-21.50 4.95 Transfusion volume PRC, unit 6.89 ± 3.85 3.09 ± 2.56 < 0.011 0.041 1.12-116.0 11.41 FFP, mL 1943.33 ± 1064.61 773.69 ± 1142.92 < 0.011 - - - Type of gastric varix GOV 7 63 IGV 2 17 0.99 Mean GV size, cm 2.16 ± 0.70 2.12 ± 0.88 0.88 Mean aliquot number/procedure 3.88 ± 1.72 2.93 ± 1.72 0.146 Endoscopic red stigmata Yes 9 69 0.19

Table 3 Factors related to early re-bleeding

1Statistically significant difference. HCC: Hepatocellular carcinoma; MELD: Model of end-stage liver disease; PRC: Packed red cell; FFP: Fresh frozen plas-ma; OR: Odds ratio.

Factors

Late re-bleeding


Yes (n = 19) No (n = 71) P value 95%CI OR P value 95%CI OR Decompensated liver diseases Yes 18 53 0.19 MELD score > 12 5 17 0.92 Encephalopathy 7 10 0.07 Ascites 14 27 0.011 1.37-13.17 4.25 0.011 1.34-12.86 4.15 Concurrent HCC Yes 10 19 0.041 1.05-8.46 2.98 - - - Transfusion volume PRC, unit 5.00 ± 3.59 3.06 ± 2.36 < 0.011 - - - FFP, mL 1648.68 ± 1720.18 688.11 ± 906.73 0.031 - - - Type of gastric varix GOV 14 56 0.89 IGV 5 15 Mean GV size, cm 2.05 ± 0.76 2.15 ± 0.89 0.67 Mean aliquot number/procedure 3.17 ± 1.75 2.98 ± 1.74 0.69 Endoscopic red stigmata Yes 17 54 0.55

Table 4 Factors related to late re-bleeding




bleeding cases in the present study population might be associated with early glue extrusion.

Procedure-related complications following Histoac-ryl® injection developed in 13.9% of the current study’s population. This rate is slightly lower than the rate of 15% reported by Fry et al[11]. One of the most concerning complications of endoscopy is fatal systemic emboliza-tion[8-27]; fortunately, no cases of severe systemic emboli-zation developed in the current study population, despite the average amount of Histoacryl® working solution used per case being about 3 mL. Most of the cases of embolization complications in the current study did not

manifest any significant clinical symptoms and/or signs, and were incidentally detected by lipiodal staining in chest X-ray or computed tomography scan. None of the fatal consequences of systemic embolization, which include organ infarction and abscess formation, developed in this study population. Thus, the collected data suggest that Histoacryl® injection is an effective and safe option for treating active or recent gastric variceal hemorrhage.

The overall post-procedure mortality in the current study’s population was similar to that reported from pre-vious studies[2-11]. We noted that one-half of the patient deaths were associated with infections, with hospital-

Factors

Mortality


Yes (n = 19) No (n = 71) P value 95%CI OR P value 95%CI OR Age, yr 56.4 ± 3.34 55.8 ± 1.65 0.95 Decompensated liver diseases Yes 18 53 0.10 MELD score > 12 8 14 0.06 Ascites 13 28 0.041 1.05-9.12 3.09 - - - Encephalopathy 6 11 0.29 Total bilirubin, mg/dL 8.50 ± 6.71 2.73 ± 2.93 < 0.011 < 0.011 3.28-85.09 16.7 Concurrent HCC Yes 10 19 0.031 1.05-8.47 2.98 - - - Transfusion volume PRC, unit 5.68 ± 3.32 2.87 ± 2.28 < 0.011 - - - FFP, mL 1934.00 ± 1850.78 611.76 ± 724.89 < 0.011 0.031 1.000-1.002 1.001 Type of gastric varix GOV 14 56 0.54 IGV 5 14 Mean GV size, cm 1.97 ± 0.74 2.16 ± 0.89 0.38 Mean aliquot number/procedure 4.13 ± 1.99 2.76 ± 1.57 < 0.011 - - - Early re-bleeding Yes 7 2 < 0.011 3.72-108.3 20.12 - - - Late re-bleeding Yes 8 11 < 0.011 3.35-34.91 10.32 < 0.011 2.15-56.35 10.99

Table 5 Correlation analysis of factors associated with mortality at final follow-up


Factors

Complications


Yes (n = 16) No (n = 74) P value 95%CI OR P value 95%CI OR Age, yr 55.92 ± 12.56 56.06 ± 19.69 0.97 Decompensated liver diseases Yes 14 57 0.19 MELD score > 12 8 14 0.14 Encephalopathy 1 16 0.06 Ascites 8 33 0.79 Concurrent HCC Yes 5 24 0.90 Mean GV size, cm 2.28 ± 0.99 2.09 ± 0.83 0.44 Mean aliquot number/procedure 2.87 ± 1.50 3.06 ± 1.79 0.71 Early re-bleeding Yes 4 5 0.49 Late re-bleeding Yes 7 12 0.041 1.25-12.87 4.01

Table 6 Correlation analysis of factors associated with procedure-related complications

1Statistically significant difference. HCC: Hepatocellular carcinoma; MELD: Model of end-stage liver disease; OR: Odds ratio.



acquired pneumonia or ventilator-associated pneumonia being predominant. Moreover, the infections occurred despite the use of prophylactic antibiotics. We believe that the pneumonic infections, in particular, might have resulted from incidental aspiration that occurred during the active bleeding condition or were secondary conse-quences of bacteremia[25]. Thus, this complication might be prevented by extending the antibiotic prophylaxis schedule, by performing early endotracheal intubation to prevent aspiration, or by using a needle fitted with a covered-tip catheter to reduce contamination.

Previously, Chang et al[2] investigated the factors which might affect clinical outcomes of patients who underwent Histoacryl® injection for gastric variceal hemorrhage. Al-though only 9% of that study population was represented by patients with gastric variceal hemorrhage, the two predictive factors of re-bleeding identified were a large amount of PRC transfusion and high MELD scores. An-other study of 118 Taiwanese patients with gastric variceal hemorrhage identified concomitant HCC as associated with early re-bleeding[5]. In particular, advanced cancer stage, newly-developed HCC, active bleeding, and high MELD score were reported as being associated with poor outcome. To date, however, no study has reported predic-tive factors for early re-bleeding in cirrhotic patients with active gastric variceal hemorrhage. In the present study, the presence of ascites was the only factor associated with both early and late re-bleeding in patients with active gas-tric variceal hemorrhage treated by Histoacryl® injection. Therefore, we propose that these re-bleeding episodes may have been related to pre-existing defects in the liver status. Ascites are one of the items considered in the Child-Pugh scoring system of liver status, yet neither the Child-Pugh score nor the MELD score was found to be significantly correlated with re-bleeding in the current study population.

A large amount of transfused PRC was identified as another potential predictive factor of re-bleeding, which is logical since this factor corresponds to the severity of active bleeding at the initial presentation for which surgery is indicated. Yet another factor, concurrent HCC, was cor-related with both early and late re-bleeding by univariate analysis only, and the correlation was lost in multivariate analysis. It is possible that our relatively small study popu-lation size limited our ability to detect the true correlation, and future study with a larger population might confirm the predictive nature of this factor. Surprisingly, the endo-scopic finding of recent bleeding signs, such as red nipple or white nipple, or even the type and size of GV itself, in-cluding the amount of injected Histoacryl®, could not be used as the predictors for re-bleeding in the present study. In addition, late re-bleeding was identified as a potential predictive factor of procedure-related complications, but again the significant correlation was lost in multivariate analysis. Because infections accounted for more than half of complications occurring in the current study popula-tion, we hypothesized that the processes of re-bleeding and infection may each represent both cause and effect; for example, the bleeding site might be a portal by which

pathogenic agents achieve more systemic distribution, or the infection itself might trigger a bleeding episode in al-ready weakened tissues further damaged by the actions of inflammatory cytokines.

The mortality rate of patients with bleeding gastric varices has been previously shown to be related to the amount of blood transfusion and the patient’s liver status (Child-Pugh score and MELD score). The present study showed that a larger amount of transfused fresh frozen plasma, elevated total bilirubin level (> 5 mg/dL), and late re-bleeding were significantly correlated with mortal-ity. Therefore, we hypothesize that the risk of mortality for a patient with gastric variceal hemorrhage follow-ing treatment with Histoacryl® injection is associated with pre-existing liver conditions, severity of the index bleeding, and development of infectious complications. Concurrent HCC and MELD score may also influence mortality, but studies with larger populations are needed to confirm their role.

Some limitations exist in the present study design that may affect generalization of our findings. First, this was a retrospective study in which the decision making of treat-ment strategy depended on the endoscopist who was in charge on the day of the procedure. However, all of the endoscopists were trained in a standardized protocol for Histoacryl® injection. Second, some of the re-bleeding patients diagnosed with advanced HCC or decompen-sated liver disease were managed noninvasively. Conser-vative treatment can be associated with a higher mortality rate and may have impacted our mortality data. Lastly, the relatively small population size of the current study may have weakened the power of detecting true correlations; studies with larger populations are required to confirm our findings.

Histoacryl® injection is an effective and safe treatment option for gastric variceal hemorrhage. Neither the type or size of gastric varices, the amount of Histoacryl®, nor the injection technique were associated with rates of re-bleeding, complications, or mortality. However, the sever-ity of index bleeding and a pre-existing decompensated liver status, especially the presence of ascites or elevated total bilirubin, are associated with the rates of re-bleeding and mortality.

ACKNOWLEDGMENTSThe authors would like to thank Mr. Sutiphol Udompan-turuk, our statistical consultant, for his help and kindness.

COMMENTSBackgroundGastric variceal hemorrhage is an uncommon cause of upper gastrointestinal bleeding, and is mostly related to portal hypertension; however, this condition is associated with very high rates of morbidity and mortality. Injection of Histoacryl® tissue adhesive (N-2-butyl-cyanoacrylate) can achieve hemostasis, but is also associated with development of life-threatening procedure-related complica-tions, such as fatal systemic embolization, and appreciable rates of re-bleeding. To date, there are limited data regarding the factors associated with the clinical outcomes of Histoacryl® injection to treat bleeding gastric varices.

COMMENTS



Research frontiersIn this article, the authors evaluate the factors associated with clinical outcomes of gastric variceal hemorrhage treated by Histoacryl® injection. These data may help to identify patients at greater risk of experiencing re-bleeding episodes following treatment and those who will benefit from closer clinical monitoring for an extended period of time following the surgical procedure.Innovations and breakthroughsInitial hemostasis was achieved in 97.8% of bleeding gastric varices patients treated with Histoacryl® injection. The rate of early (within 120 h of procedure) re-bleeding was 10.0%, and the rate of late (within two weeks of procedure) re-bleeding was 21.1%. The overall complication rate was 13.9%, and the majority of cases that died were associated with infection. The factors associated with adverse clinical outcome involved the patients’ liver status, and the procedure itself appeared to be much less involved. Peer reviewThe authors performed a retrospective analysis of patients with acute gastric variceal hemorrhage to determine the factors associated with clinical outcomes and complications of Histoacryl® injection. The Histoacryl® injection procedure and compound were effective and safe for treating gastric variceal hemorrhage, achieving a high rate of hemostasis while producing low rates of re-bleeding and procedure-related complications. The clinical outcomes were mostly associated with liver status of the patients during the index bleeding episode. The results provide insights into the underlying etiologies of re-bleeding following treatment and may help to identify patients at higher risk of re-bleeding and mortality.

REFERENCES1 Kim T, Shijo H, Kokawa H, Tokumitsu H, Kubara K, Ota K,

Akiyoshi N, Iida T, Yokoyama M, Okumura M. Risk factors for hemorrhage from gastric fundal varices. Hepatology 1997; 25: 307-312 [PMID: 9021939]

2 Chang YJ, Park JJ, Joo MK, Lee BJ, Yun JW, Yoon DW, Kim JH, Yeon JE, Kim JS, Byun KS, Bak YT. Long-term outcomes of prophylactic endoscopic histoacryl injection for gas-tric varices with a high risk of bleeding. Dig Dis Sci 2010; 55: 2391-2397 [PMID: 19911276 DOI: 10.1007/s10620-009-1023-x]

3 Rajoriya N, Forrest EH, Gray J, Stuart RC, Carter RC, McK-ay CJ, Gaya DR, Morris AJ, Stanley AJ. Long-term follow-up of endoscopic Histoacryl glue injection for the management of gastric variceal bleeding. QJM 2011; 104: 41-47 [PMID: 20871126 DOI: 10.1093/qjmed/hcq161]

4 Hou MC, Lin HC, Lee HS, Liao WC, Lee FY, Lee SD. A randomized trial of endoscopic cyanoacrylate injection for acute gastric variceal bleeding: 0.5 mL versus 1.0 mL. Gastrointest Endosc 2009; 70: 668-675 [PMID: 19559427 DOI: 10.1016/j.gie.2009.02.005]

5 Huang YH, Yeh HZ, Chen GH, Chang CS, Wu CY, Poon SK, Lien HC, Yang SS. Endoscopic treatment of bleeding gastric varices by N-butyl-2-cyanoacrylate (Histoacryl) injection: long-term efficacy and safety. Gastrointest Endosc 2000; 52: 160-167 [PMID: 10922085 DOI: 10.1067/mge.2000.104976]

6 Sugimoto N, Watanabe K, Watanabe K, Ogata S, Shimoda R, Sakata H, Eguchi Y, Mizuta T, Tsunada S, Iwakiri R, Nojiri J, Mizuguchi M, Kudo S, Miyazaki K, Fujimoto K. Endoscopic hemostasis for bleeding gastric varices treated by combina-tion of variceal ligation and sclerotherapy with N-butyl-2-cyanoacrylate. J Gastroenterol 2007; 42: 528-532 [PMID: 17653647 DOI: 10.1007/s00535-007-2041-0]

7 Wang YM, Cheng LF, Li N, Wu K, Zhai JS, Wang YW. Study of glue extrusion after endoscopic N-butyl-2-cyanoac-rylate injection on gastric variceal bleeding. World J Gastro-enterol 2009; 15: 4945-4951 [PMID: 19842227 DOI: 10.3748/wjg.15.4945]

8 Akahoshi T, Hashizume M, Tomikawa M, Kawanaka H, Yamaguchi S, Konishi K, Kinjo N, Maehara Y. Long-term results of balloon-occluded retrograde transvenous oblitera-tion for gastric variceal bleeding and risky gastric varices: a

10-year experience. J Gastroenterol Hepatol 2008; 23: 1702-1709 [PMID: 18713295 DOI: 10.1111/j.1440-1746.2008.05549]

9 Al-Ali J, Pawlowska M, Coss A, Svarta S, Byrne M, Enns R. Endoscopic management of gastric variceal bleeding with cyanoacrylate glue injection: safety and efficacy in a Cana-dian population. Can J Gastroenterol 2010; 24: 593-596 [PMID: 21037987]

10 Taghavi SA, Eshraghian A, Hamidpour L, Moshfe MJ. En-doscopic cyanoacrylate injection for the treatment of bleed-ing gastric varices: the first Iranian series. Arch Iran Med 2012; 15: 157-161 [PMID: 22369304]

11 Fry LC, Neumann H, Olano C, Malfertheiner P, Mönke-müller K. Efficacy, complications and clinical outcomes of endoscopic sclerotherapy with N-butyl-2-cyanoacrylate for bleeding gastric varices. Dig Dis 2008; 26: 300-303 [PMID: 19188718 DOI: 10.1159/000177012]

12 Linhares MM, Matone J, Matos D, Sakamoto FI, Caetano EM, Sato NY, Herani Filho B, Aramayo AL, Goldenberg A, Lopes-Filho Gde J. Endoscopic treatment of bleeding gas-tric varices using large amount of N-butyl-2-cyanoacrylate under fluoroscopic guidance. Surg Laparosc Endosc Percutan Tech 2008; 18: 441-444 [PMID: 18936661 DOI: 10.1097/SLE.0b013e31817b8f0c]

13 Marques P, Maluf-Filho F, Kumar A, Matuguma SE, Sakai P, Ishioka S. Long-term outcomes of acute gastric variceal bleeding in 48 patients following treatment with cyanoac-rylate. Dig Dis Sci 2008; 53: 544-550 [PMID: 17597405 DOI: 10.1007/s10620-007-9882-5]

14 Seewald S, Ang TL, Imazu H, Naga M, Omar S, Groth S, Seitz U, Zhong Y, Thonke F, Soehendra N. A standardized injection technique and regimen ensures success and safety of N-butyl-2-cyanoacrylate injection for the treatment of gastric fundal varices (with videos). Gastrointest Endosc 2008; 68: 447-454 [PMID: 18760173 DOI: 10.1016/j.gie.2008.02.050]

15 Noophun P, Kongkam P, Gonlachanvit S, Rerknimitr R. Bleeding gastric varices: results of endoscopic injection with cyanoacrylate at King Chulalongkorn Memorial Hospital. World J Gastroenterol 2005; 11: 7531-7535 [PMID: 16437729]

16 Kang EJ, Jeong SW, Jang JY, Cho JY, Lee SH, Kim HG, Kim SG, Kim YS, Cheon YK, Cho YD, Kim HS, Kim BS. Long-term result of endoscopic Histoacryl (N-butyl-2-cyano-acrylate) injection for treatment of gastric varices. World J Gastroenterol 2011; 17: 1494-1500 [PMID: 21472110 DOI: 10.3748/wjg.v17.i11.1494]

17 Tan PC, Hou MC, Lin HC, Liu TT, Lee FY, Chang FY, Lee SD. A randomized trial of endoscopic treatment of acute gastric variceal hemorrhage: N-butyl-2-cyanoacrylate in-jection versus band ligation. Hepatology 2006; 43: 690-697 [PMID: 16557539]

18 Hui AJ, Sung JJ. Endoscopic Treatment of Upper Gastro-intestinal Bleeding. Curr Treat Options Gastroenterol 2005; 8: 153-162 [PMID: 15769437]

19 Caldwell SH, Hespenheide EE, Greenwald BD, Northup PG, Patrie JT. Enbucrilate for gastric varices: extended expe-rience in 92 patients. Aliment Pharmacol Ther 2007; 26: 49-59 [PMID: 17555421 DOI: 10.1111/j.1365-2036.2007.03351.x]

20 Kuo MJ, Yeh HZ, Chen GH, Poon SK, Yang SS, Lien HC, Chang CS. Improvement of tissue-adhesive obliteration of bleeding gastric varices using adjuvant hypertonic glucose injection: a prospective randomized trial. Endoscopy 2007; 39: 487-491 [PMID: 17354182 DOI: 10.1055/s-2007-966267]

21 Appenrodt B, Schepke M, Kuntz-Hehner S, Schmiedel A, Sauerbruch T. A patient with portal hypertension and blind-ness after transjugular intrahepatic portosystemic shunt. Eur J Gastroenterol Hepatol 2006; 18: 447-449 [PMID: 16538120]

22 Chen YY, Shen TC, Soon MS, Lai JH. Life-threatening pericarditis after N-butyl-2-cyanoacrylate injection for esophageal variceal bleeding: Case report. Gastrointest Endosc 2005; 61: 487-489 [PMID: 15758933 DOI: 10.1016/





S0016-5107(05)00078-7]23 Kok K, Bond RP, Duncan IC, Fourie PA, Ziady C, van den

Bogaerde JB, van der Merwe SW. Distal embolization and local vessel wall ulceration after gastric variceal obliteration with N-butyl-2-cyanoacrylate: a case report and review of the literature. Endoscopy 2004; 36: 442-446 [PMID: 15100955 DOI: 10.1055/s-2004-814323]

24 Battaglia G, Morbin T, Patarnello E, Merkel C, Corona MC, Ancona E. Visceral fistula as a complication of endo-scopic treatment of esophageal and gastric varices using isobutyl-2-cyanoacrylate: report of two cases. Gastrointest Endosc 2000; 52: 267-270 [PMID: 10922108 DOI: 10.1067/mge.2000.10508]

25 Chen WC, Hou MC, Lin HC, Yu KW, Lee FY, Chang FY, Lee SD. Bacteremia after endoscopic injection of N-butyl-2-cyanoacrylate for gastric variceal bleeding. Gastrointest Endosc 2001; 54: 214-218 [PMID: 11474393]

26 Kim J, Chun HJ, Hyun JJ, Keum B, Seo YS, Kim YS, Jeen YT, Lee HS, Um SH, Kim CD, Ryu HS. Splenic infarction after cyanoacrylate injection for fundal varices. Endoscopy 2010; 42 Suppl 2: E118 [PMID: 20306402 DOI: 10.1055/s-0029-1243984]

27 Yu CF, Lin LW, Hung SW, Yeh CT, Chong CF. Diaphrag-matic embolism after endoscopic injection sclerotherapy for gastric variceal bleeding. Am J Emerg Med 2007; 25: 860.e5-860.e6 [PMID: 17870508 DOI: 10.1016/j.ajem.2007.02.013]

P- Reviewer Watanabe N S- Editor Wen LL L- Editor Logan S E- Editor Li JY


Effect of Helicobacter pylori eradication on serum ghrelin and obestatin levels

Celal Ulasoglu, Banu Isbilen, Levent Doganay, Filiz Ozen, Safak Kiziltas, Ilyas Tuncer

Celal Ulasoglu, Levent Doganay, Safak Kiziltas, Ilyas Tunc-er, Department of Gastroenterology, Istanbul Medeniyet Univer-sity, Goztepe Education and Research Hospital, 34470 Istanbul, Turkey Banu Isbilen, Department of Biochemistry, Istanbul Medeniyet University, Goztepe Education and Research Hospital, 34470 Is-tanbul, Turkey Filiz Ozen, Medical Genetics, Istanbul Medeniyet University, Goztepe Education and Research Hospital, 34470 Istanbul, TurkeyAuthor contributions: Ulasoglu C designed the study, collected the materials and contributed to writing the manuscript; Kiziltas S and Tuncer I evaluated the data and contributed to writing the manuscript; Isbilen B and Ozen F performed laboratory proce-dures; Doganay L edited the manuscript and performed the statis-tical analysis.Correspondence to: Dr. Celal Ulasoglu, Department of Gas-troenterology, Istanbul Medeniyet University, Goztepe Educa-tion and Research Hospital, 34470 Istanbul, Turkey. [email protected]: +90-216-5666600 Fax: +90-216-5666628 Received: February 22, 2013 Revised: April 8, 2013 Accepted: April 9, 2013Published online: April 21, 2013

AbstractAIM: To investigate changes in serum ghrelin and obestatin levels before and after Helicobacter pylori (H. pylori ) eradication.

METHODS: A total of 92 patients presenting with symp-toms of dyspepsia were enrolled in the study. Upper endoscopy was performed on all patients and used to diagnose H. pylori infection according to the presence of characteristic histopathological findings; seventy pa-tients were diagnosed with H. pylori infection and the remaining 22 non-infected patients were classified as healthy controls. H. pylori eradication was accomplished by administering the classical triple therapy drug regi-men, consisting of lansoprazole 30 mg bid , amoxicillin 1 g bid , and clarithromycin 500 mg tid for 14 d. The eradi-cation of H. pylori was assessed with C14-urea breath

test, which was performed at eight weeks after treat-ment. Levels of serum active ghrelin and obestatin were assessed at beginning of the study (prior to treatment) and after eight weeks. The levels were comparatively analyzed between the H. pylori negative control group, the H. pylori eradicated group, and the H. pylori non-eradicated group.

RESULTS: A total of 92 patients, 50 females and 42 males with a mean age of 38.2 ± 11.9 years (range: 19-64), were analyzed. H. pylori eradication success was achieved in 74.3% (52/70) of H. pylori positive patients. The initial levels of ghrelin in the H. pylori positive and control cases were 63.6 ± 19.8 pg/mL and 65.1 ± 19.2 pg/mL (P = 0.78), respectively, and initial obestatin levels were 771 ± 427 pg/mL and 830 ± 296 pg/mL (P = 0.19), respectively. The difference between the initial levels and the week 8 levels of ghrelin and obestatin in the control group was insignificant [4.5% (P = 0.30) and -0.9% (P = 0.65), respectively]. The dif-ference between the initial and week 8 levels of ghrelin and obestatin in the H. pylori non-eradicated group were also insignificant [0.9% (P = 0.64) and 5.3% (P = 0.32), respectively]. The H. pylori eradicated group had a greater change in obestatin levels when compared to the control and the non-eradicated groups (148 ± 381 pg/mL vs -12 ± 138 pg/mL and -72.8 ± 203 pg/mL, re-spectively, P = 0.015), while decreases in ghrelin levels were insignificant (-7.2 pg/mL vs -1.4 pg/mL and -1.9 pg/mL, respectively, P = 0.52). The ghrelin/obestatin ratio for the initial and week 8 levels changed signifi-cantly in only the H. pylori eradicated group (0.11 vs 0.08, respectively, P = 0.015). For overweight patients (as designated by body mass index), we observed sig-nificant increases in obestatin levels in the eradicated group as compared to non-eradicated group (201 ± 458 pg/mL vs -5 ± 81 pg/mL, respectively, P = 0.02). In the H. pylori -eradicated group, the levels did not differ be-tween the sexes for ghrelin (-6.3 ± 26.9 pg/mL vs -8.0 ± 24.0 pg/mL, respectively, P = 0.97) or obestatin (210 ± 390 pg/mL vs 96 ± 372 pg/mL, respectively, P = 0.23).

BRIEF ARTICLE





CONCLUSION: Serum levels of ghrelin decreased while obestatin levels increased in H. pylori eradicated sub-jects, especially in overweight and male patients.


Key words: Ghrelin; Obestatin; Helicobacter pylori ; Gas-tric peptides; Appetite

Core tip: Ghrelin and obestatin are peptides that have opposing roles in the regulation of appetite and sati-ety. Helicobacter pylori (H. pylori ), a common cause of gastric inflammation, may have important effects on these peptides and in turn be a potential target of anti-obesity strategies. While the interplay between H. pylori and these peptides are well studied, this study included two novel approaches. First, we collected se-rum samples at two separate time points for both the experimental and control groups, eliminating potential seasonal problems. Second, we focused on not only to H. pylori positive patients that responded to therapy, but also those who did not. This helped to distinguish the effects of antibiotherapy on ghrelin and obestatin regardless of the effectiveness of H. pylori treatment.

Ulasoglu C, Isbilen B, Doganay L, Ozen F, Kiziltas S, Tuncer I. Effect of Helicobacter pylori eradication on serum ghrelin and obestatin levels. World J Gastroenterol 2013; 19(15): 2388-2394 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2388.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2388

INTRODUCTIONGhrelin and obestatin are both important peptides that regulate appetite and play roles as orexigenic signals and in satiety pathways. Both are secreted mainly from gas-tric oxyntic mucosa and are thought to be influenced by Helicobacter pylori (H. pylori)[1-4]. However, the influences of H. pylori on serum concentrations of ghrelin are con-tradictory, since multiple factors interfere with its serum level. Further, and only a limited number of studies have focused on interaction between obestatin and H. pylori[5,6].

Ghrelin is a 28 amino acid (aa) peptide with a name derived from the root ghre-, which means “grow”. This peptide was discovered in 1999 and is secreted endocrine cells of the stomach and by the brain, bowel, testes, pan-creatic islet cells, and kidney[1,7] . Ghrelin has adipogenic properties and is an orexigenic peptide, acting as an ap-petite stimulant. Moreover, it is a somatotropic peptide involved in regulating body weight, is controlled by the GHRL gene, is derived from preproghrelin (contains 117 aa), and acts as a growth hormone stimulator[1,7]. It has a molecular weight of 3370.9 Da. Before release into the serum, an n-octanyl moiety is attached to a serine residue at position three, thus making the molecule hydrophobic and facilitating penetration into the hypothalamus and

hypophysis of the brain[1,4,7].Obestatin is a 23 aa peptide that is thought to be an

appetite suppressant and named from the Latin “obe-dere”, meaning to devour, and “statin”, which denotes suppression[2]. Both ghrelin and obestatin are controlled by ghrelin/obestatin prepropeptide gene (GHRL), is pro-duced by the post-translational modification by addition of -NH2 and splitting from the same protein precursor that also produces ghrelin (117 aa, preproghrelin), and is secreted mainly by the stomach[2,8]. It has a molecular weight of 2516.84 Da and it activates a rhodopsin type G coupled receptor (GPR-39), which is a member of the ghrelin receptor superfamily[2,3,5].

The underlying purpose for this mechanism that produces two hormones with opposite effects remains unclear, however, this may explain earlier findings that ini-tially seemed ambiguous. For example, removing the ghre-lin gene from mice does not significantly reduce appetite, and ghrelin may play a physiological role in the vagal control of gastric function in rats[5,6]. Moreover, obestatin counteracts growth hormone secretion and food intake induced by ghrelin[2]. Additionally, intracerebroventricular and systemic injections of obestatin suppress body weight gain in rats. Some gastrointestinal diseases, such as irri-table bowel syndrome[7,8], obesity, Prader-Willi syndrome (chromosome 15-related congenital obesity and hyper-phagia)[9], and type Ⅱ diabetes mellitus[10], may be related to the serum ghrelin/obestatin ratio.

H. pylori is a bacteria that is the main cause of gastric inflammation and peptic ulcer disease worldwide. The exact role of H. pylori on appetite hormones, such as ghrelin and obestatin, remains unclear[11-13]. In this study, we compared the changes in these hormones after a suc-cessful H. pylori eradication.

MATERIALS AND METHODSHuman subjectsThe sample population enrolled in this study consisted of ninety-two consecutive patients (50 female and 42 male patients, with ages between 19 and 65 years) who were treated for H. pylori infections based on histopathological diagnoses after upper endoscopies to investigate dyspep-sia. H. pylori positive patients received classical anti-He-licobacter triple therapy as treatment (lansoprazole 30 mg bid, amoxicillin 1 g bid, and clarithromycin 500 mg tid for 14 d). Serum ghrelin and obestatin levels were assessed before treatment and eight weeks after the completion of the eradication therapy. Patients had no comorbidi-ties, no chronic illnesses such as diabetes mellitus, no endocrinological disturbances, were not currently taking any medication, and had no history of gastrointestinal surgery. They were restricted from smoking and exercise on sampling day. The success of the H. pylori eradication therapy was assessed with C14-urea breath test (C-UBT) eight weeks after the cessation of the therapy. Before the initial endoscopy and C-UBT, patients did not use any an-tibiotic or proton pump inhibitors for one month prior.


Ulasoglu C et al . H. pylori : Effect on ghrelin and obestatin

The body mass index (BMI) for each of the patients was defined as their weight in kilograms divided by the square of height in meters (kg/m2). A cutoff of 25 kg/m2 was used to define normal versus overweight participants. The study was done in accordance with the Declaration of Helsinki and using principles of the Good Clinical Practice. The Goztepe Education and Research Hospital approved these studies (18/H-2012). Each patient gave conscious, written, and informed consent before partici-pating in the study.

Biochemical methodsFastingblood samples (12 h fast) were collected on the day of upper endoscopy and 8 wk later. The blood was allowedto clot at room temperature without any chemi-cal treatment with protease inhibitors. Within one hour of the blood draw, serum was obtained by centrifugation at 2000 × g for 10 min and stored at -80 ℃ until needed. ELISA kits were used for the measurement of active (acylated) serum ghrelin (EMD Millipore, Billerica, MA, United States) and serum obestatin (Peninsula Labora-tories LLC, San Carlos, CA, United States). Serum levels of both active ghrelin and obestatin were measured and calculated according to the manufacturers’ instructions. The analytic sensitivity of the active ghrelin test was 25 pg/mL. The intra- and inter-assay coefficients of varia-tion (%CV) for the active ghrelin test when a mean con-centration of 65.2 pg/mL was tested were 3.63% and 3.55%, respectively. The obestatin test kit measured hu-man obestatin within the range of 0.412-100 ng/mL, the intra-assay CV was less than 5%, and the inter-assay CV was less than 15%.

The units of measure for these peptides were all con-verted to pg/mL in order to make comparisons. In some studies ghrelin levels were expressed in fmol/mL and were converted to pg/mL by multiplying by a conversion factor of 3.372. Obestatin levels expressed as pmol/L were converted to pg/mL by multiplying by a conversion

factor of 2.5 according to the following formula: pmol/L/0.397 = pg/mL.

Statistical analysisSerum ghrelin levels, serum obestatin levels, the ghrelin/obestatin ratios, and the changes in levels as percentage were analyzed according to the patients’ age, sex, BMI, and eradication of H. pylori infection. The Kolmogorov and Shapiro-Wilks tests were used to analyze the normal-ity of the distribution depending on the number of cases (over or under 50, respectively). Independent continu-ous variables were analyzed using the Mann-Whitney U test. Repeated (paired) measures of serum ghrelin and obestatin levels were analyzed using the Wilcoxon signed-rank test. Alterations in serum ghrelin and obestatin levels after the anti-Helicobacter triple therapy were also calculated as numerical and percentage and then statisti-cally analyzed. The results were given as mean ± SD. All statistics were done using SPSS 20 (Chicago, IL, United States). In all analyses, double sided P values were consid-ered significant if the P value was lower than 0.05.

RESULTSSuccessful H. pylori eradication occurred in 52 (74.3%) of 70 infected patients. The remaining 22 patients were not infected with H. pylori at the initial examination and served as the control group. Serum ghrelin and obestatin levels ranged from 28.5-101.4 pg/mL and 180-2230 pg/mL, respectively.

There was no significant difference between the lev-els of ghrelin or obestatin between the H. pylori infected and control groups. The initial levels of ghrelin in the H. pylori positive cases and the control group were 63.6 ± 19.8 pg/mL and 65.1 ± 19.2 pg/mL, respectively. Initial obestatin levels for these two groups were 771 ± 427 pg/mL and 830 ± 296 pg/mL, respectively (Table 1). Eighth week ghrelin levels were 56.0 ± 19.9 pg/mL, 62.4 ± 19.0


Controls (n = 22) H. pylori infected (n = 70) P value1 H. pylori eradicated (n = 52) H. pylori non-eradicated (n = 18) P value1

Sex, M/F 10/12 32/38 0.98 24/28 8/10 0.99 NW/OW 9/13 31/39 0.89 23/29 8/10 0.99 Age (yr) 40 ± 13 38 ± 12 0.30 38 ± 12 37 ± 11 0.74 Ghr initial, pg/mL 65 ± 19 64 ± 20 0.78 63 ± 20 64 ± 20 0.82 Ghr week 8, pg/mL 64 ± 17 58 ± 20 0.16 56 ± 20 62 ± 19 0.35 P value2 0.30 0.013a 0.012a 0.64 Ob initial, pg/mL 830 ± 296 771 ± 427 0.19 765 ± 461 787 ± 322 0.35 Ob week 8, pg/mL 818 ± 291 863 ± 462 0.70 914 ± 505 714 ± 269 0.22 P value2 0.65 0.07 0.01a 0.32 Ghr/Ob ratio initial 0.089 0.107 0.420 0.113 0.092 0.460 Ghr/Ob ratio week 8 0.092 0.086 0.480 0.081 0.099 0.140 P value2 1.0 0.06 0.01a 0.64 ∆Ghr -1.4 -5.9 0.49 -7.2 -2.0 0.19 ∆Ob -12.3 91.7 0.16 148.7 -72.8 0.02a ∆Ghr_% 4.5 -2.6 0.32 -3.9 0.9 0.16 ∆Ob_% -0.9 29.4 0.13 41.5 -5.3 0.03a

Table 1 Demographic characteristics and laboratory values for the sample population and control group

1Mann-Whitney U test; 2Wilcoxon-signed ranks test. aP < 0.05 is significant. ∆: Change in mean; M: Male; F: Female; Ghr: Ghrelin; Ob: Obestatin; H. pylori: Helicobacter pylori; NW: Body mass index (BMI) ≤ 25 (normal weight); OW: BMI > 25 (overweight).



1). Overweight patients in the eradicated group demon-strated a significant rise in obestatin levels as compared to that of the overweight patients in the non-eradicated group (Table 2). For all participants with a BMI over 25 kg/m2, the Mann-Whitney U test revealed higher ghrelin and obestatin levels as compared to participants with normal BMIs (Table 2).

The differences in ghrelin and obestatin levels in males and females were insignificant in the H. pylori-erad-icated group (-6.3 ± 26.9 pg/mL vs -8.0 ± 24.0 pg/mL, respectively, P = 0.97 for ghrelin and 210 ± 390 pg/mL vs 96 ± 372 pg/mL, respectively, P = 0.23 for obestatin). We observed no significant differences in ghrelin or obestatin levels between males and females in non-eradicated and control groups. In the H. pylori-eradicated group, males demonstrated an insignificantly higher percentage change in obestatin than females (51% vs 33%, respectively, P = 0.90), but the males in the H. pylori-eradicated group demonstrated a significantly higher percentage change in obestatin than males in the non-eradicated group (51% vs -8.5%, respectively, P = 0.03).

pg/mL, and 63.7 ± 17.4 pg/mL for the eradicated, non-eradicated and the control groups, respectively. Following eight weeks of therapy, obestatin levels were 914 ± 505 pg/mL, 714 ± 269 pg/mL, and 818 ± 291 pg/mL for the eradicated, non-eradicated and the control groups, respectively (Table 1 and Figure 1).

No significant difference between the initial and 8th week measurements of ghrelin and obestatin was observed in the control group (Table 1). The H. pylori eradicated group demonstrated a significant increase in obestatin af-ter eight weeks of treatment, while the control and non-eradicated groups showed only slight decreases. Similarly, ghrelin levels also slightly decreased in the control and non-eradicated groups. Interestingly however, ghrelin levels only showed an insignificant decrease in the eradi-cated group (Figure 2). The Mann-Whitney U test re-vealed significant differences in the ghrelin and obestatin levels in the H. pylori eradicated group as compared to the non-eradicated group (Table 1). The ghrelin/obestatin ratio at the initial assessment and the 8th week changed significantly only in the H. pylori eradicated group (Table

Ghr

elin

(pg

/mL)

70

65

60

55

50Control H. pylori eradicated H. pylori non-eradicated

Wilcoxon-signed ranks testP < 0.05

Initial

8th week

Control H. pylori eradicated H. pylori non-eradicated

Obe

stat

in (

pg/m

L)

1000

800

600

400

200

0

Wilcoxon-signed ranks testP < 0.05

Figure 1 Ghrelin (A) and obestatin (B) levels at the initial and 8th week as-sessments. H. pylori: Helicobacter pylori.

Control H. pylori non-eradicated H. pylori eradicated

50.00

25.00

0.00

-25.00

-50.00

-75.00

Perc

enta

ge in

ghr

elin

Z = -0.19, P = 0.86Z = -1.39, P = 0.16A

B

A

B

Figure 2 The mean change as percentage in ghrelin (A) and obestatin (B) lev-els between the initial and 8th week assessments. H. pylori: Helicobacter pylori.

200.00

150.00

100.00

50.00

0.00

-50.00

-100.00

Perc

enta

ge in

obe

stat

in

Z = -0.36, P = 0.71

Z = -2.13, P = 0.03

Control H. pylori non-eradicated H. pylori eradicated



DISCUSSIONThis study compared the differences in serum acyl-ghrelinand obestatin levels according to H. pylori eradication status, sex, and BMI. The results revealed a significant decrease in ghrelin levels and increase in obestatin levels in the H. pylori eradicated group after treatment. Despite to reported in some studies, no significant sex differences in ghrelin and obestatin levels were observed between any of the subgroups, including the control group.

