+ All Categories
Transcript
Page 1: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Next Generation Molecular Profiling

26 oktober 2011Auditorium J, Plateau, Gent

Page 2: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Lab for Bioinformatics and computational genomics

10 “genome hackers” mostly engineers (statistics)

42 scientiststechnicians, geneticists, clinicians

>100 people hardware engineers,

mathematicians, molecular biologists

Page 3: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Overview

Personalized Medicine,

Biomarkers …

… Molecular Profiling

First Generation Molecular Profiling

Next Generation Molecular Profiling

Next Generation Epigenetic Profiling

Concluding Remarks

Page 4: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 5: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 6: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 7: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 8: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Personalized Medicine

• The use of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy

• The benefits of this approach are to– avoid adverse drug reactions– improve efficacy– adjust the dose to suit the patient– differentiate a product in a competitive market– meet future legal or regulatory requirements

• Potential uses of biomarkers– Risk assessment– Initial/early detection– Prognosis– Prediction/therapy selection– Response assessment– Monitoring for recurrence

Page 9: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Biomarker

First used in 1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventions

Characteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drug

A biomarker is valid if:– It can be measured in a test system with well

established performance characteristics – Evidence for its clinical significance has been

established

Page 10: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Rationale 1:Why now ? Regulatory path becoming more clear

There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline

Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what.

Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics

Page 11: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Why now ?

First and maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomics-based

Clinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10)

An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.

Page 12: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Molecular Profiling

The study of specific patterns (fingerprints) of proteins, DNA, and/or mRNA and how these patterns correlate with an individual's physical characteristics or symptoms of disease.

Page 13: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Generic Health advice

• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate

dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)

Page 14: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate

dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)

Page 15: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate

dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)

Page 16: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate

dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)

Page 17: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

EGFR based therapy in mCRC

Page 18: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Overview

Personalized Medicine,

Biomarkers …

… Molecular Profiling

First Generation Molecular Profiling

Next Generation Molecular Profiling

Next Generation Epigenetic Profiling

Concluding Remarks

Page 19: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Before molecular profiling …

Page 20: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 21: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 22: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 23: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Before molecular profiling …

Page 24: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Before molecular profiling …

Page 25: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 26: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

First Generation Molecular Profiling

• Flow cytometry correlates surface markers, cell size and other parameters

• Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood.

• Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types.

• Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.

Page 27: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 28: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 29: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 30: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

First Generation Molecular Profiling

• Gene sequencing for mutation detection

• Microarray for m-RNA message detection • RT-PCR for gene expression

• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for

gene copy number

Page 31: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Basics of the “old” technology

• Clone the DNA.• Generate a ladder of labeled (colored)

molecules that are different by 1 nucleotide.• Separate mixture on some matrix.• Detect fluorochrome by laser.• Interpret peaks as string of DNA.• Strings are 500 to 1,000 letters long• 1 machine generates 57,000 nucleotides/run• Assemble all strings into a genome.

Page 32: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 33: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Genetic Variation Among People

0.1% difference among people

GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG

Single nucleotide polymorphisms(SNPs)

Page 34: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

The genome fits as an e-mail attachment

Page 35: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

First Generation Molecular Profiling

• Gene sequencing for mutation detection

• Microarray for m-RNA message detection • RT-PCR for gene expression

• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for

gene copy number

Page 36: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

mRNA Expression Microarray

Page 37: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

First Generation Molecular Profiling

• Gene sequencing for mutation detection

• Microarray for m-RNA message detection • RT-PCR for gene expression

• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for

gene copy number

Page 38: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 39: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Overview

Personalized Medicine,

Biomarkers …

… Molecular Profiling

First Generation Molecular Profiling

Next Generation Molecular Profiling

Next Generation Epigenetic Profiling

Concluding Remarks

Page 40: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Basics of the “new” technology

• Get DNA.• Attach it to something.• Extend and amplify signal with some color

scheme.• Detect fluorochrome by microscopy.• Interpret series of spots as short strings of

DNA.• Strings are 30-300 letters long• Multiple images are interpreted as 0.4 to 1.2

GB/run (1,200,000,000 letters/day). • Map or align strings to one or many genome.

