doi:10.1093/brain/awl317 Brain (2007), 130, 535547
TGF-b receptor-mediated albumin uptake intoastrocytes is involved in neocorticalepileptogenesis
Sebastian Ivens,1 Daniela Kaufer,3,4 Luisa P Flores,3 Ingo Bechmann,2 Dominik Zumsteg,5
Oren Tomkins,6 Ernst Seiffert,1 Uwe Heinemann1 and Alon Friedman1,6
1Institute of Neurophysiology, 2Center of Anatomy, Charite University Medicine, Berlin, Germany, 3Department ofIntegrative Biology and 4Helen Wills Neuroscience Institute, UC Berkeley, Berkeley, CA, USA, 5Krembil NeuroscienceCentre, Toronto Western Hospital, University of Toronto, Toronto, ON, Canada and 6Departments of Physiology andNeurosurgery, Zlotowski Center for Neuroscience, Ben-Gurion University of the Negev, Beer-Sheva, Israel
Correspondence to: Dr Alon Friedman, Departments of Physiology and Neurosurgery, Soroka University Medical Centreand Zlotowski Center for Neuroscience, Ben-Gurion University, Beer-Sheva 84105, IsraelE-mail: [email protected]
It has long been recognized that insults to the cerebral cortex, such as trauma, ischaemia or infections, mayresult in the development of epilepsy, one of the most common neurological disorders. Human and animalstudies have suggested that perturbations in neurovascular integrity and breakdown of the bloodbrain barrier(BBB) lead to neuronal hypersynchronization and epileptiform activity, but the mechanisms underlying theseprocesses are not known. In this study, we reveal a novel mechanism for epileptogenesis in the injured brain.We used focal neocortical, long-lasting BBB disruption or direct exposure to serum albumin in rats (51 and13 animals, respectively, and 26 controls) as well as albumin exposure in brain slices in vitro. Most treated slices(72%, n = 189) displayed hypersynchronous propagating epileptiform field potentials when examined 549 daysafter treatment, but only 14% (n = 71) of control slices showed similar responses. We demonstrate that directbrain exposure to serum albumin is associated with albumin uptake into astrocytes, which is mediatedby transforming growth factor b receptors (TGF-bRs). This uptake is followed by down regulation of inward-rectifying potassium (Kir 4.1) channels in astrocytes, resulting in reduced buffering of extracellular potassium.This, in turn, leads to activity-dependent increased accumulation of extracellular potassium, resulting infacilitated N-methyl-D-aspartate-receptor-mediated neuronal hyperexcitability and eventually epileptiformactivity. Blocking TGF-bR in vivo reduces the likelihood of epileptogenesis in albumin-exposed brains to 29.3%(n = 41 slices, P < 0.05). We propose that the above-described cascade of events following common brain insultsleads to brain dysfunction and eventually epilepsy and suggest TGF-bRs as a possible therapeutic target.
Keywords: astrocytes; bloodbrain barrier; epileptogenesis; neocortex; transforming growth factor beta receptors
Abbreviations: ACSF artificial CSF; BBB bloodbrain barrier; DOC deoxycholic acid; FITC fluorescein isothiocyanate;GFAP glial fibrillary acidic protein; [K+]o extracellular potassium concentration; NMDA N-methyl-D-aspartate;TGF-bRs transforming growth factor b receptorsReceived June 8, 2006. Revised September 19, 2006. Accepted October 14, 2006. Advance Access publication November 21, 2006.
IntroductionEpilepsy, affecting 0.52% of the population worldwide, is
one of the most common neurological disorders. While the
characteristic electrical activity in the epileptic cortex has
been extensively studied, the mechanisms underlying
epileptogenesis are still poorly understood. Focal neocortical
epilepsy often develops following traumatic, ischaemic or
infectious brain injury. Under these conditions, vasculature
damage is common and includes a local compromise of the
2006 The Author(s).This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
by guest on May 4, 2015
Dow
nloaded from
bloodbrain barrier (BBB; Tomkins et al., 2001; Neuwelt,
2004; Abbott et al., 2006). Ultrastructural studies of human
epileptic tissue demonstrating increased micropinocytosis
and fewer mitochondria in endothelial cells, a thickening of
the basal membrane, and abnormal tight junctions further
support the notion of lasting BBB dysfunction in at least
some forms of epilepsy (Kasantikul et al., 1983; Cornford
and Oldendorf, 1986; Cornford, 1999). Indeed, clinical and
animal studies showed that vascular damage and, specifi-
cally, opening of the BBB is often observed in epileptic brain
regions, but was generally believed to result from the seizure
activity, rather than contribute to its generation (Cornford,
1999). However, conversely to that option, we have observed
in some post-traumatic patients a long-lasting BBB opening
corresponding to abnormal cortical function as revealed by
EEG analyses (Korn et al., 2005). These observations led us
to hypothesize that BBB dysfunction may have a direct role
in the pathogenesis of epilepsy. Supporting this hypothesis
of primary BBB lesions as an initial event leading to
neocortical epilepsy, we demonstrated that opening of the
BBB in the rat somatosensory cortex exposes the secluded
brain microenvironment to serum components, resulting in
the delayed development of epileptiform activity (Seiffert
et al., 2004). However, the mechanisms underlying cortical
dysfunction following BBB injury are unknown. Here we
have set out to elucidate these mechanisms, in an animal
model of BBB disruption.
Experimental evidence suggests that astrocytes display
modified properties in epileptic tissue from human and
animal (Pollen and Trachtenberg, 1970; Bordey and
Sontheimer, 1998; Hinterkeuser et al., 2000; Jauch et al.,
2002; Eid et al., 2005) and are likely to play a key role in the
pathogenesis of epilepsy (Seifert et al., 2006). Since astrocytes
are known to be contributors to BBB formation (Ballabh
et al., 2004) and enhanced immunolabelling against the
astrocytic marker, glial fibrillary acidic protein (GFAP), is
observed to follow a breach in the integrity of the BBB
(Seiffert et al., 2004), we hypothesized that these cells may
play a role in epileptogenesis after BBB disruption.