The normal levels of these peptides can vary widely; the reported ranges for ghrelin and obestatin are between 5.78 to 1732 pg/mL and 200 to 1156 pg/mL , respective-ly[10,14-22]. In fact, the expected normal serum levels for the different forms of ghrelin are very different: 32.61-65.2 pg/mL for octanoylated ghrelin, 300-430 pg/mL for non-octanoylated ghrelin, and 326-489 pg/mL for total ghrelin, plasma inactive ghrelin (without the n-octanoyl modification) accounts for > 90% of total circulating ghrelin and the ratio of inactive to active ghrelin can be modified under some physiological or pathological condi-tions. These wide ranges may be due to several reasons including the methodological differences in measure-ment, the ethnic differences in the study populations, the commercial kit used, the differences in the pre-treatment procedures, the presence of cytotoxin-associated gene A protein positive H. pylori, the nutritional and eating habits of the sample population, and the presence of diabetes or other metabolic syndromes[22]. Therefore, these wide ranges in values should be the subject of further evalua-tions. To acquire accurate data on ghrelin concentrations, this study recommends a standard procedure for the collection of blood samples: (1) the collection of blood samples with ethylenediaminetetraacetic acid-aprotinin is preferred; (2) blood samples should be chilled and centri-fuged as soon as possible, at least within 30 min after col-lection; and (3) because acidification is the best method for the preservation of plasma ghrelin, 1 mol/L HCl (10% of sample volume) can be added to the plasma sample for adjustment to pH 4[23]. Ghrelin binds to almost 50% to the high density lipoprotein (HDL) in circulation, and the HDL level varies considerably in different ethnic groups[24,25]. Thus, changes in the serum levels of HDL may also alter the ghrelin levels. All patients in our study were of Turkish descent and HDL was not considered, though it would be an interesting area of further study to

evaluate how these variables potentially affected the pep-tide levels.

Small intestine bacterial overgrowth (SIBO) is another possible factor that may explain the variation in ghrelin and obestatin levels, a variable that has been largely ne-glected to date. Antibiotics used in H. pylori eradication may alter the intestinal flora and may trigger any effects by SIBO on appetite hormones. Any comparison of the H. pylori eradicated and non-eradicated groups may need to overcome the possible effect of SIBO on these pep-tides[26,27]. Moreover, the half-life of ghrelin is very short (about 60 min), and serum esterase easily breaks ghrelin down to des-octanoyl-ghrelin, the inactive form[28,29]. The differences in these factors and the activity of ghrelin O-acyltransferase may also lead to different results. These technological disadvantages could partially be diminished by including compatible healthy control individuals in each assay[13]. In a study, two popular commercial RIA kits were compared on the same sample set, and a 10-fold difference in the measured total ghrelin levels was seen[30].

In our study, no difference was observed in the ghre-lin/obestatin ratio of H. pylori negative and H. pylori posi-tive patients. There are conflicting views of the role of ghrelin and obestatin in the literature. In some reports, the presence of H. pylori was associated with decreasing ghrelin, and its eradication was associated with increased ghrelin levels[31,32]. In contrast, ghrelin decreased after H. pylori eradication in some studies; in fact, Osawa et al[32] reported ghrelin decrease in a majority of patients, while only 50 out of 134 patients demonstrated an increase in this hormone. In Chinese adults,a reduction in the ghre-lin/obestatin ratio was associated with patients who were H. pylori positive as compared to uninfected controls[5].

Our results showed that males had insignificantly higher ghrelin and obestatin levels than females (P = 0.66 and P = 0.73, respectively). Even though a number of studies have reported higher ghrelin levels in females[33], fluctuating levels of estrogen related to the different phases of the menstrual cycle may influence serum ghre-lin levels[34].

Overweight participants in the H. pylori eradication group demonstrated significant changes in ghrelin and obestatin levels in this study. They showed a decrease in ghrelin levels, an increase in obestatin levels, and a de-crease in the ghrelin/obestatin ratio. Thus, overweight cases demonstrated opposite changes that what was ex-

Ghrelin initial, pg/mL Ghrelin week 8, pg/mL P value1 Obestatin initial, pg/mL Obestatin week 8, pg/mL P value1

H. pylori eradicated BMI-NW 58.8 ± 18.6 57.5 ± 22.0 0.46 759 ± 452 865 ± 456 0.08 H. pylori eradicated BMI-OW 68.8 ± 20.3 54.1 ± 17.1 0.002a 774 ± 413 975 ± 565 0.05a P value2 0.07 0.67 0.17 0.62 H. pylori non-eradicated BMI-NW 68.7 ± 19.7 60.8 ± 22.0 0.57 780 ± 397 653 ± 258 0.20 H. pylori non-eradicated BMI-OW 69.0 ± 21.0 64.4 ± 15.6 0.88 796 ± 221 791 ± 280 0.77 P value2 0.40 0.69 0.76 0.46

Table 2 Ghrelin and obestatin changes for normal weight and overweight patients after Helicobacter pylori eradication treatment

1Mann-Whitney U test; 2Wilcoxon-signed ranks test. aP < 0.05 is significant; BMI: Body mass index (NW: ≤ 25, normal weight; OW: > 25, overweight); H. pylori: Helicobacter pylori.



pected in terms of their serum ghrelin levels (Table 2).This study revealed no significant sex and age group

(cut-off of 40 years) differences in ghrelin levels, obestatin levels, ghrelin/obestatin ratios, and H. pylori eradication. Changes in the ghrelin/obestatin ratio were also insig-nificant in comparison to the H. pylori eradicated, non-eradicated, and control groups. According to our results, obestatin, not ghrelin, seems to be more influenced by H. pylori eradication; in fact, this was prominent in overweight and male patients.

The results of these study are valid since influencing factors, errors and procedures were identical for all cases. However, these results suggest a variety of useful, future studies. For example a larger study population would al-low generalization of the results to be applicable more than just a small subset of ethnically similar subjects. In addition, it will be interesting to explore several additional variables that were not studied here, including studying subjects in a non-fasting state to allow a comparison of the postprandial or diurnal changes in these hormones. Moreover, including an assessment of the satiety thresh-old of the patients, taking into account the menstrual status of the female patients and testing for SIBO would also be of great interest.

H. pylori eradication was associated with an signifi-cant decrease in ghrelin levels and significant increase in obestatin levels in our study. Due to the contradictory results reported in the literature, the effect of H. pylori on these appetite hormones should be the subject of future studies, and the results may provide important insight for anti-obesity treatment strategies.

COMMENTSBackgroundHelicobacter pylori (H. pylori) is a major cause of stomach inflammation also worldwide. The pathophysiology of some appetite and satiety peptides such as ghrelin and obestatin secreted from gastric mucosa may be altered by this infection. Research frontiersOverweight and obesity are major risk factors for a number of chronic diseases, including diabetes, cardiovascular diseases and cancer according to the World Health Organization reports. Worldwide, obesity has increased 82% in the last two decades. A number of studies report the relation of H. pylori with some appetite hormones as ghrelin and obestatin, but the results are not consistent. Some reveal increase and some no change of these peptides related with H. pylori. The reported levels of these hormones vary in a wide spectrum thus all studies need to be accompanied with a control group. In this study, the authors report the influence of H. pylori on these appetite peptides.Innovations and breakthroughsIn this study, the change of appetite peptides were measured in in three sub-groups of human volunteers: H. pylori infected/eradicated, H. pylori infected/non-eradicated and non-infected control. The monitoring of the non-eradicated group eliminated of a number of factors allowing us to focus only on the effect of H.pylori. In this study, comparison of ghrelin and obestatin change between eradicated and non-eradicated group gave the advantage of discarding the effect of receiving antibiotherapy. Also, including the control group provided the exclusion of possible external factors as month, season and placebo effect of being under examination. Finally, as a novel proposal, the effect of small intestinal bacterial overgrowth, considering menstrual cycles and high density lipoprotein influence on these peptides, are also discussed.ApplicationsThe study results suggest that appetite hormones may be related with H. pylori

and this may be important in anti-obesity strategies.TerminologyAppetite hormones ghrelin and obestatin, two opposite acting peptides involved in appetite and satiety and H. pylori infection and eradication were the main terminological parameters.Peer reviewThe study intends to investigate the changes in serum ghrelin and obestatin levels before and after H. pylori eradication. The authors found that serum ghre-lin and obestatin levels decreased and increased in H. pylori eradication groups compared to non-eradicated patients and controls, respectively. These changes were more prominent in overweight and male patients. The manuscript is well written. The methods are adequate. The results justify the conclusions drawn.

REFERENCES1 Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H,

Kangawa K. Ghrelin is a growth-hormone-releasing acyl-ated peptide from stomach. Nature 1999; 402: 656-660 [PMID: 10604470]

2 Zhang JV, Ren PG, Avsian-Kretchmer O, Luo CW, Rauch R, Klein C, Hsueh AJ. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin’s effects on food intake. Sci-ence 2005; 310: 996-999 [PMID: 16284174]

3 Lagaud GJ, Young A, Acena A, Morton MF, Barrett TD, Shankley NP. Obestatin reduces food intake and suppresses body weight gain in rodents. Biochem Biophys Res Commun 2007; 357: 264-269 [PMID: 17418097]

4 Gourcerol G, Taché Y. Obestatin--a ghrelin-associated pep-tide that does not hold its promise to suppress food intake and motility. Neurogastroenterol Motil 2007; 19: 161-165 [PMID: 17300284]

5 Gao XY, Kuang HY, Liu XM, Duan P, Yang Y, Ma ZB. Circulating ghrelin/obestatin ratio in subjects with Helico-bacter pylori infection. Nutrition 2009; 25: 506-511 [PMID: 19131215 DOI: 10.1016/j.nut.2008.11.002]

6 Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, Hosoda H, Kojima M, Kangawa K. Ghrelin stimu-lates gastric acid secretion and motility in rats. Biochem Bio-phys Res Commun 2000; 276: 905-908 [PMID: 11027567]

7 Kojima M, Kangawa K. Ghrelin: structure and function. Physiol Rev 2005; 85: 495-522 [PMID: 15788704]

8 Hassouna R, Zizzari P, Viltart O, Yang SK, Gardette R, Videau C, Badoer E, Epelbaum J, Tolle V. A natural variant of obestatin, Q90L, inhibits ghrelin’s action on food intake and GH secretion and targets NPY and GHRH neurons in mice. PLoS One 2012; 7: e51135 [PMID: 23251435 DOI: 10.1371/journal.pone.0051135]

9 DelParigi A, Tschöp M, Heiman ML, Salbe AD, Vozarova B, Sell SM, Bunt JC, Tataranni PA. High circulating ghrelin: a potential cause for hyperphagia and obesity in prader-willi syndrome. J Clin Endocrinol Metab 2002; 87: 5461-5464 [PMID: 12466337]

10 Cindoruk M, Yetkin I, Deger SM, Karakan T, Kan E, Unal S. Influence of H pylori on plasma ghrelin in patients without atrophic gastritis. World J Gastroenterol 2007; 13: 1595-1598 [PMID: 17461454]

11 Konturek PC, Cześnikiewicz-Guzik M, Bielanski W, Kon-turek SJ. Involvement of Helicobacter pylori infection in neuro-hormonal control of food intake. J Physiol Pharmacol 2006; 57 Suppl 5: 67-81 [PMID: 17218760]

12 Isomoto H, Ueno H, Saenko VA, Mondal MS, Nishi Y, Kawano N, Ohnita K, Mizuta Y, Ohtsuru A, Yamashita S, Nakazato M, Kohno S. Impact of Helicobacter pylori infec-tion on gastric and plasma ghrelin dynamics in humans. Am J Gastroenterol 2005; 100: 1711-1720 [PMID: 16086706 DOI: 10.1111/j.1572-0241.2005.41492.x]

13 Kosowicz J, Baumann-Antczak A, Zamysłowska H, Sowiński J. Technological difficulties in ghrelin and obestatin assays. Endokrynol Pol 2011; 62: 336-339 [PMID: 21879474]


COMMENTS


14 Polat Z, Kilciler G, Ozel AM, Kara M, Kantarcioglu M, Uy-gun A, Bagci S. Plasma ghrelin levels in patients with familial Mediterranean fever. Dig Dis Sci 2012; 57: 1660-1663 [PMID: 22297653 DOI: 10.1007/s10620-012-2049-z]

15 Sawicka B, Bossowski A, Urban M, Szalecki M, Wysocka J, Koput A, Zelazowska-Rutkowska B, Tobolczyk J, Skrzydło M, Rogowski F, Luba M. Analysis of serum levels of ghrelin and obestatin in children and adolescents with autoimmune thyroid diseases. Pediatr Endocrinol Diabetes Metab 2009; 15: 20-27 [PMID: 19454185]

16 Deng ZH, Chu B, Xu YZ, Zhang B, Jiang LR. Influence of Helicobacter pylori infection on ghrelin levels in children. World J Gastroenterol 2012; 18: 5096-5100 [PMID: 23049220 DOI: 10.3748/wjg.v18.i36.5096]

17 Gutierrez-Grobe Y, Villalobos-Blasquez I, Sánchez-Lara K, Villa AR, Ponciano-Rodríguez G, Ramos MH, Chavez-Tapia NC, Uribe M, Méndez-Sánchez N. High ghrelin and obestatin levels and low risk of developing fatty liver. Ann Hepatol 2010; 9: 52-57 [PMID: 20308723]

18 Komarowska H, Jaskula M, Stangierski A, Wasko R, Sow-inski J, Ruchala M. Influence of ghrelin on energy balance and endocrine physiology. Neuro Endocrinol Lett 2012; 33: 749-756 [PMID: 23391977]

19 Riis AL, Hansen TK, Møller N, Weeke J, Jørgensen JO. Hyperthyroidism is associated with suppressed circulat-ing ghrelin levels. J Clin Endocrinol Metab 2003; 88: 853-857 [PMID: 12574224]

20 Granata R, Settanni F, Gallo D, Trovato L, Biancone L, Can-taluppi V, Nano R, Annunziata M, Campiglia P, Arnoletti E, Ghè C, Volante M, Papotti M, Muccioli G, Ghigo E. Obestatin promotes survival of pancreatic beta-cells and human islets and induces expression of genes involved in the regulation of beta-cell mass and function. Diabetes 2008; 57: 967-979 [PMID: 18162507]

21 Zamrazilová H, Hainer V, Sedlácková D, Papezová H, Kune-sová M, Bellisle F, Hill M, Nedvídková J. Plasma obestatin levels in normal weight, obese and anorectic women. Physiol Res 2008; 57 Suppl 1: S49-S55 [PMID: 18271692]

22 Zou CC, Liang L, Wang CL, Fu JF, Zhao ZY. The change in ghrelin and obestatin levels in obese children after weight reduction. Acta Paediatr 2009; 98: 159-165 [PMID: 18710433 DOI: 10.1111/j.1651-2227.2008.00997.x]

23 Hosoda H, Doi K, Nagaya N, Okumura H, Nakagawa E, Enomoto M, Ono F, Kangawa K. Optimum collection and storage conditions for ghrelin measurements: octanoyl mod-ification of ghrelin is rapidly hydrolyzed to desacyl ghrelin in blood samples. Clin Chem 2004; 50: 1077-1080 [PMID: 15161728 DOI: 10.1373/clinchem.2003.025841]

24 Hassouna R, Zizzari P, Tolle V. The ghrelin/obestatin bal-ance in the physiological and pathological control of growth

hormone secretion, body composition and food intake. J Neuroendocrinol 2010; 22: 793-804 [PMID: 20456603 DOI: 10.1111/j.1365-2826.2010.02019.x]

25 Ujcic-Voortman JK, Bos G, Baan CA, Uitenbroek DG, Ver-hoeff AP, Seidell JC. Ethnic differences in total and HDL cholesterol among Turkish, Moroccan and Dutch ethnic groups living in Amsterdam, the Netherlands. BMC Public Health 2010; 10: 740 [PMID: 21118503 DOI: 10.1186/1471-2458-10-740]

26 Sajjad A, Mottershead M, Syn WK, Jones R, Smith S, Nwo-kolo CU. Ciprofloxacin suppresses bacterial overgrowth, increases fasting insulin but does not correct low acylated ghrelin concentration in non-alcoholic steatohepatitis. Ali-ment Pharmacol Ther 2005; 22: 291-299 [PMID: 16097995]

27 Bures J, Cyrany J, Kohoutova D, Förstl M, Rejchrt S, Kvetina J, Vorisek V, Kopacova M. Small intestinal bacterial over-growth syndrome. World J Gastroenterol 2010; 16: 2978-2990 [PMID: 20572300 DOI: 10.3748/wjg.v16.i24.2978]

28 Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Aka-mizu T, Suda M, Koh T, Natsui K, Toyooka S, Shirakami G, Usui T, Shimatsu A, Doi K, Hosoda H, Kojima M, Kangawa K, Nakao K. Stomach is a major source of circulating ghre-lin, and feeding state determines plasma ghrelin-like immu-noreactivity levels in humans. J Clin Endocrinol Metab 2001; 86: 4753-4758 [PMID: 11600536]

29 Tolle V, Bassant MH, Zizzari P, Poindessous-Jazat F, Toma-setto C, Epelbaum J, Bluet-Pajot MT. Ultradian rhythmicity of ghrelin secretion in relation with GH, feeding behavior, and sleep-wake patterns in rats. Endocrinology 2002; 143: 1353-1361 [PMID: 11897692]

30 Gröschl M, Uhr M, Kraus T. Evaluation of the comparabil-ity of commercial ghrelin assays. Clin Chem 2004; 50: 457-458 [PMID: 14752024]

31 Nwokolo CU, Freshwater DA, O’Hare P, Randeva HS. Plas-ma ghrelin following cure of Helicobacter pylori. Gut 2003; 52: 637-640 [PMID: 12692045 DOI: 10.1136/gut.52.5.637]

32 Osawa H, Kita H, Ohnishi H, Nakazato M, Date Y, Bowlus CL, Ishino Y, Watanabe E, Shiiya T, Ueno H, Hoshino H, Sa-toh K, Sugano K. Changes in plasma ghrelin levels, gastric ghrelin production, and body weight after Helicobacter py-lori cure. J Gastroenterol 2006; 41: 954-961 [PMID: 17096064]

33 Stec-Michalska K, Malicki S, Michalski B, Peczek L, Wis-niewska-Jarosinska M, Nawrot B. Gastric ghrelin in relation to gender, stomach topography and Helicobacter pylori in dyspeptic patients. World J Gastroenterol 2009; 15: 5409-5417 [PMID: 19916170]

34 De Souza MJ, Leidy HJ, O’Donnell E, Lasley B, Williams NI. Fasting ghrelin levels in physically active women: relation-ship with menstrual disturbances and metabolic hormones. J Clin Endocrinol Metab 2004; 89: 3536-3542 [PMID: 15240643]

P- Reviewers Unger M, Bian ZX, D’Elios MM S- Editor Wen LL L- Editor A E- Editor Li JY


Increased international normalized ratio level in hepatocellular carcinoma patients with diabetes mellitus

Hui Zhang, Chun Gao, Long Fang, Shu-Kun Yao

Hui Zhang, Chun Gao, Long Fang, Shu-Kun Yao, Department of Gastroenterology, China-Japan Friendship Hospital, Ministry of Health, Beijing 100029, ChinaAuthor contributions: Zhang H participated in the acquisition of data, statistical analysis and manuscript writing; Gao C and Fang L conceived the study, participated in the study design, ac-quisition of data, statistical analysis and manuscript writing; Yao SK participated in the study design and critical revision of manu-script for important intellectual content; all authors have read and approved the final manuscript.Supported by National Natural Science Foundation of China, No. 81273975; and the Research Fund of the China-Japan Friend-ship Hospital, Ministry of Health, No. 2010-QN-01Correspondence to: Long Fang, MD, Department of Gastro-enterology, China-Japan Friendship Hospital, Ministry of Health, No. 2 Yinghua East Road, Beijing 100029, China. [email protected]: +86-10-84205313 Fax: +86-10-84205313Received: December 24, 2012 Revised: January 11, 2013 Accepted: February 8, 2013Published online: April 21, 2013

AbstractAIM: To determine the association of diabetes mellitus (DM) and international normalized ratio (INR) level in hepatocellular carcinoma (HCC) patients.

METHODS: Our present study included 375 HCC pa-tients who were treated at the China-Japan Friendship Hospital, Ministry of Health (Beijing, China), in the period from January 2003 to April 2012, and with a hospital discharge diagnosis of HCC. The demographic, clinical, laboratory, metabolic and instrumental fea-tures were analyzed. χ 2 test, Student’s t test and Mann-Whitney U test were used to compare the differences between HCC patients with and without DM. Uncon-ditional multivariable logistic regression analysis was used to determine the association of DM and INR level in HCC patients. A sub-group analysis was performed to assess the effect of liver cirrhosis or hepatitis B virus

(HBV) infection on the results. The Pearson correlation test was used to determine the relationship between INR level and fasting glucose. In addition, association between diabetes duration, and diabetes treatment and INR level was determined considering the potentially different effects.

RESULTS: Of the total, 63 (16.8%) patients were dia-betic (diabetic group) and 312 (83.2%) patients were diagnosed without diabetes (non-diabetic group). Their mean age was 56.4 ± 11.0 years and 312 (83.2%) patients were male. Compared with patients without DM, the HCC patients with diabetes were older (59.5 ± 10.3 vs 55.8 ± 11.1, P = 0.015), had a lower incidence of HBV infection (79.4% vs 89.1%, P = 0.033), had increased levels of systolic blood pressure (SBP) (133 ± 17 vs 129 ± 16 mmHg, P = 0.048) and INR (1.31 ± 0.44 vs 1.18 ± 0.21, P = 0.001), had lower values of hemoglobin (124.4 ± 23.9 vs 134.2 ± 23.4, P = 0.003) and had a platelet count (median/interquartile-range: 113/64-157 vs 139/89-192, P = 0.020). There was no statistically significant difference in the percentages of males, overweight or obesity, drinking, smoking, cirrhosis and Child classification. After controlling for the confounding effects of age, systolic blood pres-sure, hemoglobin, platelet count and HBV infection by logistic analyses, INR was shown as an independent variable [odds ratio (OR) = 3.650; 95%CI: 1.372-9.714, P = 0.010]. Considering the effect of liver cirrhosis on results, a sub-group analysis was performed and the study population was restricted to those patients with cirrhosis. Univariate analysis showed that diabetic pa-tients had a higher INR than non-diabetic patients (1.43 ± 0.51 vs 1.25 ± 0.23, P = 0.041). After controlling for confounding effect of age, SBP, hemoglobin, platelet count and HBV infection by logistic analyses, INR level remained as the sole independent variable (OR = 5.161; 95%CI: 1.618-16.455, P = 0.006). No significant dif-ference in the relationship between INR level and fast-ing glucose was shown by Pearson test (r = 0.070, P = 0.184). Among the 63 diabetic patients, 35 (55.6%)

BRIEF ARTICLE





Generally, DM is associated with about two to three fold increased risk of HCC and diabetes may also increase the risk of death from HCC, which has been observed in a large cohort study conducted in Europe[18]. In addition, DM can affect the prognosis of HCC after curative thera-py and this prognostic impact is independent of the basic demographics, liver cirrhosis, and other comorbidities of HCC patients[19-21].

Blood coagulation disorders are common findings in cancer patients[22,23]. Cancer cells can activate blood coagu-lation through the expression of procoagulant molecules such as tissue factors and cancer procoagulant which con-sequently activate serine proteases factor Ⅶa, factor Ⅹa and thrombin[24,25]. However, HCC patients with impaired liver function have a more complex hemostatic distur-bance, especially those with liver cirrhosis[26,27]. Moreover, some preclinical and clinical studies have suggested that diabetes is associated with coagulation disorders, which are responsible for an increased thrombotic tendency and risk of cardiovascular disease[28-30]. Therefore, the mecha-nisms for these coagulation alterations may be complex; however, no information was available for the association between DM and coagulation disorders in HCC patients, to our best knowledge.

Prothrombin time (PT), which is used to measure the coagulation factors of the “extrinsic pathway”, is the most frequently used coagulation test in routine laboratories. In-ternational normalized ratio (INR), which was introduced to overcome the problem of marked variation in PT re-sults among laboratories, has been used to standardize PT value in liver diseases and been included in some prognos-tic models of HCC and liver cirrhosis, such as Child-Tur-cotte-Pugh (CTP) score and the model for end stage liver disease (MELD)[31]. Considering that no information was available for the effect of DM on the INR level in HCC patients, our study was designed to determine the associa-tion of DM and INR in our Chinese HCC patients.

MATERIALS AND METHODSStudy populationA cohort of patients who were treated at our hospital in the period from January 2003 to April 2012, and with a hospital discharge diagnosis of HCC, were included in our present study. Chronic HBV infection was defined as serum HBsAg-positive for at least 6 mo or at diagnosis of HCC. Patients who followed these criteria would be excluded: (1) those who had been treated by any method at inclusion or with confirmed diagnosis of HCC for more than 15 d; (2) those who had other malignancies, including leukemia and lymphoma; (3) those who were non-Chinese; (4) those who had autoimmune hepatitis, schistosomiasis, primary biliary cirrhosis, Budd-Chiari syndrome, primary sclerosing cholangitis, hemachro-matosis, Wilson’s disease, rheumatic diseases or allergic disorder; and (5) those who had serious diseases of other organs or systems, such as severe heart failure, uremia, or acute exacerbations of chronic obstructive pulmonary disease. The study was approved by the Human Research


Zhang H et al . Increased INR in HCC with DM

patients had been diagnosed with DM for more than 5 years, 23 (36.5%) received oral anti-diabetic regimens, 11 (17.5%) received insulin, and 30 (47.6%) reported relying on diet alone to control serum glucose levels. No significant differences were found for the associa-tion between DM duration/treatment and INR level, except for the age at diabetes diagnosis.

CONCLUSION: The INR level was increased in HCC patients with DM and these patients should be moni-tored for the coagulation function in clinical practice.


Key words: International normalized ratio; Coagulation function; Diabetes mellitus; Hepatocellular carcinoma; Chinese patients

Core tip: This study showed that the international nor-malized ratio (INR) level was an independent variable associated with diabetes mellitus (DM) in hepatocellular carcinoma (HCC) patients compared with those HCC patients without DM, after controlling for the confound-ing effect of age, systolic blood pressure, hemoglobin, platelet and hepatitis B virus infection by logistic analy-ses. Considering the effect of liver cirrhosis on results, a sub-group analysis was performed and the study population was restricted to those HCC patients with cirrhosis. A similar result was obtained. These results indicated that INR level was increased in HCC patients with DM and this is independent of liver cirrhosis.

Zhang H, Gao C, Fang L, Yao SK. Increased international nor-malized ratio level in hepatocellular carcinoma patients with dia-betes mellitus. World J Gastroenterol 2013; 19(15): 2395-2403 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2395.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2395

INTRODUCTIONHepatocellular carcinoma (HCC), with a mounting annual incidence of 4.9 per 100000 persons, is the third most common cause of cancer death worldwide[1-3]. In China, there is a particularly high incidence of 40 per 100000 persons per year[4,5]. Although many advances in treat-ment have been made, the prognosis of HCC is very poor and the total 5-year survival rate is as low as 10%, even in those developed countries like the United States[6]. Risk factors of HCC that were identified include hepatitis B vi-rus (HBV), hepatitis C virus (HCV), cirrhosis, heavy alco-hol consumption, non-alcoholic steatohepatitis (NASH), alfatoxin exposure, increasing age, male sex, and positive family history[7,8]; however, in 15%-50% of HCC patients no specific risk factor has been found[4,5,9].

Recently, emerging evidence suggest that diabetes mel-litus (DM) is a potential risk factor for HCC[10-13], which has been strengthened by several meta-analyses[3,14-17].

Ethics Committee of the China-Japan Friendship hos-pital and it was in accordance with the principles of the Declaration of Helsinki.

Subject determinationsHCC diagnosis was based on the histological findings of needle biopsy/surgery or typical radiological features shown by at least two image examinations including ul-trasound (US), contrast-enhanced dynamic computed tomography (CT) and magnetic resonance imaging (MRI) and hepatic angiography or by a single positive imaging with a serum alpha fetoprotein level > 400 ng/mL[32]. DM was characterized by fasting plasma glucose of 126 mg/dL or greater on at least two occasions, plasma glu-cose of 200 mg/dL or greater at 2-h oral glucose toler-ance test, or the need for an oral hypoglycemic drug or insulin to control glucose[33].

Clinical and laboratory parametersThe demographic, metabolic, biochemical, radiological, and pathological features of the patients with HCC were recorded. The data were obtained at the diagnosis of HCC, but excluded those obtained 15 d before or after the diagnosis. Patients who had missing values which may affect statistical results were be excluded. Body mass index (BMI) was computed as body weight (in ki-lograms) divided by the square of the height (in meters). Overweight was defined as BMI ≥ 23 kg/m2 and obesity BMI ≥ 25 kg/m2, according to the Asian and Chinese criteria[4,5]. The diagnosis of hypertension was defined as systolic blood pressure (SBP) ≥ 140 mmHg and/or dia-stolic blood pressure (DBP) ≥ 90 mmHg, and mean ar-terial pressure (MAP) was computed as 1/3 SBP plus 2/3 DBP. Blood pressure was measured in a quiet room at a comfortable temperature. Physical activity, smoking, cof-fee drinking, or having eaten within the past 30 min were to be avoided. Five associated parameters, including total bilirubin, albumin, INR, ascites and hepatic encephalopa-thy, were used to calculate the CTP score.

Venous blood samples were taken in the morning after a 12 h overnight fast. Standard methods were used to measure the laboratory parameters, including INR. Chronic HCV infection was defined as anti-HCV sero-positivity and/or having detectable HCV RNA. Based on the recorded results, the findings of physical examinations and imaging techniques including US, CT, MRI and hepat-ic angiography were re-assessed carefully by at least two authors independently for tumor-node-metastasis (TNM) stage and clinical classification. We classified tumor stages according to the 7th TNM staging system recommended by International Union Against Cancer. In clinical clas-sification, massive HCC was defined as a diameter of ≥ 5 cm, nodular HCC as a diameter of < 5 cm, and small HCC as a diameter of < 3 cm for single or two nodules.

Statistical analysisThe statistical analysis was performed using SPSS for Windows, version 17.0 (SPSS, Chicago, IL, United

States). For the categorical variables, the numbers and proportions were described, and Pearson χ 2 test, continu-ity correction χ 2 tests or Fisher’s exact test were used. For the continuous variables, mean ± SD deviation was de-scribed and Independent-Samples t test was used. If the continuous variable had a skewed distribution, it would be described using the median value and inter-quartile range and analyzed by Mann-Whitney non-parametric U test. Unconditional multivariable logistic regression analy-sis was used to determine the association of DM and INR level in HCC patients. According to the results of univariate analysis, six variables were included, including age, SBP, HBV infection, hemoglobin, platelet count and INR level. To assess the effect of liver cirrhosis on our results, a sub-group analysis was performed and the study population was restricted to those HCC patients with and without cirrhosis. The Pearson correlation test was used to determine the relationship between INR level and fasting glucose. Stepwise multiple regression analysis (Backward: Wald; Entry: 0.05, Removal: 0.10) was used. We expressed results as odds ratio (OR) and their 95%CI. For all tests, P < 0.05 was considered statistically signifi-cant and all P values quoted are two-sided.

RESULTSBaseline characteristics of the study populationOur present study included 375 HCC patients based on the diagnostic, inclusion and exclusion criteria. Of the to-tal, 63 (16.8%) patients were diabetic (diabetic group) and 312 (83.2%) patients were diagnosed without diabetes (non-diabetic group). Their baseline characteristics were shown in Table 1. Their mean age was 56.4 ± 11.0 years and 312 (83.2%) patients were male. Of these patients, 328 (87.5%) had HBV infection and 22 (5.9%) patients had HCV infection. One hundred and ninety-nine (53.1%) patients were diagnosed with liver cirrhosis, 88 (23.5%) patients had a past history of hypertension, 159 (159/281, 56.6%) patients were overweight or obese, 104 (27.7%) patients were alcohol drinkers, and 154 (41.4%) patients were smokers. TNM stage and clinical classification of our study population were shown in Table 2. For the clinical classification, massive-type HCC (213, 56.8%) and nodular-type HCC (117, 31.2%) were the two major types, which accounted for nearly 90% of the total pa-tients. For M stage, 269 (71.7%) were diagnosed with M0.

Univariable analysis: Comparison of HCC patients with and without DMOf the 63 diabetic patients, the mean age was 59.5 ± 10.3 years, 51 (81.0%) were male, the mean BMI was 23.69 ± 3.51 kg/m2, and 17 (27.0%) patients had a past history of hypertension. Twenty (31.7%) patients were smokers, and 14 (22.2%) were drinkers (Table 1). The duration and treatment of diabetes is shown in a later section.

χ 2 test, Student’s t test and Mann-Whitney U test were used to compare the differences between HCC patients with and without diabetes. As shown in Table 1, compared




iate analysis, six variables were included (Table 3), includ-ing age, SBP, HBV infection, hemoglobin, platelet count and INR level. Statistical differences were shown for three variables (Table 3): INR level (OR = 3.650; 95%CI: 1.372-9.714; P = 0.010), SBP (OR = 1.019; 95%CI: 1.002-1.036; P = 0.029), and hemoglobin value (OR = 0.987; 95%CI: 0.975-0.999; P = 0.038).

Considering that some factors may play possible roles in HCC based on the published literature and our current knowledge, for example male gender, alcohol drinking, HCV infection, liver cirrhosis, and CTP classification. To control the effect of these variables, they were included in the multivariable analysis, although no statistical sig-nificance were shown by univariate analysis (Table 1). For this purpose, more potentially confounding factors were controlled and logistic regression was repeated, including age, sex, HBV infection, HCV infection, alcohol drink-ing, liver cirrhosis, CTP classification and INR (Table 3). Results showed that INR level remained statistically significant (OR = 4.487; 95%CI: 1.713-11.754; P = 0.002).

with patients without DM, the HCC patients with diabe-tes had: an older age (59.5 ± 10.3 vs 55.8 ± 11.1, P = 0.015); a lower incidence of HBV infection (79.4% vs 89.1%, P = 0.033); increased levels of SBP (133 ± 17 vs 129 ± 16, P = 0.048) and INR (1.31 ± 0.44 vs 1.18 ± 0.21, P = 0.001); lower values of hemoglobin (124.4 ± 23.9 vs 134.2 ± 23.4, P = 0.003); and platelet count (median/interquartile-range: 113/64-157 vs 139/89-192, P = 0.020). There was no statistically significant difference in the percentages of males, overweight or obesity, drinking, smoking, cirrhosis and Child classification. Results of univariable analysis for the TNM stage and clinical classification were shown in Table 2. No significant differences were demonstrated for T stage, N stage, M stage and the clinical classification.

Multivariable analysis: Increased INR levels in HCC patients with DMUnconditional multivariable logistic regression analysis was used to determine the association of DM and INR level in HCC patients. According to the results of univar-

Variable Total patients(n = 375)

HCC patients with diabetes (n = 63)

HCC patients without diabetes(n = 312) P value

Male sex 312 (83.2) 51 (81.0) 261 (83.7) 0.601 Mean age, yr (mean ± SD) 56.4 ± 11.0 59.5 ± 10.3 55.8 ± 11.1 0.015 Body weight1, kg (mean ± SD) 68.1 ± 10.9 69.3 ± 13.0 67.8 ± 10.5 0.346 Body height2, cm (mean ± SD) 168.8 ± 7.0 168.6 ± 8.0 168.9 ± 6.8 0.810 BMI3, kg/m2 (mean ± SD) 23.77 ± 3.39 23.69 ± 3.51 23.68 ± 3.71 0.991 Overweight or obesity3 159 (56.6) 27 (57.4) 132 (56.4) 0.896 History of hypertension 88 (23.5) 17 (27.0) 71 (22.8) 0.470 SBP, mmHg (mean ± SD) 130 ± 17 133 ± 17 129 ± 16 0.048 DBP, mmHg (mean ± SD) 79 ± 10 78 ± 10 79 ± 10 0.455 Smoking 154 (41.4) 20 (31.7) 134 (42.9) 0.099 Alcohol intake 104 (27.7) 14 (22.2) 90 (28.8) 0.284 HBV infection 328 (87.5) 50 (79.4) 278 (89.1) 0.033 HCV infection 22 (5.9) 3 (4.8) 19 (6.1) 0.908 Liver cirrhosis 199 (53.1) 38 (60.3) 161 (51.6) 0.206 Fatty liver 11 (2.9) 2 (3.2) 9 (2.9) 1.000 Child-Turcotte-Pugh classification4

Child A 243 (65.5) 35 (56.5) 208 (67.3) 0.101 Child B 92 (24.8) 17 (27.4) 75 (24.3) 0.600 Child C 36 (9.7) 10 (16.1) 26 (8.4) 0.061 AFP > 400 ng/mL5 167 (45.8) 27 (43.5) 140 (46.2) 0.702 Neutrophil, × 109/L (mean ± SD) 4.13 ± 2.49 3.88 ± 2.52 4.18 ± 2.49 0.389 Hemoglobin, g/L (mean ± SD) 132.5 ± 23.8 124.4 ± 23.9 134.2 ± 23.4 0.003 Platelet count, × 109/L 130 (85-189) 113 (64-157) 139 (89-192) 0.020 ALT, U/L 45 (29-81) 44 (27-91) 45 (30-79) 0.943 AST, U/L 62 (38-117) 52 (34-97) 66 (39-119) 0.124 ALP, U/L 111 (82-176) 111 (84-171) 111 (81-177) 0.907 GGT, U/L 106 (55-233) 96 (51-190) 109 (57-239) 0.406 INR6 (mean ± SD) 1.20 ± 0.27 1.31 ± 0.44 1.18 ± 0.21 0.001 Total bilirubin, mg/L 16 (10-27) 17 (10-31) 16 (10-25) 0.561 Albumin, g/L (mean ± SD) 37.4 ± 6.0 36.4 ± 5.9 37.6 ± 6.0 0.148 Total cholesterol, mmol/L (mean ± SD) 4.26 ± 1.34 4.18 ± 1.12 4.28 ± 1.39 0.662 BUN, mmol/L 5.14 (4.00-6.36) 5.12 (3.92-6.46) 5.18 (4.04-6.34) 0.738 Creatinine, µmol/L 80 (71-88) 80 (70-97) 80 (71-88) 0.860

Table 1 Baseline characteristics of the study population and univariate analysis of comparison of hepatocellular carcinoma patients with and without diabetes n (%)

Data were available in 1366 (60 + 306), 2286 (49 + 237), 3281 (47 + 234), 4371 (62 + 309), 5365 (62 + 303) and 6367 (62 + 305) patients. The numbers before the brackets indicate the total available cases in the two groups. BMI: Body mass index; BUN: Blood urea nitrogen; DBP: Diastolic blood pressure; HBV: Hepatitis B virus; HCC: Hepatocellular carcinoma; HCV: Hepatitis C virus; INR: International normalized ratio; SBP: Systolic blood pressure; ALT: Aminoleucine transferase; AST: Aspartate aminotransferase; ALP: Alkaline phos-phatase; GGT: Galactosylhydroxylysyl glucosyltransferase.



In addition, one significant difference was found for age (OR = 1.032; 95%CI: 1.005-1.059; P = 0.020).