Page 41: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Next Generation Technologies

• Roche (454)–Emulsion PCR–Polymerase–Natural Nucleotides

• 100-500 Mb for 5-15k –1% error rate–Homopolymers

Page 42: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 43: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 44: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 45: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 46: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

One additional insight ...

Page 47: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Read Length is Not As Important For Resequencing

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

8 10 12 14 16 18 20

Length of K-mer Reads (bp)

% o

f P

aire

d K

-mer

s w

ith

Un

iqu

ely

Ass

ign

able

Lo

cati

on

E.COLI

HUMAN

Jay Shendure

Page 48: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Short Read Techologies

• Illumina GA (HiSeq, MySeq)

• ABI SOLID

Page 49: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 50: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 51: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 52: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Other second generation technology: (ABI) SOLID

Page 53: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 54: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

So what ?

Page 55: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 56: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second generation DNA/RNA profiling

Page 57: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation DNA profiling

• Enrichment Sequencing• ChIP-Seq (Chromosome

Immunoprecipitation)• A substitute for ChIP-chip• Eg. to find the binding sequence of

proteins (TFBS)

Page 58: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Paired End Reads are Important!

Repetitive DNAUnique DNA

Single read maps to multiple positions

Read 1 Read 2

Known Distance

Page 59: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Paired End Reads are Important!

Repetitive DNAUnique DNA

Single read maps to multiple positions

Read 1 Read 2

Known Distance

Page 60: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation DNA profiling

• Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders.

• 160K exons

Page 61: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation DNA profiling

Page 62: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation DNA profiling

Page 63: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Bioinformatics tools

Page 64: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Bioinformatics tools

Page 65: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Con

tent

s-S

ched

ule

Besides the 6000 protein coding-genes …

140 ribosomal RNA genes275 transfer RNA gnes40 small nuclear RNA genes>100 small nucleolar genes

Function of RNA genes

pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000)Cartilage-hair hypoplasmia mapped to an RNA (Ridanpoa et al. Cell 104:195-203,2001)The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)

Second Generation RNA profiling

Page 66: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

RNA genes can be hard to detects

UGAGGUAGUAGGUUGUAUAGU

C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000)

Often smallSometimes multicopy and redundantOften not polyadenylated (not represented in ESTs)Immune to frameshift and nonsense mutationsNo open reading frame, no codon biasOften evolving rapidly in primary sequence

Second Generation RNA profiling

Page 67: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Although details of the methods vary, the concept behind RNA-seq is simple:

• isolate all mRNA• convert to cDNA using reverse transcriptase• sequence the cDNA• map sequences to the genome

The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.

Second Generation RNA profiling

Page 68: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

• Comparing to microarray– Microarray

• Closed technology: Prior knowledge required• Affected by pseudo-genes (homologous of real genes)• Low sensitivity

– RNA-Seq• Open technology: No prior knowledge required• Not affected by pseudo-genes because exact

sequence is measured• Other information could be yielded (SNP, Alternative

splicing)

Second Generation RNA profiling

Page 69: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

ncRNAs in human genome

tRNA 60018S rRNA 2005.8S rRNA 20028S rRNA 2005S rRNA 200snoRNA 300miRNA 250U1 40U2 30U4 30U5 30U6 20U4atac 5U6atac 5U11 5U12 5

SRP RNA 1

RNase P RNA 1

Telomerase RNA 1

RNase MRP 1

Y RNA 5

Vault 4

7SK RNA 1

Xist1

H191

BIC1

Antisense RNAs 1000s?

Cis reg regions 100s?

Others ?

Page 70: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 71: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Mapping Structural Variation in Humans

- Thought to be Common 12% of the genome (Redon et al. 2006)

- Likely involved in phenotype variation and disease

- Until recently most methods fordetection were low resolution (>50 kb)

CNVs

>1 kb segments

Page 72: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Size Distribution of CNV in a Human Genome

Page 73: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 74: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Next next generation sequencing

Third generation sequencing

Now sequencing

Page 75: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Ultra-low-cost SINGLE molecule sequencing

Page 76: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Pacific Biosciences: A Third Generation Sequencing Technology

Eid et al 2008

Page 77: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Complete genomics

Page 78: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Nanopore Sequencing

Page 79: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation Protein profiling

• Proteomics MS-MS-based exclusively in discovery mode

• Automate diagnostics assay generation (next generation proteomics)• Aptamers as alternative to antibodies• ImmunoPCR