In this study, we investigated the mechanisms underlying
epileptogenesis induced by BBB opening. We demonstrate
for the first time in a rat model the role played by astrocytes
in epileptogenesis and propose a cascade of events that takes
place during the window period of epileptogenesis, i.e. after
BBB opening and before the development of epileptiform
activity. Surprisingly, we have identified transforming
growth factor b receptor (TGF-bR) as a key player in thecellular response, and demonstrate an effective blockade of
the cascade, and the resulting epileptiform activity, by
blocking TGF-bRs.
Material and methodsIn vivo experimentsAll experimental procedures were approved by the ethical commit-
tees dealing with experiments on animals at Charite University
Medicine, Berlin and Ben-Gurion University of the Negev,
Beer-Sheva. The in vivo experiments were performed as described
previously in Wistar rats (Seiffert et al., 2004). For the treated rats,
we added to the artificial CSF (ACSF) the BBB-disrupting agent
deoxycholic acid sodium salt (DOC, 2 mM, Sigma-Aldrich,
Steinheim, Germany) or bovine serum albumin (BSA, 0.1 mM,
>98% in agarose-cell electrophoresis; Merck, Darmstadt, Germany,
ordering number 1.12018.0025), corresponding to 25% of serum
albumin concentration (0.4 mM determined for 10 rats, see also
Geursen and Grigor, 1987; osmolarity 303305 mOsmol/l). ACSF
alone was applied to the sham-operated controls. The composition
of the ACSF was (in mM): 129 NaCl, 21 NaHCO3, 1.25 NaH2PO4,
1.8 MgSO4, 1.6 CaCl2, 3 KCl, 10 glucose. In some experiments, the
cortex was exposed (30 min) to ACSF containing the TGF-bR1kinase activity inhibitor SB431542 (100 mM, Tocris, Bristol, UK) indimethyl sulphoxide (DMSO, 0.1%, Merck) and TGF-bR2
antibody (50 mg/ml, Santa Cruz Biotechnology, Santa Cruz, USA)and subsequently exposed to BSA (0.1 mM) for 30 min. The
control brains for these experiments were superfused with ACSF
containing 0.1% DMSO, followed by ACSF with DMSO and BSA
(0.1 mM).
In vitro slice preparationBrain slices were prepared by standard techniques (Kaufer et al.,
1998; Pavlovsky et al., 2003; Seiffert et al., 2004). To study albumin
uptake, slices were incubated in a submerged chamber containing
ACSF with 0.0040.1 mM fluorescein isothiocyanate (FITC)-
conjugated albumin (Sigma-Aldrich, Germany, osmolarity 311
312 mOsmol/l) for 560 min. In some experiments, slices were
incubated with non-labelled BSA (0.004, 0.04 and 0.4 mM,
osmolarity 308311 mOsmol/l) in the presence of FITC-albumin,
with 0.0040.04 mM FITC-labelled dextran (70 kDa, Sigma-
Aldrich) or with 0.04 mM Texas-Red-conjugated ovalbumin
(Invitrogen, Karlsruhe, Germany). To block TGF-bRs, slices were
incubated (60 min) in ACSF containing SB431542 (in DMSO) or
with TGF-bR2 antibody. FITC-albumin (0.004 mM) was thenadded, and the slices were incubated for another 25 min. Following
incubation, slices were washed with oxygenated ACSF (30 min) in a
submerged chamber and prepared for histological analysis
(see below).
Electrophysiological recordingsFor electrophysiological recordings, we used brain slices prepared
as mentioned above. Following the slicing procedure slices were
transferred immediately to the recording chamber, maintained
at 36C, as reported previously from our laboratory (Seiffert et al.,2004). For detection of epileptiform activity we recorded
field potentials from 10 positions along the treated/sham-treated
region in cortical layer 4, stimulating on the border of white to grey
matter. Extracellular potassium concentrations ([K+]o) were
measured with ion-sensitive microelectrodes (ISMEs, Lux and
Neher, 1973; Jauch et al., 2002). For K+-ionophoresis, double-
barrelled theta glass electrodes with slightly angled tips were filled
with 1 M KCl and 154 mM NaCl and glued to the ISME
(tip distance: 5080 mm). K+ was applied by ionophoresis (60 s,
1501000 nA). Injections were repeated at least three times at 5 min
intervals to confirm stability. Intracellular recordings were
performed with sharp microelectrodes using standard techniques
(Seiffert et al., 2004).
536 Brain (2007), 130, 535547 S. Ivens et al.
by guest on May 4, 2015
Dow
nloaded from
Drug applicationKir and K+ leak currents were blocked by BaCl2 (100 mM and2 mM, respectively), dissolved in sulphate-free ACSF (Ransom and
Sontheimer, 1995; Jauch et al., 2002). To isolate astrocytic currents,
the following drugs were applied in combination before BaCl2application: 30 mM 2-amino-5-phosphovaleric acid (APV), 30 mM6-cyano-7-nitroquinoxyline-2,3-dione (CNQX), 10 mM bicuculline
and 1 mM tetrodotoxin (TTX) (all from Tocris, Bristol, UK) wereused to block N-methyl-D-aspartate (NMDA), AMPA/KA, and
GABA receptors and voltage activated Na+-channels, respectively.
Drugs were applied by addition to the ACSF.