Sub-group analysisAs demonstrated in Table 1, among the six variables which were shown as statistically significant in univariate analysis, 5 were associated with liver cirrhosis, including age, HBV infection, hemoglobin, platelet count and INR level. To assess the effect of liver cirrhosis on our results, sub-group analysis was performed although liver cirrhosis had been controlled in the multivariable logistic analysis. We restricted our study population to those HCC patients with and without cirrhosis.

In the 199 HCC patients with liver cirrhosis, data were not available in 7 patients for INR level and 192 were included in the sub-group analysis, including 37 pa-

tients in the diabetic group and 155 in the non-diabetic group. Univariate analysis showed that diabetic patients had a higher level of INR than non-diabetic patients (1.43 ± 0.51 vs 1.25 ± 0.23, P = 0.041). After controlling for the confounding effects of age, SBP, hemoglobin, platelet count and HBV infection by logistic analyses (Table 4), INR level remained as the sole independent variable (OR = 5.161; 95%CI: 1.618-16.455, P = 0.006).

When the study population was restricted to those pa-tients without liver cirrhosis, no significant difference was found for INR value (1.12 ± 0.19 vs 1.10 ± 0.16, P = 0.721). A similar result was gained in logistic analyses (OR = 2.082; 95%CI: 0.130-33.333; P = 0.604). In addition, considering that more than 80% of HCC has been attributed to HBV infection in China (this number was 87.5% in our present study), we performed a sub-group analysis in those HCC patients with HBV infection. Unfortunately, no statistical-ly significant differences were found in univariate analysis (1.28 ± 0.43 vs 1.18 ± 0.21, P = 0.091) and multivariable analysis (OR = 2.508; 95%CI: 0.860-7.315, P = 0.092).

Variable Total patients(n = 375)

HCC patients with diabetes (n = 63)

HCC patients without diabetes(n = 312) P value

T stage T1 82 (21.9) 15 (23.8) 67 (21.5) 0.683 T2 90 (24.0) 19 (30.2) 71 (22.8) 0.210 T3a 157 (41.9) 22 (34.9) 135 (43.3) 0.221 T3b 37 (9.9) 6 (9.5) 31 (9.9) 0.920 T4 9 (2.4) 1 (1.6) 8 (2.6) 0.991 N stage N0 334 (89.1) 57 (90.5) 277 (88.8) 0.694 N1 41 (10.9) 6 (9.5) 35 (11.2) - M stage M0 269 (71.7) 49 (77.8) 220 (70.5) 0.243 M1 106 (28.3) 14 (22.2) 92 (29.5) - Clinical classification Massive 213 (56.8) 29 (46.0) 184 (59.0) 0.059 Nodular 117 (31.2) 22 (34.9) 95 (30.4) 0.485 Small-cancer 28 (7.5) 8 (12.7) 20 (6.4) 0.142 Diffuse 17 (4.5) 4 (6.3) 13 (4.2) 0.503

Table 2 Tumor-node-metastasis stage and clinical type of the study population n (%)

Variable AOR 95%CI P value Model 1 INR 3.650 1.372-9.714 0.010 SBP 1.019 1.002-1.036 0.029 Hemoglobin 0.987 0.975-0.999 0.038 Model 2 INR 4.487 1.713-11.754 0.002 Age 1.032 1.005-1.059 0.020

Table 3 Multivariable analysis: Increased international normal-ized ratio level in hepatocellular carcinoma patients with dia-betes mellitus

Model 1: Based on the results of univariate analysis, unconditional mul-tivariable logistic regression analysis was performed. Six variables were included, including age, systolic blood pressure (SBP), hepatitis B virus (HBV) infection, hemoglobin, platelet count and international normalized ratio (INR). Statistical differences were shown for 3 variables (shown in Table), and other four variables were omitted because no significant differ-ences were found; Model 2: According to the published literatures and our current knowledge, more potential confounding factors were controlled, including age, sex, HBV infection, hepatitis C virus infection, alcohol drinking, liver cirrhosis, Child-Turcotte-Pugh classification and INR. AOR: Adjusted odds ratio.

Variable1 AOR2 95%CI P value HCC patients with liver cirrhosis INR 5.161 1.618-16.455 0.006 HCC patients without liver cirrhosis INR 2.082 0.130-33.333 0.604 Age 1.060 1.015-1.107 0.008 HCC patients with HBV infection INR 2.508 0.860-7.315 0.092 Hemoglobin 0.984 0.970-0.998 0.024

Table 4 Results of multivariable analysis for sub-group analysis

1International normalized ratio (INR) and variables with significant differ-ence were shown; 2Adjusted odds ratio (AOR) for the confounding effect of age, systolic blood pressure, hemoglobin, platelet count, and hepatitis B virus (HBV) infection using unconditional multivariable logistic regres-sion analyses, based on the results of univariate analysis shown in Table 1. HCC: Hepatocellular carcinoma.

HCC: Hepatocellular carcinoma; T: Tumor; N: Node; M: Metastasis.



Association of INR and fasting glucose levelA Pearson correlation test was used to determine the re-lationship between INR level and fasting glucose. In the entire study population of 367 patients (data were not available in 8 patients for INR), the mean value of fast-ing glucose was 8.83 ± 3.12 mmol/L for diabetic patients whereas the value was 5.21 ± 1.07 mmol/L for non-diabetic patients (P < 0.001). However, no significant dif-ference was shown by Pearson test (r = 0.070, P = 0.184). Even after the analysis was restricted to diabetics only, the same result was obtained.

Association between diabetes duration/treatment and INR levelConsidering the potentially different effects of diabetes du-ration and anti-diabetic agents, we studied the association between DM duration/treatment and INR level. Among the 63 diabetic patients (Table 5), 35 (55.6%) patients had been diagnosed with DM for more than 5 years, 23 (36.5%) received oral anti-diabetic regimens, 11(17.5%) received insulin, and 30 (47.6%) reported relying on diet alone to control serum glucose level. The cutoff values of 1.20 and 1.50 were determined based on the mean value and range of the normal value. χ 2 test, continuity correction χ 2 tests or Fisher’s exact test were used to determine the association. As shown in Table 5, no statistically significant differences were found for the association between DM duration/treatment and INR level, except for the age at diabetes diagnosis.

DISCUSSIONOur study showed that the INR level was an indepen-dent variable associated with DM in HCC patients (OR = 3.650; 95%CI: 1.372-9.714; P = 0.010), compared with those HCC patients without DM, after controlling for the confounding effect of age, SBP, hemoglobin, platelet and HBV infection by logistic analyses. Consid-ering the effect of liver cirrhosis on results, a sub-group analysis was performed and the study population was restricted to those HCC patients with cirrhosis. A similar result was obtained (OR = 5.161; 95%CI: 1.618-16.455, P = 0.006). These results indicated that INR level was increased in HCC patients with DM and this is indepen-dent of liver cirrhosis.

No information was available for the association be-tween DM and coagulation disorders in HCC patients, to the best of our knowledge. For the first time, our study was designed to determine the association of DM and INR in HCC patients. INR, developed by the World Health Organization to standardize PT reporting in the early 1980s, is used worldwide to monitor oral antico-agulation therapy[22,23]. The INR level is used to measure the extrinsic pathway of the coagulation cascade and influenced by coagulation factors Ⅰ (fibrinogen), Ⅱ(prothrombin), Ⅴ, Ⅶ, and Ⅹ. This index has been also recommended to evaluate the survival of patients with severe liver disease, and been included in some prognos-tic models, such as CTP score and MELD score.

Variable INR < 1.20 (n = 36)

INR ≥ 1.20 (n = 27)

P value INR < 1.50 (n = 52)

INR ≥ 1.50 (n = 11)

P value

Duration of diabetes, yr < 5 15 (41.70) 13 (48.10) 0.608 23 (44.20) 5 (45.50) 1.000 ≥ 5 21 (58.30) 14 (51.90) - 29 (55.80) 6 (54.50) - Age at diabetes diagnosis, yr < 50 11 (30.60) 12 (44.40) 0.257 15 (28.80) 8 (72.70) 0.016 ≥ 50 25 (69.40) 15 (55.60) - 37 (71.20) 3 (27.30) - Diabetes treatment Oral treatment Non-users 21 (58.30) 19 (70.40) 0.326 31 (59.60) 9 (81.80) 0.296 Users 15 (41.70) 8 (29.60) - 21 (40.40) 2 (18.20) - Insulin treatment Non-users 27 (75.00) 25 (92.60) 0.138 43 (82.70) 9 (81.80) 1.000 Users 9 (25.00) 2 (7.40) - 9 (17.30) 2 (18.20) - Diet only Non-users 16 (44.40) 17 (63.00) 0.145 26 (50.00) 7 (63.60) 0.411 Users 20 (55.60) 10 (37.00) - 26 (50.00) 4 (36.40) - Type of oral treatment Biguanide Non-users 32 (88.90) 22 (81.50) 0.640 43 (82.70) 11 (100) 0.310 Users 4 (11.10) 5 (18.50) - 9 (17.30) 0 (0) - Sulfonylureas Non-users 29 (80.60) 23 (85.20) 0.886 42 (80.80) 10 (90.9) 0.713 Users 7(19.40) 4 (14.80) - 10 (19.20) 1 (9.1) - α-glucosidase inhibitor Non-users 29 (80.60) 25 (92.60) 0.323 44 (84.60) 10 (90.9) 0.946 Users 7 (19.40) 2 (7.40) - 8 (15.40) 1 (9.1) -

Table 5 Association between diabetes duration/treatment and International normalized ratio level n (%)

INR: International normalized ratio.



Previous studies have reported that DM has a role in the activation of coagulation factors and subsequently increases thrombotic tendency and cardiovascular risk[28-30]. However, no information was available in HCC patients. Our study included 375 HCC patients based on the diagnostic, inclusion and exclusion criteria, and the unconditional multivariable logistic regression analysis used to determine the association. Our results indicated that coagulation disorders could also be found in HCC with DM, but the effect may be different from previously published literature.

Patients with DM have higher levels of circulating tissue factor (TF), which initiate the extrinsic pathway of the coagulation cascade by binding and activating fac-tor Ⅶ[28,29]. The levels of TF are directly modulated by glucose and insulin, as well as by nuclear factor kappa B which is activated by the formation of advanced gly-cation end products and reactive oxygen species[34,35]. Levels of factor Ⅶ are influenced by triglyceride levels, which often increase in poorly controlled diabetic pa-tients. Plasma levels of other coagulation factors, such as fibrinogen and prothrombin, are also elevated in diabetic patients. In addition to the changes in levels of coagula-tion factors, DM induces quantitative modifications of those factors, which also increases thrombosis risk.

However, our study showed that the INR level was increased in HCC patients with DM. The exact mecha-nism remains as yet unclearly understood and it was deduced as follows. The first was due to the liver itself. Diabetes plays its role in increasing the levels of coagula-tion factors in the circulation mainly through increased synthesis of the liver. When liver function is impaired, the synthesis of coagulation factors would also be im-paired. In addition, our study found that a similar result was obtained when the population was restricted to those HCC patients with liver cirrhosis, whereas no significant difference was observed for those patients without cir-rhosis. Increased INR levels in HCC patients with DM may be partly associated with liver cirrhosis.

Secondly, activation of inflammatory and coagulation pathways is important in the pathogenesis of coronary artery disease that worsens the prognosis of HCC pa-tients[36]. There is ample evidence that extensive cross-talk between these two systems exists, whereby inflam-mation not only leads to activation of coagulation, but coagulation also markedly affects inflammatory activity. The main interfaces linking coagulation and inflamma-tion are beyond the tissue factor pathway and thrombin, the protein C system and the fibrinolytic (or plasmino-gen-plasmin) system. Proinflammatory cytokines (mainly IL-6) and chemokines can affect all these coagulation mechanisms, and vice versa, activated coagulation prote-ases and physiological anticoagulants or components of the plasminogen-plasmin system can modulate inflam-mation by specific cell receptors. The intricate relation-ship between inflammation and coagulation is extremely clear in nonalcoholic fatty liver disease (NAFLD)[36].

Thirdly, angiogenesis is required for tumor growth

and metastasis. Activation of the coagulation pathway also enhances tumor growth and metastasis[37]. Procoagu-lants involved in angiogenesis include TF and thrombin. Vascular endothelial growth factor, the most potent pro-angiogenic factor, is an indirect procoagulant; it is capable of inducing vascular hyperpermeability and of increasing TF expression on endothelial cells. Vascular hyperperme-ability results in leakage of plasma proteins, including prothrombin and fibrinogen, into the extracellular matrix. Prothrombin converted into thrombin by the activated coagulation pathway may result in platelet activation and the production of fibrin from fibrinogen[37].

In our study, we found that, compared with patients without DM, HCC patients with diabetes were older. The reason remains as yet unclearly understood. It was deduced to be possibly related to the duration, treatment and monitoring of diabetes. Some limitations should also be acknowledged. The first limitation is the case-control design, which could not provide definite evidence to clarify the causal association. To clarify the causal rela-tionship, well-designed prospective studies are required. The second is that most of the HCC and cirrhotic pa-tients were diagnosed clinically rather than by biopsy, and the diagnosis of most diabetics was dependent on their self-reported history or fasting serum glucose, not on an oral glucose tolerance test. Thus the role of DM could be underestimated. However, we followed strictly the diagnostic criteria recommended by the authorized institutes and used them widely in clinical practice. We believe that our results are more likely applicable in clini-cal practice.

The third limitation was due to the nature of our case-control study, which meant that some data could not be obtained and some possible factors could not be adjusted. For example, NAFLD and NASH have been regarded as risk factors for HCC, but we could not as-sess these changes. However, biopsy was unnecessary for these confirmed HCC patients and was not recom-mended. In addition, activated partial thromboplastin time is another commonly used screening test for evalu-ating coagulation disorders. Unfortunately, data were not available for some patients and the analysis could not be performed. However, in clinical practice, this parameter is not frequently used in liver disease, compared with PT and the INR.

Our present study also raises several questions for future research. Firstly, how DM affects the coagulation system in HCC patients; secondly, whether increased INR in diabetic patients has a clinical meaning or can affect the prognosis of HCC patients; and last but not least, whether antidiabetic treatment can improve coagulation function in HCC. To answer these questions, further pre-clinical and clinical studies are needed.

In conclusion, our study showed that INR level was increased in HCC patients with DM and these patients should be monitored for coagulation function in clinical practice. More studies are required for a better under-standing of this change.



COMMENTSBackgroundDiabetes mellitus (DM) is a potential risk factor for hepatocellular carcinoma (HCC). HCC patients with impaired liver function have complex coagulation disorders, especially in those with liver cirrhosis. However, no information was available for the association between DM and coagulation disorders in HCC patients.Research frontiersInternational normalized ratio (INR) has been included in some prognostic models of HCC and liver cirrhosis, such as Child-Turcotte-Pugh score and the model for end stage liver disease. This study was designed to determine the association of DM and INR in HCC patients, considering that no information was available for the effect of DM on INR in HCC.Innovations and breakthroughsThe authors found that the INR level was increased in HCC patients with DM which is independent of liver cirrhosis. This is the first time that information was available for the effect of DM on the INR level in HCC.ApplicationsHCC patients with DM should be monitored for coagulation function in clinical practice.Peer reviewThe effect of DM in INR levels in HCC is quite interesting with clinical therapeu-tic implications. Nice paper to be published after minor revision.

REFERENCES1 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman

D. Global cancer statistics. CA Cancer J Clin 2011; 61: 69-90 [PMID: 21296855 DOI: 10.3322/caac.20107]

2 Bosch FX, Ribes J, Díaz M, Cléries R. Primary liver cancer: worldwide incidence and trends. Gastroenterology 2004; 127: S5-S16 [PMID: 15508102 DOI: 10.1053/j.gastro.2004.09.011]

3 Zhang H, Gao C, Fang L, Zhao HC, Yao SK. Metformin and reduced risk of hepatocellular carcinoma in diabetic pa-tients: a meta-analysis. Scand J Gastroenterol 2013; 48: 78-87 [PMID: 23137049 DOI: 10.3109/00365521.2012.719926]

4 Gao C, Zhao HC, Li JT, Yao SK. Diabetes mellitus and hepa-tocellular carcinoma: comparison of Chinese patients with and without HBV-related cirrhosis. World J Gastroenterol 2010; 16: 4467-4475 [PMID: 20845516 DOI: 10.3748/wjg.v16.i35.4467]

5 Gao C, Yao SK. Diabetes mellitus: a “true” independent risk factor for hepatocellular carcinoma? Hepatobiliary Pancreat Dis Int 2009; 8: 465-473 [PMID: 19822488]

6 Altekruse SF, McGlynn KA, Reichman ME. Hepatocellu-lar carcinoma incidence, mortality, and survival trends in the United States from 1975 to 2005. J Clin Oncol 2009; 27: 1485-1491 [PMID: 19224838 DOI: 10.1200/JCO.2008.20.7753]

7 White DL, Kanwal F, El-Serag HB. Association between nonalcoholic fatty liver disease and risk for hepatocellular cancer, based on systematic review. Clin Gastroenterol Hepa-tol 2012; 10: 1342-1359.e2 [PMID: 23041539 DOI: 10.1016/j.cgh.2012.10.001]

8 Bühler S, Bartenschlager R. Promotion of hepatocellular carcinoma by hepatitis C virus. Dig Dis 2012; 30: 445-452 [PMID: 23108300 DOI: 10.1159/000341688]

9 Schuppan D, Afdhal NH. Liver cirrhosis. Lancet 2008; 371: 838-851 [PMID: 18328931 DOI: 10.1016/S0140-6736(08)60383-9]

10 El-Serag HB, Tran T, Everhart JE. Diabetes increases the risk of chronic liver disease and hepatocellular carcinoma. Gastroenterology 2004; 126: 460-468 [PMID: 14762783 DOI: 10.1053/j.gastro.2003.10.065]

11 Lai MS, Hsieh MS, Chiu YH, Chen TH. Type 2 diabetes and hepatocellular carcinoma: A cohort study in high preva-lence area of hepatitis virus infection. Hepatology 2006; 43: 1295-1302 [PMID: 16729295 DOI: 10.1002/hep.21208]

12 Chen HF, Chen P, Li CY. Risk of malignant neoplasms of

liver and biliary tract in diabetic patients with different age and sex stratifications. Hepatology 2010; 52: 155-163 [PMID: 20578004 DOI: 10.1002/hep.23641]

13 Davila JA, Morgan RO, Shaib Y, McGlynn KA, El-Serag HB. Diabetes increases the risk of hepatocellular carcinoma in the United States: a population based case control study. Gut 2005; 54: 533-539 [PMID: 15753540 DOI: 10.1136/gut.2004.052167]

14 El-Serag HB, Hampel H, Javadi F. The association between diabetes and hepatocellular carcinoma: a systematic review of epidemiologic evidence. Clin Gastroenterol Hepatol 2006; 4: 369-380 [PMID: 16527702 DOI: 10.1016/j.cgh.2005.12.007]

15 Noto H, Osame K, Sasazuki T, Noda M. Substantially in-creased risk of cancer in patients with diabetes mellitus: a systematic review and meta-analysis of epidemiologic evidence in Japan. J Diabetes Complications 2010; 24: 345-353 [PMID: 20656522 DOI: 10.1016/j.jdiacomp.2010.06.004]

16 Wang P, Kang D, Cao W, Wang Y, Liu Z. Diabetes mellitus and risk of hepatocellular carcinoma: a systematic review and meta-analysis. Diabetes Metab Res Rev 2012; 28: 109-122 [PMID: 21898753 DOI: 10.1002/dmrr.1291]

17 Wang C, Wang X, Gong G, Ben Q, Qiu W, Chen Y, Li G, Wang L. Increased risk of hepatocellular carcinoma in pa-tients with diabetes mellitus: a systematic review and meta-analysis of cohort studies. Int J Cancer 2012; 130: 1639-1648 [PMID: 21544812 DOI: 10.1002/ijc.26165]

18 Zhou XH, Qiao Q, Zethelius B, Pyörälä K, Söderberg S, Pajak A, Stehouwer CD, Heine RJ, Jousilahti P, Ruotolo G, Nilsson PM, Calori G, Tuomilehto J. Diabetes, prediabetes and cancer mortality. Diabetologia 2010; 53: 1867-1876 [PMID: 20490448 DOI: 10.1007/s00125-010-1796-7]

19 Ikeda Y, Shimada M, Hasegawa H, Gion T, Kajiyama K, Shi-rabe K, Yanaga K, Takenaka K, Sugimachi K. Prognosis of hepatocellular carcinoma with diabetes mellitus after hepatic resection. Hepatology 1998; 27: 1567-1571 [PMID: 9620328]

20 Shau WY, Shao YY, Yeh YC, Lin ZZ, Kuo R, Hsu CH, Hsu C, Cheng AL, Lai MS. Diabetes mellitus is associated with increased mortality in patients receiving curative therapy for hepatocellular carcinoma. Oncologist 2012; 17: 856-862 [PMID: 22622151 DOI: 10.1634/theoncologist.2012-0065]

21 Yang WS, Va P, Bray F, Gao S, Gao J, Li HL, Xiang YB. The role of pre-existing diabetes mellitus on hepatocellular carcinoma occurrence and prognosis: a meta-analysis of prospective cohort studies. PLoS One 2011; 6: e27326 [PMID: 22205924 DOI: 10.1371/journal.pone.0027326]

22 Ustuner Z, Akay OM, Keskin M, Kuş E, Bal C, Gulbas Z. Evaluating coagulation disorders in the use of bevacizumab for metastatic colorectal cancer by thrombelastography. Med Oncol 2012; 29: 3125-3128 [PMID: 22696065 DOI: 10.1007/s12032-012-0274-0]

23 Zucker S, Cao J. New wrinkle between cancer and blood coagulation: metastasis and cleavage of von Willebrand fac-tor by ADAM28. J Natl Cancer Inst 2012; 104: 887-888 [PMID: 22636799]

24 Kocatürk B, Versteeg HH. Tissue factor isoforms in cancer and coagulation: may the best isoform win. Thromb Res 2012; 129 (Suppl 1): S69-S75 [PMID: 22682138 DOI: 10.1016/S0049-3848(12)70020-8]

25 Wang JG, Geddings JE, Aleman MM, Cardenas JC, Chant-rathammachart P, Williams JC, Kirchhofer D, Bogdanov VY, Bach RR, Rak J, Church FC, Wolberg AS, Pawlinski R, Key NS, Yeh JJ, Mackman N. Tumor-derived tissue factor activates coagulation and enhances thrombosis in a mouse xenograft model of human pancreatic cancer. Blood 2012; 119: 5543-5552 [PMID: 22547577 DOI: 10.1182/blood-2012-01-402156]

26 Miyamoto Y, Takikawa Y, De Lin S, Sato S, Suzuki K. Apop-totic hepatocellular carcinoma HepG2 cells accelerate blood coagulation. Hepatol Res 2004; 29: 167-172 [PMID: 15203081 DOI: 10.1016/j.hepres.2004.03.011]

27 Alkim H, Ayaz S, Sasmaz N, Oguz P, Sahin B. Hemostatic

COMMENTS



abnormalities in cirrhosis and tumor-related portal vein thrombosis. Clin Appl Thromb Hemost 2012; 18: 409-415 [PMID: 22166587 DOI: 10.1177/1076029611427900]

28 Madan R, Gupt B, Saluja S, Kansra UC, Tripathi BK, Guliani BP. Coagulation profile in diabetes and its association with diabetic microvascular complications. J Assoc Physicians In-dia 2010; 58: 481-484 [PMID: 21189694]

29 Banga JD. Coagulation and fibrinolysis in diabetes. Semin Vasc Med 2002; 2: 75-86 [PMID: 16222598 DOI: 10.1055/s-2002-23098]

30 Dayer MR, Mard-Soltani M, Dayer MS, Alavi SM. Inter-pretation of correlations between coagulation factors FV, FVIII and vWF in normal and type 2 diabetes mellitus pa-tients. Pak J Biol Sci 2011; 14: 552-557 [PMID: 22032085 DOI: 10.3923/pjbs.2011.552.557]

31 Saad WE, Darwish WM, Davies MG, Kumer S, Anderson C, Waldman DL, Schmitt T, Matsumoto AH, Angle JF. Tran-sjugular intrahepatic portosystemic shunts in liver trans-plant recipients: technical analysis and clinical outcome. AJR Am J Roentgenol 2013; 200: 210-218 [PMID: 23255764 DOI: 10.2214/AJR.11.7653]

32 Huo TI, Wu JC, Lui WY, Huang YH, Lee PC, Chiang JH, Chang FY, Lee SD. Differential mechanism and prognostic impact of diabetes mellitus on patients with hepatocellular

carcinoma undergoing surgical and nonsurgical treatment. Am J Gastroenterol 2004; 99: 1479-1487 [PMID: 15307864 DOI: 10.1111/j.1572-0241.2004.30024.x]

33 Diagnosis and classification of diabetes mellitus. Diabetes Care 2012; 35 (Suppl 1): S64-S71 [PMID: 22187472 DOI: 10.2337/dc12-s064]

34 Boden G, Vaidyula VR, Homko C, Cheung P, Rao AK. Cir-culating tissue factor procoagulant activity and thrombin generation in patients with type 2 diabetes: effects of insu-lin and glucose. J Clin Endocrinol Metab 2007; 92: 4352-4358 [PMID: 17785358 DOI: 10.1210/jc.2007-0933]

35 Breitenstein A, Tanner FC, Lüscher TF. Tissue factor and cardiovascular disease: quo vadis? Circ J 2010; 74: 3-12 [PMID: 19996531 DOI: 10.1253/circj.CJ-09-0818]

36 Tarantino G, Savastano S, Colao A. Hepatic steatosis, low-grade chronic inflammation and hormone/growth fac-tor/adipokine imbalance. World J Gastroenterol 2010; 16: 4773-4783 [PMID: 20939105 DOI: 10.3748/wjg.v16.i38.4773]

37 Tarantino G, Conca P, Pasanisi F, Ariello M, Mastrolia M, Arena A, Tarantino M, Scopacasa F, Vecchione R. Could inflammatory markers help diagnose nonalcoholic steato-hepatitis? Eur J Gastroenterol Hepatol 2009; 21: 504-511 [PMID: 19318968 DOI: 10.1097/MEG.0b013e3283229b40]

P- Reviewers Koutsilieris M, Izumi N S- Editor Zhai HH L- Editor O’Neill M E- Editor Li JY


Twist2 is a valuable prognostic biomarker for colorectal cancer

Hao Yu, Guang-Zhi Jin, Kai Liu, Hui Dong, Hua Yu, Ji-Cheng Duan, Zhe Li, Wei Dong, Wen-Ming Cong, Jia-He Yang

Hao Yu, Kai Liu, Ji-Cheng Duan, Zhe Li, Jia-He Yang, De-partment of Laparoscopy, Eastern Hepatobiliary Surgery Hospi-tal, the Second Military Medical University, Shanghai 200438, ChinaGuang-Zhi Jin, Hui Dong, Hua Yu, Wei Dong, Wen-Ming Cong, Department of Pathology, Eastern Hepatobiliary Surgery Hospital, the Second Military Medical University, Shanghai 200438, ChinaAuthor contributions: Yu H, Jin GZ and Liu K contributed equally to this work: they performed the major experiments, ana-lyzed the data and wrote the manuscript; Dong H and Cong WM evaluated the immunohistochemical staining; Yu H, Duan JC, Li Z and Dong W acquired the data; Cong WM and Yang JH de-signed the study together and critically reviewed the manuscript.Supported by National Natural Science Foundation of China, grant, No. 81201937 and 81070359Correspondence to: Jia-He Yang, MD, PhD, Department of Laparoscopy, Eastern Hepatobiliary Surgery Hospital, the Second Military Medical University, No. 225, Changhai Road, Shanghai 200438, China. [email protected]: +86-21-81875262 Fax: +86-21-81875262Received: December 14, 2012 Revised: January 15, 2013Accepted: February 2, 2013Published online: April 21, 2013

AbstractAIM: To investigate the significance of Twist2 for colorec-tal cancer (CRC).

METHODS: In this study, 93 CRC patients were includ-ed who received curative surgery in Eastern Hepatobili-ary Surgery Hospital from January 1999 to December 2010. Records of patients’ clinicopathological character-istics and follow up data were reviewed. Formalin-fixed, paraffin-embedded tissue blocks were used to observe the protein expression of Twist2 and E-cadherin by im-munohistochemistry. Two independent pathologists who were blinded to the clinical information performed semi-quantitative scoring of immunostaining. A total score of 3-6 (sum of extent + intensity) was considered as Twist2-positive expression. The expression of E-cadherin

was divided into two levels (preserved and reduced). An exploratory statistical analysis was conducted to de-termine the association between Twist2 expression and clinicopathological parameters, as well as E-cadherin expression. Furthermore, the variables associated with prognosis were analyzed by Cox’s proportional hazards model. Kaplan-Meier analysis was used to plot survival curves according to different expression levels of Twist2.

RESULTS: Twist2-positive expression was observed in 66 (71.0%) samples and mainly located in the cyto-plasm. Forty-three (46.2%) samples showed reduced expression of E-cadherin. There were no significant correlations between Twist2 expression and any of the clinicopathological parameters. However, Twist2-positive expression was significantly associated with reduced expression of E-cadherin (P = 0.040). Multivariate analysis revealed that bad M-stage [hazard ratio (HR) = 7.694, 95%CI: 2.927-20.224, P < 0.001] and Twist2-positive (HR = 5.744, 95%CI: 1.347-24.298, P = 0.018) were the independent risk factors for poor overall sur-vival (OS), while Twist2-positive (HR = 3.264, 95%CI: 1.455-7.375, P = 0.004), bad N-stage (HR = 2.149, 95%CI: 1.226-3.767, P = 0.008) and bad M-stage (HR = 10.907, 95%CI: 4.937-24.096, P < 0.001) were independently associated with poor disease-free sur-vival (DFS). Survival curves showed a definite trend for Twist2-negative patients to have longer OS and DFS than Twist2-negative patients, not only overall, but also for patients in different stages, especially for DFS of patients in stage Ⅲ (P = 0.033) and Ⅳ (P = 0.026).

CONCLUSION: Our data suggests, for the first time, that Twist2 is a valuable prognostic biomarker for CRC, particularly for patients in stage Ⅲ and Ⅳ.


Key words: Colorectal cancer; Prognostic biomarker; Twist2; Epithelial-mesenchymal transition; Immunohis-tochemstry

BRIEF ARTICLE





Yu H, Jin GZ, Liu K, Dong H, Yu H, Duan JC, Li Z, Dong W, Cong WM, Yang JH. Twist2 is a valuable prognostic bio-marker for colorectal cancer. World J Gastroenterol 2013; 19(15): 2404-2411 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2404.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2404

INTRODUCTIONColorectal cancer (CRC) is one of the most common malignant tumors and continues to be one of the leading causes of cancer-related death worldwide[1]. Traditionally, the prognosis of patients with CRC is mainly evaluated by the tumor (T) node (N) metastasis (M) stage[2]. How-ever, patients in the same stage frequently had different outcomes, despite similar postoperative treatments. There must be some unknown mechanisms affecting patients’ outcome beyond the clinical stage. Although many ef-forts have been made to find biomarkers to predict CRC, truly effective clinical biomarkers are rare. Therefore, new and more effective biomarkers are still needed.

Recently, Twist2 (Dermo1), a highly homologous pro-tein of Twist1[3,4], has attracted our attention. Koh et al[5] reported that Twist2 could increase resistance to galectin-1-mediated-apoptosis, which facilitated the progression of some T-cells into tumors. Gasparotto et al[6] found over-expression of Twist2 correlated with the poor prognosis of head and neck squamous cell carcinomas. Zhou et al[7] suggested that Twist2 is associated with the invasion and metastasis of salivary adenoid cystic carcinoma. Li et al[8] found that Twist2 is involved in the cervical malignant conversion and tumor metastasis. Twist2 is also consid-ered an inducer of epithelial-mesenchymal transition (EMT)[9-11], a well-known progression involved in embryo-genesis[12,13], tumor invasion and metastasis[14-18], and drug resistance[19]. Evidently Twist2 is a significant biomarker for human tumors. However, until now, the relationship between Twist2 and CRC has remained unknown.

Therefore, we undertook the present investigation to determine the significance of Twist2 for CRC and to verify its function as an EMT inducer.

MATERIALS AND METHODSPatients and tumor samplesNinety-three CRC patients were included who underwent curative surgery in Eastern Hepatobiliary Surgery Hos-pital, the Second Military Medical University of China, from January 1999 to December 2010. The patients met the following criteria: no anti-cancer treatments were given before surgery; all the visible tumor nodules were resected (including the distant metastatic nodules); pa-tients who died during surgery or from serious surgical complications were excluded; the resected nodules were identified as primary CRC or metastasis of CRC and the surgical margin was free of tumor cells by pathological examination; patients with lymphatic metastasis or/and

distant metastasis had received postoperative adjuvant chemotherapy, patients who died from non-CRC diseases or accidents were excluded; and the clinicopathologi-cal and follow-up data were available. All the formalin-fixed and paraffin-embedded primary CRC samples were obtained from the Department of Pathology of Eastern Hepatobiliary Surgery Hospital. All patients in this study gave written informed consent.

Follow-up and postoperative treatmentPatients were followed up until death or until June 15, 2011. All patients were monitored by physical examina-tion, routine blood tests [including serum carcinoem-bryonic antigen (CEA) concentration], chest X-ray and abdominal ultrasonography every 2 mo in the first year after surgery, and every 3-6 mo thereafter. A computed tomography scan (CT) or magnetic resonance imaging was performed every 6 mo or immediately when a recur-rence/metastasis was suspected. If needed, a whole-body fludeoxyglucose positron emission tomography/CT was performed. The follow-up data were recorded during the postoperative examination in our hospital, while patients who were examined in another hospital were followed up by telephone or letter. Recurrence was determined by at least two imaging examination results. Once recurrent tu-mors were confirmed, further treatment was implement-ed, such as a second surgery and palliative chemotherapy. Disease-free survival (DFS) was defined as the period from the tumor resection until the tumor recurrence or the last observation. The overall survival (OS) was the interval between the surgery and death or the last follow-up examination.

ImmunohistochemistryImmunohistochemstry was carried out as described pre-viously[20]. Representative 4-μm serial sections were pre-pared from 10% formalin-fixed, paraffin-embedded tissue blocks. To increase the immunoreactivity, microwave antigen retrieval was performed in citrate buffer (pH 6.0) for 5 min, then cooled the sections at room temperature for at least 30 min. Subsequently 3% hydrogen peroxide was used for 10 min to block endogenous peroxidase activity. After nonspecific binding sites were blocked for 30 min with goat serum, a monoclonal antibody against Twist2 (1:300, H00117581-M01, Abnova) and polyclonal antibodies against E-cadherin (1:100, BS1098, Bioworld Technology) were used to incubate the sections in a hu-mid chamber at 4 ℃ overnight. Next, an EnVision Detec-tion kit (GK500705, Gene Tech, China) was used to vi-sualize tissue antigens. Sections were counterstained with hematoxylin for 5 min. Negative control sections were incubated with phosphate buffered solution instead of the primary antibody.

Evaluation of immunohistochemistryTwo independent pathologists (Dong H and Cong WM), who were blinded to clinical information, assessed the expression of Twist2 and E-cadherin semiquantitatively.


Yu H et al . Twist2 in colorectal cancer

Twist2 staining was observed only in the cytoplasm of CRC tumor cells (described in the results); therefore, the nucleolus staining was not evaluated. Cytoplasmic staining of Twist2 was scored according to its extent and inten-sity (extent + intensity), similar to the methods described previously[21-24]. The extent of staining was graded as fol-lows: 0 for < 15% positive cells, 1 for 15%-30%, 2 for 30%-60% and 3 for more than 60% positive cells. The in-tensity of staining was scored on the following scale: 0, no staining; 1, weak staining; 2, moderate staining; 3, strong staining. The total score was 0 to 6 when summed (extent + intensity) together. Subsequently, a total score of 0-2 was considered to be a negative/low expression, while a score of 3-6 was considered as positive/high expression. For E-cadherin, the scoring was determined as previ-ous studies[25,26]. Preserved expression of E-cadherin was defined where tumor cells were stained as strongly and homogeneously as normal epithelial cells. Heterogeneous staining, weaker staining or completely negative staining of E-cadherin was considered as reduced expression.

Statistical analysisPearson’s χ 2 test and Fisher’s exact test (wherever was applicable) were performed to determine the relation-ship between Twist2 expression and clinicopathological parameters and E-cadherin expression. The prognostic

factors for OS and DFS were examined by both univari-ate and multivariate analyses (Cox’s proportional hazards model). Survival curves were plotted by Kaplan-Meier analysis and by a log rank test. A P value < 0.05 (two-sided) was considered statistically significant. All statisti-cal analysis were performed using SPSS version 19 (SPSS Inc., Chicago, IL, United States).

RESULTSPatients’ clinicopathological characteristics are shown in Table 1. The mean age was 58.9 years, ranging from 16 to 81. Forty-one patients had distant metastasis (M1); all the metastatic nodes were in the liver. The median follow-up period was 32 mo (range 6-144 mo). At the last follow-up, 55 patients had tumor recurrence, including one in rectal anastomotic, two with pelvic metastasis, three in the lung, one in both the liver and the lung and the other 48 only in the liver. Thirty patients had died. The OS and DFS rates were 82.2% and 61.0% at 1 year, 71.3% and 42.4% at 3 years, and 66.2% and 30.3% at 5 years, respectively.

Twist2 and E-cadherin expression in CRCAlthough some previous investigations found Twist2 was expressed in both the cytoplasm and the nucleus in sev-eral tumors[7,8,11,27], we found Twist2 was mainly expressed in the cytoplasm in CRC, not in the nucleus (Figure 1). A similar expression pattern of Twist2 was found in hepato-cellular carcinoma (HCC)[28]. By semiquantitative analysis, 66 (71.0%) of the 93 primary CRC tissue samples were positive for Twist2 expression, while the other 27 (39.0%) were negative. Twist2 expression was generally low in normal colon mucosa compared with the cancer tissues. For E-cadherin, as described previously[29,30], normal epi-thelial cells were strongly and homogeneously stained in the membrane, while tumor cells were stained mainly in the membrane and occasionally in the cytoplasm (Figure 2). E-cadherin was considered as reduced in 43 (46.2%) patients. The other 50 (53.8%) patients were preserved.

Relationship between Twist2 expression and clinicopathological parameters and E-cadherin expressionAs shown in Table 1, we did not find that Twist2 expres-sion correlated with any of the clinicopathological pa-rameters (gender, age, T-stage, N-stage, M-stage, tumor differentiation, vascular invasion, Tumor location and serum CEA level, all P > 0.05). When the relationship between Twist2 and E-cadherin expression was analyzed, we found a significant correlation: Twist2-positive pa-tients showed a higher percentage of reduced E-cadherin than Twist2-negative ones (53.0% vs 29.6%, P = 0.040, Table 2).