Page 80: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

MS/MS identification pipeline

pipeline overview

Bonanza

Bonanza + IggyPep

Goaldefine PTMs profile

prior to database

search

Goalmulti-tiered

database search

Goalfilter

dataset prior to

database search

Page 81: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Second Generation Protein profiling

• Proteomics MS-MS-based exclusively in discovery mode

• Automate diagnostics assay generation (next generation proteomics)• Aptamers as alternative to antibodies• ImmunoPCR

Page 82: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Overview

Personalized Medicine,

Biomarkers …

… Molecular Profiling

First Generation Molecular Profiling

Next Generation Molecular Profiling

Next Generation Epigenetic Profiling

Concluding Remarks

Page 83: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Defining Epigenetics

Reversible changes in gene expression/function

Without changes in DNA sequence

Can be inherited from precursor cells

Allows to integrate intrinsic with environmental signals (including diet)

Methylation I Epigenetics | Oncology | Biomarker

Genome

DNA

Gene Expression

Epigenome

Chromatin

Phenotype

I NEXT-GEN | PharmacoDX | CRC

Page 84: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 85: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Epigenetic Regulation: Post Translational Modifications to Histones and Base Changes in DNA

Epigenetic modifications of histones and DNA include:– Histone acetylation and methylation, and DNA methylation

HistoneAcetylation

HistoneMethylation

DNA Methylation

MeMe

Ac

Me

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 86: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 87: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

MGMT BiologyO6 Methyl-Guanine Methyl Transferase

Essential DNA Repair Enzyme

Removes alkyl groups from damaged guanine bases

Healthy individual: - MGMT is an essential DNA repair enzymeLoss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development

Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 88: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy

Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation

0

5

10

15

20

25Median Overall Survival

21.7 months

12.7 months

radiotherapy

plus temozolomide

Methylated MGMT Gene

Non-Methylated MGMT Gene

radiotherapy

Adapted from Hegi et al.NEJM 2005352(10):1036-8.Study with 207 patients

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 89: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Genome-wide methylation by methylation sensitive restriction enzymes

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 90: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Genome-wide methylation by probes

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 91: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

MBD_Seq

DNA Sheared

Immobilized Methyl Binding Domain

Methylation I Epigenetics | Oncology | Biomarker

Condensed Chromatin

DNA Sheared

I NEXT-GEN | PharmacoDX | CRC

Page 92: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

CONFIDENTIAL

Immobilized Methyl binding domain

MgCl2

Next Gen SequencingGA Illumina: 100 million reads

MBD_Seq

Methylation I Epigenetics | Oncology | Biomarker

I NEXT-GEN | PharmacoDX | CRC

Page 93: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Overview

Personalized Medicine,

Biomarkers …

… Molecular Profiling

First Generation Molecular Profiling

Next Generation Molecular Profiling

Next Generation Epigenetic Profiling

Concluding Remarks

Page 94: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Math

Informatics

Bioinformatics, a life science discipline … management of expectations

Theoretical Biology

Computational Biology

(Molecular)Biology

Computer Science

BioinformaticsDiscovery Informatics – Computational Genomics

Interface Design

AI, Image Analysisstructure prediction (HTX)

Sequence Analysis

Expert Annotation

NPDatamining

Page 95: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Translational Medicine: An inconvenient truth

• 1% of genome codes for proteins, however more than 90% is transcribed

• Less than 10% of protein experimentally measured can be “explained” from the genome

• 1 genome ? Structural variation• > 200 Epigenomes ??

• Space/time continuum …

Page 96: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Translational Medicine: An inconvenient truth

• 1% of genome codes for proteins, however more than 90% is transcribed

• Less than 10% of protein experimentally measured can be “explained” from the genome

• 1 genome ? Structural variation• > 200 Epigenomes …

• “space/time” continuum

Page 97: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 98: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter
Page 99: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Epigenetic (meta)information = stem cells

Cellular programming

Page 100: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Cellular reprogramming

Tumor

Epigenetically altered, self-renewing cancer stem cells

Tumor Development and Growth

Page 101: 2011 10 26_quantitative_cell_biology_molecular_profiling_v_twitter

Gene-specificEpigeneticreprogramming

Cellular reprogramming


Top Related