Evaluation of BBB integrityTwo approaches were used to estimate BBB integrity: (i) ex vivo
measurements following intra-peritoneal injection with 2 ml of 2%
Evans blue (Sigma, St Louis, USA) (Friedman et al., 1996; Seiffert
et al., 2004); and (ii) image analyses of in vivo MRI measurements
by using a 7 tesla scanner (Pharmascan 70/16 AS, Bruker Biospin,
Ettlingen, Germany) with a 16 cm horizontal bore magnet and a
9 cm (inner diameter) shielded gradient having a maximum
strength of 300 mT/m. Rats were anaesthetized with 1.5%
isoflurane delivered in 100% O2 via a face mask and then placed
in the centre of a 38 mm RF coil on a heated pad. Respiration and
pulse rate were continuously monitored (monitoring unit Model
1025; SA Instruments, Inc., Stony Brook, New York). Coronal slices
were imaged (35 slices, slice thickness = 0.5 mm). The field of view
was 3 3 cm, and the matrix was 256 256, resulting in anin-plane resolution of 117 mm. Two brain imaging sequences wereperformed: (i) T1-weighted 2D turbo spin echo with RARE factor
2 (TR 1141.7 ms, TE 13.2 ms, 8 averages, total scan time 19 min: 30
s), in which the sequence was repeated before and after the
injection of the BBB non-permeable agent gadolinium diethylene
triamine pentaacetate (Gd-DTPA, 0.5 mol/l, 0.5 ml/200 g body
weight; Magnevist, Schering, Berlin, Germany); and (ii)
T2-weighted sequence with RARE factor 4 (TR 5046.6 ms, TE
36.5 ms, 5 averages, total scan time 26 min: 54 s). Spatially
matching T1 images were compared for statistically significant
differences in signal enhancement, reflecting changes in BBB
permeability (Tomkins et al., 2001).
HistologyFor histological experiments, rat brains were fixed by transcardial
perfusion with 4% paraformaldehyde in 0.1 M phosphate-buffered
saline. After perfusion, brains were kept in the same fixative at
4C overnight. Brains were then removed from the skull, dissected,and treated with 96% alcohol overnight and subsequently paraffin
embedded in accordance with routine procedures. Eight to ten
micrometre coronal sections were mounted. Immunohistochem-
istry was performed on 10 mm paraffin sections. Sections wereincubated with primary antibodies at 4C overnight. We usedrabbit antibodies against GFAP (1 : 400, DakoCytomation,
Glostrup, Denmark), microtubule-associated protein 2 (MAP2,
1 : 500, Sigma) and Kir 4.1 (1 : 200, Alomone Labs, Jerusalem,
Israel). Signal detection was achieved by incubation with secondary
antibody for 2 h at room temperature. Alexa Fluor 568 goat anti-
rabbit antibody (1:200, MoBiTec, Gottingen, Germany) was used
for red fluorescence, and biotinylated goat anti-rabbit antibody
(1:250, Vector, Peterborough, UK) followed by a standard ABC-
DAB development was used for non-fluorescent staining (Bech-
mann et al., 2000). To verify double-labelling throughout the entire
extent of the cells, we examined them in orthogonal planes with a
Zeiss Axiovert 510 confocal microscope (Thornwood, New York).
Upper and lower thresholds were set with the range indicator
function. We obtained optical stacks of 1 mm thick sectionsthrough putatively double-labelled cells.
Gene expressionmRNA levels were determined using quantitative RTPCR by real-
time kinetic analysis with an iQ5 detection system (Bio-Rad).
Primer pairs specific to GFAP (forward: 1138+ 50AGAAAACCG-CATCACCATTC30; reverse: 1287 50TCCTTAATGACCTCGCC-ATC30), Kir 4.1 (forward: 150+ 50GAGACGACGCAGACAGA-GAG30; reverse: 310 50CCACTGCATGTCAATGAAGG30) andactin (forward: 1012+ 50GGGAAATCGTGCGTGACATT30;reverse: 1081 50GCGGCAGTGGCCATCTC30) were used. Real-time PCR data were analysed using the Livak 2-Delta Delta C(T)
calculation method (Livak and Schmittgen, 2001). Presented are
percentages of gene expression level of the treated hemisphere, as
compared with the non-operated contralateral hemisphere. Actin
mRNA levels were used as internal controls for variations in sample
preparation.
Data acquisition and analysisSignals were amplified (SEC-10L, NPI, Tamm, Germany), filtered
at 3 and 0.03 KHz (field potential, K+ signal, respectively),
displayed on an oscilloscope, digitized on-line (CED-1401,
Cambridge, UK) and stored for off-line analysis. Data and bar
graphs are presented throughout as means 6 SEM. Differencesbetween treated and control slices were determined by the non-
parametric MannWhitney test for independent samples. The effect
of pharmacological agents was tested with the non-parametric
Wilcoxon signed rank test for related variables. We performed all
statistical tests using SPSS 12.0.1 for Windows. P < 0.05 was taken
as the level of statistical significance.
ResultsBrain exposure to serum albuminleads to cortical dysfunctionIn order to study the consequences of an open BBB on brain
function, we employed an established in vivo model of
disturbing BBB using DOC sodium salt. Using this model we
produce a localized, highly reproducible perturbation in the
BBB by opening a cranial window over the somatosensory
region through which the exposed cortex is superfused with
DOC solution (2 mM) for 30 min. In vivoMRI obtained 24 h
after exposure to DOC confirmed BBB opening by showing
local enhancement of the T1 signal following injection of
Gd-DTPA. Both a local increase in cortical diameter and an
increased T2 signal indicated local vasogenic brain oedema
(Fig. 1A and B, n = 4). The MRI images also demonstrated
that there was no penetrating injury or significant
intracortical bleeding due to the treatment, supporting
previous histological analyses (Seiffert et al., 2004).