Prognostic analysis For OS on univariate analysis, bad N-stage (lymph node metastasis), bad M-stage (distant metastasis), vascular inva-sion, serum CEA level (> 5 ng/mL) and Twist2-positive


Characteristics Total Twist2 expression P value

Negative PositiveGender Female 52 (55.9) 18 (66.7) 34 (51.5) 0.1821

Male 41 (44.1) 9 (33.3) 32 (48.5)Age < 59 41 (44.1) 13 (48.1) 28 (42.4) 0.6141

≥ 59 52 (55.9) 14 (51.9) 38 (57.6)T-stage T1-2 17 (18.3) 5 (18.5) 12 (18.2) 1.0002

T3-4 76 (81.7) 22 (81.5) 54 (81.8)N-stage N0 52 (55.9) 17 (63.0) 35 (53.0) 0.3811

N1-2 41 (44.1) 10 (37.0) 31 (47.0)M-stage M0 52 (55.9) 17 (63.0) 35 (53.0) 0.3811

M1 41 (44.1) 10 (37.0) 31 (47.0)Tumor differentiationModerate/good 83 (89.2) 26 (96.3) 57 (86.4) 0.2712

Poor 10 (10.8) 1 (3.7) 9 (13.6)Vascular invasion No 56 (60.2) 17 (63.0) 39 (59.1) 0.7291

Yes 37 (39.8) 10 (37.0) 27 (40.9)Tumor location Rectum 19 (20.4) 4 (14.8) 15 (22.7) 0.3901

Colon 74 (79.6) 23 (85.2) 51 (77.3)CEA level (ng/mL) ≤ 5 48 (51.6) 12 (4.4) 36 (54.5) 0.3761

> 5 45 (48.4) 15 (55.6) 30 (45.5)

Table 1 Relationship between Twist2 expression and clinico-pathological characteristics n (%)

1Pearson’s χ 2 test; 2Fisher’s exact test. T-, N-, M-stage are tumor, node, and metastasis stage (6th edition), performed according to the American Joint Committee on Cancer; CEA: Serum carcinoembryonic antigen.



level (> 5 ng/mL) and Twist2-positive were risk factors for poor DFS (all P < 0.05). After adjustment, multivari-ate analysis revealed bad N-stage (HR = 2.149, 95%CI: 1.226-3.767, P = 0.008), bad M-stage (HR = 10.907, 95%CI: 4.937-24.096, P < 0.001) and Twist2-positive (HR = 3.264, 95%CI: 1.455-7.375, P = 0.004) were indepen-dent risk factors for poor DFS, while vascular invasion and serum CEA level were not.

Survival curves plotted according to different expres-sion levels of Twist2 are shown in Figure 3. Significantly, Twist2-negative patients had a higher 5-year OS (86.2% vs 59.6%, P = 0.015, Figure 3A) and 5-year DFS (55.4% vs 24.8%, P = 0.012, Figure 3B) than the Twist2-positive patients. Interestingly, further analysis of the value of Twist2 for CRC patients in different stages showed that for patients in stage Ⅰ-Ⅱ (n = 34), there were no differ-ences in OS or DFS (both P > 0.05, Figure 3C and D). For patients in stage Ⅲ (n = 18) and Ⅳ (n = 41), Kaplan-

were significantly associated with poor survival (all P < 0.05, Table 3). When adjusted by multivariate analysis by Cox’s proportional hazard model, bad M-stage [hazard ratio (HR) = 7.694, 95%CI: 2.927-20.224, P < 0.001] and Twist2-positive (HR = 5.744, 95%CI: 1.347-24.298, P = 0.018) were considered to independent risk factors for poor OS.

We also analyzed the risk factors for DFS (Table 4). The result of univariate analysis was similar to OS: bad N-stage, bad M-stage, vascular invasion, serum CEA

A B C

D E

Figure 1 Immunohistochemical images of Twist2. A: Negative staining in the normal mucosa; B: Negative; C: Weak; D: Moderate; E: Strong cytoplasmic staining in colorectal cancer (200× magnification).

Figure 2 Immunohistochemical images of E-cadherin. A: Strong and homogeneous staining in normal mucosa; B: Preserved expression in colorectal cancer (CRC); C: Reduced expression in CRC (200× magnification).

A B C

Twist2 expression E-cadherin expression P value

Preserved (n = 50) Reduced (n = 43)

Positive (n = 66) 31 (47.0) 35 (53.0) 0.040 Negative (n = 27) 19 (70.4) 8 (29.6)

Table 2 Relationship between Twist2 and E-cadherin expres-sion n (%)



Meier curves showed a clear trend that Twist2-negative patients had a more favorable outcome. Although the dif-ferences in OS were not statistically significant (both P > 0.05, Figure 3E and G), we found significant differences in DFS for both stage Ⅲ and Ⅳ (P = 0.033 and P = 0.026 respectively, Figure 3F and H).

DISCUSSIONThis study, which investigated the significance of Twist2 protein expression in CRC, identified some variables that affected the patients’ prognosis. Bad N-stage, bad M-stage (liver metastasis in our study), vascular invasion, serum CEA level (> 5 ng/mL) and Twist2-positive were valu-able predictors for both OS and DFS by univariate analy-sis. After adjustment by multivariate analysis, bad M-stage and Twist2-positive remained as independent risk factors for poor OS, while bad N-stage, bad M-stage and Twist2-positive were the independent risk factors for poor DFS. Twist2-positive was identified to be an independent risk factor for both poor OS and DFS. Kaplan-Meier analysis showed that patients with Twist2-negative expression had significantly longer OS and DFS than the positive pa-

tients. When considering the prognostic value of Twist2 for CRC patients in different stages, we observed a trend for Twist2-negative patients to have a more favorable prognosis compared with Twist2-positive patients, espe-cially for the patients in stage Ⅲ and Ⅳ. Although the P values for OS in stage Ⅲ and Ⅳ didn’t reach significance, the P values for DFS in stage Ⅲ and Ⅳ were statistically significant.

To the best of our knowledge, our study is the first report on the prognostic value of Twist2, based on the protein level, for human CRC. Currently, there is a lack of clinical biomarkers for effectively and routinely predicting CRC, especially for the patients in stage Ⅳ. Therefore, the findings of this study are very useful, as we found that Twist2 could be an effective biomarker for predicting the prognosis of CRC, even for patients in stage Ⅳ. Furthermore, the expression of Twist2 protein is easily detected by immunohistochemistry. For these reasons, Twist2 is potentially an extremely useful clinical biomarker for predicting the prognosis of CRC patients.

Reduced expression of E-cadherin, which is a hall-mark of EMT[14] and plays a significant role in multi-stage carcinogenesis[31], generally represents a common

Prognostic factors Univariate analysis Multivariate analysis

HR 95%CI P value HR 95%CI P value

Gender Female 1 Male 1.011 0.490-2.085 0.977 NA NA NA Age < 59 1 ≥ 59 1.579 0.750-3.326 0.229 NA NA NA T-stage T1-2 1 T3-4 1.118 0.493-2.534 0.789 NA NA NA N-stage N0 1 N1-2 2.172 1.056-4.468 0.035 NS NS NS M-stage M0 1 1 M1 6.324 2.659-15.041 < 0.001 7.694 2.927-20.224 < 0.001 Tumor differentiation Moderate/good 1 Poor 1.290 0.491-3.384 0.229 NA NA NA Vascular invasion No 1 Yes 3.398 1.601-7.211 0.001 NS NS NS Tumor location Rectum 1 Colon 1.188 0.517-2.729 0.685 NA NA NA CEA level (ng/mL) ≤ 5 1 > 5 3.173 1.475-6.827 0.003 NS NS NS Twist2 expression Negative 1 1 Positive 4.964 1.181-20.863 0.029 5.744 1.347-24.298 0.018

Table 3 Univariate and multivariate analysis of the prognostic factors for overall survival

Multivariate analysis included adjustment for N-stage, M-stage, vascular invasion, serum carcinoembryonic antigen level and Twist2 expression. T: Tumor; N: Node; M: Metastasis; HR: Hazard ratio; NA: Not available; NS: Not significant.

Table 4 Univariate and multivariate analysis of the prognostic factors for disease-free survival

Prognostic factors Univariate analysis Multivariate analysis

HR 95%CI P value HR 95%CI P value

Gender Female 1 Male 1.001 0.587-1.706 0.998 NA NA NA Age < 59 1 ≥ 59 1.060 0.621-1.809 0.831 NA NA NA T-stage T1-2 1 T3-4 1.258 0.833-1.899 0.276 NA NA NA N-stage N0 1 1 N1-2 2.511 1.468-4.295 0.001 2.149 1.226-3.767 0.008 M-stage M0 1 1 M1 11.737 5.442-25.313 < 0.001 10.907 4.937-24.096 < 0.001 Tumor differentiation Moderate/good 1 Poor 1.140 0.537-2.418 0.733 NA NA NA Vascular invasion No 1 Yes 3.246 1.874-5.625 < 0.001 NS NS NS Tumor location Rectum 1 Colon 1.557 0.810-2.992 0.184 NA NA NA CEA level (ng/mL) ≤ 5 1 > 5 2.958 1.692-5.172 < 0.001 NS NS NS Twist2 expression Negative 1 1 Positive 2.632 1.184-5.809 0.017 3.264 1.455-7.375 0.004

Multivariate analysis included adjustment for N-stage, M-stage, vascular invasion, serum carcinoembryonic antigen level and Twist2 expression. T: Tumor; N: Node; M: Metastasis; HR: Hazard ratio; NA: Not available; NS: Not significant.



feature of EMT inducers if these biomarkers were also upregulated[8]. In this study, Twist2-positive expression was significantly associated with reduced expression of E-cadherin, which supports the view that Twist2 is an EMT inducer in CRC. Unfortunately, we did not find a significant correlation between Twist2 expression and the adverse biological behaviors of CRC (bad T, N, M-stage, poor differentiation and vascular invasion). Thus, the mechanism remains unclear. However, other prognostic biomarkers share similar features with Twist2, such as vimentin[32], a-smooth muscle actin[33] and S100A4[29] for CRC, and osteopontin for HCC[34].

Considering the previous reports and the present study, several mechanisms probably contribute to the function of Twist2. Crucially, as an inducer of EMT, Twist2 can activate the EMT program, which is frequently involved in tumor progression and correlates with acquisi-

tion of therapeutic resistance[14-19]. In addition, hypoxia may participate in Twist2 function, as Zhou et al[7] found that positive expression of hypoxia-inducible factor-2α was significantly associated with Twist2 overexpression in salivary adenoid cystic carcinoma. Furthermore, Twist2 also correlates with methylation[35,36] and cancer stem cell self-renewal[11], as well as drug resistance[37], which may ex-plain the different outcomes of patients in the same stage. As EMT, cancer stem cells and drug resistance together comprise an axis of evil during tumor progression[19], we speculate that Twist2 is a key component of this axis. In summary, the mechanism of Twist2’s function in CRC is likely to be complex rather than simple.

In conclusion, the results of this study suggest that Twist2 is an independent prognostic factor for CRC. In particular, Twist2 exhibits a prognostic value for CRC in stage Ⅲ and Ⅳ. Future studies with larger samples and

Figure 3 Kaplan-Meier analysis of overall survival and disease-free survival, according to the expression levels of Twist2. A, B: All patients (A, OS, P = 0.015 and B, DFS, P = 0.012); C, D: Patients in stage Ⅰ-Ⅱ (C, OS, P = 0.351 and D, DFS, P = 0.652); E, F: Patients in stage Ⅲ (E, OS, P = 0.178 and F, DFS, P = 0.033); G, H: Patients in stage Ⅳ (G, OS, P = 0.101 and H, DFS, P = 0.026). OS: Overall survival; DFS: Disease-free survival.

1.0

0.8

0.6

0.4

0.2

0.0

OS

A

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00

Time after surgery (mo)

Twist2 (-) (n = 27)Twist2 (+) (n = 66)Twist2 (-) censoredTwist2 (+) censored

1.0

0.8

0.6

0.4

0.2

0.0

DFS

B

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00



1.0

0.8

0.6

0.4

0.2

0.0

OS

C

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00



D E F1.0

0.8

0.6

0.4

0.2

0.0

DFS

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00



1.0

0.8

0.6

0.4

0.2

0.0

OS

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00



1.0

0.8

0.6

0.4

0.2

0.0

DFS

0.00 20.00 40.00 60.00 80.00 100.00 120.00 140.00



1.0

0.8

0.6

0.4

0.2

0.0

DFS

0.00 5.00 10.00 15.00 20.00 25.00 30.00



G H1.0

0.8

0.6

0.4

0.2

0.0

OS

0.00 5.00 10.00 15.00 20.00 25.00 30.00





functional experiments are needed to confirm the func-tion of Twist2 in CRC.

COMMENTSBackgroundColorectal cancer (CRC) is one of the most common malignant tumors and continues to be one of the most common causes of cancer death worldwide. It is important to identify biomarkers to predict patients’ outcomes. Twist2 is a potential prognostic biomarker, but its value for CRC is unknown. Research frontiersTwist2 is a regulatory factor of epithelial-mesenchymal transition, a well-known progression involved in embryogenesis, tumor invasion, metastatic dissemination and acquisition of therapeutic resistance. Hypoxia, methylation, cancer stem cell self-renewal and drug resistance correlate with Twist2 func-tion. Therefore, Twist2 is a potential prognostic biomarker for tumors, and its prognostic value has also been identified for head and neck squamous cell carcinomas.Innovations and breakthroughsThis study revealed that Twist2 was overexpressed in CRC at the protein level. Twist2-positive expression correlated with the poor prognosis of CRC, particu-larly for patients in stage Ⅲ and Ⅳ (tumor-node-metastasis stage).ApplicationsThese results suggest that overexpression of Twist2 can probably serve as a prognostic factor for patients with CRC.TerminologyEMT is an important change in cell phenotype, which allows the escape of epi-thelial cells from the structural constraints imposed by tissue architecture, and was first recognized as a central process in early embryonic morphogenesis. Over recent decades, a series of studies have identified the involvement of EMT in solid tissue epithelial cancers’ invasiveness and metastasis.Peer reviewThis study investigated Twist2 expression in 93 CRC patients and evaluated its value as a prognostic biomarker based on relapse and survival data of pa-tients. The results indicate that Twist2 could be used as an effective prognostic biomarker for CRC. This paper is generally well designed and the result looks reliable.

REFERENCES1 Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statis-

tics, 2002. CA Cancer J Clin 2005; 55: 74-108 [PMID: 15761078]2 Compton CC, Greene FL. The staging of colorectal cancer:

2004 and beyond. CA Cancer J Clin 2004; 54: 295-308 [PMID: 15537574]

3 Li L, Cserjesi P, Olson EN. Dermo-1: a novel twist-related bHLH protein expressed in the developing dermis. Dev Biol 1995; 172: 280-292 [PMID: 7589808 DOI: 10.1006/dbio.1995.0023]

4 Lee MS, Lowe G, Flanagan S, Kuchler K, Glackin CA. Hu-man Dermo-1 has attributes similar to twist in early bone development. Bone 2000; 27: 591-602 [PMID: 11062344]

5 Koh HS , Lee C, Lee KS, Park EJ, Seong RH, Hong S, Jeon SH. Twist2 regulates CD7 expression and galectin-1-induced apoptosis in mature T-cells. Mol Cells 2009; 28: 553-558 [PMID: 19937140 DOI: 10.1007/s10059-009-0150-8]

6 Gasparotto D, Polesel J, Marzotto A, Colladel R, Piccinin S, Modena P, Grizzo A, Sulfaro S, Serraino D, Barzan L, Doglioni C, Maestro R. Overexpression of TWIST2 corre-lates with poor prognosis in head and neck squamous cell carcinomas. Oncotarget 2011; 2: 1165-1175 [PMID: 22201613]

7 Zhou C, Liu J, Tang Y, Zhu G, Zheng M, Jiang J, Yang J, Liang X. Coexpression of hypoxia-inducible factor-2α, TWIST2, and SIP1 may correlate with invasion and me-tastasis of salivary adenoid cystic carcinoma. J Oral Pathol Med 2012; 41: 424-431 [PMID: 22103974 DOI: 10.1111/j.1600-0714.2011.01114.x]

8 Li Y, Wang W, Wang W, Yang R, Wang T, Su T, Weng D, Tao T, Li W, Ma D, Wang S. Correlation of TWIST2 up-regulation and epithelial-mesenchymal transition during tumorigenesis and progression of cervical carcinoma. Gyne-col Oncol 2012; 124: 112-118 [PMID: 22018873 DOI: 10.1016/j.ygyno.2011.09.003]

9 Tsuji T, Ibaragi S, Shima K, Hu MG, Katsurano M, Sasaki A, Hu GF. Epithelial-mesenchymal transition induced by growth suppressor p12CDK2-AP1 promotes tumor cell local invasion but suppresses distant colony growth. Cancer Res 2008; 68: 10377-10386 [PMID: 19074907 DOI: 10.1158/0008-5472.CAN-08-1444]

10 Ansieau S, Bastid J, Doreau A, Morel AP, Bouchet BP, Thomas C, Fauvet F, Puisieux I, Doglioni C, Piccinin S, Maestro R, Voeltzel T, Selmi A, Valsesia-Wittmann S, Caron de Fromentel C, Puisieux A. Induction of EMT by twist pro-teins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell 2008; 14: 79-89 [PMID: 18598946 DOI: 10.1016/j.ccr.2008.06.005]

11 Fang X, Cai Y, Liu J, Wang Z, Wu Q, Zhang Z, Yang CJ, Yuan L, Ouyang G. Twist2 contributes to breast cancer pro-gression by promoting an epithelial-mesenchymal transition and cancer stem-like cell self-renewal. Oncogene 2011; 30: 4707-4720 [PMID: 21602879 DOI: 10.1038/onc.2011.181]

12 Acloque H, Adams MS, Fishwick K, Bronner-Fraser M, Ni-eto MA. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Invest 2009; 119: 1438-1449 [PMID: 19487820 DOI: 10.1172/JCI38019]

13 Kalluri R, Weinberg RA. The basics of epithelial-mesen-chymal transition. J Clin Invest 2009; 119: 1420-1428 [PMID: 19487818 DOI: 10.1172/JCI39104]

14 Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 2004; 117: 927-939 [PMID: 15210113 DOI: 10.1016/j.cell.2004.06.006]

15 Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell 2008; 14: 818-829 [PMID: 18539112 DOI: 10.1016/j.devcel.2008.05.009]

16 Ruan K, Bao S, Ouyang G. The multifaceted role of peri-ostin in tumorigenesis. Cell Mol Life Sci 2009; 66: 2219-2230 [PMID: 19308325 DOI: 10.1007/s00018-009-0013-7]

17 Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell 2009; 139: 871-890 [PMID: 19945376 DOI: 10.1016/j.cell.2009.11.007]

18 Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell 2011; 144: 646-674 [PMID: 21376230 DOI: 10.1016/j.cell.2011.02.013]

19 Singh A, Settleman J. EMT, cancer stem cells and drug re-sistance: an emerging axis of evil in the war on cancer. On-cogene 2010; 29: 4741-4751 [PMID: 20531305 DOI: 10.1038/onc.2010.215]

20 Jin GZ, Li Y, Cong WM, Yu H, Dong H, Shu H, Liu XH, Yan GQ, Zhang L, Zhang Y, Kang XN, Guo K, Wang ZD, Yang PY, Liu YK. iTRAQ-2DLC-ESI-MS/MS based identification of a new set of immunohistochemical biomarkers for classi-fication of dysplastic nodules and small hepatocellular car-cinoma. J Proteome Res 2011; 10: 3418-3428 [PMID: 21631109 DOI: 10.1021/pr200482t]

21 Koomägi R, Volm M. Expression of Fas (CD95/APO-1) and Fas ligand in lung cancer, its prognostic and predictive rel-evance. Int J Cancer 1999; 84: 239-243 [PMID: 10371340]

22 Rahman MA, Dhar DK, Yamaguchi E, Maruyama S, Sato T, Hayashi H, Ono T, Yamanoi A, Kohno H, Nagasue N. Coexpression of inducible nitric oxide synthase and COX-2 in hepatocellular carcinoma and surrounding liver: possible involvement of COX-2 in the angiogenesis of hepatitis C vi-

COMMENTS



rus-positive cases. Clin Cancer Res 2001; 7: 1325-1332 [PMID: 11350902]

23 Cheng AL, Huang WG, Chen ZC, Peng F, Zhang PF, Li MY, Li F, Li JL, Li C, Yi H, Yi B, Xiao ZQ. Identification of novel nasopharyngeal carcinoma biomarkers by laser capture microdissection and proteomic analysis. Clin Cancer Res 2008; 14: 435-445 [PMID: 18223218 DOI: 10.1158/1078-0432.CCR-07-1215]

24 Zhao N, Sun BC, Zhao XL, Liu ZY, Sun T, Qiu ZQ, Gu Q, Che N, Dong XY. Coexpression of Bcl-2 with epithelial-mesenchymal transition regulators is a prognostic indicator in hepatocellular carcinoma. Med Oncol 2012; 29: 2780-2792 [PMID: 22460834 DOI: 10.1007/s12032-012-0207-y]

25 Shiozaki H, Tahara H, Oka H, Miyata M, Kobayashi K, Tamura S, Iihara K, Doki Y, Hirano S, Takeichi M. Expres-sion of immunoreactive E-cadherin adhesion molecules in human cancers. Am J Pathol 1991; 139: 17-23 [PMID: 1713020]

26 Shioiri M, Shida T, Koda K, Oda K, Seike K, Nishimura M, Takano S, Miyazaki M. Slug expression is an independent prognostic parameter for poor survival in colorectal carcino-ma patients. Br J Cancer 2006; 94: 1816-1822 [PMID: 16773075 DOI: 10.1038/sj.bjc.6603193]

27 Liang X, Zheng M, Jiang J, Zhu G, Yang J, Tang Y. Hypoxia-inducible factor-1 alpha, in association with TWIST2 and SNIP1, is a critical prognostic factor in patients with tongue squamous cell carcinoma. Oral Oncol 2011; 47: 92-97 [PMID: 21167768 DOI: 10.1016/j.oraloncology.2010.11.014]

28 Zhao XL, Sun T, Che N, Sun D, Zhao N, Dong XY, Gu Q, Yao Z, Sun BC. Promotion of hepatocellular carcinoma metastasis through matrix metalloproteinase activation by epithelial-mesenchymal transition regulator Twist1. J Cell Mol Med 2011; 15: 691-700 [PMID: 20219012 DOI: 10.1111/j.1582-4934.2010.01052.x]

29 Kwak JM, Lee HJ, Kim SH, Kim HK, Mok YJ, Park YT, Choi JS, Moon HY. Expression of protein S100A4 is a predic-tor of recurrence in colorectal cancer. World J Gastroenterol 2010; 16: 3897-3904 [PMID: 20712050 DOI: 10.3748/wjg.v16.i31.3897]

30 Stanczak A, Stec R, Bodnar L, Olszewski W, Cichowicz

M, Kozlowski W, Szczylik C, Pietrucha T, Wieczorek M, Lamparska-Przybysz M. Prognostic significance of Wnt-1, β-catenin and E-cadherin expression in advanced colorec-tal carcinoma. Pathol Oncol Res 2011; 17: 955-963 [PMID: 21678109 DOI: 10.1007/s12253-011-9409-4]

31 Hirohashi S. Inactivation of the E-cadherin-mediated cell adhesion system in human cancers. Am J Pathol 1998; 153: 333-339 [PMID: 9708792 DOI: 10.1016/S0002-9440(10)65575-7]

32 Ngan CY, Yamamoto H, Seshimo I, Tsujino T, Man-i M, Ike-da JI, Konishi K, Takemasa I, Ikeda M, Sekimoto M, Matsuura N, Monden M. Quantitative evaluation of vimentin expres-sion in tumour stroma of colorectal cancer. Br J Cancer 2007; 96: 986-992 [PMID: 17325702 DOI: 10.1038/sj.bjc.6603651]

33 Tsujino T, Seshimo I, Yamamoto H, Ngan CY, Ezumi K, Takemasa I, Ikeda M, Sekimoto M, Matsuura N, Monden M. Stromal myofibroblasts predict disease recurrence for colorectal cancer. Clin Cancer Res 2007; 13: 2082-2090 [PMID: 17404090 DOI: 10.1158/1078-0432.CCR-06-2191]

34 Yang GH, Fan J, Xu Y, Qiu SJ, Yang XR, Shi GM, Wu B, Dai Z, Liu YK, Tang ZY, Zhou J. Osteopontin combined with CD44, a novel prognostic biomarker for patients with hepa-tocellular carcinoma undergoing curative resection. Oncolo-gist 2008; 13: 1155-1165 [PMID: 18997126 DOI: 10.1634/the-oncologist.2008-0081]

35 Raval A, Lucas DM, Matkovic JJ, Bennett KL, Liyanarachchi S, Young DC, Rassenti L, Kipps TJ, Grever MR, Byrd JC, Plass C. TWIST2 demonstrates differential methylation in immunoglobulin variable heavy chain mutated and unmu-tated chronic lymphocytic leukemia. J Clin Oncol 2005; 23: 3877-3885 [PMID: 15809452 DOI: 10.1200/JCO.2005.02.196]

36 Mao Y, Toh HB, Ding Z, Sun L, Hong L, Chen CS, Wu X. Differential methylation of CpG islands within the dermo1 gene promoter in several cancer cell lines. Oncol Rep 2011; 25: 107-111 [PMID: 21109964 DOI: 10.3892/or_00001048]

37 Pham CG, Bubici C, Zazzeroni F, Knabb JR, Papa S, Kunt-zen C, Franzoso G. Upregulation of Twist-1 by NF-kappaB blocks cytotoxicity induced by chemotherapeutic drugs. Mol Cell Biol 2007; 27: 3920-3935 [PMID: 17403902 DOI: 10.1128/MCB.01219-06]

P- Reviewer Chung YJ S- Editor Jiang L L- Editor Stewart GJ E- Editor Li JY




Elevated serum levels of human relaxin-2 in patients with esophageal squamous cell carcinoma

Peng Ren, Zhen-Tao Yu, Li Xiu, Mei Wang, Hua-Min Liu

Peng Ren, Zhen-Tao Yu, Li Xiu, Mei Wang, Hua-Min Liu, Department of Esophageal Cancer, Tianjin Medical University Cancer Institute and Hospital and Key Laboratory of Cancer Pre-vention and Therapy, Tianjin 300060, ChinaAuthor contributions: Ren P and Liu HM performed the major-ity of experiments; Yu ZT and Wang M collected all the human materials; Yu ZT designed the study and wrote the manuscript; Ren P and Xiu L revised the manuscript.Correspondence to: Zhen-Tao Yu, MD, Department of Esoph-ageal Cancer, Tianjin Medical University Cancer Institute and Hospital and Key Laboratory of Cancer Prevention and Therapy, Huanhu West Road, Tianjin 300060, China. [email protected] Telephone: +86-22-23340123 Fax: +86-22-23340123Received: December 29, 2012 Revised: February 2, 2013Accepted: February 28, 2013Published online: April 21, 2013

AbstractAIM: To assess the prognostic value of serum human relaxin 2 (H2 RLN) level in patients with esophageal squamous cell carcinoma (ESCC).

METHODS: From October 1998 to September 2009, 146 patients with histopathologically confirmed ESCC were enrolled in this study. One hundred patients un-derwent en bloc esophagectomy, and 46 patients with unresectable tumors underwent palliative surgery. Five of the 146 patients died of surgical complications. Serum levels of H2 RLN were measured by enzyme linked immunosorbent assay. The relationship between serum H2 RLN level and each of the clinicopathologi-cal parameters was analyzed using the χ 2 test. Patients were classified into two groups according to their H2 RLN level (< 0.462 ng/mL vs ≥ 0.462 ng/mL). When any analysis cell had fewer than five cases, the Fisher’s exact test was used. The statistical difference between groups A and B in each clinicopathological category was determined by the Student’s t test (two-tailed) or analysis of variance. Survival curves were plotted using the Kaplan-Meier method. The statistical difference in

BRIEF ARTICLE





survival between the different groups was compared using the log-rank test. Survival correlation with the prognostic factors was further investigated by mul-tivariate analysis using the Cox proportional hazards model with backward stepwise likelihood ratio.

RESULTS: ESCC patients tended to have significantly higher serum H2 RLN concentrations (0.48 ± 0.17 ng/mL, n = 141) compared with the healthy control group (0.342 ± 0.12 ng/mL, n = 112). There was a signifi-cant difference between patients with lymph node involvement (0.74 ± 0.15 ng/mL, n = 90), distant metastasis (0.90 ± 0.19 ng/mL, n = 32) and those without lymph node involvement (0.45 ± 0.12 ng/mL, n = 51), and distant metastasis (0.43 ± 0.14 ng/mL, n = 109), respectively (P < 0.01). Patients with high H2 RLN levels (≥ 0.462 ng/mL) had a poorer prognosis than patients with low serum H2 RLN levels (< 0.462 ng/mL; P = 0.0056). The H2 RLN level was also corre-lated with survival and tumor-node-metastasis staging, but not with age, tumor size, gender, lymphovascular invasion or the histological grade of tumors. Cox re-gression analysis showed that H2 RLN was an indepen-dent variable.

CONCLUSION: Serum concentrations of H2 RLN are frequently elevated in ESCC patients and are corre-lated with disease metastasis and survival. Serum con-centrations of H2 RLN may be an important prognostic marker in ESCC patients.


Key words: Esophageal squamous cell carcinoma; Re-laxin; Tumor markers; Metastasis

Core tip: Esophageal squamous cell carcinoma (ESCC) is one of the most aggressive carcinomas of the gas-trointestinal tract. Despite improvements in detection, surgical resection, and (neo-) adjuvant therapy, the overall survival of ESCC patients remains lower than

RLN in supporting tumor cell growth and metastasis[10]. RLN is known to regulate the expression of a variety of genes, including collagens and matrix metallopro-teinase (MMP)-1[11], vascular endothelial growth factor[9]

and cyclooxygenase-2[10]. In addition, the expression and catalytic activities of MMP-1, 2, 3 and 9 are increased by RLN[12,13]. Moreover, RLN regulates the complex inter-actions of the plasminogen activator and MMPs/tissue inhibitors of MMP systems on the ECM, thus facilitat-ing tumor cell attachment, migration and invasion. RLN has been shown to enhance in vitro invasiveness of breast cancer cells by upregulating the MMP-2, -7, -9, -13 and -14[14]. Similarly, adenovirus-mediated expression of RLN promotes the invasive potential of breast cancer cells[15].

A previous study showed that RLN concentrations in cancer patients were significantly higher than in a control population of healthy blood donors and patients with various other diseases. There was a significant difference between patients with and without metastases. Overall survival was shorter in RLN-positive than in RLN-neg-ative patients. Cox regression analysis showed that RLN was not an independent variable, in contrast to metastatic disease and primary lymph node involvement.

In this study, we measured the serum levels of hu-man relaxin 2 (H2 RLN) in ESCC patients and healthy controls using an enzyme linked immunosorbent assay (ELISA), and analyzed the association between clinical parameters of ESCC and serum H2 RLN levels.

MATERIALS AND METHODSEthics statementThis study was approved by the Medical Ethics Commit-tee of the Cancer Center at Tianjin University.

Clinical specimen collection and preparationFrom October 1998 to October 2009, 146 consecutive patients with histopathologically proven ESCC were en-rolled in this study. The average age was 62.7 ± 11.3 years, and the male: female ratio was 40:3 (male 136, female 10). Tumor stage was classified according to the TNM system[16]. Extensive preoperative examinations including esophagoscopy with biopsy, esophagogram, chest radi-ography, sonograms of abdomen and neck, computed tomography of the chest, and radionuclide bone scan-ning were performed to determine the need for surgery. Patients with resectable tumor (n = 100) underwent en bloc esophagectomy with locoregional lymphadenectomy through a right thoracotomy, laparotomy with reconstruc-tion using the stomach through a retrosternal route, and cervical esophagogastrostomy. For patients at stage Ⅱb or beyond, concurrent chemoradiotherapy was adminis-tered after surgery. Patients with unresectable tumor (n = 46) received chemoradiotherapy after the installation of a feeding jejunostomy or bypass procedure. None of these patients received neoadjuvant therapy. After treatment, all patients were followed regularly. Five patients died of car-diopulmonary or chronic obstructive pulmonary disease


Ren P et al . Serum relaxin-2 levels in ESCC patients

that of patients with other solid tumors due to distant metastasis. Therefore, it is important to detect disease progression and metastasis as early as possible to im-prove timely treatment and improve survival. In this study, the authors assessed the prognostic value of serum human relaxin 2 (H2 RLN) level in patients with ESCC, and found that serum concentrations of H2 RLN were elevated in ESCC patients and were correlated with disease metastasis and survival. Serum concen-trations of H2 RLN may be an important prognostic marker in ESCC patients.

Ren P, Yu ZT, Xiu L, Wang M, Liu HM. Elevated serum levels of human relaxin-2 in patients with esophageal squamous cell car-cinoma. World J Gastroenterol 2013; 19(15): 2412-2418 Avail-able from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2412.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2412

INTRODUCTIONEsophageal squamous cell carcinoma (ESCC) is one of the most aggressive carcinomas of the gastrointestinal tract. Despite improvements in detection, surgical resec-tion, and (neo-) adjuvant therapy, the overall survival of ESCC patients remains lower than that of patients with other solid tumors due to distant metastasis[1-4]. There-fore, it is important to detect disease progression and me-tastasis as early as possible to improve timely treatment and improve survival.

Several recent studies have shown that tumor-node-metastasis (TNM) stage and the number of diseased lymph nodes are two important factors associated with the prognosis of ESCC[2-4]. Although these two factors can only be assessed during surgery, they are not applica-ble for monitoring disease advancement and the potential of metastasis. On the other hand, serum biomarkers are often associated with the biological behavior of cancer cells. The prognostic measure of a serum biomarker that can reflect the concerted interaction between the tumor and the host immune system may provide scientific in-sight to improve the therapeutic strategy. However, there are few serum biomarkers that can be used as comple-mentary prognostic factors for patients with ESCC.

Relaxin (RLN) is a short circulating peptide hormone. Two highly homologous genes on human chromosome 9 encode relaxin gene 1 (RLN1) and relaxin gene 2 (RLN2) peptides with a predicted 82% identity at the amino acid level[5,6]. Despite having two peptide-coding genes, RLN1 and RLN2, the major stored and circulatory form of relaxin in humans is RLN2. RLN2 is produced in the prostate by males[7] and in the corpus lutea in females[8], and RLN1 is a pseudogene, which does not translate into a functional peptide in rodents, humans and other non-human species.

RLN plays an important role in the remodeling of extracellular matrix (ECM) in several reproductive tract tissues[9]. There is growing evidence that implicates

complications after surgery and were excluded from the prognosis analysis. Serum samples were obtained from each patient at the time of diagnosis. Serum samples from 112 healthy individuals with equivalent age and sex distri-bution were used as normal controls. The Medical Ethics Committee (Tianjin University) approved the protocol, and written informed consent was obtained from each healthy individual (normal controls). The healthy individu-als were negative for hepatitis B virus, hepatitis C virus, and human immunodeficiency virus. Abdominal and breast (female) ultrasound examination, chest X-ray, rou-tine blood tests, and biochemistry tests were performed for the healthy controls, and the results were within nor-mal ranges. After centrifugation of the peripheral blood, serum samples were stored at -20 ℃ until assayed.

ELISA assaysThe serum level of H2 RLN was measured with a com-mercially available ELISA kit (Santa Cruz, Shanghai, China) following the manufacturers’ instructions. Briefly, 96-well ELISA microplates were coated overnight with 100 μL H2 RLN antibody (Santa Cruz, Shanghai, China) at a final concentration of 0.25 mg/L in phosphate buffered saline (PBS). After washing with PBS/0.05% (w/v) Tween-20 (PBST, pH 7.4), the wells were blocked with blocking buf-fer at room temperature for 1 h. Then, 100 μL diluted serum samples (at 1:30 dilution) were added and incubated at room temperature for 2 h. Similarly, 100 μL PBS with 0.04% Tween 80 (PBST), PBST lacking antibody was used as a negative control. Following three washes with PBST, 100 μL antibody diluted to a concentration of 0.25 mg/L was added. After incubation at room temperature for 2 h, 100 μL avidin-horseradish peroxidase conjugated second-ary antibody (at 1:2000 dilution) was added, and the plates were incubated at room temperature for 30 min. Excess conjugate was removed by washing the plates three times with PBST. The amount of bound conjugate was deter-mined by adding phosphate buffer and 3-ethylbenzothi-azoline-6-sulfonic acid. Liquid substrate solution to each well, and plates were incubated at room temperature for color development. The absorbance was measured at 405 nm using a Model 680 microplate reader (Bio-Rad Lab. Inc., Hercules, CA, United States). All analyses were per-formed in triplicate. The coefficient of variation was lower than 15% between analyses. Concentrations of H2 RLN were presented in ng/mL. Patients were classified into two groups according to their H2 RLN level (< 0.462 ng/mL vs ≥ 0.462 ng/mL).

Statistical analysisThe results were expressed as mean ± SD. The relation-ship between serum H2 RLN level and each of the clinicopathological parameters (age, size, lymph node in-volvement, distant metastasis, cell differentiation, lympho-vascular invasion, and tumor stage) was analyzed using the χ 2 test. When any analysis cell had fewer than five cases, Fisher’s exact test was used. The statistical difference be-tween groups A and B in each clinicopathological category

was determined by Student’s t test (two-tailed) or analysis of variance. Survival curves were plotted using the Ka-plan-Meier method. The statistical difference in survival between the different groups was compared using the log-rank test. Survival correlation with the prognostic factors was further investigated by multivariate analysis using the Cox proportional hazards model with backward stepwise likelihood ratio. Statistical analysis was performed using SPSS statistical software (Chicago, IL, United States). Sta-tistical significance was assumed for P < 0.05.

RESULTSSerum H2 RLN level and clinicopathological features in ESCC patients Serum H2 RLN was 0.342 ± 0.12 ng/mL in normal healthy controls (range, 0.26-0.41 ng/mL; n = 112) and was significantly higher in patients with ESCC (0.48 ± 0.17 ng/mL; range, 0.43-0.58 ng/mL, n = 141; P < 0.05). This was above the normal range in 69.5% (98 of 141) of ESCC patients before surgery, and 30.5% (43 of 141) of these patients had levels < 0.462 ng/mL, the mean plus 1 SD as determined from the control. Using 0.462 ng/mL as the cutoff value, these ESCC patients were then divided into group A (n = 43) as those with the lower level (< 0.462 ng/mL; mean, 0.45 ng/mL; range, 0.164-0.618 ng/mL) and group B (n = 98) as those with the higher level (> 0.462 ng/mL; mean, 0.71 ng/mL; range, 0.624-0.93 ng/mL). Of the 146 ESCC patients, 136 male patients had a serum H2 RLN level ranging from 0.26-0.40 ng/mL and 10 female patients had a se-rum H2 RLN level ranging from 0.253-0.41 ng/mL. χ 2 analysis showed that the preoperative serum H2 RLN levels correlated well with lymph node involvement (N status) and distant metastasis (M status, Table 1). Higher H2 RLN levels were related to disease progression (Table 2). Serum levels of H2 RLN were significantly higher in patients with lymph node metastasis or distant metastasis than in those without lymph node involvement or distant metastasis. No relationship was found between gender and H2 RLN levels. However, although the patients were grouped by their histopathological findings (pathological grade or lymphovascular invasion), no more differences were found in their serum H2 RLN levels (Tables 1 and 2). Although ESCC was most often found in male patients, there were only a limited number of female patients (n = 10), and we were unable to study the correlations be-tween H2 RLN levels and sex hormones (ER, PR and Her-2).

