+ All Categories
Transcript
Page 1: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

2006-2007

Genetic EngineeringBiotechnology

Page 2: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

(c) define the term recombinant DNA;

(d) explain that genetic engineering involves the extraction of genes from one organism, or the manufacture of genes, in order to place them in another organism (often of a different species) such that the receiving organism expresses the gene product;

(e) describe how sections of DNA containing a desired gene can be extracted from a donor organism using restriction enzymes;

(i) explain how isolated DNA fragments can be placed in plasmids, with reference to the role of ligase;

(j) state other vectors into which fragments of DNA may be incorporated;

(k) explain how plasmids may be taken up by bacterial cells in order to produce a transgenic microorganism that can express a desired gene product;

(l) describe the advantage to microorganisms of the capacity to take up plasmid DNA from the environment;

(m) outline how genetic markers in plasmids can be used to identify the bacteria that have taken up a recombinant plasmid;

Page 3: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

We have been manipulating DNA for generations! Artificial breeding

creating new breeds of animals & new crop plants to improve our food

Page 4: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Animal breeding

Page 5: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Breeding food plants “Descendants” of the wild mustard

the “Cabbage family”

Page 6: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

Page 7: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

A Brave New World

Page 8: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

The code is universal Since all living

organisms… use the same DNA use the same code

book read their genes

the same way

Page 9: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT

human genome3.2 billion bases

Page 10: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Can we mix genes from one creature to another?

YES!

Page 11: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Mixing genes for medicine… Allowing organisms to produce new

proteins bacteria producing human insulin bacteria producing human growth hormone

Page 12: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

How do we do mix genes? Genetic engineering

find gene cut DNA in both organisms paste gene from one creature into other

creature’s DNA insert new chromosome into organism organism copies new gene as if it were its

own organism reads gene as if it were its own organism produces NEW protein:

Remember: we all use the same genetic code!

Page 13: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Cutting DNA

DNA “scissors” enzymes that cut DNA restriction enzymes

used by bacteria to cut up DNA of attacking viruses

EcoRI, HindIII, BamHI

cut DNA at specific sites enzymes look for specific base sequences

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAAGTAACG|AATTCACGCTTCATTGCTTAA|GTGCGAA

Page 14: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Restriction enzymes Cut DNA at specific sites

leave “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

Page 15: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Sticky ends Cut other DNA with same enzymes

leave “sticky ends” on both can glue DNA together at “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

gene you want

GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT

chromosome want to add

gene to

GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA

combinedDNA

Page 16: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Sticky ends help glue genes together

TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA

gene you want cut sitescut sites

AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene tocut sites

AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAAisolated gene

sticky ends

chromosome with new gene added

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

sticky ends stick together

DNA ligase joins the strands Recombinant DNA molecule

Page 17: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organism ex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Page 18: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Uses of genetic engineering Genetically modified organisms (GMO)

enabling plants to produce new proteins Protect crops from insects: BT corn

corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)

Extend growing season: fishberries strawberries with an anti-freezing gene from

flounder

Improve quality of food: golden rice rice producing vitamin A

improves nutritional value

Page 19: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Bacteria Bacteria are great!

one-celled organisms reproduce by mitosis

easy to grow, fast to grow generation every ~20 minutes

Page 20: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Bacterial DNA Single circular chromosome

only one copy = haploid no nucleus

Other DNA = plasmids!

bacteriachromosome

plasmids

Page 21: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

There’s more… Plasmids

small extra circles of DNA carry extra genes that bacteria can use can be swapped between bacteria

bacterial sex!! rapid evolution = antibiotic resistance

can be picked up from environment

Page 22: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

How can plasmids help us? A way to get genes into bacteria easily

insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene

bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vector

glue DNA

Page 23: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Page 24: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Applications of biotechnology

Page 25: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Outline the use of genetic markers HGH gene inserted into plasmids that

are resistant to certain antibiotics, for detail review p. 167 of OCR Biology 2.

How ever, are there possible ‘issues’ with this type of marker DISCUSS.

Suggest possible alternative marker… .. Insert a gene that cause fluorescence

from jellyfish.

Page 26: 2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

2006-2007

I’m a very special pig!

Got any Questions?


Top Related