Treatment with either DOC or BSA induced indistin-
guishable hypersynchronized epileptiform activity in the
treated region, as expected (see below and Seiffert et al.,
2004). In the cortices of control sham-operated animals,
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 537
by guest on May 4, 2015
Dow
nloaded from
brief electrical stimulation of the white matter evoked
electrophysiological responses in a small cortical region
(
found to be similar in DOC- and albumin-treated slices but
significantly lower in control slices (Fig. 1C). In both control
and treated brains, the early evoked synaptic response was
limited to a narrow band of cortex, while the paroxysmal
prolonged activity was propagating along a wide cortical
area within the treated region (Fig. 1DF). Simultaneous
recordings from treated slices using multiple electrodes
revealed similar propagating epileptiform activity 1 week
after treatment for both DOC and albumin-treated slices
(6.18 6 1.98 and 5.31 6 1.75 mm/s, respectively, n = 4 foreach group, Fig. 1DF). Clear epileptiform activity was
recorded in 72% of slices (DOC: n = 100 out of 139, BSA:
36 out of 50 slices) from over 90% of the treated rats (DOC:
n = 47 of 51, BSA: 12 of 13 rats), but in only 9.1% of slices
(2 of 22) from sham-operated rats (1 of 7) and in 16.3% of
slices (8 of 49) from the non-treated contralateral hemi-
sphere of treated rats (6 of 19 animals, Pearson x2 test,P < 0.001). These findings point to reorganization of
the BBB-disrupted cortex in a manner similar to the
chronically injured (Prince and Tseng, 1993), undercut
(Hoffman et al., 1994), or maldeveloped cortex (Jacobs et al.,
1996). We observed spontaneous recurrent partial seizures
in three of our treated animals, sometime followed by
secondary generalization. The observed behavioural sponta-
neous seizures, while not investigated in detail under this
study, support the notion that paroxysmal activity observed
in the in vitro slice preparation indeed reflects abnormal
epileptic network activity in vivo (video; available as
supplementary material at Brain Online).
Albumin is selectively transportedinto astrocytesLike BBB opening, direct application of serum albumin in
vivo causes cortical dysfunction (Fig. 1). To confirm that our
BBB opening protocol results in diffusion of serum albumin
into the brains extracellular space, we injected Evans blue
intra-peritoneally and then traced the BBB non-permeable
albuminEvans blue complex (red fluorescence, Fig. 2A) in
brain capillaries (Ehrlich, 1885; Friedman et al., 1996). While
in control brains fluorescence was limited to the intra-
capillary space, after BBB opening Evans bluealbumin
complex was observed around the capillaries (Fig. 2A). Six
to eight hours post-treatment, the albumindye complex
was detected inside some cellular elements (Fig. 2A, arrows).
In order to confirm the inclusion of albumin in the protein
dye complexes, we performed immunohistochemistry stain-
ing with an antibody directed against serum albumin.
Albumin antibody staining produced a similar staining to
the Evans blue dye distribution (data not shown), further
verifying the penetration of serum albumin into the brain
microenvironment.
To further explore the mechanisms underlying albumin
uptake by brain cells, we directly exposed cortical slices to
albumin labelled with FITC or biotin. Prominent intracel-
lular staining was evident in the neocortex and hippocampus
of all slices (242.2 6 10.3 cells/mm2, n = 269 windows from50 sections, 10 slices). The number of stained cells increased
during the first 40 min of exposure (87.96 20.0, 93.86 60.5,223.0 6 25 and 270.0 6 13.6 cells/mm2 for 5, 10, 30 and40 min, respectively), during which staining clearly shifted
from extranuclear sites (membrane and/or cytoplasma) to
the nucleus (Fig. 2BD and G). Many labelled cells exhibi-
ted processes that were directed towards blood vessels,
resembling astrocytic end feet (Fig. 2C, left panel).
In addition, labelled albumin was found in the cytoplasm
(but not the nucleus) of other cells around blood vessels,
probably perivascular cells (Bechmann et al., 2001). To
control the specificity of albumin uptake, slices were exposed
to either FITC-dextran (70 kDa), which has a molecular
weight similar to that of albumin, or to ovalbumin labelled
with Texas Red (45 kDa). In the latter experiments, labelling
was limited to the cytoplasm of perivascular cells and was
never found in parenchymal cells (Fig. 2C right panel, D).
To identify the brain cells that take up FITC-albumin,
immunohistochemical labelling for astrocytes and neurons
was performed using antibodies directed against GFAP
and MAP2 as markers, respectively. Confocal analysis of
co-labelled cells revealed that most of the FITC-albumin-
containing cells expressed GFAP, but none expressed MAP2
(Fig. 2E and F). In addition, a small number of labelled cells
were both non-GFAP and non-MAP2 positive. These cells
were not characterized in this study: they could be non-
GFAP expressing astrocytes, pericytes and/or microglia. To
test the nature of the uptake process a competition assay
was performed in the presence of increasing amounts of
non-labelled albumin in the bathing solution. FITC-albumin
uptake was reduced in a dose-dependent manner as expected
for a receptor-mediated process (Fig. 2H). Taken together,
the selectivity of ligand uptake (albumin but not dextran
and ovalbumin), the selectivity of cell-type uptake (astro-
cytes but not neurons), the sub-cellular localization of
labelled albumin and the dose-dependency in the competi-
tion assay strongly suggest that the process of albumin
uptake into the brain cellular compartments is mediated via
a specific receptor.
Serum albumin induces epileptiformactivity in vitroIn the in vitro brain slices, albumin uptake by astrocytes was
faster and more efficient in comparison to that observed
in the in vivo paradigm. If albumin uptake has a role in
the development of BBB dysfunction, we would expect that
the induction of cortical dysfunction by albumin may also
be accelerated in vitro. We tested this hypothesis by
continuous recordings of population activity (n = 26) or
single neuron responses (n = 5) to albumin wash-in
(0.1 mM). Albumin wash-in for 13 h resulted in one slice
(10%, n = 10) showing abnormal, paroxysmal responses.