Correlation of serum H2 RLN level with the prognosis of ESCC patients The associations between median serum H2 RLN levels and clinicopathological parameters are presented in Table 2. H2 RLN levels were not associated with age, tumor size and gender (data not shown), cell differentiation, lym-phovascular invasion and tumor status, however, elevated median H2 RLN levels were significant for patients with




assessed. No significant difference in age, gender, tumor size (data not shown), tumor status, lymphovascular inva-sion and cell differentiation was found between the two groups; however, patients with lymph node metastasis, distant metastasis and higher clinical stage were more fre-quently observed in the elevated H2 RLN group (≥ 0.462 ng/mL) than in the non-elevated H2 RLN group (< 0.462 ng/mL). The overall cumulative survival rates of our pa-tients were 42.4% at 2 years and 18.2% at 5 years. In view of the serum H2 RLN level, group A patients seemed to have a much worse prognosis than group B patients (P = 0.018; Figure 1). Figures 2 and 3 show the comparison of survival time between different disease stages. The cumula-tive 2-year survival rate for group A patients was 27.3% and for group B patients was 48.2%. The median survival for group A was 7.8 mo, and for group B was 22.4 mo. Among patients who had persistently high H2 RLN levels or a marked increase in H2 RLN level within a short in-terval (1-6 mo) after esophagectomy, distant metastasis of cancer was frequently found. On the other hand, patients with a low preoperative level of H2 RLN or H2 RLN levels which decreased after esophagectomy could remain disease-free for 12-23 mo. As previously mentioned, the depth of tumor invasion, lymph node metastasis, distant nodal or organ metastasis correlated well with H2 RLN level.

Further univariate and multivariate analyses also showed these parameters to be independent factors for patient survival (lymph node metastasis, P < 0.001; distant

distant metastasis and lymph node involvement (P < 0.05). We also noted that the median levels of H2 RLN significantly increased with increasing T classification (P < 0.05) of the malignancy. Next, patients were classified into two groups according to their H2 RLN level (< 0.462 ng/mL vs ≥ 0.462 ng/mL); the relationships between H2 RLN levels and clinicopathological parameters were

Clinicopathological factorsGroups1

P value2

A (n) B (n) Age (yr) 0.144 < 65 (n = 72) 21 51 ≥ 65 (n = 69) 22 47 Tumor status 0.089 T1 (n = 16) 2 14 T2 (n = 14) 4 10 T3 (n = 75) 24 51 T4 (n = 36) 13 23 Lymph node involvement 0.003 Positive (n = 90) 32 58 Negative (n = 51) 11 40 Distant metastasis 0.027 Positive (n = 32) 21 11 Negative (n = 109) 22 87 Lymphovascular invasion 0.186 Positive (n = 42) 18 24 Negative (n = 99) 25 74 Stage (TNM) 0.035 Ⅰ (n = 17) 7 10 Ⅱ (n = 37) 8 29 Ⅲ (n = 53) 10 43 Ⅳ (n = 34) 18 16 Cell differentiation 0.267 Well (n = 23) 9 14 Moderate (n = 90) 23 56 Poor (n = 28) 9 19

Table 1 Relationship between serum levels of human relaxin 2 and clinicopathological factors

1Patients were grouped by preoperative serum levels of human relaxin 2 (H2 RLN). In group B (n = 43), serum H2 RLN levels were ≥ 0.462 ng/mL, and in group A (n = 98), H2 RLN levels were 0.462 ng/mL; 2P values were determined by χ 2 test. TNM: Tumor-node-metastasis.

Category H2 RLN (ng/mL) P value

Normal control (n = 112) 0.34 ± 0.12 0.0261

ESCC (n = 141) 0.48 ± 0.17 Tumor status 0.1422

T1 (n = 16) 0.32 ± 0.08 T2 (n = 14) 0.53 ± 0.13 T3 (n = 75) 0.49 ± 0.16 T4 (n = 36) 0.47 ± 0.19 Lymph node involvement 0.0141

Positive (n = 90) 0.74 ± 0.15 Negative (n = 51) 0.45 ± 0.12 Distant metastasis 0.0161

Positive (n = 32) 0.90 ± 0.19 Negative (n = 109) 0.43 ± 0.14 Lymphovascular invasion 0.3422

Positive (n = 42) 0.51 ± 0.18 Negative (n = 99) 0.46 ± 0.16 Stage (TNM) 0.0022

Ⅰ (n = 17) 0.42 ± 0.09 Ⅱ (n = 37) 0.46 ± 0.12 Ⅲ (n = 53) 0.47 ± 0.14 Ⅳ (n = 34) 0.82 ± 0.23 Cell differentiation 0.5421

Well (n = 23) 0.46 ± 0.21 Moderate (n = 90) 0.48 ± 0.13 Poor (n = 28) 0.52 ± 0.12

Table 2 Levels of serum human relaxin 2 in patients with esophageal squamous cell carcinoma

P value was determined by: 1Student’s t test (two-tailed) or 2one way analysis of variance test. ESCC: Esophageal squamous cell carcinoma; H2 RLN: Human relaxin 2; TNM: Tumor-node-metastasis.

1.0

0.8

0.6

0.4

0.2

0.0

High H2 RLN levelsLow H2 RLN levels

P = 0.018

0 10 20 30 40 50 60Months after surgery

Prec

ent

surv

ival

Figure 1 Survival of patients with esophageal squamous cell carcinoma in relation to their serum human relaxin 2 levels. The cutoff value of serum human relaxin 2 (H2 RLN) concentration for dividing patients into groups A and B was defined as 0. 462 ng/mL which represents the mean plus 1 SD measured from the healthy control subjects. Survival analysis between group A (H2 RLN, ≥ 0.462 ng/mL) and group B (H2 RLN, < 0.462 ng/mL) was assessed using the Kaplan-Meier method, and the survival difference between the groups was compared using the log rank test (P = 0.018).



organ metastasis, P < 0.001; H2 RLN, P < 0.05 (Table 3).

DISCUSSIONIdentification of targets for early detection of ESCC is important to improve the prognosis of patients with this pernicious disease. Currently, carcinoembryonic an-tigen[17], cytokeratin-19 fragments[18], and squamous cell carcinoma-associated antigen[18], are routinely used as serum markers for the detection of ESCC. Due to the low sensitivity and specificity of detection of these mark-ers[19], additional serum markers must be established for early detection and diagnosis of ESCC.

It has been previously shown that the polypeptide

hormone relaxin is expressed exclusively in human breast cancer[20], and relaxin confers increased carcinoma cell growth, motility, adhesion and in vitro invasiveness in hu-man breast cancer cells[14,21]. Furthermore, adenoviral-me-diated delivery of the prorelaxin 2 gene increases the in-vasiveness of canine breast cancer cells[10]. It was reported

CharacteristicUnivariate analysis Multivariate analysis

HR 95%CI P value1 HR 95%CI P value1

Age (yr) < 65 vs ≥ 65 1.321 0.864-1.743 0.185 1.268 0.747-1.826 0.174 Gender Male vs female 0.942 0.621-1.563 0.342 0.852 0.732-1.472 0.296 Lymph node involvement Yes vs no 2.136 1.142-2.687 < 0.001 2.830 1.384-2.982 0.001 Distant metastasis Yes vs no 3.784 2.543-5.894 < 0.001 3.549 1.302-3.108 0.001 pTNM Ⅰ-Ⅱ vs Ⅲ-Ⅳ 3.120 2.148-5.143 < 0.001 1.632 1.130-2.740 0.028 Lymphovascular invasion Yes vs no 1.121 0.765-1.574 0.129 1.290 0.862-1.420 0.172 H2 RLN level < 0.462 ng/mL vs ≥ 0.462 ng/mL 2.469 1.362-2.836 0.015 2.530 1.424-2.732 0.003

Table 3 Univariate and multivariate survival analysis in patients with esophageal squamous cell carcinoma

1Cox hazard regression model. HR: Hazard ratio; TNM: Tumor-node-metastasis; H2 RLN: Human relaxin 2.

0 20 40 60 80 Survival time (mo)

StageⅠ

P = 0.002

1.0

0.8

0.6

0.4

0.2

0.0

Cum

ulat

ive

surv

ival

Figure 2 Comparison of overall survival between different disease stages. We also analyzed the prognostic value of human relaxin 2 (H2 RLN) levels in selected patient subgroups stratified according to disease stage. Esophageal squamous cell carcinoma patients with elevated H2 RLN levels had a significantly shorter overall survival rate compared to patients with non-elevated H2 RLN levels in the clinical stage Ⅰ-Ⅱ subgroup (n = 54; log-rank P < 0.001; Figure 3A), and the clinical stage Ⅲ-Ⅳ subgroup (n = 87; log-rank P < 0.001; Figure 3B).

0 20 40 60 80 Survival time (mo)

1.0

0.8

0.6

0.4

0.2

0.0

Cu

mul

ativ

e su

rviv

al

P < 0.001

High serum H2 RLN level (n = 39)

Low serum H2 RLN level (n = 15)

Stage Ⅰ-Ⅱ

0 20 40 60 80Survival time (mo)

1.0

0.8

0.6

0.4

0.2

0.0

Cum

ulat

ive

surv

ival

P < 0.001

High serum H2 RLN level (n = 59)Low serum H2 RLN level (n = 28)

Stage Ⅲ-Ⅳ

Figure 3 Overall survival curves for patients with esophageal squamous cell carcinoma after curative resection. The patients were categorized with elevated (≥ 0.462 ng/mL) or non-elevated (< 0.462 ng/mL) levels of relaxin. P values were determined using the log rank test. A: Clinical stage Ⅰ-Ⅱ sub-group; B: Clinical stage Ⅲ-Ⅳ subgroup.

A

B

Stage ⅡStage ⅢStage Ⅳ



that serum RLN concentrations were significantly higher in breast cancer patients than in a control population of healthy blood donors[22]. Notably, serum RLN levels were higher in patients with metastatic disease compared to those without known metastases[22].

Immunostaining with antibodies to human relaxin (H2) suggests the presence of a relaxin-like peptide in the gastrointestinal tract and its tumors[23]. In our preliminary experiment, we found that H2 RLN was overexpressed in ESCC tissues using an immunohistochemistry assay (data not shown). In this study, we evaluated the H2 RLN serum concentrations in ESCC patients. Our results dem-onstrate that median H2 RLN serum concentrations in a population of ESCC patients were significantly higher than those in a control group of healthy blood donors. H2 RLN concentrations were particularly elevated in pa-tients with lymph node metastasis and distant metastasis. However, no significant differences were found in the serum levels of H2 RLN in ESCC patients according to different histological tumor grades, age, tumor size and tumor status. Thus, H2 RLN concentration may be a suit-able routine serum marker for the detection of metastatic disease in ESCC. Because our study involved a relatively small number of ESCC patients and the sensitivity and specificity of our assay which measured serum H2 RLN were not sufficiently high, further confirmation of these findings in a larger sample size is warranted.

Evaluation of survival data showed that survival was significantly shorter in patients with H2 RLN concentra-tions > 0.462 ng/mL, and high H2 RLN concentrations predicted a poor prognosis in patients with ESCC, espe-cially in those presenting with distant and lymph node metastasis. H2 RLN was not an independent variable in ESCC. However, in breast cancer[22], although elevated RLN serum concentrations were a significant discrimina-tor between metastatic and non-metastatic patients, the predictive power of individual RLN values in the inves-tigated population was rather low, as there was a broad overlap of concentrations in the two groups with or without metastases, suggesting cell type-specific effects of RLN.

In conclusion, we found that serum H2 RLN levels were increased in ESCC patients and correlated positively with TNM stage and both lymph node and distant metas-tasis, but not with gender, tumor size or the histological grade of ESCC. H2 RLN was an independent variable in ESCC. Examining and monitoring serum H2 RLN levels may be useful in estimating the prognosis of patients with ESCC.

ACKNOWLEDGMENTSWe wish to thank both the reviewers and editors for their helpful instructions for our further studies.

COMMENTSBackgroundAlthough the serum level of human relaxin-2 (H2 RLN) has been shown to cor-

relate with progression and prognosis of several cancers, data to support its clinical significance in esophageal squamous cell carcinoma (ESCC) are lim-ited. This study was conducted to assess the prognostic value of serum human H2 RLN level in patients with ESCC. Research frontiersSerum levels of H2 RLN were measured by ELISA in 146 patients with his-topathologically confirmed ESCC. The authors also assessed the prognostic value of serum human H2 RLN level in these patients with ESCC. Innovations and breakthroughsSerum concentrations of H2 RLN are frequently elevated in ESCC patients and are correlated with disease metastasis and survival. ApplicationsSerum concentrations of H2 RLN may be an important prognostic marker in ESCC patients. Peer reviewThe authors assessed the prognostic value of serum H2 RLN level in patients with ESCC, and found that serum concentrations of H2 RLN were elevated in ESCC patients and were correlated with disease metastasis and survival. This is an interesting report.

REFERENCES1 Vallböhmer D, Brabender J, Metzger R, Hölscher AH. Ge-

netics in the pathogenesis of esophageal cancer: possible predictive and prognostic factors. J Gastrointest Surg 2010; 14 (Suppl 1): S75-S80 [PMID: 19756878]

2 Lam AK. Molecular biology of esophageal squamous cell carcinoma. Crit Rev Oncol Hematol 2000; 33: 71-90 [PMID: 10737369 DOI: 10.1016/S1040-8428(99)00054-2]

3 Lehrbach DM, Nita ME, Cecconello I. Molecular aspects of esophageal squamous cell carcinoma carcinogenesis. Arq Gastroenterol 2003; 40: 256-261 [PMID: 15264049 DOI: 10.1590/S0004-28032003000400011]

4 Stoner GD, Wang LS, Chen T. Chemoprevention of esopha-geal squamous cell carcinoma. Toxicol Appl Pharmacol 2007; 224: 337-349 [PMID: 17475300 DOI: 10.1016/j.taap.2007.01.030]

5 Fahn HJ, Wang LS, Huang BS, Huang MH, Chien KY. Tumor recurrence in long-term survivors after treatment of carcinoma of the esophagus. Ann Thorac Surg 1994; 57: 677-681 [PMID: 8147640 DOI: 10.1016/0003-4975(94)90566-5]

6 Patil P, Redkar A, Patel SG, Krishnamurthy S, Mistry RC, Deshpande RK, Mittra I, Desai PB. Prognosis of operable squamous cell carcinoma of the esophagus. Relationship with clinicopathologic features and DNA ploidy. Cancer 1993; 72: 20-24 [PMID: 8508407]

7 Wang LS, Chow KC, Chi KH, Liu CC, Li WY, Chiu JH, Huang MH. Prognosis of esophageal squamous cell carci-noma: analysis of clinicopathological and biological factors. Am J Gastroenterol 1999; 94: 1933-1940 [PMID: 10406262 DOI: 10.1111/j.1572-0241.1999.01233.x]

8 Sherwood OD. Relaxin’s physiological roles and other di-verse actions. Endocr Rev 2004; 25: 205-234 [PMID: 15082520 DOI: 10.1210/er.2003-0013]

9 Bathgate RA, Ivell R, Sanborn BM, Sherwood OD, Summers RJ. International Union of Pharmacology LVII: recommen-dations for the nomenclature of receptors for relaxin family peptides. Pharmacol Rev 2006; 58: 7-31 [PMID: 16507880 DOI: 10.1124/pr.58.1.9]

10 Feng S, Agoulnik IU, Bogatcheva NV, Kamat AA, Kwabi-Addo B, Li R, Ayala G, Ittmann MM, Agoulnik AI. Relaxin promotes prostate cancer progression. Clin Cancer Res 2007; 13: 1695-1702 [PMID: 17363522 DOI: 10.1158/1078-0432.CCR-06-2492]

11 Shabanpoor F, Separovic F, Wade JD. The human insulin superfamily of polypeptide hormones. Vitam Horm 2009; 80: 1-31 [PMID: 19251032 DOI: 10.1016/S0083-6729(08)00601-8]

12 Palejwala S, Tseng L, Wojtczuk A, Weiss G, Goldsmith LT. Relaxin gene and protein expression and its regulation of procollagenase and vascular endothelial growth factor in

COMMENTS



human endometrial cells. Biol Reprod 2002; 66: 1743-1748 [PMID: 12021056 DOI: 10.1095/biolreprod66.6.1743]

13 Silvertown JD, Summerlee AJ, Klonisch T. Relaxin-like peptides in cancer. Int J Cancer 2003; 107: 513-519 [PMID: 14520686 DOI: 10.1002/ijc.11424]

14 Unemori EN, Amento EP. Relaxin modulates synthesis and secretion of procollagenase and collagen by human dermal fi-broblasts. J Biol Chem 1990; 265: 10681-10685 [PMID: 2162358]

15 Unemori EN, Lewis M, Grove BH, Deshpande U. Relaxin induces specific alterations in gene expression in human endometrial stromal cells. In: Tregear G, Ivell R, Bathgate R, Wade JD, editers. Proceedings from the Third International Congress on Relaxin and Related Peptides. Dordrecht: Klu-wer Academic Publisher, 2002: 65-72

16 Qin X, Chua PK, Ohira RH, Bryant-Greenwood GD. An autocrine/paracrine role of human decidual relaxin. II. Stromelysin-1 (MMP-3) and tissue inhibitor of matrix metal-loproteinase-1 (TIMP-1). Biol Reprod 1997; 56: 812-820 [PMID: 9096860 DOI: 10.1095/biolreprod56.4.812]

17 Binder C, Hagemann T, Husen B, Schulz M, Einspanier A. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod 2002; 8: 789-796 [PMID: 12200455 DOI: 10.1093/molehr/8.9.789]

18 Silvertown JD, Geddes BJ, Summerlee AJ. Adenovirus-mediated expression of human prorelaxin promotes the

invasive potential of canine mammary cancer cells. Endocri-nology 2003; 144: 3683-3691 [PMID: 12865351 DOI: 10.1210/en.2003-0248]

19 International Union Against Cancer. TNM Classification of Malignant Tumors, revised edition. New York: Springer-Verlag, 1987

20 Nakashima S, Natsugoe S, Matsumoto M, Miyazono F, Na-kajo A, Uchikura K, Tokuda K, Ishigami S, Baba M, Takao S, Aikou T. Clinical significance of circulating tumor cells in blood by molecular detection and tumor markers in esopha-geal cancer. Surgery 2003; 133: 162-169 [PMID: 12605177 DOI: 10.1067/msy.2003.9]

21 Cao X, Zhang L, Feng GR, Yang J, Wang RY, Li J, Zheng XM, Han YJ. Preoperative Cyfra21-1 and SCC-Ag serum titers predict survival in patients with stage II esophageal squamous cell carcinoma. J Transl Med 2012; 10: 197 [PMID: 22999061 DOI: 10.1186/1479-5876-10-197]

22 Kawaguchi H, Ohno S, Miyazaki M, Hashimoto K, Egashira A, Saeki H, Watanabe M, Sugimachi K. CYFRA 21-1 deter-mination in patients with esophageal squamous cell car-cinoma: clinical utility for detection of recurrences. Cancer 2000; 89: 1413-1417 [PMID: 11013352]

23 Sacchi TB, Bani D, Brandi ML, Falchetti A, Bigazzi M. Re-laxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int J Cancer 1994; 57: 129-134 [PMID: 8150531 DOI: 10.1002/ijc.2910570123]

P- Reviewers Goan YG, Inamori M S- Editor Song XX L- Editor A E- Editor Li JY


Exposure to gastric juice may not cause adenocarcinogenesis of the esophagus

Peng Cheng, Jian-Sheng Li, Lian-Feng Zhang, Yong-Zhong Chen, Jun Gong

Peng Cheng, Jian-Sheng Li, Lian-Feng Zhang, Yong-Zhong Chen, Department of Gastroenterology, the First Hospital of Zhengzhou University, Zhengzhou 450052, Henan Province, ChinaJun Gong, Department of Gastroenterology, the Second Hospital of Xi’an Jiao Tong University, Xi’an 710004, Shaanxi Province, ChinaAuthor contributions: Cheng P designed the study, wrote the manuscript and performed the majority of experiments; Li JS, Zhang LF and Chen YZ provided vital reagents and analytical tools and were also involved in revising the manuscript; Gong J designed the study and provided financial support for this work.Correspondence to: Peng Cheng, MD, Associate Professor, Department of Gastroenterology, the First Hospital of Zhengzhou University, No. 1, Jianshe Donglu, Zhengzhou 450052, Henan Province, China. [email protected]: +86-371-66862062 Fax: +86-371-66964992Received: October 24, 2012 Revised: March 15, 2013Accepted: March 21, 2013Published online: April 21, 2013

AbstractAIM: To determine the effects of gastric juice on the development of esophageal adenocarcinoma (EAC).

METHODS: A animal model of duodenogastroesopha-geal reflux was established in Sprague-Dawley rats undergoing esophagoduodenostomy. The development of EAC and forestomach adenocarcinoma was investi-gated 40 wk after the treatment. Intraluminal pH and bile of the forestomach were measured.

RESULTS: There were no significant differences in pH (t = 0.117, P = 0.925) or bile (χ 2 = 0.036, P = 0.85) in the forestomach before and 40 wk after esophagoduo-denostomy. There were also no significant differences between the model and controls during esophagoduo-denostomy or 40 wk after esophagoduodenostomy. The incidence of intestinal metaplasia (88%) and in-

BRIEF ARTICLE





testinal metaplasia with dysplasia and adenocarcinoma (28%) in the esophagus in the model was higher than in the controls 40 wk after surgery (χ 2 = 43.06, P < 0.001 and χ 2 = 9.33, P = 0.002, respectively) and in the forestomach in the model (χ 2 = 32.05, P < 0.001 and χ 2 = 8.14, P = 0.004, respectively). The incidence rates of inflammation in the esophagus and forestom-ach were 100% and 96%, respectively (χ 2 = 1.02, P = 0.31) in the model, which was higher than in the esophageal control (6.8%) (χ 2 = 42.70, P < 0.001).

CONCLUSION: Gastric juice exposure may not cause intestinal metaplasia with dysplasia or adenocarcinoma of the forestomach and may not be related to EAC.


Key words: Intestinal metaplasia; Gastric juice; Patho-genesis; Esophageal adenocarcinoma; Gastroesopha-geal reflux

Core tip: The incidence of esophageal adenocarcinoma (EAC) has rapidly increased, which may be related to the increased incidence of gastroesophageal reflux dis-ease. A better understanding of how refluxate contrib-utes to development of EAC will help decrease the in-cidence of cancer. We surgically developed a rat model of duodenogastroesophageal reflux and found that although exposure of the forestomach to gastric juice may induce inflammation and mild metaplasia, it does not lead to the development of metaplasia with dys-plasia or adenocarcinoma. It is concluded that gastric juice may not be related to the development of EAC.

Cheng P, Li JS, Zhang LF, Chen YZ, Gong J. Exposure to gastric juice may not cause adenocarcinogenesis of the esophagus. World J Gastroenterol 2013; 19(15): 2419-2424 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2419.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2419

INTRODUCTIONThe incidence rate of esophageal adenocarcinoma (EAC) has recently increased more quickly than that of any other malignancies, which has attracted attention[1]. The rapid increase in the incidence of EAC might be related to the increase in that of gastroesophageal reflux disease (GERD) and Barrett’s esophagus[2,3]. The presence of Barrett’s metaplasia with specialized intestinal epithelium is the main risk factor for these tumors. This epithelium is an acquired condition after a particular type of heal-ing from esophageal mucosal injury resulting from reflux disease[4]. Reflux of gastric acid and duodenal juice is the main cause of GERD, and gastric acid has always been regarded as the major risk element in GERD; the main clinical treatment of which is acid suppression[5]. However, because of the rapid increase in the incidence of EAC, the role of gastric acid in the development of GERD remains controversial.

Gastric juice that has refluxed into the esophagus in patients with GERD also contains biliary and pancre-atic secretions that have refluxed into the stomach from the duodenum. Early studies have shown that reflux of combined duodenal and gastric juices into the esopha-gus causes severe esophagitis[6]. Reflux of duodenal juice results in the same degree of esophageal injury in gastrectomized animals[7]. Evidence from both animal models[8-11] and human clinical studies[12] has implicated esophageal exposure to duodenal juice as a key factor in the genesis of specialized intestinal metaplasia and the development of adenocarcinoma. Some researchers be-lieve that acid resistance may be related to the obvious in-crease in the incidence of EAC[13]. With the development of the dynamic surveying system of duodenal juice, the role of duodenal juice reflux in the pathological process has attracted increasing attention. One study has even confirmed that duodenal juice reflux could induce Bar-rett’s esophagus and EAC in rats[10].

Therefore, the roles of gastric juice and of bile and pancreatic juice regurgitation in duodenal juice reflux in the development of EAC without exogenous carcinogens should be studied in an animal model of duodenogastro-esophageal reflux. The aim of the current study was to investigate the role of gastric juice in the genesis of intes-tinal metaplasia and EAC in this rat model.

MATERIALS AND METHODSAnimalsSixty healthy 8-wk-old Sprague-Dawley rats weighing 200-250 g were purchased from the Experimental Animal Center of Xi’an Jiao Tong University. The paired male and female rats were randomly divided into two groups: sham-operated control (n = 30) and model (n = 30) groups.

Experimental animal model A Sprague-Dawley rat model of duodenogastroesopha-geal reflux was created in accordance with the method of

Zhang et al[14] and a sham-operated group was used as the control group. Surgical diversion of duodenal secretions into the esophagus was induced by end-to-side esophago-duodenostomy in the experimental group. All operated rats underwent esophagoduodenostomy. The esophagus was separated from the posterior vagal trunk and left gastric vessels, tied with silk at the gastroesophageal junc-tion, and divided 2 mm proximal to the tie. The anterior vagus nerve was divided when the esophagus was cut and sutured with 16 interrupted stitches of 7-0 polypropylene.

Esophagoduodenostomy was the only procedure per-formed in 30 animals. The purpose of the anastomosis was to induce reflux of both gastric and duodenal juice into the esophagus. The anterolateral wall of the distal duodenum was opened longitudinally 1 cm from the py-lorus, and the broken ends of the esophagus were anas-tomosed to the duodenal incision.

The sham-operated group included 30 rats. After the rats were paunched, only the lower esophagus and first portion of the duodenum were dissociated.

Operations were performed after an acclimatization period of 4 d. Rats were kept in hanging cages on a 12 h light-dark cycle at a temperature of 21 ℃ and humidity of 60%. Water and standard chow were given ad libitum. Food was discontinued in the evening before surgery or sacrifice, and water was discontinued in the morning of surgery. Rats were anesthetized with an intramuscular injection of xylazine hydrochloride (18 mg/kg) and ket-amine (72 mg/kg), with further doses administered intra-peritoneally during surgery as required. Before closure, 0.5 mL-1.5 mL 0.9% sodium chloride was instilled into the peritoneal cavity. Water was permitted when the rats awoke, and chow was provided on the next day. The rats were housed in cages at 22 ℃-25 ℃ with free access to standard rat pellet food and water for 40 wk. Rats were treated following the Guidelines for the Care and Use of Laboratory Animals of the National Animal Welfare Committee.

Intraluminal pH and bile of the forestomach were measured during esophagoduodenostomy with a portable glass electrode pH monitor (Digitrapper MK; Medtronic Synectics, Stockholm, Sweden) and a portable bile moni-tor (Bilitec 2000; Medtronic Synectics). These parameters were also measured after rats were sacrificed 40 wk after the operation. For duodenal gastric reflux, the 2-min pe-riod was considered reflux positive if the bilirubin optical density was > 0.14 and lasted 5 s. An absorbance > 0.14 was used as the Bilitec threshold value[15].

Tissues and specimensThe rats were sacrificed 40 wk after surgery. The esopha-gus and forestomach were opened longitudinally, and gross pathological changes were examined macroscopical-ly. The samples of the esophagus and forestomach were then fixed in formalin, made into paraffin sections after numbering, and stained with hematoxylin-eosin. The char-acteristics of the pathological tissues were then observed under a light microscope.


Cheng P et al . Gastric juice and esophageal adenocarcinoma

Statistical analysisThe incidence rates of inflammation, intestinal metapla-sia, intestinal metaplasia with dysplasia, and adenocarci-noma in the esophagus and forestomach were analyzed and compared using χ 2 tests with SPSS software. Intralu-minal pH of the forestomach was compared using t tests. Intraluminal bile of the forestomach was compared using χ 2 tests. The level of significance was set at P < 0.05.

RESULTSTwenty-five model and 29 control rats survived. Six rats died, and the mortality rate was 10%.

pH and bile in the forestomach There were no significant differences in intraluminal pH (t = 0.117, P = 0.925) (Table 1) or bile (χ 2 = 0.036, P = 0.85) (Table 1) in the forestomach between the time of esoph-agoduodenostomy and 40 wk after the operation in the model rats. There were also no significant differences in pH (t = 0.006, P = 0.99 and t = 0.20, P = 0.87) (Table 1) or bile (χ 2 = 0.218, P = 0.64 and χ 2 = 0.466, P = 0.495) (Table 1) in the forestomach between model and control rats at the time of esophagoduodenostomy and 40 wk after the operation.

Gross specimensIn the sham-operated group, the esophagus and fore-stomach walls were thin, the mucosa was smooth, and the blood vessels below the mucous membrane were vis-ible with occasional changes consistent with congestive

inflammation. In the animal models, inflammation and intestinal metaplasia differed in the esophagus and fore-stomach. Inflammation appeared as mucosal hyperplasia characterized by a thickened, rough surface with both small and large kernels or mild erosion and ulceration. Intestinal metaplasia appeared as a smooth and velvet-like surface. Adenocarcinoma in the forestomach had not de-veloped. However, adenocarcinoma in the esophagus had developed and was characterized by nodular hyperplasia, ulceration, and a fish-like appearance (Figure 1).

Histological characteristics Normal forestomach and esophageal epithelia appeared as stratification of squamous epithelium in neat rows, and some showed keratinization. Inflammation in the fore-stomach and esophagus appeared as hyperplasia of scaly epithelial basal cells, excessive keratinization of papillo-matosis, visible neutrophilic granulocytes, infiltration of lymphoepithelioid cells, and mucosal erosion and edema of the submucosa and lower layer of the mucosa. Intes-tinal metaplasia was characterized by replacement of the squamous mucosa with simple columnar epithelium. EAC was characterized by severe intestinal metaplasia with dys-plasia, pathological invasion of the basilar membrane, and some invasion of the blood or lymphatic vessels (Figure 2).

Incidence rates of inflammation, intestinal metaplasia, and adenocarcinoma in the forestomach and esophagus 40 wk after surgery The incidence of intestinal metaplasia (88%) or intestinal metaplasia with dysplasia and adenocarcinoma (28%) in the esophagus in model rats was higher than in the con-trol rats 40 wk after surgery (χ 2 = 43.06, P < 0.001 and χ 2 = 9.33, P = 0.002, respectively) (Table 2). In model rats, the incidence of inflammation in the esophagus and forestomach was 100% and 96%, respectively (χ 2 = 1.02, P = 0.31). However, the rates of intestinal metaplasia (8%) and intestinal metaplasia with dysplasia and adenocar-cinoma (0%) in the forestomach were lower than those in the esophagus (χ 2 = 32.05, P < 0.001 and χ 2 = 8.14, P = 0.004, respectively) (Table 2). In a comparison of model and control rats 40 wk after creating the models, the incidence of inflammation in the forestomach was 96% and 6.8%, respectively (χ 2 = 42.70, P < 0.001), and the incidence of intestinal metaplasia was 12% and 3.4%, respectively (χ 2 = 1.43, P = 0.32).

DISCUSSIONRat stomach has a nonglandular forestomach and glan-


Model (n = 25) Control (n = 29)

pH (mean ± SD) Bile positive (n ) pH (mean ± SD) Bile positive (n )

At the time of esophagoduodenostomy 3.22 ± 0.29 2 3.23 ± 0.29 3 40 wk after esophagoduodenostomy 3.24 ± 0.31 2 3.25 ± 0.25 4

Table 1 Intraluminal pH and bile positive in the forestomach between the time of esophagoduode-nostomy and 40 wk after esophagoduodenostomy

A B C D

Figure 1 Gross specimens changes in the esophagus and forestomach mucosa in the sham-operated and model groups. A, B: Gross esophageal specimens of the sham-operated group (A) and animal model group (B); C, D: Gross forestomach specimens of the sham-operated group (C) and animal model group (D).



anatomical and histological points of view; especially for studying the mechanism of action of human esophageal cancer[18]. However, several attempts to demonstrate simi-lar reactivity for the esophageal and forestomach mucosa in various species have been unsuccessful.

GERD refers to conditions in which gastric and duodenal contents are regurgitated into the esophagus, which causes pathological mucosal lesions and esopha-geal changes[19]. Gastroesophageal reflux could cause EAC. The incidence rate of the latter has increased sig-nificantly in recent years and has taken the lead among all tumors[20]. The yearly increase in the incidence of GERD has been accompanied with an increasing trend in the incidence of EAC. Clinical epidemiology has shown that gastroesophageal reflux correlates closely with EAC[21].

The mechanism of induction of EAC by gastro-esophageal reflux has been a hot research topic[22]. Recent studies have shown that reflux of both gastric and duo-denal juice can damage the esophageal mucosa[23]. How-

dular portions separated by the limiting ridge. The fore-stomach, which is the proximal compartment of the stomach in many animal species, is especially well devel-oped in rats. Its function is storage and predigestion of food, and histologically it is covered with esophageal-type mucosa; thus, the rodent forestomach is considered to be a dilation of the lower esophagus. In small laboratory rodents that are commonly used for carcinogenicity stud-ies (rats, mice and hamsters), the forestomach comprises about 50% of the gastric surface[16].

The issues discussed above raise obvious questions about the predictive value of forestomach carcinogen-esis. Indeed, the chronic animal study is regarded as the most predictive test for carcinogenicity in humans, and anatomical or physiological interspecies differences that might result in different tumor patterns are gener-ally tolerated without seriously affecting the weight of evidence[17]. It would be provocative to consider the forestomach as a model for the human esophagus from

A B C

D E F

Figure 2 Changes in the esophagus and forestomach mucosa in the sham-operated and model groups under light microscope (200×). A: Normal esophagus in the sham-operated group; B: Esophagitis and Barrett’s esophagus in the model group; C: Intestinal metaplasia with dysplasia and esophageal adenocarcinoma in the model group; D: Normal forestomach in the sham-operated group; E, F: Inflammation in the forestomach of the model group.

Inflammation Intestinal metaplasia Intestinal metaplasia with dysplasia Adenocarcinoma

Control esophagus (n = 29) 2 (6.8) 1 (3.4) 0 0 Model esophagus (n = 25) 24 (96) 22 (88) 5 (20) 2 (8) Control forestomach (n = 29) 2 (6.8) 1 (3.4) 0 0 Model forestomach (n = 25) 25 (100) 2 (8) 0 0

Table 2 Incidence of inflammation, intestinal metaplasia, intestinal metaplasia with dysplasia, and adenocar-cinoma in the esophagus and forestomach 40 wk after surgery n (%)



ever, which contents are related to induction of EAC by gastroesophageal reflux is still controversial[24].

Gastric acid is considered to be an important factor in GERD[25]. Gastric acid and duodenal juice reflux is the main cause of GERD, and gastric acid has always been regarded as the major risk element in GERD; the main clinical treatment of which is acid suppression[5]. Howev-er, because of the rapid increase in the incidence of EAC, the role of gastric acid in the development of GERD re-mains controversial. Proton-pump inhibitors (PPIs) have not prevented recent increases in EAC[26]. Three large studies have examined PPI usage and EAC risk in Barrett’s esophagus patients; each reporting a strong inverse cor-relation. Two studies have shown a decreased risk with longer duration of PPIs, and one an increased risk with delayed PPI use[27].

We investigated the effects of gastric acid on intesti-nal metaplasia with dysplasia and malignant transforma-tion of stratified squamous epithelium in the forestom-ach to study the specific factors involved in the induction of EAC through the surgical establishment of an animal model of duodenogastric reflux.

Surgical establishment of a duodenogastroesophageal reflux rat model showed that the forestomach developed abnormal changes. Most of the lesions were inflammatory (including mucosal damage); very few had intestinal meta-plasia, and none had intestinal metaplasia with dysplasia or adenocarcinoma. As a result of surgical retention of the vagus nerve to maintain gastric acid secretion, the pH val-ue in the forestomach was unchanged after the operation. The absence of bile detection explained why there was no obvious duodenal juice reflux in the forestomach. These results indicate that the simple lack of food and long-term stimulation of gastric juice might not cause the stratified squamous epithelium of intestinal metaplasia with dyspla-sia or adenocarcinoma. The histological structure of the forestomach and esophagus of the rat is the same: both comprise stratified squamous epithelial cells. It can be concluded that long-term stimulation by gastric juice of esophageal stratified squamous epithelial cells may only cause inflammation, mucosal damage, and mild intestinal metaplasia, but no induction of intestinal metaplasia with dysplasia or adenocarcinoma.

However, due to the small sample size of the study, the observation time was short, and there may be some limitations to the results. Nevertheless, the result provides new ideas and methods for the pathogenesis of EAC.

COMMENTSBackgroundThe incidence of esophageal adenocarcinoma (EAC) is currently rising faster than any other cancers in the Western world, although the cause of this in-crease is largely unknown. However, the relationship between the specific reflux components and the induction of EAC remains unclear. Research frontiersGastroesophageal reflux can cause EAC, and the mechanisms have been the subject of extensive research. The specific gastroesophageal reflux compo-nents responsible for EAC remain largely unknown. In this study, the authors demonstrated that stimulation of long-term gastric juice on esophageal stratified

squamous epithelial cells may only cause inflammation, mucosal damage, and mild intestinal metaplasia, but no induction of intestinal metaplasia with dyspla-sia or adenocarcinoma.Innovations and breakthroughsRecent reports have highlighted the importance of duodenal juice in the patho-genesis of EAC. This study indicates that forestomach gastric juice exposure does not cause adenocarcinogenesis. The results of this study therefore sug-gest that gastric juice plays no role in the pathogenesis of EAC.ApplicationsBy understanding of the roles of gastric juice in the pathogenesis of EAC, this study may represent a future strategy for therapeutic intervention in the treat-ment of patients with EAC.TerminologyMetaplasia is the reversible replacement of one differentiated cell type with another mature differentiated cell type. Dysplasia is an expansion of immature cells, with a decrease in the number and location of mature cells. Duodenogas-troesophageal reflux is esophagus exposure to gastric and duodenal juice.Peer reviewThe manuscript proposes interesting aspects of the development of EAC (Bar-rett’s esophagus and carcinoma), although contradictory to the current and past literature.

REFERENCES1 Lagergren J. Adenocarcinoma of oesophagus: what exactly is

the size of the problem and who is at risk? Gut 2005; 54 (Suppl 1): i1-i5 [PMID: 15711002 DOI: 10.1136/gut.2004.041517]

2 Hongo M, Nagasaki Y, Shoji T. Epidemiology of esophageal cancer: Orient to Occident. Effects of chronology, geography and ethnicity. J Gastroenterol Hepatol 2009; 24: 729-735 [PMID: 19646015 DOI: 10.1111/j.1440-1746.2009.05824.x]

3 Pohl H, Welch HG. The role of overdiagnosis and reclas-sification in the marked increase of esophageal adenocarci-noma incidence. J Natl Cancer Inst 2005; 97: 142-146 [PMID: 15657344 DOI: 10.1093/jnci/dji024]

4 Lee IS, Choi SC, Shim KN, Jee SR, Huh KC, Lee JH, Lee KJ, Park HS, Lee YC, Jung HY, Park HJ. Prevalence of Barrett’s esophagus remains low in the Korean population: nation-wide cross-sectional prospective multicenter study. Dig Dis Sci 2010; 55: 1932-1939 [PMID: 19798574 DOI: 10.1007/s10620-009-0984-0]

5 Theisen J, Peters JH, Stein HJ. Experimental evidence for mu-tagenic potential of duodenogastric juice on Barrett’s esopha-gus. World J Surg 2003; 27: 1018-1020 [PMID: 14560365 DOI: 10.1007/s00268-003-7055-z]

6 Fujikawa H, Saijyo T, Ito S, Ii K. [Studies of experimental model of reflux esophagitis in rats by ligature on both lower portion of duodenum and most of forestomach]. Nihon Sho-kakibyo Gakkai Zasshi 1994; 91: 829-838 [PMID: 8170054]

7 Orel R, Vidmar G. Do acid and bile reflux into the esopha-gus simultaneously? Temporal relationship between duo-denogastro-esophageal reflux and esophageal pH. Pediatr Int 2007; 49: 226-231 [PMID: 17445043 DOI: 10.1111/j.1442-200X.2007.02338.x]

8 Kauer WK, Stein HJ. Emerging concepts of bile reflux in the constellation of gastroesophageal reflux disease. J Gastro-intest Surg 2010; 14 (Suppl 1): S9-16 [PMID: 19756880 DOI: 10.1007/s11605-009-1014-4]

9 Chen KH, Mukaisho K, Sugihara H, Araki Y, Yamamoto G, Hattori T. High animal-fat intake changes the bile-acid com-position of bile juice and enhances the development of Bar-rett’s esophagus and esophageal adenocarcinoma in a rat du-odenal-contents reflux model. Cancer Sci 2007; 98: 1683-1688 [PMID: 17868414 DOI: 10.1111/j.1349-7006.2007.00605.x]

10 Miyashita T, Ohta T, Fujimura T, Ninomiya I, Fushida S, Hattori T, Miwa K. Duodenal juice stimulates oesophageal stem cells to induce Barrett’s oesophagus and oesophageal adenocarcinoma in rats. Oncol Rep 2006; 15: 1469-1475 [PMID: 16685381]

COMMENTS



11 Miyashita T, Miwa K, Fujimura T, Ninomiya I, Fushida S, Shah FA, Harmon JW, Hattori T, Ohta T. The severity of duodeno-esophageal reflux influences the development of different histological types of esophageal cancer in a rat model. Int J Cancer 2013; 132: 1496-1504 [PMID: 22961324 DOI: 10.1002/ijc.27824]

12 Freedman J, Ye W, Näslund E, Lagergren J. Association be-tween cholecystectomy and adenocarcinoma of the esopha-gus. Gastroenterology 2001; 121: 548-553 [PMID: 11522738]

13 Theisen J, Peters JH, Fein M, Hughes M, Hagen JA, De-meester SR, Demeester TR, Laird PW. The mutagenic poten-tial of duodenoesophageal reflux. Ann Surg 2005; 241: 63-68 [PMID: 15621992]

14 Zhang T, Zhang F, Han Y, Gu Z, Zhou Y, Cheng Q, Zhu Y, Zhang C, Wang Y. A rat surgical model of esophageal metaplasia and adenocarcinoma-induced by mixed reflux of gastric acid and duodenal contents. Dig Dis Sci 2007; 52: 3202-3208 [PMID: 17393326 DOI: 10.1007/s10620-007-9774-8]

15 Chen H, Li X, Ge Z, Gao Y, Chen X, Cui Y. Rabeprazole combined with hydrotalcite is effective for patients with bile reflux gastritis after cholecystectomy. Can J Gastroenterol 2010; 24: 197-201 [PMID: 20352149]

16 Aqeilan RI, Hagan JP, Aqeilan HA, Pichiorri F, Fong LY, Croce CM. Inactivation of the Wwox gene accelerates forestomach tumor progression in vivo. Cancer Res 2007; 67: 5606-5610 [PMID: 17575124 DOI: 10.1158/0008-5472.CAN-07-1081]

17 Oba M, Miwa K, Fujimura T, Harada S, Sasaki S, Oyama K, Ohta T, Hattori T. A selective cyclooxygenase-2 inhibitor prevents inflammation-related squamous cell carcinogen-esis of the forestomach via duodenogastric reflux in rats. Cancer 2009; 115: 454-464 [PMID: 19110997 DOI: 10.1002/cncr.23990]

18 Proctor DM, Gatto NM, Hong SJ, Allamneni KP. Mode-of-action framework for evaluating the relevance of rodent forestomach tumors in cancer risk assessment. Toxicol Sci 2007; 98: 313-326 [PMID: 17426108 DOI: 10.1093/toxsci/

kfm075]19 Armstrong D, Sifrim D. New pharmacologic approaches

in gastroesophageal reflux disease. Gastroenterol Clin North Am 2010; 39: 393-418 [PMID: 20951909 DOI: 10.1016/j.gtc.2010.08.019]

20 Holmes RS, Vaughan TL. Epidemiology and pathogenesis of esophageal cancer. Semin Radiat Oncol 2007; 17: 2-9 [PMID: 17185192 DOI: 10.1016/j.semradonc.2006.09.003]

21 Buxbaum JL, Eloubeidi MA. Endoscopic evaluation and treatment of esophageal cance. Minerva Gastroenterol Dietol 2009; 55: 455-469 [PMID: 19942829]

22 Herbella FA, Patti MG. Gastroesophageal reflux disease: From pathophysiology to treatment. World J Gastroenterol 2010; 16: 3745-3749 [PMID: 20698035 DOI: 10.3748/wjg.v16.i30.3745]

23 Lahiri S, Singh P, Singh S, Rasheed N, Palit G, Pant KK. Melatonin protects against experimental reflux esophagitis. J Pineal Res 2009; 46: 207-213 [PMID: 19067786 DOI: 10.1111/j.1600-079X.2008.00650.x]

24 Grotenhuis BA, van Lanschot JJ, Dinjens WN, Wijnhoven BP. The pathogenesis of Barrett’s metaplasia and the pro-gression to esophageal adenocarcinoma. Recent Results Can-cer Res 2010; 182: 39-63 [PMID: 20676870 DOI: 10.1007/978-3-540-70579-6_4]

25 Miner PB. Review article: physiologic and clinical effects of proton pump inhibitors on non-acidic and acidic gastro-oesophageal reflux. Aliment Pharmacol Ther 2006; 23 (Suppl 1): 25-32 [PMID: 16483267 DOI: 10.1111/j.1365-2036.2006.02802.x]

26 Attwood SE, Harrison LA, Preston SL, Jankowski JA. Esoph-ageal adenocarcinoma in “mice and men”: back to basics! Am J Gastroenterol 2008; 103: 2367-2372 [PMID: 18844624 DOI: 10.1111/j.1572-0241.2008.02004.x]

27 Islami F, Kamangar F, Boffetta P. Use of proton pump in-hibitors and risk of progression of Barrett’s esophagus to neoplastic lesions. Am J Gastroenterol 2009; 104: 2646-2648 [PMID: 19806109 DOI: 10.1038/ajg.2009.369]

P- Reviewer Gockel I S- Editor Huang XZ L- Editor A E- Editor Li JY


Endoscopic papillary balloon intermittent dilatation and endoscopic sphincterotomy for bile duct stones

Bai-Qing Fu, Ya-Ping Xu, Li-Sheng Tao, Jun Yao, Chun-Suo Zhou

Bai-Qing Fu, Ya-Ping Xu, Li-Sheng Tao, Jun Yao, Chun-Suo Zhou, Department of Gastroenterology, the People’s Hospital, Affiliated to Jiangsu University, Zhenjiang 212002, Jiangsu Prov-ince, ChinaAuthor contributions: Xu YP designed the research; Yao J and Zhou CS performed the research; Tao LS analyzed the data; Fu BQ wrote the paper. Correspondence to: Ya-Ping Xu, Chief Physician, Depart-ment of Gastroenterology, the People’s Hospital, Affiliated to Jiangsu University, 8 Dianli Road, Zhenjiang 212002, Jiangsu Province, China. [email protected]: +86-511-88915641 Fax: +86-511-85234387Received: November 6, 2012 Revised: January 25, 2013Accepted: February 5, 2013Published online: April 21, 2013

AbstractAIM: To compare the effectiveness and safety of endo-scopic papillary balloon intermittent dilatation (EPBID) and endoscopic sphincterotomy (EST) in the treatment of common bile duct stones.

METHODS: From March 2011 to May 2012, endo-scopic retrograde cholangiopancreatography was per-formed in 560 patients, 262 with common bile duct stones. A total of 206 patients with common bile duct stones were enrolled in the study and randomized to receive either EPBID with a 10-12 mm dilated balloon or EST (103 patients in each group). For both groups a conventional reticular basket or balloon was used to remove the stones. After the procedure, routine endo-scopic nasobiliary drainage was performed.

RESULTS: First-time stone removal was successfully performed in 94 patients in the EPBID group (91.3%) and 75 patients in the EST group (72.8%). There was no statistically significant difference in terms of operation time between the two groups. The overall incidence of early complications in the EPBID and EST groups was 2.9% and 13.6%, respectively, with no deaths reported during the course of the study and

follow-up. Multiple regression analysis showed that the success rate of stone removal was associated with stone removal method [odds ratio (OR): 5.35; 95%CI: 2.24-12.77; P = 0.00], the transverse diameter of the stone (OR: 2.63; 95%CI: 1.19-5.80; P = 0.02) and the presence or absence of diverticulum (OR: 2.35; 95%CI: 1.03-5.37; P = 0.04). Postoperative pancre-atitis was associated with the EST method of stone removal (OR: 5.00; 95%CI: 1.23-20.28; P = 0.02) and whether or not pancreatography was performed (OR: 0.10; 95%CI: 0.03-0.35; P = 0.00).

CONCLUSION: The EPBID group had a higher suc-cess rate of stone removal with a lower incidence of pancreatitis compared with the EST group.


Key words: Endoscopic papillary balloon dilatation; En-doscopic retrograde cholangiopancreatography; Endo-scopic sphincterotomy; Common bile duct stones; Suc-cess rate

Core tip: Previous studies have shown that endoscopic papillary balloon dilatation with a 8 mm dilated balloon and endoscopic sphincterotomy (EST) have similar success rates in terms of stone removal. The incidence of postoperative pancreatitis with these procedures is high, so its application is limited. We compared the safety and efficacy of endoscopic papillary balloon in-termittent dilatation, with an increase in dilated balloon diameter (10-12 mm) and extended dilatation time, and EST in the treatment of common bile duct stones (transverse diameter ≤ 12 mm).

Fu BQ, Xu YP, Tao LS, Yao J, Zhou CS. Endoscopic papillary balloon intermittent dilatation and endoscopic sphincterotomy for bile duct stones. World J Gastroenterol 2013; 19(15): 2425-2432 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2425.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2425

BRIEF ARTICLE





INTRODUCTIONEndoscopic retrograde cholangiopancreatography (ERCP) has gradually replaced a surgical operation and become the preferred method for the treatment of common bile duct stones because of its minimal invasiveness and low cost. There are two main ERCP methods for treating choledocholithiasis: endoscopic papillary balloon dilata-tion (EPBD) and endoscopic sphincterotomy (EST). Previous studies have shown that EPBD with an 8 mm dilated balloon and EST have similar success rates in terms of stone removal. The incidence of postoperative pancreatitis with these procedures is high[1], so their ap-plication is limited. In recent years, some studies showed that the incidence of postoperative pancreatitis was re-duced when the dilatation diameter was larger and the dilatation time was extended during EPBD[2,3]. However, few studies have compared EST and EPBD which had an increased dilatation diameter and extended dilatation time. We compared the safety and efficacy of endoscopic papillary balloon intermittent dilatation (EPBID) and EST in the treatment of common bile duct stones (trans-verse diameter ≤ 12 mm) after increasing the dilated bal-loon diameter (10-12 mm) and extending the dilatation time. This study was conducted at the People’s Hospital affiliated to Jiangsu University. The study was approved by the hospital’s ethics committee.

MATERIALS AND METHODSClinical data From March 2011 to May 2012, ERCP was performed at our hospital on common bile duct stones and a medi-cal X-ray gauge (Philips EasyDiagnost 4.0) was used to measure the transverse diameter of stones. During this period, 206 consecutive patients (97 male, 109 female) with a stone transverse diameter of ≤ 12 mm were iden-tified. Patient age ranged from 15 to 93 years (median: 61 years). Patients who had previously undergone EPBD or EST for stone removal, distal common bile duct stenosis, stones with transverse diameters greater than 12 mm, se-vere coagulation dysfunction, hepatobiliary and/or pan-creatic duct malignant tumor, or calculus incarceration in the duodenal papilla were excluded from the study.

According to the requirement of randomized con-trolled trials, the treatment schemes were randomly generated and put into sealed capsules. After the bile duct cannula was successfully performed, the research-ers randomly chose a capsule to allocate patients into the EPBID or EST group. Neither the patients nor the en-doscopy doctors were aware of the treatment option the patient would receive. There were specialized researchers observing and recording the experimental procedures to ensure that the experiment was conducted according to the appropriate procedures.

EPBID and EST procedures Equipment included an Olympus JF-240/TJF-240 elec-

tronic duodenoscope, standard radiographic catheters, smart-type pulling papillotome, Boston 30 mm × 10 mm dilating balloon (balloon length 30 mm, maximum dilated diameter 12 mm), ERBE200 high-frequency electrosurgi-cal generator, mechanical lithotripsy basket, reticular bas-ket and balloon catheter.

Preoperative preparations: all patients were asked to fast for 12 h prior to the start of the procedure. Scopol-amine butylbromide (10 mg), dolantin (50 mg) and va-lium (10 mg) were injected intramuscularly 20 min before the start of the procedure to suppress intestinal peristal-sis, alleviate pain and provide sedation. Lidocaine hydro-chloride mucilage was used to provide local anesthesia of the throat.

EPBID procedure: The presence of common bile duct stones (maximum diameter less than or equal to 12 mm) was confirmed by cholangiography. Based on the stone size, the balloon was dilated to 10-12 mm using a pres-sure pump. The pressure was maintained for about 1 min and removed after 30 s. One minute pressure followed by 30 s relaxation was repeated two more times (total dilata-tion time: 3 min).

EST procedure: The presence of common bile duct stones (maximum diameter less than or equal to 12 mm) was confirmed by cholangiography. Endoscopic sphinc-terotomy was performed at an 11/12 o’clock position. The incision length (medium-large incision) was deter-mined according to the stone size.

Steps performed similarly within the two groups: Use of a reticular basket or balloon catheter to remove the common bile duct stones, use of mechanical lithotripsy basket to break the stones or expand the incision length or increase the dilated balloon diameter if stone removal failed. If another failure occurred, the application of an indwelling nasobiliary tube and scheduling for ERCP on a different day, or a referral for a surgical operation was given. The nasobiliary tube was inserted into all patients after the procedure, and 3 d later nasobiliary duct radiog-raphy was performed to check for residual stones.

Observation indices Operation time: The time taken from the beginning of papilla incision or dilatation until the end of stone removal.

Lithotomy success or failure: Complete removal of the stones using a conventional reticular basket or bal-loon was deemed a success. The following scenarios were all considered as failed lithotomy: removal of the stones through mechanical lithotripsy, expanding endoscopic incision or increasing the balloon dilatation diameter, referral for surgery, or identifying residual stones in post-operative nasobiliary drainage radiography.

Postoperative clinical symptoms and laboratory pa-rameters: Postoperative clinical symptoms and labora-


Fu BQ et al . Endoscopic treatments for bile duct stones

tory parameters including abdominal pain, tenderness, nausea, vomiting, fever and melena 4, 12 and 24 h after the procedure, and blood amylase were recorded.

Follow up: One month after operation, the patients were followed up by telephone to check for any symptoms.

Assessment of complications ERCP postoperative pancreatitis was diagnosed us-ing the following criteria: No pancreatitis existed before the procedure; 4 h after the procedure, the blood amylase level was increased to over 3 times higher than the upper normal limit accompanied by abdominal pain, nausea and vomiting, fever or signs of peritoneal irritation and other clinical symptoms; or morphological changes of the pan-creas were detected via imaging techniques.

Endoscopic bleeding observed: ERCP postoperative bleeding was defined as having hematemesis, melena and other clinical manifestations accompanied by a decrease in hemoglobin levels (at least 2 g/dL)[4-7], after the exclusion of other possible causes for upper gastrointestinal bleed-ing. Endoscopic bleeding observed during the procedure was not considered as ERCP postoperative bleeding.

Other complications: Patients were considered to have biliary infections if they had a body temperature above 38 ℃, right upper abdominal pain, and increased total leukocyte and neutrophil differential counts. Gastroin-testinal perforation was diagnosed in the presence of abdominal pain and radiographic evidence.

Statistical analysisStata7.0 was used for statistical analysis. Measurement data

were expressed as mean ± SD and compared using the Student t test. Numerical data were compared using the χ 2 test. Logistic regression analysis was applied to evalu-ate the success rate of the procedures and the incidence rates of complications. Regression analysis was performed to determine any correlations of success rate of the procedures, postoperative pancreatitis and postoperative bleeding with respect to sex, age (< 60 and ≥ 60 group), presence of a diverticulum near papilla, diameter of the common bile duct (< 12 mm and ≥ 12 mm), maximum transverse diameter of the stone (< 10 mm and 10-12 mm), number of stones (1 or ≥ 2), application of pre-cut, stone removal methods, and use of pancreatography (if the guide wire was inserted into the bile duct more than 4 times it was considered as pancreatography). Statis-tical significance for all tests was set at P < 0.05.

RESULTSComparison between general data of the two groups of patientsThe differences in sex, age, common bile duct diameter, transverse diameter of the stone, and number of stones between the two groups were not statistically significant (P > 0.05, Table 1).

Comparison between success rates of stone removal by the two methods First-time stone removal was successfully carried out in 94 cases in the EPBID group (91.3%) and in 75 cases in the EST group (72.8%). The success rate of stone removal in the EPBID group was significantly higher than that of the EST group (P < 0.05, Figure 1; Table 2). For those with a transverse stone diameter of < 10 mm, the success rate of stone removal in the EPBID and EST groups was 53 out of 54 (98.1%), and 55 out of 71 (77.5%), respectively. The difference between the two groups was statistically significant (P < 0.05, Table 2). For the group of patients with stone transverse diameters of 10-12 mm, the stone-removal success rate of the EPBID


Group EPBID EST P value

Success rate of stone removal 94/103 75/103 0.00 Transverse diameter of stone < 10 mm 53/54 55/71 0.00 Transverse diameter of stone ≥ 10 mm 41/49 20/32 0.03 Operation time (min) 9.86 ± 5.21 9.03 ± 4.92 0.29

Table 2 Comparison of success rate and stone removal time between the two stone removal methods


Male/female 52/51 45/58 0.33 Age (yr) 61.83 ± 17.36 60.48 ± 14.69 0.55 Common bile duct diameter (mm) 12.74 ± 2.79 12.55 ± 3.05 0.65 Transverse diameter of stone (mm) 8.38 ± 2.67 7.71 ± 2.35 0.06 No. of stones 2.17 ± 1.43 1.89 ± 1.37 0.15

Table 1 Comparison of characteristics of the two groups of patients

EPBID: Endoscopic papillary balloon intermittent dilatation; EST: Endo-scopic sphincterotomy.


Success Pancreatitis Bleeding Result

EPBIDEST

100%

80%

60%

40%

20%

0%

Figure 1 Comparison of case numbers of successful lithotomy, postopera-tive pancreatitis, and postoperative bleeding of the two groups. EPBID: Endo-scopic papillary balloon intermittent dilatation; EST: Endoscopic sphincterotomy.



3). Overall, no perforations and postoperative cholangitis was observed in any patient. The doctors evaluating the postoperative complications of the patients did not know which treatment methods had been used for the treatment of each particular patient.

The success rate of stone removal was related to the stone removal method, the presence or absence of pa-pilla diverticulum, and the maximum transverse diameter of the common bile duct stones (< 10 mm vs 10-12 mm group) (P < 0.05, Tables 4 and 5). Postoperative pancre-atitis was related to whether pancreatography was per-formed, and the method used for stone removal (P < 0.05, Tables 6 and 7). This study did not identify risk factors related to postoperative bleeding.

DISCUSSIONThe ERCP procedure has become the main method for the treatment of common bile duct stones because it is less invasive and has a lower cost than EST. Kawai et al[8] first reported on EST; since then, EST has been widely accepted as an option in the clinical management of the disease and has gradually replaced surgical operations. However, since EST causes damage to the papilla sphinc-ter, it is generally believed to have a negative lasting im-pact on papilla sphincter function. In 1983, Staritz et al[9]

introduced EPBD for the first time. Since EPBD does not require sphincterotomy, it is believed that EPBD can better protect sphincter function compared with EST, whereas EST results in a permanent loss of sphincter function[10,11]. However, Takezawa et al[12] suggested that the difference between the two methods in protecting papilla sphincter function is not statistically significant. Both domestic and international research studies showed that, compared with EPBD, EST had a higher stone recurrence rate[13-15]. Most recently, a method that uses larger dilated balloons (EPLBD) that requires a small incision has been performed for larger stones[16-21]. Kim et al[18] showed that for the stones with a transverse diameter greater than 10 mm, the first-time success rate of stone removal by EPLBD is higher than that of simple sphinc-terotomy. In addition, EPBLD can reduce the probability of mechanical lithotripsy with no additional incidence of complications.

Yu et al[22] indicated that the difference in the suc-cess rate for stone removal between EST and EPBD was not statistically significant. Their overall success rate of stone removal for EST and EPBD was 97.5% and 98.1% respectively (first-time success rate of 70% and 65%, respectively). In our study however, the success rate of stone removal of the EPBID group (91.3%) was significantly higher than that of the EST group (72.8%). Conventional EPBD usually uses smaller dilated balloon diameters (around 8 mm) and a short dilatation time. However, in this investigation, the dilatation diameter was larger, and the dilatation time was extended making the pathway of stone removal wider and leading to a higher success rate of stone removal. Multiple regression analy-sis showed that the success rate of stone removal was

and EST groups was 41 out of 49 (83.7%) and 20 out of 32 (62.5%), respectively, with statistical significance (P < 0.05, Table 2) favoring the EPBD group.

Comparison between the operation times of the two successful stone removal methodsThe stone removal time for the EPBD and EST groups were 9.86 ± 5.21 min and 9.03 ± 4.92 min, respectively, and showed no significant difference (P > 0.05, Table 2).

Outcome after failure of the two stone removal methods In the EPBID group a total of 9 cases failed of which 3 were transferred for surgical operations; 3 were referred for mechanical lithotripsy, and 2 underwent an increase in dilated balloon diameter. Radiography found residual stones in one patient in the EPBID group who subse-quently underwent ERCP a second time.

In the EST group a total of 28 cases failed, of which 2 were transferred to surgical operations, 3 underwent enlargement of the incision, 9 were transferred to receive balloon dilatation, and 4 received mechanical lithotripsy. Through radiography, residual stones in 10 patients of the EST group were found, for which the ERCP proce-dure was performed a second time.

Comparison of postoperative complications In the EPBID and EST groups there were 88 cases with-out pancreatitis before the operation. Three patients in the EPBID group reported postoperative pancreatitis while 11 patients in the EST group reported postoperative pan-creatitis. All the cases of pancreatitis were mild. The inci-dence of pancreatitis in the EPBID group was statistically significantly lower than in the EST group (3.4% vs 12.5%; P < 0.05; Figure 1; Table 3). For the group of patients who had stones with a transverse diameter < 10 mm, the incidence of pancreatitis in the EPBID and EST groups was 0% (0 out of 43) and 11.5% (7 out of 61), respec-tively, and showed a clinically significant difference favor-ing the EPBID group (P < 0.05, Table 2). For the group of patients with stones of a transverse diameter of 10-12 mm, the incidence of pancreatitis in the EPBID group was 6.7% (3 out of 45) and the incidence of pancreatitis in the EST group was 14.8% (4 out of 27), with no sig-nificant difference (P > 0.05, Table 2). Also, no significant difference was seen between the 2 groups in terms of the incidence of postoperative bleeding (0% in EPBID group and 2.9% in EST group; P > 0.05, Figure 1; Table


Pancreatitis 3/88 11/88 0.03 Transverse diameter of stone < 10 mm 0/43 7/61 0.04 Transverse diameter of stone ≥ 10 mm 3/45 4/27 0.41 Bleeding 0/103 3/103 0.25

Table 3 Comparison of postoperative complications




related to the method of stone removal, the transverse diameter of the stones and the presence or absence of diverticulum. Often, when the transverse diameter of a stone is larger it is more difficult to remove. In these cas-es, mechanical lithotripsy, enlargement of the incision or increasing the dilated balloon diameter may be required. In this investigation, no significant difference between the two groups was seen in terms of stone removal time.

Liu et al[1] indicated that EPBD had a much lower incidence of postoperative bleeding than EST, but its incidence of postoperative pancreatitis was significantly higher than that of EST. The mechanism of the devel-opment of EPBD-induced postoperative pancreatitis is thought to be due to compartment syndrome. Two hours after EPBD procedures, the papilla develops in-flammatory edema. The papillary sphincter does not relax sufficiently, which restricts the expansion of the internal contents and results in compartment syndrome. This finally leads to poor drainage of pancreatic fluid and postoperative pancreatitis[2,23]. We believe that if the balloon diameter is small in EPBD, bile will not be easily discharged and would flow back to the pancreatic duct, thus increasing the risk of pancreatitis; in addition, the smaller the dilatation diameter, the slower the removal of the stone. The reticular basket or balloon is required to

be repeatedly moved forward and backward through the papilla passage, which could induce further tissue edema. In our investigation, by increasing the dilated balloon di-ameter, and the time of intermittent dilatation (the total time of dilatation was three minutes), the papilla sphinc-ter was torn apart and fully relaxed, alleviating papillary edema and reducing the obstruction of the pancreatic duct. Therefore, postoperative bile excretion was easier and reduced the risk of postoperative pancreatitis.

The results of this study also suggest that the risk of postoperative pancreatitis is related to whether pancrea-tography was performed as well as the method of stone removal. In the course of pancreatography, contrast me-dium bubbles enter the pancreatic duct, and the internal pressure of the pancreatic duct increases making the pan-creas prone to inflammation. If the guidewire repeatedly comes into the pancreatic duct it is highly likely to cause edema around the pancreatic duct orifice and would then contribute to postoperative pancreatitis. Ueki et al[24] showed that postoperative pancreatitis was related to pre-cut sphincterotomy (PST) because cannulation was often difficult in patients who received PST, and their operation time was longer, causing papillary edema. In this inves-tigation, there were a few cases of PST and the differ-ence in the incidence of pancreatitis between the groups had no statistical significance. The results of this study showed that in the EPBD group, 3 cases of postoperative pancreatitis occurred in those patients who had stones of < 10 mm in diameter. The development of pancreatitis was more common in the patients of the EST group who had stones of over 10 mm in diameter. However, because the sample size was small, statistical significance could not be shown. Previous studies suggest that the possibil-ity of EST postoperative bleeding was between 2.5% and 5%[6]. In this investigation the EST group had 3 patients who suffered from complicated postoperative bleeding

Factor Sample size Success Sample size Failure OR P value

Age (yr) 169 60.30 ± 16.62 37 64.60 ± 12.81 1.31 0.14 Sex 1.59 0.21 Male 83 49.11% 14 37.84% Female 86 50.89% 23 62.16% Papilla diverticulum 2.25 0.03 Yes 36 21.30% 14 37.84% No 133 78.70% 23 62.16% Papilla pre-cut 0.91 0.93 No 164 97.04% 36 97.30% Yes 5 2.96% 1 2.70% Performance of pancreatography 0.50 0.18 Yes 15 8.88% 6 16.22% No 154 91.12% 31 83.78% Stone removal method 3.90 0.00 EPBD 94 55.62% 9 24.32% EST 75 44.38% 28 75.68% Common bile duct diameter 169 12.38 ± 2.49 37 13.86 ± 4.21 3.26 0.00 Common bile duct stone number 169 2.02 ± 1.43 37 2.08 ± 1.32 1.65 0.82 Maximum transverse diameter of stone 169 7.81 ± 2.53 37 9.11 ± 2.28 2.08 0.00

Table 4 Clinical factors and success rate of stone removal

EPBID: Endoscopic papillary balloon intermittent dilatation; EST: Endoscopic sphincterotomy; OR: Odds ratio.

Factors b SE P value OR 95%CI

Stone removal method 1.68 0.44 0.00 5.35 2.24-12.77 Whether there is diverticulum 0.85 0.42 0.04 2.35 1.03-5.37 Stone transverse diameter 0.97 0.40 0.02 2.63 1.19-5.80 Constant term -3.22 0.48 0.00

Table 5 Multiple regression model to predict the success rate of stone removal

OR: Odds ratio.



while no patient in the EPBD group experienced compli-cated postoperative bleeding; however, due to the small sample size there was no statistical significance. There were no cases of duodenal perforations, cardiovascular accidents or other complications.

This study was different because of the increase in the dilated balloon diameter in EPBD and of the extend-ed time of intermittent dilatation. The first 1-min balloon dilatation tore apart the papilla sphincter; the second and the third 1-min balloon dilatations compressed the bleed-ing caused by the first dilatation tear and further tore the papilla sphincter, while avoiding long-time compression of the pancreatic duct orifice. This was intended to re-move the stone and reduce the incidence of postopera-tive pancreatitis. Results of this study indicate that by in-creasing the balloon dilatation diameter and extending the dilatation time in EPBD, bile duct stones with transverse diameters smaller than 12 mm could be removed in a quicker, more effective way compared with EST. The use of EPBD can also reduce significantly the incidence of postoperative pancreatitis. Bang et al[25] showed that con-tinuous endoscopic dilatations for 20 s and 60 s were not significantly different in the success rate of stone removal and in the incidence of postoperative pancreatitis. We believe that extending the papillary dilatation time to 60 s is still insufficient to fully clear the passage. Liao et al[3]

showed that continuous endoscopic dilatation for 5 min, rather than 1 min, resulted in a higher success rate of stone removal, and significantly decreased the incidence of postoperative pancreatitis. The results of this study showed that the EPBD group had a success rate of up to 98.1% for the removal of stones of a maximum trans-verse diameter of 10 mm. Therefore, properly increasing the dilatation diameter and extending the dilatation time can contribute to a higher success rate in stone removal and lower the risk of postoperative pancreatitis. How-ever, it should be noted that an excessive increase in the diameter of balloon dilatation could increase the chance of perforation. Theoretically speaking, the balloon dilata-tion diameter determines the size of the stones removed, and the method of using a 10 mm-diameter balloon for continuous dilatation for 5 min adopted by Liao et al[3] ap-plies to stones with a size of 15 mm. Therefore, further research is needed to provide more details on the optimal dilatation time and diameter as well as their relationship to the transverse diameter of the stone.

COMMENTSBackgroundCholedocholithiasis is a common disease in the gastroenterology clinic, and can cause biliary obstruction, acute obstructive suppurative cholangitis, acute pancreatitis, hepatic failure, gallstone shock, even threaten patient’s life. Endo-scopic retrograde cholangiopancreatography (ERCP) has gradually replaced surgery and become the preferred method for the treatment of common bile duct stones because of its minimal invasiveness and low cost. There are two main ERCP methods for treating choledocholithiasis: endoscopic papillary balloon dilatation (EPBD) and endoscopic sphincterotomy (EST). Since EPBD does not require sphincterotomy, it is believed that EPBD can protect sphincter function better than EST.Research frontiersPrevious studies have shown that EPBD with a 8 mm dilated balloon and EST have similar success rates in terms of stone removal. The incidence of postoperative pancreatitis with these procedures is high, so its application is

Factor Sample size No pancreatitis Sample size Pancreatitis OR P value

Age 162 60.33 ± 16.17 14 64.29 ± 14.58 1.09 0.38 Sex 1.51 0.47 Male 74 45.68% 5 35.71% Female 88 54.32% 9 64.29% Papilla diverticulum 1.75 0.34 Yes 39 24.07% 5 35.71% No 123 75.93% 9 64.29% Papilla pre-cut 8.83 0.05 No 159 98.15% 12 85.71% Yes 3 1.85% 2 14.29% Performance of pancreatography 0.12 0.00 Yes 13 8.02% 6 42.86% No 149 91.98% 8 57.14% Stone removal method 4.05 0.03 EPBD 85 52.47% 3 21.43% EST 77 47.53% 11 78.57% Common bile duct diameter 162 12.64 ± 2.98 14 13.86 ± 2.98 2.53 0.15 Common bile duct stone number 162 2.09 ± 1.46 14 1.43 ± 0.85 0.46 0.10 Transverse diameter of stone 162 8.17 ± 2.45 14 8.29 ± 2.64 1.49 0.86

Table 6 Clinical factors and incidence of postoperative pancreatitis

EPBID: Endoscopic papillary balloon intermittent dilatation; EST: Endoscopic sphincterotomy; OR: Odds ratio.

Factor b SE P value OR 95%CI

Performance of pancreatography -2.35 0.66 0.00 0.10 0.03-0.35 Stone removal method 1.61 0.71 0.02 5.00 1.23-20.28 Constant term -1.66 0.69 0.02

Table 7 Multiple regression model to predict the incidence of postoperative pancreatitis

OR: Odds ratio.

COMMENTS



limited. In recent years, some studies showed that the incidence of postopera-tive pancreatitis could be reduced when the dilatation diameter was larger and the dilatation time was extended during EPBD. Recent studies indicated that a small incision plus endoscopic papillary balloon intermittent dilatation (EPBID) had more advantages over EST in treating larger diameter (> 15 mm) common bile duct stones.Innovations and breakthroughsThere are few studies focusing on the comparison of EST and EPBID with increased dilatation diameter and extended dilatation time. We compared the safety and efficacy of EPBID and EST in the treatment of common bile duct stones (transverse diameter ≤ 12 mm) after increasing the dilated balloon diameter (10-12 mm) and extending the dilatation time. The advantages of EP-BID are larger dilatation diameter, longer dilatation time, less bleeding.ApplicationsEPBD have several advantages over EST, such as no incision, lower opera-tional difficulty, less bleeding and less perforation, therefore EPBD would be suitable for novices to remove the common bile duct stones.TerminologyEPBID: Duodenal side mirrors was inserted into the duodenal papilla, then the guide wire was inserted into bile duct, and balloon catheter was put in common bile duct, the balloon was dilated 10 to 12 mm using a pressure pump. The pressure was maintained for about 1 min and removed for 30 s. One-minute pressure followed by the 30 s relaxation was repeated two more times (total dilatation time: 3 min). Then the common bile duct stones were removed by us-ing the reticular basket or the balloon catheter.Peer reviewThis is an interesting manuscript comparing EPBID and EST for normal size stones. It has an important impact on the further expansion of EPBID as a tech-nology for remove of bile duct stones.