Exposure to albumin for 46 h resulted in robust
hypersynchronized, prolonged paroxysmal responses in
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 539
by guest on May 4, 2015
Dow
nloaded from
15 of 16 slices (94%; Fig. 3). All control slices washed with
ACSF for a similar time showed normal field potentials
(n = 5). A gradual transformation from normal, brief
synaptic responses to epileptiform activity was also observed
during continuous (>3 h) intracellular recordings from all
five neurons exposed to albumin-containing ACSF (Fig. 3B).
The epileptiform activity persisted despite >4 h of wash-out
with albumin-free ACSF, pointing to a lasting cortical
dysfunction.
TGF-b receptors mediate albuminuptake into astrocytesThe experiments described so far suggested that the rapid
transport of albumin is receptor mediated and that this
Fig. 2 Albumin is preferentially transported into astrocytes. (A) Sections from control and BBB-treated animals 6 h following intra-peritoneal injection of Evans blue. Note the separation between intravascular Evans bluealbumin complex (red) and cellular elements of thebrain (DAPI staining in blue) in controls, compared with the extracellular and intracellular staining under BBB opening. Arrows markapparent membrane processes of stained cells. (B) Direct exposure of brain slices in vitro to FITC-albumin resulted in fast extranuclear(5 and 10 min), and nuclear staining (30 min) of cells. (C) Cellular elements labelled with FITC-albumin resembled astrocytes (arrows) andperivascular cells (open arrows). Inset: Co-localization of FITC-albumin and DAPI nuclear staining. FITC-dextran was taken up only byperivascular cells (right panel). (D) Co-administration of FITC-albumin and Texas Red-ovalbumin: Uptake of ovalbumin is limited toperivascular cells. Inset: Co-localization of albumin and ovalbumin in perivascular cells but not in a nearby parenchymal cell. (E and F)Confocal imaging of FITC-albumin labelled cells showing co-localization with cells positively immunolabelled for GFAP (astrocytes, E) butnot for MAP2 (neurons, F). In all insets scale bar represents 10 mm. (G) Number of stained cells at different times after exposure toFITC-albumin (n = 15 sections, three slices at each time point). (H) Addition of non-labelled BSA resulted in a dose-dependent decreasein the number of FITC-albumin labelled cells (n = 15 sections, three slices at each time point).
540 Brain (2007), 130, 535547 S. Ivens et al.
by guest on May 4, 2015
Dow
nloaded from
transport is followed by a delayed and robust change in
network neuronal responses. TGF-bR type 2 (TGF-bR2) hasbeen recently found to function as an albumin-binding
protein in lung endothelial cells (Siddiqui et al., 2004).
To test the possibility that TGF-bRs mediate albumin uptakeinto brain astrocytes, we exposed cortical slices to either
the TGF-bR type 1 (TGF-bR1) kinase activity inhibitor,SB431542, and/or to antibodies against TGF-bR2. SB431542reduced the number of FITC-albumin-labelled-cells in a
dose-dependent manner (Fig. 4AC). Similarly, in the
presence of anti-TGF-bR2 antibodies, the number oflabelled cells was reduced and the labelled fraction showed
mainly membrane staining, with no nuclear staining (Fig. 4B
and D). These findings suggest that the transport of albumin
into cells is dependent on TGF-bRs.To probe the role of TGF-bRs in the generation of
abnormal electrophysiological responses, we exposed rat
cortices in vivo to albumin in the presence and absence of
TGF-bR antagonists. Extracellular recordings in vitro oneweek after treatment revealed paroxysmal activity in 76.3%
of the slices from albumin-exposed rats as compared with
29.3% of the slices from rats exposed to both albumin and
TGF-bR antagonists (45 of 59 slices, n = 13 animalscompared with 12 of 41 slices, n = 6 animals, Pearson x2 test,P < 0.001, Fig. 4E and F). Thus, the application of TFG-bRantagonists at the time of exposure of the brain environment
to serum albumin effectively blocks the consequent
generation of epileptiform activity. These findings validate
the involvement of TGF-bR-mediated albumin transport inthe generation of abnormal brain activity following albumin
exposure.
Extracellular buffering of K+ is impairedduring epileptogenesisPrevious studies of the injured cortex, the BBB-disrupted
cortex and the albumin-exposed cortex all show a window
of at least several days before epileptiform activity can be
recorded (e.g. Hoffman et al., 1994; Seiffert et al., 2004).
Within this period of epileptogenesis an astrocytic reaction
is established, as shown by enhanced immunostaining
against the GFAP. The pioneer works of Kuffler and Potter
(1964) established that astrocytes control the brains
extracellular environment, particularly by buffering rises
in [K+]o during neuronal activity. Thus, we tested the
hypothesis that during this window period of epileptogen-
esis, i.e. following treatment but prior to the onset of
epileptiform activity, [K+]o buffering is impaired (Pollen and
Trachtenberg, 1970; DAmbrosio et al., 1999). Using ISMEs,
we measured changes in [K+]o following neuronal activation
24 h after BBB disruption. In all slices, a low-frequency
(20 s interval) stimulation of the white matter showed
normal field responses for treated animals similar to that
recorded from sham and non-operated control rats, thus
excluding epileptiform activity at this early stage (field
potential amplitude; stimulation at five times threshold
intensity: 1.58 6 0.29 mV, n = 9, 1.53 6 0.28 mV, n = 7 and1.59 6 0.17 mV, n = 13, for BBB-treated, sham and non-operated rats, respectively, Fig. 5A). During repetitive
stimulation (25 Hz, 2 s, one stimulation train), the rate of
increase of [K+]o (time to 50% of maximum: 0.71 6 0.04,0.67 6 0.03 and 0.71 6 0.03 s) and the maximal increase in[K+]o (4.84 6 0.67, 5.40 6 1.07 and 4.34 6 0.59 mM) weresimilar in treated and control brains. In contrast, the decay
in [K+]o was slightly, but significantly, slower in treated
than in sham-operated or control slices (decay time to 50%
of maximal [K+]o: 1.91 6 0.1 s, n = 11; 1.51 6 0.06 s, n = 7;and 1.50 6 0.07 s, n = 15, respectively, P < 0.01, Fig. 5B).Interestingly, the reduced [K+]o clearance following stimula-
tion returned to control values within four weeks
after treatment with DOC (1.91 6 0.1 s, n = 11, 1.65 60.14 s, n = 2, 1.51 6 0.05 s, n = 4 for 1, 7 and 30 days,respectively; Fig. 5C).
Fig. 3 Serum albumin induces epileptogenesis in vitro.Extracellular (A) and intracellular (B) electrophysiologicalrecordings in slices exposed to BSA. Numbers on the leftindicate hours of exposure. Paroxysmal activity developed fully56 h after exposure. (C) Bar graph shows the averaged integral(50500 ms after stimulation) of the evoked responses in31 slices (see text for details).
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 541
by guest on May 4, 2015
Dow
nloaded from
Reduced inward-rectifying K+ currentsin the albumin-exposed cortexThe reduced clearance of [K+]o during epileptogenesis
implied a down regulation of astrocytic K+ channels.
It has been demonstrated that the inwardly rectifying K+
channels play a particularly important role in K+ buffering
(Ransom and Sontheimer, 1995; DAmbrosio et al., 1999).
We performed local K+ application by ionophoresis and
pharmacological manipulations to further explore the
mechanisms underlying reduced [K+]o clearance. To abolish
neuronal firing and synaptic responses, thus excluding
neuronal contribution to [K+]o changes, these experiments
were conducted in the presence of NMDA, AMPA/KA and
GABA receptors as well as voltage activated Na+-channel
blockers. We applied low (100 mM) and high (2 mM)concentrations of Ba2+ to differentially block inward-
rectifying K+ currents (IKIR) and leak K+ currents (IKL),
respectively (Ransom and Sontheimer, 1995; Jauch et al.,
2002). Before the application of Ba2+ we performed a series
of ionophoretic K+ applications to determine a stable
baseline of [K+]o increases during injection (amplitude of
[K+]o increase during injection: 1.52 mM 6 0.05, n = 41injections). After wash in of low concentrations of Ba2+,
[K+]o increase during ionophoresis was elevated in control
brains by 77 6 15% (n = 5 slices, 5 animals), whereas inbrains of treated animals this increase was significantly
lower (31 6 5% increase, n = 5 slices, 5 animals, P < 0.05,Fig. 5DF). No difference was found when Ba2+ concentra-
tions were elevated to 2 mM to block IKL (68 6 12% versus66 6 5%, control versus treated, respectively, Fig. 5F). Theseexperiments indicate a reduction in IKIR in the presence of
normal IKL 24 h following treatment. Six hours of in vitro
exposure to serum albumin (Fig. 3) was similarly associated
with a reduced effect of 100 mM Ba2+ on ionophoreticallyinduced increases in [K+]o (31 6 4 and 68 6 12% in treatedand controls, respectively, P < 0.05). Since the Kir 4.1
channel has been shown to be expressed in cortical
astrocytes, especially in the processes of astrocytes wrapping
synapses and blood vessels (Higashi et al., 2001; Hibino et al.,
2004), we performed immunostaining experiments to reveal
Kir 4.1 channel levels following treatment with DOC. We
found that Kir 4.1 immunolabelling was indeed limited to
morphologically identified astrocytes (Fig. 5G, also con-
firmed by GFAP immunostaining, data not shown) and to
blood vessels. Twenty-four hours after treatment, Kir 4.1
channel immunolabelling was markedly reduced, whereas
Fig. 4 TGF-b receptors mediate albumin uptake and epileptogenesis. (A and B) Microscopic sections of brain slices exposed for30 min to FITC-albumin in the presence or absence of anti-TGF-bR2 antibodies. No nuclear staining is observed in the presence ofanti-TGF-bR2 antibodies (see higher magnification in the inset and quantification in D). (C) Number of FITC-albumin labelled cells isreduced by the TGF-bR1 antagonist SB431542 in a dose-dependent manner. (D) Percentage of cells with nuclear FITC-albumin labelling inthe absence (control) and presence (+Ab) of anti-TGF-bR2 antibodies. (E) Traces showing epileptiform activity recorded in vitro oneweek following in vivo exposure to albumin and a brief normal response in slices from a cortex exposed to albumin in the presence ofTGF-bR blockers. (F) Bar graph representing percentage of slices showing paroxysmal epileptiform activity in brains treated with albuminin the absence (Alb) and presence (+blockers) of TGF-bR blockers. All recordings were obtained one week following treatment in thepresence of ACSF (see text for details).
542 Brain (2007), 130, 535547 S. Ivens et al.
by guest on May 4, 2015
Dow
nloaded from
GFAP labelling was enhanced, as expected (Fig. 5G and H;
Seiffert et al., 2004). Furthermore, quantitative real-time RT
PCR showed significant higher GFAP and lower Kir 4.1
mRNA levels 1448 h following in vivo exposure to either
DOC or albumin (Fig. 5I, n = 5 for each group). These
accumulating results suggest an early transcriptional down
regulation of Kir 4.1 channels, yielding a lower level of Kir 4.1
functional protein and resulting in reduced [K+]o buffering.
Activity-dependent [K+]o accumulationand subsequent neuronal hyperexcitabilityduring epileptogenesisFinally, we studied the effect of reduced [K+]o clearance on
neuronal excitability. The observed slowing of [K+]oclearance suggested K+ accumulation during low-frequency
stimulation. Indeed, while the increase in [K+]o during the
first stimulus was similar for DOC-treated and control
brains (0.093 6 0.013 versus 0.095 6 0.019 mM, respec-tively), during the 50th stimulus (0.67 Hz), [K+]o peak levels
increased to 315 6 39% of the first stimulus in treatedbrains, but only to 193 6 11% in controls (n = 7, P < 0.05;Fig. 6A). Stimulus-induced [K+]o enhanced accumula-
tion was associated with the appearance of all-or-none,
paroxysmal, prolonged negative deflections in the field
responses. The latter were associated with a further increase
in [K+]o and were blocked by the NMDA-receptor
antagonist, MK-801 (Fig. 6B). Intracellular recordings
from identified pyramidal neurons confirmed that repetitive
stimulation was associated with long depolarization shifts,
which upon further membrane depolarization induced
action potentials (Fig. 6CD).