REFERENCES1 Liu Y, Su P, Lin S, Xiao K, Chen P, An S, Zhi F, Bai Y. En-

doscopic papillary balloon dilatation versus endoscopic sphincterotomy in the treatment for choledocholithiasis: a meta-analysis. J Gastroenterol Hepatol 2012; 27: 464-471 [PMID: 21913984 DOI: 10.1111/j.1440-1746.2011.06912.x]

2 Baron TH, Harewood GC. Endoscopic balloon dilation of the biliary sphincter compared to endoscopic biliary sphinc-terotomy for removal of common bile duct stones during ERCP: a metaanalysis of randomized, controlled trials. Am J Gastroenterol 2004; 99: 1455-1460 [PMID: 15307859 DOI: 10.1111/j.1572-0241.2004.30151.x]

3 Liao WC, Lee CT, Chang CY, Leung JW, Chen JH, Tsai MC, Lin JT, Wu MS, Wang HP. Randomized trial of 1-minute versus 5-minute endoscopic balloon dilation for extraction of bile duct stones. Gastrointest Endosc 2010; 72: 1154-1162 [PMID: 20869710 DOI: 10.1016/j.gie.2010.07.009]

4 Sugiyama M, Atomi Y. The benefits of endoscopic nasobili-ary drainage without sphincterotomy for acute cholangitis. Am J Gastroenterol 1998; 93: 2065-2068 [PMID: 9820374 DOI: 10.1111/j.1572-0241.1998.00593.x]

5 Freeman ML, Nelson DB, Sherman S, Haber GB, Herman ME, Dorsher PJ, Moore JP, Fennerty MB, Ryan ME, Shaw MJ, Lande JD, Pheley AM. Complications of endoscopic bili-ary sphincterotomy. N Engl J Med 1996; 335: 909-918 [PMID: 8782497 DOI: 10.1056/NEJM199609263351301]

6 Cotton PB, Lehman G, Vennes J, Geenen JE, Russell RC, Meyers WC, Liguory C, Nickl N. Endoscopic sphincteroto-my complications and their management: an attempt at con-sensus. Gastrointest Endosc 1991; 37: 383-393 [PMID: 2070995 DOI: 10.1016/S0016-5107(91)70740-2]

7 Mallery JS, Baron TH, Dominitz JA, Goldstein JL, Hirota WK, Jacobson BC, Leighton JA, Raddawi HM, Varg JJ, Waring JP, Fanelli RD, Wheeler-Harbough J, Eisen GM, Faigel DO. Complications of ERCP. Gastrointest Endosc 2003; 57: 633-638 [PMID: 12709688 DOI: 10.1053/ge.2003.v57.amge030576633]

8 Kawai K, Akasaka Y, Murakami K, Tada M, Koli Y. Endo-

scopic sphincterotomy of the ampulla of Vater. Gastrointest Endosc 1974; 20: 148-151 [PMID: 4825160 DOI: 10.1016/S0016-5107(74)73914-1]

9 Staritz M, Ewe K, Meyer zum Büschenfelde KH. Endoscop-ic papillary dilatation, a possible alternative to endoscopic papillotomy. Lancet 1982; 1: 1306-1307 [PMID: 6123047 DOI: 10.1016/S0140-6736(82)92873-2]

10 Minami A, Nakatsu T, Uchida N, Hirabayashi S, Fukuma H, Morshed SA, Nishioka M. Papillary dilation vs sphinc-terotomy in endoscopic removal of bile duct stones. A ran-domized trial with manometric function. Dig Dis Sci 1995; 40: 2550-2554 [PMID: 8536511 DOI: 10.1007/BF02220440]

11 Bergman JJ, van Berkel AM, Groen AK, Schoeman MN, Offerhaus J, Tytgat GN, Huibregtse K. Biliary manometry, bacterial characteristics, bile composition, and histologic changes fifteen to seventeen years after endoscopic sphinc-terotomy. Gastrointest Endosc 1997; 45: 400-405 [PMID: 9165322 DOI: 10.1016/S0016-5107(97)70151-2]

12 Takezawa M, Kida Y, Kida M, Saigenji K. Influence of en-doscopic papillary balloon dilation and endoscopic sphinc-terotomy on sphincter of oddi function: a randomized con-trolled trial. Endoscopy 2004; 36: 631-637 [PMID: 15243887 DOI: 10.1055/s-2004-814538]

13 Fujita N, Maguchi H, Komatsu Y, Yasuda I, Hasebe O, Iga-rashi Y, Murakami A, Mukai H, Fujii T, Yamao K, Maeshiro K. Endoscopic sphincterotomy and endoscopic papillary balloon dilatation for bile duct stones: A prospective random-ized controlled multicenter trial. Gastrointest Endosc 2003; 57: 151-155 [PMID: 12556774 DOI: 10.1067/mge.2003.56]

14 Komatsu Y, Kawabe T, Toda N, Ohashi M, Isayama M, Tateishi K, Sato S, Koike Y, Yamagata M, Tada M, Shiratori Y, Yamada H, Ihori M, Kawase T, Omata M. Endoscopic papillary balloon dilation for the management of common bile duct stones: experience of 226 cases. Endoscopy 1998; 30: 12-17 [PMID: 9548037 DOI: 10.1055/s-2007-993721]

15 Sugiyama M, Suzuki Y, Abe N, Masaki T, Mori T, Atomi Y. Endoscopic retreatment of recurrent choledocholithia-sis after sphincterotomy. Gut 2004; 53: 1856-1859 [PMID: 15542528 DOI: 10.1136/gut.2004.041020]

16 Feng Y, Zhu H, Chen X, Xu S, Cheng W, Ni J, Shi R. Com-parison of endoscopic papillary large balloon dilation and endoscopic sphincterotomy for retrieval of choledocholithi-asis: a meta-analysis of randomized controlled trials. J Gas-troenterol 2012; 47: 655-663 [PMID: 22361862 DOI: 10.1007/s00535-012-0528-9]

17 Kim HG, Cheon YK, Cho YD, Moon JH, Park do H, Lee TH, Choi HJ, Park SH, Lee JS, Lee MS. Small sphincterotomy combined with endoscopic papillary large balloon dila-tion versus sphincterotomy. World J Gastroenterol 2009; 15: 4298-4304 [PMID: 19750573 DOI: 10.3748/wjg.15.4298]

18 Kim TH, Oh HJ, Lee JY, Sohn YW. Can a small endoscopic sphincterotomy plus a large-balloon dilation reduce the use of mechanical lithotripsy in patients with large bile duct stones? Surg Endosc 2011; 25: 3330-3337 [PMID: 21533521 DOI: 10.1007/s00464-011-1720-3]

19 Stefanidis G, Viazis N, Pleskow D, Manolakopoulos S, Theocharis L, Christodoulou C, Kotsikoros N, Giannousis J, Sgouros S, Rodias M, Katsikani A, Chuttani R. Large bal-loon dilation vs. mechanical lithotripsy for the management of large bile duct stones: a prospective randomized study. Am J Gastroenterol 2011; 106: 278-285 [PMID: 21045816 DOI: 10.1038/ajg.2010.421]

20 Lin CK, Lai KH, Chan HH, Tsai WL, Wang EM, Wei MC, Fu MT, Lo CC, Hsu PI, Lo GH. Endoscopic balloon dilata-tion is a safe method in the management of common bile duct stones. Dig Liver Dis 2004; 36: 68-72 [PMID: 14971818 DOI: 10.1016/j.dld.2003.09.014]

21 Bang S, Kim MH, Park JY, Park SW, Song SY, Chung JB. Endoscopic papillary balloon dilation with large balloon



after limited sphincterotomy for retrieval of choledocholi-thiasis. Yonsei Med J 2006; 47: 805-810 [PMID: 17191309 DOI: 10.3349/ymj.2006.47.6.805]

22 Yu T, Liu L, Chen J, Li YQ. A comparison of endoscopic papillary balloon dilation and endoscopic sphincterotomy for the removal of common bile duct stones. Zhonghua Neike Zazhi 2011; 50: 116-119 [PMID: 21418830 DOI: 10.3760/cma.j.issn.0578-1426.2011.02.008]

23 Mac Mathuna P, Siegenberg D, Gibbons D, Gorin D, O’Brien M, Afdhal NA, Chuttani R. The acute and long-term effect of balloon sphincteroplasty on papillary structure in pigs. Gastrointest Endosc 1996; 44: 650-655 [PMID: 8979052

DOI: 10.1016/S0016-5107(96)70046-9]24 Ueki T, Otani K, Fujimura N, Shimizu A, Otsuka Y, Kawa-

moto K, Matsui T. Comparison between emergency and elective endoscopic sphincterotomy in patients with acute cholangitis due to choledocholithiasis: is emergency en-doscopic sphincterotomy safe? J Gastroenterol 2009; 44: 1080-1088 [PMID: 19597758 DOI: 10.1007/s00535-009-0100-4]

25 Bang BW, Jeong S, Lee DH, Lee JI, Lee JW, Kwon KS, Kim HG, Shin YW, Kim YS. The ballooning time in endo-scopic papillary balloon dilation for the treatment of bile duct stones. Korean J Intern Med 2010; 25: 239-245 [PMID: 20830219 DOI: 10.3904/kjim.2010.25.3.239]

P- Reviewers Yamamoto S, Marks JM S- Editor Song XX L- Editor Cant MR E- Editor Li JY




Dysphagia lusoria: A late onset presentation

Alice Louise Bennett, Charles Cock, Richard Heddle, Russell Kym Morcom

Alice Louise Bennett, Department of Gastroenterology and Hep-atology, Flinders Medical Centre, South Australia 5042, AustraliaCharles Cock, Richard Heddle, Department of Gastroenterol-ogy and Hepatology, Repatriation General Hospital, South Aus-tralia 5042, AustraliaRussell Kym Morcom, Department of Radiology, Repatriation General Hospital, South Australia 5042, AustraliaAuthor contributions: Bennett AL and Cock C were involved in the conception of the paper, data acquisition and analysis and coordinated the writing of the manuscript; Heddle R participated in the data acquisition and analysis, and contributed to the writing of the manuscript; Morcom RK participated in the data acquisi-tion; Bennett AL, Cock C and Heddle R read and approved the final version of the manuscript.Correspondence to: Dr. Alice Louise Bennett, Department of Gastroenterology and Hepatology, Flinders Medical Centre, Flinders Drive Bedford Park, South Australia 5042, Australia. [email protected]: +61-8-82044964 Fax: +61-8-82042943Received: November 7, 2012 Revised: February 19, 2013 Accepted: March 6, 2013Published online: April 21, 2013

AbstractDysphagia lusoria is a term used to describe dysphagia secondary to vascular compression of the oesopha-gus. The various embryologic anomalies of the arterial brachial arch system often remain unrecognised and asymptomatic, but in 30%-40% of cases can result in tracheo-oesophageal symptoms, which in the majority of cases manifest as dysphagia. Diagnosis of dysphagia lusoria is via barium swallow and chest Computed to-mography scan. Manometric abnormalities are variable, but age-related manometric changes may contribute to clinically relevant dysphagia lusoria in patients who present later in life. Our report describes a case of late-onset dysphagia secondary to a right aortic arch with an aberrant left subclavian artery, which represents a rare variant of dysphagia lusoria. The patient had prov-en additional oesophageal dysmotility with solid bolus only and a clinical response to dietary modification.


Key words: Dysphagia; Dysphagia Lusoria; Oesopha-gus; Dysmotility; Endoscopy

Core tip: Dysphagia lusoria is a term used to describe dysphagia as a consequence of vascular compression of the oesophagus. Our case describes a rare anatomi-cal variant of a right-sided aortic arch with aberrant left subclavian artery with late onset dysphagia. Mano-metric studies were abnormal with solid bolus, likely contributing to the worsening of the patient’s symp-toms over time. The patient is managing to maintain weight and nutrition through dietary modification and no operative intervention is currently planned.

Bennett AL, Cock C, Heddle R, Morcom RK. Dysphagia lu-soria: A late onset presentation. World J Gastroenterol 2013; 19(15): 2433-2436 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2433.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2433

INTRODUCTIONDysphagia lusoria is a term used to describe dysphagia as a consequence of vascular compression of the oesopha-gus. Bayford coined the term itself meaning “freak or jest of nature” in 1761 in describing a case of longstanding dysphagia leading to emaciation and eventual death of a 62-year old female patient. On autopsy the patient was found to have an aberrant right subclavian artery (ARSA) running anterior to and causing compression of her oe-sophagus[1]. The majority of cases of dysphagia lusoria are due to ARSA causing posterior oesophageal compres-sion; yet only 20%-40% of aberrant arteries are thought to cause tracheo-oesophageal symptoms including dys-phagia[2,3]. In patients who present at an advanced age, decreased vascular compliance is thought to be the most predominant factor; however the additional contribution

CASE REPORT





of age-related oesophageal dysmotility to their symptoms needs to be considered. Our report describes a case of late-onset dysphagia secondary to a right aortic arch with an aberrant left subclavian artery, which represents a rare variant of dysphagia lusoria.

CASE REPORTA 68-year-old male presented to the Gastroenterology Outpatient Department with a five-year history of dys-phagia. The initial presenting symptom was that of inter-mittent dysphagia to solids, which had recently worsened and become more progressive in nature. The patient also reported a sensation of food sticking in the left side of his chest. There was no weight loss reported. Past medi-cal history was noteworthy for well-controlled gastro-esophageal reflux and cardiovascular disease including both ischaemic heart disease and peripheral vascular dis-ease. Physical examination was unremarkable.

Initial investigations some 5 years ago included rou-tine laboratory blood tests and chest X-ray, which were within normal limits. A barium swallow and modified barium swallow (MBS) were obtained suggestive of oesophageal dysmotility, which was treated with several empirical oesophageal dilatations over the subsequent years with transient improvement. Throughout the MBS assessment the patient repeatedly cleared his throat and complained of perceived left-sided food residue in the absence of the actual presence of pharyngeal or oesoph-ageal residue. Oesophageal manometry was normal for liquid swallows by Chicago criteria. Solid bolus swallows demonstrated shortened distal latency and a rapid con-tractile front velocity. The lower oesophageal sphincter relaxed appropriately with all swallows during manom-etry (Figure 1). A non-contrast computed tomography (CT) scan of the abdomen and chest was not reported as showing any abnormal pathology. A therapeutic trial of a proton pump inhibitor and domperidone was com-menced, but failed to improve his symptoms.

Due to the progression of his symptoms, a repeat video-fluoroscopic barium swallow was performed. This

demonstrated passage of barium freely through the phar-ynx and upper oesophagus (Figure 2). An extrinsic im-pression running obliquely across the upper oesophagus just below the level of the aortic arch and a right-sided aortic arch was noted. A contrast CT scan of the chest demonstrated an aberrant subclavian artery running pos-teriorly to the oesophagus, as well as a Kommerell’s diver-ticulum at the origin of the attenuated vessel (Figure 3).

Given the patient’s co-morbidities, age and considering the ability to maintain weight and nutrition, it was decided that the patient would not be a suitable candidate for vas-cular revision of his aberrant vessel and he was managed conservatively. Lifestyle and diet issues were addressed in conjunction with modification of atherosclerotic risk fac-tors.. It was thought that the progressive symptoms were likely due to a combination of the oesophageal dysmotility demonstrated with solids and artherosclerotic progression with vascular non-compliance.

DISCUSSIONARSA is a common variant of embryonic aortic arch involution within the general population[3]. This occurs as a consequence of a persistent 7th intersegmental artery with involution of the 4th vascular arch with the right


Bennett AL et al . A late onset presentation of dysphagia

Figure 1 Manometry study demonstrating a high pressure band in the lower oesophagus (at the 360 mm mark/36 cm) consistent with arterial pulsations. This pressure band does not manometrically cause obstruction with a clear relaxation across the region of interest during the swallow.

Figure 2 Barium oesophogram demonstrating the extrinsic impression on the oesophagus secondary to the aberrant left subclavian artery supe-riorly and right aortic arch distally.

Figure 3 Computed tomography chest demonstrating the right aortic arch and dilatation at the origin of the aberrant left subclavian artery (Komerrell’s diverticulum).

dorsal aorta[4,5]. In the majority of cases the aberrant ar-tery has a course posterior to the oesophagus, but in a small percentage may run anterior to the oesophagus, as in the original description of the syndrome by Bayford[1]. At times a broad base, known as Kommerell’s diverticu-lum, accompanies ARSA[3]. In rare cases Kommerell’s diverticulum may become aneurysmal with subsequent oesophageal compression and dysphagia[6,7].

The prevalence in the general population of an aber-rant subclavian artery is estimated at 0.4% to 0.7% in the majority of the published literature. A study by Haese-meyer et al[8] found 29 cases in 7174 chest CT scans per-formed in trauma patients. Abhaichand et al[9] found 14 in 3730 patients undergoing transradial coronary angiogra-phy. Fockens et al[10] found 6 cases out of 1629 examined via endoscopic ultrasound. Kelly[11] found a single case in 223 patients undergoing upper gastrointestinal endoscopy for dysphagia. Molz et al[12] described a prevalence of 0.7% during autopsies. Aberrant subclavian arteries are present on routine endoscopy as a pulsatile posterior indentation in the upper oesophagus. However, endoscopic diagnosis is rare.

The majority of lesions are a right subclavian artery originating from the left-sided aortic arch. A similar abnormality can occur as a consequence of a left-sided aberrant subclavian artery with a right-sided aortic arch, although this arterial abnormality is much rarer[13,14]. This anomaly develops when the right dorsal artery remains patent and either the left 4th arch or left dorsal aorta regress abnormally. A complete vascular ring is formed when the anomaly is associated with a left sided ductus arteriousus passing from the left subclavian artery to the proximal left pulmonary artery. 30%-40% of patients with vascular anomalies have dysphagia as a consequence, with the majority presenting with solid bolus dysphagia[3]. Patients may at times report the dysphagia to be one-sid-ed, such as in our case. However, these anomalies largely remain asymptomatic and are often an incidental finding on imaging.

Dynamic barium swallow studies, including as-sessment of solid bolus swallow, serve as diagnostic screening for dysphagia lusoria. CT chest or magnetic resonance imaging with vascular reconstruction are used to define the vascular lesion and plan surgical interven-tions. Manometry may show variable abnormalities and is not helpful in diagnosis. Manometric studies on six patients with dysphagia lusoria by Janssen et al[2]. showed abnormalities in five out of six patients with two studies showing diminished amplitude contractions, two show-ing a high pressure zone (increase in intrabolus pressure) above the aberrant artery and one a hypocontractile zone proximal to the aberrant artery. When dysphagia occurs with ageing it seems probable that non-specific age-related manometric abnormalities (such as an increased prevalence of peristaltic failure)[2,15,16] may be contributory to dysphagia in these patients.

Several explanations exist for patients who present with late onset of symptoms. Motility abnormalities and

oesophageal stiffening, which occur as a consequence of ageing represent one possibility[2]. Several additional mechanisms have been proposed, including atherosclero-sis induced vascular changes leading to stiffening of the obstructing artery, aortic elongation with increased trac-tion on the obstructing artery or aneurysmal dilatation in the presence of Kommerell’s diverticulum[2].

The management of patients with dysphagia lusoria is dependent on the degree of symptoms and impact on the ability of the patients to maintain their weight and nutri-tion. It would appear approximately half of patients can be managed through dietary modification and through eating slower and chewing well. Severe symptoms, not amenable to interventional dietary and swallowing strate-gies may warrant surgical treatment.

Gross[17] first reported surgical management of this condition, describing the division and ligation of an aber-rant right subclavian artery in a 4-mo old infant via left thoracotomy. Lichter[18] described surgery on an adult patient. The most common approach to repair of a right sided aortic arch and aberrant left subclavian artery is a left postero-lateral thoracotomy followed by division of the liagamentum with dissection. This allows the medias-tinal structures to be freed in order to assume a less con-stricting position[19]. The decision to ligate or re-implant the aberrant vessel to avoid steal syndrome remains an intra-operative one.

Our case describes a rare anatomical variant of a right-sided aortic arch with aberrant left subclavian artery with late onset dysphagia. Manometric studies were abnormal with solid bolus, likely contributing to the worsening of the patient’s symptoms over time. The patient is managing to maintain weight and nutrition through dietary modifi-cation and no operative intervention is currently planned.

REFERENCES1 Asherson N. David Bayford. His syndrome and sign of dys-

phagia lusoria. Ann R Coll Surg Engl 1979; 61: 63-67 [PMID: 369446]

2 Janssen M, Baggen MG, Veen HF, Smout AJ, Bekkers JA, Jonkman JG, Ouwendijk RJ. Dysphagia lusoria: clinical aspects, manometric findings, diagnosis, and therapy. Am J Gastroenterol 2000; 95: 1411-1416 [PMID: 10894572 DOI: 10.1016/S0002-9270(00)00863-7]

3 Levitt B, Richter JE. Dysphagia lusoria: a comprehensive re-view. Dis Esophagus 2007; 20: 455-460 [PMID: 17958718 DOI: 10.1111/j.1442-2050.2007.00787.x]

4 Taylor M, Harris KA, Casson AG, DeRose G, Jamieson WG. Dysphagia lusoria: extrathoracic surgical management. Can J Surg 1996; 39: 48-52 [PMID: 8599791]

5 Dandelooy J, Coveliers JP, Van Schil PE, Anguille S. Dys-phagia lusoria. CMAJ 2009; 181: 498 [PMID: 19667034 DOI: 10.1503/cmaj.081651]

6 Triantopoulou C, Ioannidis I, Komitopoulos N, Papailiou J. Aneurysm of aberrant right subclavian artery causing Dysphagia lusoria in an elderly patient. AJR Am J Roentgenol 2005; 184: 1030-1032 [PMID: 15728644]

7 Singh S, Grewal PD, Symons J, Ahmed A, Khosla S, Arora R. Adult-onset dysphagia lusoria secondary to a dissect-ing aberrant right subclavian artery associated with type B acute aortic dissection. Can J Cardiol 2008; 24: 63-65 [PMID:




tery and diverticulum of Kommerell. Dig Dis Sci 1992; 37: 144-149 [PMID: 1728521 DOI: 10.1007/BF01308358]

14 Panduranga P, Al-Delamie T, Ratnam L, Al-Mukhaini M, Zachariah S. Repair of Kommerell’s diverticulum with aber-rant left subclavian artery in an elderly patient with right aor-tic arch and dysphagia lusoria. J Card Surg 2011; 26: 637-640 [PMID: 22122377 DOI: 10.1111/j.1540-8191.2011.01344.x]

15 Grishaw EK, Ott DJ, Frederick MG, Gelfand DW, Chen MY. Functional abnormalities of the esophagus: a prospec-tive analysis of radiographic findings relative to age and symptoms. AJR Am J Roentgenol 1996; 167: 719-723 [PMID: 8751689]

16 Tack J, Vantrappen G. The aging oesophagus. Gut 1997; 41: 422-424 [PMID: 9391234]

17 Gross RE. Surgical treatment for dysphagia lusoria. Ann Surg 1946; 124: 532-534 [PMID: 20997805]

18 Lichter I. The treatment of dysphagia lusoria in the adult. Br J Surg 1963; 50: 793-796 [PMID: 14068623]

19 Morris CD, Kanter KR, Miller JI. Late-onset dysphagia luso-ria. Ann Thorac Surg 2001; 71: 710-712 [PMID: 11235738 DOI: 10.1016/S0003-4975(00)02241-4]

P- Reviewer Clave P S- Editor Gou SX L- Editor A E- Editor Li JY

18209773 DOI: 10.1016/S0828-282X(08)70552-X]8 Haesemeyer SW, Gavant ML. Imaging of acute traumatic

aortic tear in patients with an aberrant right subclavian ar-tery. AJR Am J Roentgenol 1999; 172: 117-120 [PMID: 9888750]

9 Abhaichand RK, Louvard Y, Gobeil JF, Loubeyre C, Lefèvre T, Morice MC. The problem of arteria lusoria in right tran-sradial coronary angiography and angioplasty. Catheter Cardiovasc Interv 2001; 54: 196-201 [PMID: 11590683 DOI: 10.1002/ccd.1266]

10 Fockens P, Kisman K, Tytgat GNJ. Endosonographic imaging of an aberrant right subclavian (lusorian) artery. Gastrointesti-nal Endosc 1996; 43: 419 [DOI: 10.1016/S0016-5107(96)80512-8]

11 Kelly MD. Endoscopy and the aberrant right subclavian artery. Am Surg 2007; 73: 1259-1261 [PMID: 18186385]

12 Molz G, Burri B. Aberrant subclavian artery (arteria luso-ria): sex differences in the prevalence of various forms of the malformation. Evaluation of 1378 observations. Virchows Arch A Pathol Anat Histol 1978; 380: 303-315 [PMID: 153045 DOI: 10.1007/BF00431315]

13 McNally PR, Rak KM. Dysphagia lusoria caused by per-sistent right aortic arch with aberrant left subclavian ar-


Fifteen-year-old colon cancer patient with a 10-year history of ulcerative colitis

Seung Yeon Noh, Seung Young Oh, Soo-Hong Kim, Hyun-Young Kim, Sung-Eun Jung, Kwi-Won Park

Seung Yeon Noh, Seung Young Oh, Department of Surgery, Seoul National University Hospital, Seoul 110-744, South KoreaSoo-Hong Kim, Hyun-Young Kim, Sung-Eun Jung, Kwi-Won Park, Department of Pediatric Surgery, Seoul National Univer-sity Children’s Hospital, Seoul 110-744, South KoreaAuthor contributions: Noh SY, Oh SY, Kim SH, Kim HY, Jung SE and Park KW contributed equally to this work; Noh SY, Oh SY, Kim SH, Kim HY, Jung SE and Park KW designed the research; Noh SY, Oh SY, Kim SH, Kim HY and Park KW per-formed the research; Noh SY and Oh SY wrote the paper.Correspondence to: Kwi-Won Park, MD, PhD, Department of Pediatric Surgery, Seoul National University Children’s Hospital, 101 Daehak-Ro Jongno-Gu, Seoul 110-744, South Korea. [email protected]: +82-2-20723635 Fax: +82-2-7475130Received: October 30, 2012 Revised: January 31, 2013Accepted: February 5, 2013Published online: April 21, 2013

AbstractInflammatory bowel disease (IBD) is regarded as one of the risk factors for colorectal cancer, and early detection of cancer in these patients may be difficult, especially in pediatric patients. Prognosis of pediatric colorectal cancer is known to be poor, because of delayed diagno-sis and unfavorable differentiation. We report a case of a pediatric patient with a 10-year history of ulcerative colitis who was diagnosed with sigmoid colon cancer when he was 15 years old. He underwent proctocolec-tomy with ileal pouch anal anastomosis. Postoperative pathological examination of the tumor revealed adeno-carcinoma. The pericolic tissue layer was infiltrated, but metastases were not found in either of the two lymph nodes. Children with a long history of predispos-ing factors such as IBD need particular attention to the possibility of colorectal cancer. Early diagnosis through regular screening with colonoscopy is one of the most important critical factors for a good prognosis.


Key words: Colon; Rectum; Cancer; Ulcerative colitis; Pediatric

Core tip: Inflammatory bowel disease (IBD) is regarded as one of the important risk factors of colorectal can-cer. Several cases of colorectal cancer with pediatric IBD have been reported. However, this case is notice-able in that the onset of disease in the patient was at a relatively young age and the duration of illness was rather short, even though the patient was given con-tinuous medication and regular follow-ups. Therefore, this case highlights the importance the early diagnosis of the disease with a high level of awareness in chil-dren with a history of predisposing factors.

Noh SY, Oh SY, Kim SH, Kim HY, Jung SE, Park KW. Fifteen-year-old colon cancer patient with a 10-year history of ulcerative colitis. World J Gastroenterol 2013; 19(15): 2437-2440 Avail-able from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2437.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2437

INTRODUCTIONPediatric colorectal cancer has a poor prognosis com-pared with adult colorectal cancer because of delayed diagnoses at an advanced stage. Thus, early diagnosis based on a high degree of suspicion could be the most important factor in a more favorable prognosis, especially in patients with predisposing factors. Here, we report a 15-year-old boy with a 10-year history of ulcerative colitis (UC) who developed sigmoid colon cancer.

Pediatric colorectal cancer is very rare. The reported incidence is 0.3 to 2 cases per million, accounting for 0.4% of all fatal malignancies in patients younger than 15 years of age[1-6]. According to some studies, most cases occur in the second decade of life[1,7,8]. The sex distribution is equal in adults, whereas in children, a notable preponder-ance of boys has been reported[2,7].

CASE REPORT





Although colorectal cancer has a relatively good prog-nosis in adults, the overall reported survival of pediatric colorectal cancer is poorer than in adults[5,9,10]. The most likely reason is delayed diagnoses with advanced stages of colorectal cancer and high potential for dissemina-tion[2,8,11]. The other reason for the poor prognosis of pediatric colorectal cancer is a high proportion of mu-cinous histology, accounting for more than 50% of the cases[2,7,12].

CASE REPORTA 15-year-old boy was transferred from another hospital because of abnormal computed tomography (CT) find-ings. He presented with abdominal pain, vomiting and poor oral intake for 1 wk before admission.

He had a very long and complicated past medical his-tory. When he was 3 years old, he was treated for an anal fissure. Additionally, when he was 5 years old, he had bilateral knee joint pain with swelling, and a laboratory test was positive for antinuclear cytoplasmic antibody. Through a colon study and colonoscopic biopsy, he was finally diagnosed with UC. After the diagnosis, he was maintained on the combined medications of mesalazine, azathioprine and prednisolone for 5 years.

When he was 10 years old, he moved to another hos-pital which was in his home town. He had follow-ups through the hospital for 5 years. Then, he was admitted to that hospital for abdominal pain and vomiting, and his

CT scan showed suspected cancer lesions. Therefore, he was referred back to our institute for further evaluation.

Several clinical tests were performed after admission to evaluate the patient. The esophagogastroscopy did not show any abnormal findings. The abdominal CT showed a segmental polypoid mass at the sigmoid colon, which was consistent with cancer (Figure 1A). The finding of diffuse colonic wall thickening with a loss of haustra, called “lead pipe appearance”, which was consistent with UC, was also observed (Figure 1B).

The colonoscopy showed diffuse granular lesions in the ascending colon, multiple ulcerations from the trans-verse colon to rectum, and two polypoid masses without ulcerations in the descending and sigmoid colon (Figure 2).

The patient underwent surgery. In a digital rectal ex-amination, we found a 6 cm nodular lesion at the level of the anal verge which was not found in colonoscopy. At the level of the sigmoid colon, a 3 cm-sized mass involv-ing one-third of the lumen was found. Based on these findings, a total proctocolectomy with ileal pouch anal anastomosis was performed.

Grossly, there were two lesions suspicious of malig-nancy. A 4.0 cm × 2.0 cm × 1.0 cm-sized ulceroinfiltrative mass was located at the ascending colon. The other lesion, a 5.0 cm × 3.0 cm × 1.1 cm-sized polypoid mass, was lo-cated at the sigmoid colon (Figure 3). Microscopically, the tumors were adenocarcinomas and were T3 and T1 stage, respectively. Of the 127 lymph nodes, none were posi-tive for metastatic carcinoma. Postoperative pathological examination of the tumor revealed adenocarcinoma. The pericolic tissue layer was infiltrated, but metastases were not found in either of the two lymph nodes.

DISCUSSIONMany studies have reported risk factors for colorectal cancer. Known genetic factors that can increase the risk of colorectal cancer are familial polyposis of the colon, Gardner’s syndrome, Turcot’s syndrome, Peutz-Jegher’s syndrome, UC, familial occurrence of colorectal cancer, and Bloom’s syndrome[9,13,14]. According to most studies, 10% of pediatric colorectal cancers have predisposing factors[9,13].

The rate of adenocarcinoma in childhood-onset UC patients is higher than that in adult-onset UC patients[15,16]. Eaden et al[16] investigated the long-term incidence of colorectal cancer among patients with childhood-onset UC through a meta-analysis. They reported that the cumu-lative probabilities of developing colorectal cancer were 5.5% at 10 years after onset of UC, 10.8% at 20 years and 15.7% at 3 years.

Diagnosis of inflammatory bowel disease at a young age is a well-known factor for an increased risk of colorectal cancer[15]. Ekbom et al[17] reported that the aver-age incidence of colorectal cancer among patients with UC between the ages of 0 and 14 was 118.3 times that of the control population.

Considering the relatively high incidence of colorectal


Noh SY et al . A 15-year-old colon cancer patient

A

B

Figure 1 Preoperative computed tomography. A: Enhanced protruding pol-ypoid mass at the sigmoid colon; B: diffuse colonic wall thickening with loss of haustra (“lead pipe appearance”).

cancer and the poor prognosis in patients with child-hood-onset UC, early diagnosis through regular screening with colonoscopy can increase the resectability and im-prove the prognosis.

In summary, pediatric surgeons always have to keep in mind the possibility of colorectal cancer in children with a long history of predisposing factors such as UC. Early diagnosis through regular screening with colonoscopy is one of the most important critical factors for a good prognosis.

REFERENCES1 Jain AK, Motil KJ, Olutoye OO, Cope-Yokoyama S, Egler

RA, Tatevian N. Colon cancer in a 16-year-old girl: signet-ring cell carcinoma without microsatellite instability--an un-usual suspect. J Pediatr Gastroenterol Nutr 2009; 48: 110-114 [PMID: 19172134 DOI: 10.1097/MPG.0b013e31815dda8c]

2 Kravarusic D, Feigin E, Dlugy E, Steinberg R, Baazov A, Erez I, Lazar L, Kapuller V, Grunspan M, Ash S, Freud E. Colorectal carcinoma in childhood: a retrospective multicenter study. J Pediatr Gastroenterol Nutr 2007; 44: 209-211 [PMID: 17255833 DOI: 10.1097/01.mpg.0000252195.84084.52]

3 Angelini C, Crippa S, Uggeri F, Bonardi C, Sartori P, Uggeri F. Colorectal cancer with neuroendocrine differentiation in a child. Pediatr Surg Int 2005; 21: 839-840 [PMID: 16177922 DOI: 10.1007/s00383-005-1525-3]

4 Yamamoto K, Tanaka T, Kuno K, Amoh Y, Takahashi Y, Murakami H. Carcinoma of the colon in children: case re-

port and review of the Japanese literature. J Gastroenterol 1994; 29: 647-652 [PMID: 8000515 DOI: 10.1007/BF02365450]

5 Durno C, Aronson M, Bapat B, Cohen Z, Gallinger S. Fam-ily history and molecular features of children, adolescents, and young adults with colorectal carcinoma. Gut 2005; 54: 1146-1150 [PMID: 15845562 DOI: 10.1136/gut.2005.066092]

6 Chantada GL, Perelli VB, Lombardi MG, Amaral D, Cas-callar D, Scopinaro M, Deza EG, Gercovich FG. Colorectal carcinoma in children, adolescents, and young adults. J Pediatr Hematol Oncol 2005; 27: 39-41 [PMID: 15654277 DOI: 10.1097/01.mph.0000149251.68562.8e]

7 Rao BN, Pratt CB, Fleming ID, Dilawari RA, Green AA, Austin BA. Colon carcinoma in children and adolescents. A review of 30 cases. Cancer 1985; 55: 1322-1326 [PMID: 3971300 DOI: 10.1002/1097-0142(19850315)55]

8 Steinberg JB, Tuggle DW, Postier RG. Adenocarcinoma of the colon in adolescents. Am J Surg 1988; 156: 460-462 [PMID: 3202257 DOI: 10.1016/S0002-9610(88)80528-2]

9 Salas-Valverde S, Lizano A, Gamboa Y, Vega S, Barrantes M, Santamaría S, Zamora JB. Colon carcinoma in children and adolescents: prognostic factors and outcome-a review of 11 cases. Pediatr Surg Int 2009; 25: 1073-1076 [PMID: 19816697 DOI: 10.1007/s00383-009-2491-y]

10 Brown RA, Rode H, Millar AJ, Sinclair-Smith C, Cywes S. Colorectal carcinoma in children. J Pediatr Surg 1992; 27: 919-921 [PMID: 1640344 DOI: 10.1016/0022-3468(92)90399-R]

11 Vastyan AM, Walker J, Pintér AB, Gerrard M, Kajtar P. Colorectal carcinoma in children and adolescents--a report of seven cases. Eur J Pediatr Surg 2001; 11: 338-341 [PMID: 11719875 DOI: 10.1055/s-2001-18548]

12 Goldthorn JF, Powars D, Hays DM. Adenocarcinoma of the colon and rectum in the adolescent. Surgery 1983; 93:


A B C

Figure 2 Colonoscopy findings. A: Diffuse granular lesions; B: Multiple ulcerations from the transverse colon to the rectum; C: A polypoid mass at the sigmoid colon.

A B

Figure 3 Gross appearance of the colon. A: There was a 5 cm × 3 cm-sized polypoid mass at the sigmoid colon; B: There was severe nodularity with fibrosis in the whole colon.



ease. Semin Pediatr Surg 2007; 16: 205-213 [PMID: 17602977 DOI: 10.1053/j.sempedsurg.2007.04.010]

16 Eaden JA, Abrams KR, Mayberry JF. The risk of colorectal cancer in ulcerative colitis: a meta-analysis. Gut 2001; 48: 526-535 [PMID: 11247898 DOI: 10.1136/gut.48.4.526]

17 Ekbom A, Helmick C, Zack M, Adami HO. Ulcerative coli-tis and colorectal cancer. A population-based study. N Engl J Med 1990; 323: 1228-1233 [PMID: 2215606 DOI: 10.1056/NEJM199011013231802]

P- Reviewers Yang SF, Fang BL S- Editor Huang XZ L- Editor Cant MR E- Editor Li JY

409-414 [PMID: 6600855]13 Karnak I, Ciftci AO, Senocak ME, Büyükpamukçu N. Colorec-

tal carcinoma in children. J Pediatr Surg 1999; 34: 1499-1504 [PMID: 10549756 DOI: 10.1016/S0022-3468(99)90112-4]

14 Heiss KF, Schaffner D, Ricketts RR, Winn K. Malignant risk in juvenile polyposis coli: increasing documentation in the pediatric age group. J Pediatr Surg 1993; 28: 1188-1193 [PMID: 8308690 DOI: 10.1016/0022-3468(93)90162-E]

15 Kayton ML. Cancer and pediatric inflammatory bowel dis-


Duct-to-duct biliary reconstruction after radical resection of Bismuth Ⅲa hilar cholangiocarcinoma

Wen-Guang Wu, Jun Gu, Ping Dong, Jian-Hua Lu, Mao-Lan Li, Xiang-Song Wu, Jia-Hua Yang, Lin Zhang, Qi-Chen Ding, Hao Weng, Qian Ding, Ying-Bin Liu

Wen-Guang Wu, Jun Gu, Ping Dong, Jian-Hua Lu, Mao-Lan Li, Xiang-Song Wu, Jia-Hua Yang, Lin Zhang, Qi-Chen Ding, Hao Weng, Qian Ding, Ying-Bin Liu, Depatment of General Surgery, Xinhua Hospital, Affiliated to School of Medicine, Shanghai Jiaotong University, Shanghai 200092, ChinaAuthor contributions: Wu WG, Gu J and Liu YB designed the research; Dong P, Lu JH, Li ML, Wu XS and Yang JH performed the research; Zhang L, Ding QC, Weng H and Ding Q contrib-uted new reagents or analytic tools; Dong P, Lu JH, Li ML, Wu XS and Yang JH analyzed data; Wu WG, Gu J and Liu YB wrote the paper; Wu WG and Gu J contributed equally to this work.Correspondence to: Ying-Bin Liu, PhD, MD, Department of General Surgery, Xinhua Hospital, Affiliated to School of Medicine, Shanghai Jiaotong University, 1665 Kongjiang Road, Shanghai 200092, China. [email protected]: +86-21-25077880 Fax: +86-21-25077880Received: January 25, 2013 Revised: March 1, 2013 Accepted: March 15, 2013Published online: April 21, 2013

AbstractAt present, radical resection remains the only effective treatment for patients with hilar cholangiocarcinoma. The surgical approach for R0 resection of hilar cholan-giocarcinoma is complex and diverse, but for the biliary reconstruction after resection, almost all surgeons use Roux-en-Y hepaticojejunostomy. A viable alternative to Roux-en-Y reconstruction after radical resection of hilar cholangiocarcinoma has not yet been proposed. We report a case of performing duct-to-duct biliary re-construction after radical resection of Bismuth Ⅲa hilar cholangiocarcinoma. End-to-end anastomosis between the left hepatic duct and the distal common bile duct was used for the biliary reconstruction, and a single-layer continuous suture was performed along the bile duct using 5-0 prolene. The patient was discharged favorably without biliary fistula 2 wk later. Evidence for tumor recurrence was not found after an 18 mo follow-up. Performing bile duct end-to-end anastomosis in

hilar cholangiocarcinoma can simplify the complex di-gestive tract reconstruction process.


Key words: Hilar cholangiocarcinoma; Biliary recon-struction; Duct-to-duct; Radical resection; Digestive tract reconstruction; Hepaticojejunostomy; Bile duct anastomosis

Core tip: Roux-en-Y anastomosis is the standard of care for biliary reconstruction after radical resection of hilar cholangiocarcinoma. However, a direct duct-to-duct biliary reconstruction preserves the normal sphincter mechanism and endoscopic access to the biliary tree for diagnostic and therapeutic purposes. Duct-to-duct biliary reconstruction is widely used in liver transplan-tation and hepatic resection. The objective of this study was to determine the feasibility of duct-to-duct biliary reconstruction in the setting of Bismuth Ⅲa hi-lar cholangiocarcinoma with limited biliary confluence involvement.

Wu WG, Gu J, Dong P, Lu JH, Li ML, Wu XS, Yang JH, Zhang L, Ding QC, Weng H, Ding Q, Liu YB. Duct-to-duct biliary reconstruction after radical resection of Bismuth Ⅲa hilar chol-angiocarcinoma. World J Gastroenterol 2013; 19(15): 2441-2444 Available from: URL: http://www.wjgnet.com/1007-9327/full/v19/i15/2441.htm DOI: http://dx.doi.org/10.3748/wjg.v19.i15.2441

INTRODUCTIONSurgical outcomes for treating hilar cholangiocarcinoma have gradually improved due to advances in surgical pro-cedures and the accumulation of anatomic knowledge concerning the hepatic hilum[1-5]. As cancer-free margins

CASE REPORT





are considered to be particularly important for curative resection of hilar cholangiocarcinoma[6], bile ducts should be dissected longitudinally as far from the tumor as pos-sible to ensure curative resection[7]. For biliary reconstruc-tion after resection, almost all surgeons use Roux-en-Y hepaticojejunostomy[1-7]. Following curative resection of a tumor, if there is still sufficient tissue available for remodeling the normal biliary structure, should hepatic duct and common bile duct one stage anastomosis be considered? We report a case of performing duct-to-duct biliary one stage reconstruction for biliary reconstruction after radical resection of Bismuth Ⅲa hilar cholangiocar-cinoma. Evidence for tumor recurrence was not found after an 18 mo follow-up.

CASE REPORTThe patient, a 58-year old female, was admitted to the hospital on February 15, 2011 because of “paroxysmal right upper quadrant pain for one week”. Admission examination: body skin and sclera are slightly yellow; the whole abdomen is soft, with no tenderness, no rebound tenderness and no mass; and no other symptoms are not-ed. Liver function: Glutamic-pyvuvic-transaminase 213

U/L, Glutamic-oxaiacetic-transaminase 177 U/L, alka-line phosphatase 1171 U/L, gamma-glutamyltransferase 1262 U/L, total bilirubin 21.3 μmol/L, direct bilirubin 8.8 μmol/L. Tumor markers: carbohydrate antigen 19-9 336.10 U/mL, carbohydrate antigen-50 38.46 U/mL, al-pha fetoprotein 1.88 ng/mL. Magnetic resonance cholan-giopancreatograph (MRCP)/abdominal enhanced com-puted tomography (CT): hepatic portal soft tissue signal intensity, approximately 1.6 cm in diameter, and the com-mon bile duct proximal locally shows truncated change. The extrahepatic bile duct widened, and the left hepatic intrahepatic bile duct dilatation staggered. Hepatic cirrho-sis was noted. A diagnosis of hilar cholangiocarcinoma (Bismuth Ⅲa type) was made (Figure 1).