Fig. 5 Abnormal [K+]o buffering 24 h following treatment is due to a transcriptional downregulation of Kir 4.1 channels. (A) Representativetraces showing normal evoked field potentials recorded 24 h after treatment in sham-operated (S) and treated (T) cortices. (B) Twosuperimposed traces of the [K+]o signals in response to a 2 s, 25 Hz stimulation (marked as underlying bar). [K
+]o signals were normalized tomaximal increase (100%, 4.34 and 4.84 mM for control and treated, respectively). (C) [K+]o decay time to 50% of its maximal value 1 day(1d), 1 week (1w) and 1 month (1m) after treatment as well as 1 day after sham-operation (s) and in non-operated controls (c) (n = 11, 2, 4,7 and 15, respectively). (D and E) Representative traces showing the effect of Ba2+ on ionophoretically induced [K+]o increase in treated andcontrol slices before (D) and after (E) addition of 0.1 mM Ba2+. (F) Summary of Ba2+ effect on [K+]o increase. (G and H) Images of GFAPimmunostaining in cortical sections 24 h after treatment compared with controls. Insets: Higher magnifications of GFAP (left) and Kir 4.1(right) immunostaining in consecutive sections from the same brain. Note the enhanced GFAP and reduced Kir immunostaining inmorphologically identified astrocytes. Black arrows point to astrocyte processes towards neighbouring vessels. (I) % change in mRNAlevels for GFAP and Kir 4.1 in albumin or DOC-treated cortices compared with the contralateral, non-treated hemisphere(n = 5 for each group).
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 543
by guest on May 4, 2015
Dow
nloaded from
DiscussionIn this study, we outlined a novel mechanism underlying
epileptogenesis in the BBB-injured cerebral cortex.
Our experiments were designed in light of accumulating
clinical evidence supporting a causative role between lasting
enhanced BBB permeability and epilepsy (Tomkins et al.,
2001; Avivi et al., 2004; Korn et al., 2005). We confirmed
that both in vivo and in vitro exposure to serum albumin can
induce hypersynchronized responses to a single stimulation.
The observed paroxysmal events recorded in the BBB/
albumin-treated cortex were similar to those described in
cortical slices from chronic animal models of epilepsies
(e.g. the chronically injured cortex: Prince and Tseng, 1993;
Jacobs et al., 1996; chemical kindling: Barkai et al., 1994;
or pilocarpine treatment: Sanabria et al., 2002). Similar
to the above-mentioned models of neocortical epilepsy,
spontaneous interictal-like hypersynchronous activity was
only rarely recorded in the BBB-treated cortex in vitro
(see Fig. 5 in Seiffert et al., 2004). While EEG recordings are
needed to characterize the in vivo correlates for the parox-
ysmal responses recorded in vitro, the clear spontaneous
seizures observed in few of the BBB-treated rats support the
relevance of this model in studying epileptogenesis.
Similar to lesional neocortical epilepsy in man and to
the above-mentioned models in experimental animals the
epileptogenic effect of albumin is delayed. This latent period
suggests that the underlying mechanism cannot be explained
solely in terms of simple binding to a channel/receptor,
but rather that it involves a slower biological process,
such as a transcriptional response. In contrast to the in vivo
condition, in vitro exposure to albumin showed the
development of paroxysmal activity within 46 h, perhaps
reflecting a more efficient diffusional equilibration or uptake
of albumin or additional injury-related processes occurring
in the slice preparation. The rapid uptake of albumin in vitro
also stresses the in vivo efficiency of the BBB in limiting the
incursion of serum proteins (e.g. by the strong uptake
capacity of the perivascular cells), even when the endothelial
barrier is disrupted (e.g. in the presence of DOC).
On the basis of our findings, we now propose a new
mechanism for the uptake of albumin and its effect on
astrocytes. It is noteworthy that astrocytes are normally
exposed to albumin only during brain development when
the BBB is not yet fully developed (at this stage brain
astrocytes do indeed display lower IKIR and reduced K+
buffering; Kressin et al., 1995). Hence, the presence of
specific albumin uptake in adulthood is surprising but may
serve to reduce vasogenic oedema following BBB disruption.
The findings of this studykinetics of albumin entry into
astrocytes, the specificity of albumin (labelled dextran or
ovalbumin were not transported) and the reduced transport
of albumin in the presence of non-labelled albuminall
point to a receptor-mediated uptake. TGF-bR emerged as apossible candidate in light of the following pieces of evidence
from previous studies: uptake of albumin is modulated
by TGF-bRs in the kidney (Gekle et al., 2003) and lungendothelial cells (Siddiqui et al., 2004); brain astrocytes
express TGF-bRs (Vivien et al., 1998); and TGF-bRexpression is increased following brain injury (Morganti-
Kossmann et al., 2002). The observation in this study
that albumin uptake was inhibited by the TGF-bR1 kinaseactivity inhibitor, SB431542, suggests that the uptake
depends on intracellular TGF-bR signalling. It is noteworthythat exposing brain slices to anti-TGF-bR antibodiesblocked the uptake of albumin into the cells but did not
prevent the surface membrane staining (Fig. 4B), suggesting
that albumin binds to another site at the same receptor or to
an additional surface receptor. It remains to be further
studied whether albumin transport to the nucleus directly
triggers altered gene expression and to what extent other
intracellular signalling pathways are involved. Previous
studies in cultured astrocytes from rat brains show
that albumin induces calcium signalling (Nadal et al.,
Fig. 6 Activity-dependent K+ accumulation and neuronalhyperexcitability 24 h following BBB disruption. (A) Recording of[K+]o increase during slow (0.67 Hz) repetitive stimulationshows excessive [K+]o accumulation in the treated cortex.(B) Superimposed (1st, 3rd and 5th) field potential responsesduring repetitive 0.67 Hz stimulation. Note the MK-801 sensitive,late negative deflection of the field potential in the treated slice.(C) Intracellular recording from a single identified pyramidalneuron in a treated slice showing depolarizing after-potentialsinduced by low-frequency (0.4 Hz) repetitive stimulation(resting potential = 75 mV). (D) Recording from the same cellas in C. Stimulus-induced depolarizing after-potentials led to actionpotential firing when the resting potential was set to 60 mV(overshooting action potentials are truncated).