The patient underwent right hemihepatectomy with caudate process lobectomy on February 18 and systematic lymphadenectomy of the nodes (Figure 2). The lymph node groups resected en bloc included the anterior pan-creaticoduodenal lymph nodes (lymph node station 17 in the Japanese system), the posterior pancreaticoduodenal lymph nodes (station 13), nodes in the hepatoduodenal ligament (stations 12a, 12b and 12c), nodes along the common hepatic artery (station 8a), and the superior pyloric node (station 5). Intraoperative frozen pathologi-cal examination indicated duct cell carcinoma in the right hepatic duct and common bile duct. Negative margins were found on the left hepatic duct and common bile duct (Figure 3). After removal of the right lobe and the caudate process, the left hepatic duct and distal common bile duct end-to-end anastomoses were used for the bili-ary reconstruction and a biliary stent was placed in the bile duct. The specific method of the bile duct reconstruction was as follows: (1) ensure blood supply of the left hepatic duct and common bile duct resection margin; (2) mobi-lization of the left liver was performed from the left side followed by the Kocher maneuver to release the duodenal descending portion to reduce anastomosis tension; and (3) single-layer continuous suture was performed for bile duct reconstruction with 5-0 prolene (Figure 4). Ten days after the operation, liver function had generally returned to normal. The patient was discharged favorably without


Wu WG et al . Duct-to-duct biliary reconstruction for hilar cholangiocarcinoma

Figure 1 Magnetic resonance cholangiopancreatograph (A)/abdominal en-hanced computed tomography (B) showing the hepatic portal soft tissue signal intensity (arrow in B), which is approximately 1.6 cm in diameter, and the common bile duct proximal locally shows truncated change (arrow in A). The extrahepatic bile duct is widened and the left hepatic intrahepatic bile duct is dilated. Hepatic cirrhosis is present. Images indicate hilar cholangiocar-cinoma with intrahepatic bile duct dilatation.

A B

Figure 2 Right hemihepatectomy with caudate process lobectomy and systematic lymphadenectomy of the nodes.

Figure 3 Performing hepatoduodenal ligament lymphadenectomy in hilar cholangiocarcinoma and right hemihepatectomy with caudate process lo-bectomy. The left hepatic duct and common bile duct stump are shown (arrows).

biliary fistula 2 wk later. Postoperative pathology indicated hilar bile duct adenocarcinoma grade Ⅱ involving the right hepatic duct. A 2 cm diameter tumor was found with in-vasion to the fibrous muscular layer and outer connective tissue. The common bile duct and the left hepatic duct resection margin was negative. The tumor-free margin of the left duct was approximately 5 mm in the final post-operative pathological assessment. No regional lymph node metastasis was observed in a total of 19 dissected nodes. Consequently, the tumor was staged according to the American Joint Commission on Cancer staging as T2N0M0. No evidence of tumor recurrence was found using MRCP scans 18 mo post-operation (Figure 5).

DISCUSSIONSurgical radical resection currently remains the only ef-fective method that increases long-term survival for treat-ing patients with hilar cholangiocarcinoma[8]. The hilar cholangiocarcinoma surgical approach is complex and diverse; however, for biliary reconstruction after resec-tion, almost all surgeons use the biliary-enteric Roux-en-Y anastomosis method. The Roux-en-Y hepaticojeju-nostomy is primarily preferred for the following reasons: (1) it is imperative to remove as much of the bile duct as possible to ensure that the bile duct resection margin is negative; (2) removal of the common bile duct simpli-fies the hepatoduodenal ligament lymphadenectomy, reduces the difficulty of lymphadenectomy and generally improves its quality; and (3) the lower tension of Roux-en-Y hepaticojejunostomy reduces the occurrence of postoperative biliary fistula. However, performing duct-to-duct biliary reconstruction in hilar cholangiocarcinoma can simplify the complex digestive tract reconstruction process required in the traditional Roux-en-Y hepatico-jejunostomy because it requires less radical alteration to normal gastrointestinal physiology, reduces some post-operative complications, and can simplify the treatment of complications. The faster anastomotic procedure in duct-to-duct may be another advantage over Roux-en-Y hepaticojejunostomy.

Studies suggest that the invasion longitude of hilar cholangiocarcinoma along the bile duct varies significant-ly, with distances ranging from a few millimeters to sever-al centimeters[9], with variations related to bile duct cancer type, degree of differentiation, and other factors. A posi-tive bile duct resection margin not only correlates with higher local recurrence rate after surgery but is also an in-dependent risk factor for poor prognosis of hilar cholan-giocarcinoma; furthermore, its role is similar to a positive lymph node[10]. Unfortunately, preoperative procedures such as CT or MRCP, and even intraoperative exploration, cannot conclusively determine bile duct involvement. At present, intraoperative frozen pathological examination of bile duct resection margins is an important method to determine if a clean bile duct resection margin was achieved. For cases with intraoperative local excision of bile duct and a frozen pathological examination indicating a negative resection, it may be unnecessary to expand the scope of the bile duct resection and perform the routine Roux-en-Y hepaticojejunostomy. If there is still sufficient tissue available for remodeling the normal biliary struc-ture after the tumor R0 resection, should hepatic duct and common bile duct one stage anastomosis be considered? In addition, performing the skeletonization of the hepa-toduodenal ligament in carcinoma of the gallbladder or intrahepatic cholangiocarcinoma does not require the ex-pense of the extrahepatic bile duct to reduce the difficulty of operation and improve the quality of skeletonization. The current practice of unconditional selection of the Roux-en-Y hepaticojejunostomy to reconstruct the biliary tract for hilar cholangiocarcinoma requires further reflec-tion and research. Duct-to-duct anastomosis is currently a favorable method to reconstruct the biliary tract, even in live donor liver transplantation[11,12]. Technically easier manipulation and the preservation of physiologic bilio-enteric continuity are two main advantages of duct-to-duct anastomosis over Roux-en-Y hepaticojejunostomy. Furthermore, following Roux-en-Y hepaticojejunostomy, the loss of the normal biliary tract and the digestive tract anatomical structures makes anastomotic stenosis or stone formation relatively complicated to address using minimally invasive endoscopic retrograde cholangio-pancreatography and other treatments. These complica-tions represent clinical issues that need to be considered.


Figure 4 After the radical resection of hilar cholangiocarcinoma, duct-to-duct anastomosis was performed using continuous 5-0 polydioxanone sutures (arrow), with a biliary stent in the bile duct.

Figure 5 Evidence for tumor recurrence was not found in an magnetic resonance cholangiopancreatograph scan (A, B) 18 mo after operation.

A B



hilar bile duct cancer: application of extended hepatectomy after biliary drainage and hemihepatic portal vein embo-lization. Ann Surg 2003; 238: 84-92 [PMID: 12832969 DOI: 10.1097/01.SLA.0000074984.83031.02]

5 Sano T, Shimada K, Sakamoto Y, Yamamoto J, Yamasaki S, Kosuge T. One hundred two consecutive hepatobiliary resections for perihilar cholangiocarcinoma with zero mor-tality. Ann Surg 2006; 244: 240-247 [PMID: 16858186 DOI: 10.1097/01.sla.0000217605.66519.38]

6 Kondo S, Hirano S, Ambo Y, Tanaka E, Okushiba S, Mori-kawa T, Katoh H. Forty consecutive resections of hilar cholangiocarcinoma with no postoperative mortality and no positive ductal margins: results of a prospective study. Ann Surg 2004; 240: 95-101 [PMID: 15213624 DOI: 10.1097/01.sla.0000129491.43855.6b]

7 Endo I, Sugita M, Masunari H, Yoshida K, Takeda K, Sekido H, Togo S, Shimada H. Retroportal hepaticojejunostomy for extended resection of hilar bile ducts. J Gastrointest Surg 2008; 12: 962-965 [PMID: 17963011 DOI: 10.1007/s11605-007-0388-4]

8 Hemming AW, Reed AI, Fujita S, Foley DP, Howard RJ. Surgical management of hilar cholangiocarcinoma. Ann Surg 2005; 241: 693-699; discussion 699-702 [PMID: 15849505 DOI: 10.1097/01.sla.0000160701.38945.82]

9 Lim JH. Cholangiocarcinoma: morphologic classification ac-cording to growth pattern and imaging findings. AJR Am J Roentgenol 2003; 181: 819-827 [PMID: 12933488]

10 Sasaki R, Takeda Y, Funato O, Nitta H, Kawamura H, Ue-sugi N, Sugai T, Wakabayashi G, Ohkohchi N. Significance of ductal margin status in patients undergoing surgical resection for extrahepatic cholangiocarcinoma. World J Surg 2007; 31: 1788-1796 [PMID: 17647056 DOI: 10.1007/s00268-007-9102-7]

11 Ishiko T, Egawa H, Kasahara M, Nakamura T, Oike F, Kai-hara S, Kiuchi T, Uemoto S, Inomata Y, Tanaka K. Duct-to-duct biliary reconstruction in living donor liver transplanta-tion utilizing right lobe graft. Ann Surg 2002; 236: 235-240 [PMID: 12170029 DOI: 10.1097/01.SLA.0000022026.90761.FC]

12 Jabłońska B, Lampe P, Olakowski M, Górka Z, Lekstan A, Gruszka T. Hepaticojejunostomy vs. end-to-end biliary reconstructions in the treatment of iatrogenic bile duct inju-ries. J Gastrointest Surg 2009; 13: 1084-1093 [PMID: 19266245 DOI: 10.1007/s11605-009-0841-7]

P- Reviewers Fan ST, Cho A S- Editor Gou SX L- Editor A E- Editor Li JY

Therefore, we believe that in the case of intraoperative frozen pathology indicating a negative bile duct resection margin, it is unnecessary to expand the removal of bile duct. For cases with a lesser degree of bile duct resection, duct-to-duct anastomosis of the bile duct should be con-sidered. Provided that the blood supply of the bile duct stump is adequate, performing end-to-end tension-free anastomosis is the most effective way to ensure the anas-tomosis is secure, which can reduce the occurrence of the postoperative biliary fistula.

In conclusion, duct-to-duct biliary reconstruction may be a better option for bile duct reconstruction after R0 resection of hilar cholangiocarcinoma when sufficient bile duct remains for remodeling the normal biliary struc-ture. However, the precise candidates for duct-to-duct anastomosis are difficult to define and still require further investigation.

REFERENCES1 Tsao JI, Nimura Y, Kamiya J, Hayakawa N, Kondo S,

Nagino M, Miyachi M, Kanai M, Uesaka K, Oda K, Rossi RL, Braasch JW, Dugan JM. Management of hilar cholangio-carcinoma: comparison of an American and a Japanese ex-perience. Ann Surg 2000; 232: 166-174 [PMID: 10903592 DOI: 10.1097/00000658-200008000-00003]

2 Jarnagin WR, Fong Y, DeMatteo RP, Gonen M, Burke EC, Bodniewicz BS J, Youssef BA M, Klimstra D, Blumgart LH. Staging, resectability, and outcome in 225 patients with hilar cholangiocarcinoma. Ann Surg 2001; 234: 507-517; discussion 517-519 [PMID: 11573044 DOI: 10.1097/00000658-200110000-00010]

3 Seyama Y, Kubota K, Sano K, Noie T, Takayama T, Kosuge T, Makuuchi M. Long-term outcome of extended hemihepatec-tomy for hilar bile duct cancer with no mortality and high survival rate. Ann Surg 2003; 238: 73-83 [PMID: 12832968 DOI: 10.1097/01.SLA.0000074960.55004.72]

4 Kawasaki S, Imamura H, Kobayashi A, Noike T, Miwa S, Miyagawa S. Results of surgical resection for patients with


GENERAL INFORMATIONWorld Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN 1007-9327, online ISSN 2219-2840, DOI: 10.3748) is a peer-reviewed open access (OA) journal. WJG was established on October 1, 1995. It is published weekly on the 7th, 14th, 21st, and 28th each month. The WJG Editorial Board consists of 1352 experts in gastroenterology and hepatology from 64 countries.

Aims and scopeThe primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gas-trointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointesti-nal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastro-intestinal immunology, gastrointestinal microbiology, gastroin-testinal genetics, gastrointestinal translational medicine, gastro-intestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and thera-peutic skill and expertise of clinicians.

WJG is published by Baishideng Publishing Group (BPG) in both electronic and online forms. All WJG articles are pub-lished in WJG website and PubMed Central. The major advan-tages of OA journals are faster release and delivery, no page or graph restrictions, and increased visibility, usage and impact. Full-text PDF articles and electronic/online versions are freely available to global readers. After the paper is published, the author(s) can obtain high-quality PDF files, which contain the journal cover, a list of editorial board members, table of con-tents, text, and back cover of the journal. BPG has a strong professional editorial team composed of editorial board mem-bers, editors-in-chief, science editors, language editors, and elec-tronic editors. BPG currently publishes 42 OA clinical medical journals, including 41 in English, has a total of 15471 editorial board members or peer reviewers, and is a world first-class publisher.

ColumnsThe columns in the issues of WJG will include: (1) Editorial: The editorial board members are invited to make comments on an important topic in their field in terms of its current re-search status and future directions to lead the development of this discipline; (2) Frontier: The editorial board members are invited to select a highly cited cutting-edge original paper of his/her own to summarize major findings, the problems that have been resolved and remain to be resolved, and future re-

search directions to help readers understand his/her important academic point of view and future research directions in the field; (3) Diagnostic Advances: The editorial board members are invited to write high-quality diagnostic advances in their field to improve the diagnostic skills of readers. The topic cov-ers general clinical diagnosis, differential diagnosis, pathological diagnosis, laboratory diagnosis, imaging diagnosis, endoscopic diagnosis, biotechnological diagnosis, functional diagnosis, and physical diagnosis; (4) Therapeutics Advances: The editorial board members are invited to write high-quality therapeutic advances in their field to help improve the therapeutic skills of readers. The topic covers medication therapy, psychotherapy, physical therapy, replacement therapy, interventional therapy, minimally invasive therapy, endoscopic therapy, transplantation therapy, and surgical therapy; (5) Field of Vision: The editorial board members are invited to write commentaries on classic articles, hot topic articles, or latest articles to keep readers at the forefront of research and increase their levels of clinical re-search. Classic articles refer to papers that are included in Web of Knowledge and have received a large number of citations (ranking in the top 1%) after being published for more than years, reflecting the quality and impact of papers. Hot topic articles refer to papers that are included in Web of Knowledge and have received a large number of citations after being pub-lished for no more than 2 years, reflecting cutting-edge trends in scientific research. Latest articles refer to the latest published high-quality papers that are included in PubMed, reflecting the latest research trends. These commentary articles should focus on the status quo of research, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions. Basic informa-tion about the article to be commented (including authors, article title, journal name, year, volume, and inclusive page num-bers; (6) Minireviews: The editorial board members are invited to write short reviews on recent advances and trends in re-search of molecular biology, genomics, and related cutting-edge technologies to provide readers with the latest knowledge and help improve their diagnostic and therapeutic skills; (7) Review: To make a systematic review to focus on the status quo of re-search, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions; (8) Topic Highlight: The editorial board members are invited to write a series of articles (7-10 articles) to comment and discuss a hot topic to help improve the diag-nostic and therapeutic skills of readers; (9) Medical Ethics: The editorial board members are invited to write articles about medical ethics to increase readers’ knowledge of medical ethics. The topic covers international ethics guidelines, animal studies, clinical trials, organ transplantation, etc.; (10) Clinical Case Con-ference or Clinicopathological Conference: The editorial board members are invited to contribute high-quality clinical case conference; (11) Original Articles: To report innovative and original findings in gastroenterology and hepatology; (12) Brief

Online Submissions: http://www.wjgnet.com/esps/[email protected]

World J Gastroenterol 2013 April 21; 19(15): I-VIISSN 1007-9327 (print) ISSN 2219-2840 (online)


I April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

INSTRUCTIONS TO AUTHORS

Articles: To briefly report the novel and innovative findings in gastroenterology and hepatology; (13) Meta-Analysis: To evalu-ate the clinical effectiveness in gastroenterology and hepatology by using data from two or more randomised control trials; (14) Case Report: To report a rare or typical case; (15) Letters to the Editor: To discuss and make reply to the contributions pub-lished in WJG, or to introduce and comment on a controversial issue of general interest; (16) Book Reviews: To introduce and comment on quality monographs of gastroenterology and hepatology; and (17) Autobiography: The editorial board mem-bers are invited to write their autobiography to provide readers with stories of success or failure in their scientific research ca-reer. The topic covers their basic personal information and in-formation about when they started doing research work, where and how they did research work, what they have achieved, and their lessons from success or failure.

Name of journalWorld Journal of Gastroenterology

ISSNISSN 1007-9327 (print)ISSN 2219-2840 (online)

Launch dateOctober 1, 1995

FrequencyWeekly

Editor-in-chiefFerruccio Bonino, MD, PhD, Professor of Gastroenterology, Director of Liver and Digestive Disease Division, Department of Internal Medicine, University of Pisa, Director of General Medicine 2 Unit University Hospital of Pisa, Via Roma 67, 56124 Pisa, Italy

Myung-Hwan Kim, MD, PhD, Professor, Head, Department of Gastroenterology, Director, Center for Biliary Diseases, University of Ulsan College of Medicine, Asan Medical Center, 388-1 Pungnap-2dong, Songpa-gu, Seoul 138-736, South Korea

Kjell Öberg, MD, PhD, Professor, Department of Endocrine Oncology, Uppsala University Hospital, SE-751 85 Uppsala, Sweden

Matt D Rutter, MBBS, MD, FRCP, Consultant Gastroenterolo-gist, Senior Lecturer, Director, Tees Bowel Cancer Screening Centre, University Hospital of North Tees, Durham University, Stockton-on-Tees, Cleveland TS19 8PE, United Kingdom

Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States

Editorial officeJin-Lei Wang, DirectorXiu-Xia Song, Vice DirectorWorld Journal of GastroenterologyRoom 903, Building D, Ocean International Center,No. 62 Dongsihuan Zhonglu, Chaoyang District,Beijing 100025, ChinaTelephone: +86-10-59080039Fax: +86-10-85381893E-mail: [email protected]://www.wjgnet.com

PublisherBaishideng Publishing Group Co., LimitedFlat C, 23/F., Lucky Plaza, 315-321 Lockhart Road, Wan Chai, Hong Kong, ChinaFax: +852-65557188Telephone: +852-31779906E-mail: [email protected]://www.wjgnet.com

Production centerBeijing Baishideng BioMed Scientific Co., LimitedRoom 903, Building D, Ocean International Center,No. 62 Dongsihuan Zhonglu, Chaoyang District,Beijing 100025, ChinaTelephone: +86-10-85381892Fax: +86-10-85381893

Representative officeUSA Office8226 Regency Drive,Pleasanton, CA 94588-3144, United States

Instructions to authorsFull instructions are available online at http://www.wjgnet.com/1007-9327/g_info_20100315215714.htm

Indexed and abstracted inCurrent Contents®/Clinical Medicine, Science Citation Index Expanded (also known as SciSearch®), Journal Citation Reports®, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Thomson Reuters, 2011 Impact Factor: 2.471 (32/74 Gastroen-terology and Hepatology).

SPECIAL STATEMENTAll articles published in this journal represent the viewpoints of the authors except where indicated otherwise.

Biostatistical editingStatistical review is performed after peer review. We invite an expert in Biomedical Statistics to evaluate the statistical method used in the paper, including t test (group or paired compari-sons), chi-squared test, ridit, probit, logit, regression (linear, curvilinear, or stepwise), correlation, analysis of variance, anal-ysis of covariance, etc. The reviewing points include: (1) Statisti-cal methods should be described when they are used to verify the results; (2) Whether the statistical techniques are suitable or correct; (3) Only homogeneous data can be averaged. Standard deviations are preferred to standard errors. Give the number of observations and subjects (n). Losses in observations, such as drop-outs from the study should be reported; (4) Values such as ED50, LD50, IC50 should have their 95% confidence limits calculated and compared by weighted probit analysis (Bliss and Finney); and (5) The word “significantly” should be replaced by its synonyms (if it indicates extent) or the P value (if it indi-cates statistical significance).

Conflict-of-interest statementIn the interests of transparency and to help reviewers as-sess any potential bias, WJG requires authors of all papers to declare any competing commercial, personal, political, intel-lectual, or religious interests in relation to the submitted work. Referees are also asked to indicate any potential conflict they

Instructions to authors

II April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

might have reviewing a particular paper. Before submitting, authors are suggested to read “Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Ethical Consid-erations in the Conduct and Reporting of Research: Conflicts of Interest” from International Committee of Medical Journal Editors (ICMJE), which is available at: http://www.icmje.org/ethical_4conflicts.html.

Statement of informed consentManuscripts should contain a statement to the effect that all hu-man studies have been reviewed by the appropriate ethics com-mittee or it should be stated clearly in the text that all persons gave their informed consent prior to their inclusion in the study. Details that might disclose the identity of the subjects under study should be omitted. Authors should also draw attention to the Code of Ethics of the World Medical Association (Declara-tion of Helsinki, 1964, as revised in 2004).

Sample wording: [Name of individual] has received fees for serving as a speaker, a consultant and an advisory board member for [names of organizations], and has received research fund-ing from [names of organization]. [Name of individual] is an employee of [name of organization]. [Name of individual] owns stocks and shares in [name of organization]. [Name of individu-al] owns patent [patent identification and brief description].

Statement of human and animal rightsWhen reporting the results from experiments, authors should follow the highest standards and the trial should conform to Good Clinical Practice (for example, US Food and Drug Ad-ministration Good Clinical Practice in FDA-Regulated Clinical Trials; UK Medicines Research Council Guidelines for Good Clinical Practice in Clinical Trials) and/or the World Medical Association Declaration of Helsinki. Generally, we suggest au-thors follow the lead investigator’s national standard. If doubt exists whether the research was conducted in accordance with the above standards, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study.

Before submitting, authors should make their study ap-proved by the relevant research ethics committee or institutional review board. If human participants were involved, manuscripts must be accompanied by a statement that the experiments were undertaken with the understanding and appropriate informed consent of each. Any personal item or information will not be published without explicit consents from the involved patients. If experimental animals were used, the materials and methods (experimental procedures) section must clearly indicate that ap-propriate measures were taken to minimize pain or discomfort, and details of animal care should be provided.

SUBMISSION OF MANUSCRIPTSManuscripts should be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Number all pages consecutively, and start each of the following sections on a new page: Title Page, Abstract, Introduction, Materials and Methods, Results, Discussion, Acknowledgements, References, Tables, Figures, and Figure Legends. Neither the editors nor the publisher are responsible for the opinions expressed by contributors. Manu-scripts formally accepted for publication become the permanent property of Baishideng Publishing Group Co., Limited, and may not be reproduced by any means, in whole or in part, without the written permission of both the authors and the publisher. We reserve the right to copy-edit and put onto our website accepted

manuscripts. Authors should follow the relevant guidelines for the care and use of laboratory animals of their institution or national animal welfare committee. For the sake of transparency in regard to the performance and reporting of clinical trials, we endorse the policy of the ICMJE to refuse to publish papers on clinical trial results if the trial was not recorded in a publicly-accessible registry at its outset. The only register now available, to our knowledge, is http://www.clinicaltrials.gov sponsored by the United States National Library of Medicine and we encourage all potential contributors to register with it. However, in the case that other registers become available you will be duly notified. A letter of recommendation from each author’s organization should be provided with the contributed article to ensure the pri-vacy and secrecy of research is protected.

Authors should retain one copy of the text, tables, photo-graphs and illustrations because rejected manuscripts will not be returned to the author(s) and the editors will not be responsible for loss or damage to photographs and illustrations sustained dur-ing mailing.

Online submissionsManuscripts should be submitted through the Online Submis-sion System at: http://www.wjgnet.com/esps/. Authors are highly recommended to consult the ONLINE INSTRUC-TIONS TO AUTHORS (http://www.wjgnet.com/1007-9327/g_info_20100315215714.htm) before attempting to submit online. For assistance, authors encountering problems with the Online Submission System may send an email describing the problem to [email protected], or by telephone: +86-10-5908-0039. If you submit your manuscript online, do not make a postal contribu-tion. Repeated online submission for the same manuscript is strictly prohibited.

MANUSCRIPT PREPARATIONAll contributions should be written in English. All articles must be submitted using word-processing software. All submissions must be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Style should conform to our house format. Required in-formation for each of the manuscript sections is as follows:

Title pageTitle: Title should be less than 12 words.

Running title: A short running title of less than 6 words should be provided.

Authorship: Authorship credit should be in accordance with the standard proposed by ICMJE, based on (1) substantial contribu-tions to conception and design, acquisition of data, or analysis and interpretation of data; (2) drafting the article or revising it critically for important intellectual content; and (3) final approval of the version to be published. Authors should meet conditions 1, 2, and 3.

Institution: Author names should be given first, then the com-plete name of institution, city, province and postcode. For ex-ample, Xu-Chen Zhang, Li-Xin Mei, Department of Pathology, Chengde Medical College, Chengde 067000, Hebei Province, China. One author may be represented from two institutions, for example, George Sgourakis, Department of General, Viscer-al, and Transplantation Surgery, Essen 45122, Germany; George Sgourakis, 2nd Surgical Department, Korgialenio-Benakio Red Cross Hospital, Athens 15451, Greece.


III April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

Author contributions: The format of this section should be: Author contributions: Wang CL and Liang L contributed equally to this work; Wang CL, Liang L, Fu JF, Zou CC, Hong F and Wu XM designed the research; Wang CL, Zou CC, Hong F and Wu XM performed the research; Xue JZ and Lu JR contributed new reagents/analytic tools; Wang CL, Liang L and Fu JF analyzed the data; and Wang CL, Liang L and Fu JF wrote the paper.

Supportive foundations: The complete name and number of supportive foundations should be provided, e.g. Supported by National Natural Science Foundation of China, No. 30224801

Correspondence to: Only one corresponding address should be provided. Author names should be given first, then author title, affiliation, the complete name of institution, city, postcode, prov-ince, country, and email. All the letters in the email should be in lower case. A space interval should be inserted between country name and email address. For example, Montgomery Bissell, MD, Professor of Medicine, Chief, Liver Center, Gastroenterology Division, University of California, Box 0538, San Francisco, CA 94143, United States. [email protected]

Telephone and fax: Telephone and fax should consist of +, country number, district number and telephone or fax number, e.g. Telephone: +86-10-59080039 Fax: +86-10-85381893

Peer reviewers: All articles received are subject to peer review. Normally, three experts are invited for each article. Decision on acceptance is made only when at least two experts recommend publication of an article. All peer-reviewers are acknowledged on Express Submission and Peer-review System website.

AbstractThere are unstructured abstracts (no less than 200 words) and structured abstracts. The specific requirements for structured abstracts are as follows:

An informative, structured abstract should accompany each manuscript. Abstracts of original contributions should be struc-tured into the following sections: AIM (no more than 20 words; Only the purpose of the study should be included. Please write the Aim in the form of “To investigate/study/…”), METH-ODS (no less than 140 words for Original Articles; and no less than 80 words for Brief Articles), RESULTS (no less than 150 words for Original Articles and no less than 120 words for Brief Articles; You should present P values where appropriate and must provide relevant data to illustrate how they were obtained, e.g., 6.92 ± 3.86 vs 3.61 ± 1.67, P < 0.001), and CONCLUSION (no more than 26 words).

Key wordsPlease list 5-10 key words, selected mainly from Index Medicus, which reflect the content of the study.

Core tipPlease write a summary of less than 100 words to outline the most innovative and important arguments and core contents in your paper to attract readers.

TextFor articles of these sections, original articles and brief articles, the main text should be structured into the following sections: INTRODUCTION, MATERIALS AND METHODS, RE-SULTS and DISCUSSION, and should include appropriate Fig-ures and Tables. Data should be presented in the main text or in

Figures and Tables, but not in both.

IllustrationsFigures should be numbered as 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each figure on a separate page. Detailed legends should not be provided under the figures. This part should be added into the text where the figures are ap-plicable. Keeping all elements compiled is necessary in line-art image. Scale bars should be used rather than magnification fac-tors, with the length of the bar defined in the legend rather than on the bar itself. File names should identify the figure and panel. Avoid layering type directly over shaded or textured areas. Please use uniform legends for the same subjects. For example: Figure 1 Pathological changes in atrophic gastritis after treatment. A:...; B:...; C:...; D:...; E:...; F:...; G: …etc. It is our principle to publish high resolution-figures for the E-versions.

TablesThree-line tables should be numbered 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each table. De-tailed legends should not be included under tables, but rather added into the text where applicable. The information should complement, but not duplicate the text. Use one horizontal line under the title, a second under column heads, and a third below the Table, above any footnotes. Vertical and italic lines should be omitted.

Notes in tables and illustrationsData that are not statistically significant should not be noted. aP < 0.05, bP < 0.01 should be noted (P > 0.05 should not be noted). If there are other series of P values, cP < 0.05 and dP < 0.01 are used. A third series of P values can be expressed as eP < 0.05 and fP < 0.01. Other notes in tables or under illustra-tions should be expressed as 1F, 2F, 3F; or sometimes as other symbols with a superscript (Arabic numerals) in the upper left corner. In a multi-curve illustration, each curve should be la-beled with ●, ○, ■, □, ▲, △, etc., in a certain sequence.

AcknowledgmentsBrief acknowledgments of persons who have made genuine contributions to the manuscript and who endorse the data and conclusions should be included. Authors are responsible for obtaining written permission to use any copyrighted text and/or illustrations.

REFERENCESCoding systemThe author should number the references in Arabic numerals ac-cording to the citation order in the text. Put reference numbers in square brackets in superscript at the end of citation content or after the cited author’s name. For citation content which is part of the narration, the coding number and square brackets should be typeset normally. For example, “Crohn’s disease (CD) is associ-ated with increased intestinal permeability[1,2]”. If references are cited directly in the text, they should be put together within the text, for example, “From references[19,22-24], we know that...”.

When the authors write the references, please ensure that the order in text is the same as in the references section, and also ensure the spelling accuracy of the first author’s name. Do not list the same citation twice.

PMID and DOIPleased provide PubMed citation numbers to the reference list,


IV April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

e.g. PMID and DOI, which can be found at http://www.ncbi.nlm.nihgov/sites/entrez?db=pubmed and http://www.crossref.org/SimpleTextQuery/, respectively. The numbers will be used in E-version of this journal.

Style for journal referencesAuthors: the name of the first author should be typed in bold-faced letters. The family name of all authors should be typed with the initial letter capitalized, followed by their abbreviated first and middle initials. (For example, Lian-Sheng Ma is ab-breviated as Ma LS, Bo-Rong Pan as Pan BR). The title of the cited article and italicized journal title (journal title should be in its abbreviated form as shown in PubMed), publication date, volume number (in black), start page, and end page [PMID: 11819634 DOI: 10.3748/wjg.13.5396].

Style for book referencesAuthors: the name of the first author should be typed in bold-faced letters. The surname of all authors should be typed with the initial letter capitalized, followed by their abbreviated middle and first initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong Pan as Pan BR) Book title. Publication number. Publica-tion place: Publication press, Year: start page and end page.

FormatJournalsEnglish journal article (list all authors and include the PMID where ap-

plicable)1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J,

Kubale R, Feuerbach S, Jung F. Evaluation of quantitative contrast harmonic imaging to assess malignancy of liver tumors: A prospective controlled two-center study. World J Gastroenterol 2007; 13: 6356-6364 [PMID: 18081224 DOI: 10.3748/wjg.13.6356]

Chinese journal article (list all authors and include the PMID where ap-plicable)

2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunolog-ic effect of Jianpi Yishen decoction in treatment of Pixu-diarrhoea. Shijie Huaren Xiaohua Zazhi 1999; 7: 285-287

In press3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M.

Signature of balancing selection in Arabidopsis. Proc Natl Acad Sci USA 2006; In press

Organization as author4 Diabetes Prevention Program Research Group. Hyper-

tension, insulin, and proinsulin in participants with impaired glucose tolerance. Hypertension 2002; 40: 679-686 [PMID: 12411462 PMCID:2516377 DOI:10.1161/01.HYP.00000 35706.28494.09]

Both personal authors and an organization as author 5 Vallancien G, Emberton M, Harving N, van Moorse-

laar RJ; Alf-One Study Group. Sexual dysfunction in 1, 274 European men suffering from lower urinary tract symptoms. J Urol 2003; 169: 2257-2261 [PMID: 12771764 DOI:10.1097/01.ju.0000067940.76090.73]

No author given6 21st century heart solution may have a sting in the tail. BMJ

2002; 325: 184 [PMID: 12142303 DOI:10.1136/bmj.325. 7357.184]

Volume with supplement7 Geraud G, Spierings EL, Keywood C. Tolerability and

safety of frovatriptan with short- and long-term use for treatment of migraine and in comparison with sumatrip-tan. Headache 2002; 42 Suppl 2: S93-99 [PMID: 12028325

DOI:10.1046/j.1526-4610.42.s2.7.x]Issue with no volume8 Banit DM, Kaufer H, Hartford JM. Intraoperative frozen

section analysis in revision total joint arthroplasty. Clin Orthop Relat Res 2002; (401): 230-238 [PMID: 12151900 DOI:10.1097/00003086-200208000-00026]

No volume or issue9 Outreach: Bringing HIV-positive individuals into care.

HRSA Careaction 2002; 1-6 [PMID: 12154804]

BooksPersonal author(s)10 Sherlock S, Dooley J. Diseases of the liver and billiary

system. 9th ed. Oxford: Blackwell Sci Pub, 1993: 258-296Chapter in a book (list all authors)11 Lam SK. Academic investigator’s perspectives of medical

treatment for peptic ulcer. In: Swabb EA, Azabo S. Ulcer disease: investigation and basis for therapy. New York: Marcel Dekker, 1991: 431-450

Author(s) and editor(s)12 Breedlove GK, Schorfheide AM. Adolescent pregnancy.

2nd ed. Wieczorek RR, editor. White Plains (NY): March of Dimes Education Services, 2001: 20-34

Conference proceedings13 Harnden P, Joffe JK, Jones WG, editors. Germ cell tu-

mours V. Proceedings of the 5th Germ cell tumours Confer-ence; 2001 Sep 13-15; Leeds, UK. New York: Springer, 2002: 30-56

Conference paper14 Christensen S, Oppacher F. An analysis of Koza’s compu-

tational effort statistic for genetic programming. In: Foster JA, Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Ge-netic programming. EuroGP 2002: Proceedings of the 5th European Conference on Genetic Programming; 2002 Apr 3-5; Kinsdale, Ireland. Berlin: Springer, 2002: 182-191

Electronic journal (list all authors)15 Morse SS. Factors in the emergence of infectious diseases.

Emerg Infect Dis serial online, 1995-01-03, cited 1996-06-05; 1(1): 24 screens. Available from: URL: http://www.cdc.gov/ncidod/eid/index.htm

Patent (list all authors)16 Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee.

Flexible endoscopic grasping and cutting device and posi-tioning tool assembly. United States patent US 20020103498. 2002 Aug 1

Statistical dataWrite as mean ± SD or mean ± SE.

Statistical expressionExpress t test as t (in italics), F test as F (in italics), chi square test as χ2 (in Greek), related coefficient as r (in italics), degree of free-dom as υ (in Greek), sample number as n (in italics), and probabil-ity as P (in italics).

UnitsUse SI units. For example: body mass, m (B) = 78 kg; blood pressure, p (B) = 16.2/12.3 kPa; incubation time, t (incuba-tion) = 96 h, blood glucose concentration, c (glucose) 6.4 ± 2.1 mmol/L; blood CEA mass concentration, p (CEA) = 8.6 24.5 mg/L; CO2 volume fraction, 50 mL/L CO2, not 5% CO2; likewise for 40 g/L formaldehyde, not 10% formalin; and mass fraction, 8 ng/g, etc. Arabic numerals such as 23, 243, 641 should be read 23243641.


V April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

The format for how to accurately write common units and quantums can be found at: http://www.wjgnet.com/1007-9327/g_info_20100315223018.htm.

AbbreviationsStandard abbreviations should be defined in the abstract and on first mention in the text. In general, terms should not be ab-breviated unless they are used repeatedly and the abbreviation is helpful to the reader. Permissible abbreviations are listed in Units, Symbols and Abbreviations: A Guide for Biological and Medical Editors and Authors (Ed. Baron DN, 1988) published by The Royal Society of Medicine, London. Certain commonly used abbreviations, such as DNA, RNA, HIV, LD50, PCR, HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS, ATP, EDTA, mAb, can be used directly without further explanation.

ItalicsQuantities: t time or temperature, c concentration, A area, l length, m mass, V volume.Genotypes: gyrA, arg 1, c myc, c fos, etc.Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc.Biology: H. pylori, E coli, etc.

Examples for paper writingAll types of articles’ writing style and requirement will be found in the link: http://www.wjgnet.com/esps/Navigation-Info.aspx?id=15.

RESUBMISSION OF THE REVISED MANUSCRIPTSAuthors must revise their manuscript carefully according to the revision policies of Baishideng Publishing Group Co., Limited. The revised version, along with the signed copyright transfer agreement, responses to the reviewers, and English language Grade A certificate (for non-native speakers of English), should be submitted to the online system via the link contained in the e-mail sent by the editor. If you have any questions about the revision, please send e-mail to [email protected].

Language evaluation The language of a manuscript will be graded before it is sent for

revision. (1) Grade A: priority publishing; (2) Grade B: minor language polishing; (3) Grade C: a great deal of language polish-ing needed; and (4) Grade D: rejected. Revised articles should reach Grade A.

Copyright assignment formPlease download a Copyright assignment form from http://www.wjgnet.com/1007-9327/g_info_20100315222818.htm.

Responses to reviewersPlease revise your article according to the comments/sugges-tions provided by the reviewers. The format for responses to the reviewers’ comments can be found at: http://www.wjgnet.com/1007-9327/g_info_20100315222607.htm

Proof of financial supportFor papers supported by a foundation, authors should provide a copy of the approval document and serial number of the foundation.

Links to documents related to the manuscript WJG will be initiating a platform to promote dynamic interac-tions between the editors, peer reviewers, readers and authors. After a manuscript is published online, links to the PDF version of the submitted manuscript, the peer-reviewers’ report and the revised manuscript will be put on-line. Readers can make com-ments on the peer reviewer’s report, authors’ responses to peer reviewers, and the revised manuscript. We hope that authors will benefit from this feedback and be able to revise the manuscript accordingly in a timely manner.

Publication feeWJG is an international, peer-reviewed, open access, online journal. Articles published by this journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non com-mercial and is otherwise in compliance with the license. Authors of accepted articles must pay a publication fee. Publication fee: 1365 USD per article. All invited articles are published free of charge.


VI April 21, 2013|Volume 19|Issue 15|WJG|www.wjgnet.com

Baishideng Publishing Group Co., Limited © 2013 Baishideng. All rights reserved.

Published by Baishideng Publishing Group Co., LimitedFlat C, 23/F., Lucky Plaza,

315-321 Lockhart Road, Wan Chai, Hong Kong, ChinaFax: +852-65557188

Telephone: +852-31779906E-mail: [email protected]

http://www.wjgnet.com

I S S N 1 0 0 7 - 9 3 2 7

9 7 7 1 0 07 9 3 2 0 45

1 5

Date post:	24-Feb-2023
Category:	Documents
Upload:	khangminh22
View:	0 times
Download:	0 times

World Journal of Gastroenterology - NET

Documents