544 Brain (2007), 130, 535547 S. Ivens et al.
by guest on May 4, 2015
Dow
nloaded from
1995) and that TGF-bR activation causes a rapid downregulation of Kir channels (Perillan et al., 2002) further
supporting a direct role for the interactions between
albumin and TGF-b signalling systems in modulatingastrocyte functions. Since TGF-b1 may be secreted in alatent form non-covalently bound to extracellular matrix
proteins (Munger et al., 1997), we cannot entirely rule out
an alternative hypothesis that albumin exerts its action by
increasing the bioavailability of TGF-b1.We confirmed that the astrocyte reaction (observed
as increased GFAP expression) is associated with reduced
K+ buffering capacity as early as 24 h after brain exposure
to albumin in vivo. Slowing of [K+]o decay was observed
both in the presence of apparently normal cortical
excitability (to a single stimulation) and during the initial
period of abnormal activity, but returned to control values
within 4 weeks, despite the continuous presence of abnormal
electrophysiological responses. The period of reduced
K+ buffering was similar to the period observed in which
an increase in the number of GFAP-labelled astrocytes was
observed (Seiffert et al., 2004). Astrocytic reaction is
prominent in a wide variety of brain insults, in both
animals and man, and while it may be important in
stabilization of the injured tissue (e.g. scar formation), it
seems to interfere with neuronal regeneration (Silver and
Miller, 2004). Abnormal K+ buffering in the injured brain
has been reported previously (DAmbrosio et al., 1999;
Anderova et al., 2004), but this is the first report showing
that abnormal K+ buffering precedesand may be associated
withthe development of epileptiform activity (see below).
Furthermore, we showed that while K+ clearance gradually
returns to normal values, hyperexcitability is maintained.
We also demonstrated that reduced K+ uptake by astrocytes
(as we employed sodium channel and synaptic receptor
blockers to block neuronal activity; Jauch et al., 2002) is
associated with reduced IKIR and not IKL. This conclusion
was initially supported by the augmenting effect of low
concentrations of Ba2+ on ionophoretically induced K+
signals. Ba2+ also affects a number of voltage- and calcium-
dependent K+ channels in neurons. However, since we
blocked transmitter receptors and voltage-dependent Na+
channel in these experiments, effects of Ba2+ on neuronal
excitability are unlikely. The reduced IKIR in the BBB-treated
cortex is consistent with previous studies showing a loss of
IKIR in reactive cortical astrocytes in rats around freeze
lesions (Bordey et al., 2001), ischaemic insults (Koller et al.,
2000) and direct injuries (Schroder et al., 1999) as well as in
epileptic Tsc1 knockout mice (Jansen et al., 2005) and
human subjects with temporal lobe epilepsy (Bordey and
Sontheimer, 1998; Hinterkeuser et al., 2000; Jauch et al.,
2002). Interestingly, all these cortical insults are frequently
associated with enhanced BBB permeability. Only Kir 4.1
and 5.1 channels have been shown to be expressed in the
neocortex (Hibino et al., 2004) and their key role in
buffering activity-dependent [K+]o increases is supported by
studies showing that their expression is limited to the
astrocytic membrane domains facing blood vessels or in the
processes surrounding synapses (Higashi et al., 2001). Our
immunolabelling experiments and the determination of
mRNA levels suggest a rapid downregulation of Kir channel
expression together with the upregulation of GFAP. At this
point, however, we cannot rule out additional changes in
Kir channels rectification properties (Bordey et al., 2001)
and/or their re-distribution in the cell membrane (Warth
et al., 2005). A downregulation of Kir channels will not only
affect potassium buffering but also lead to depolarization of
astrocytes and thereby reduce the efficacy of glutamate
transport into astrocytes, thus contributing to the facilitated
emergence of epileptiform discharges.
We showed here that even a relatively small reduction in K+-
buffering capacity may be functionally significant, since it
augments activity-dependentK+ accumulation and consequent
NMDA receptor activation (Fig. 6). The activation of NMDA
receptors may be due to K+ accumulation at the synaptic cleft
and consequent depolarization at the post-synaptic site (thus
increasing the likelihood of NMDA receptor opening) and/or
by reduced glutamate transport into depolarized astrocytes. A
plausible hypothesis would be that the increased, repeated
activation of NMDA receptors leads to non-specific synaptic
plasticity, thus strengthening excitatory synapses and causing
hyperexcitability (Li and Prince, 2002; Shao and Dudek, 2004).
This premise would also explain the efficacy of NMDA-
receptor antagonists in improving cortical functions after brain
injury and in some neurodegenerative disordersall condi-
tions in which the BBB is frequently impaired (Hickenbottom
and Grotta, 1998; Sonkusare et al., 2005).
In summary, we conclude that following brain insults,
exposure of brain cells to albuminthemost abundant serum
proteinleads to cortical dysfunction, recorded as epilepti-
form hypersynchronous activity. We suggest that the
development of cortical dysfunction is mediated by TGF-
bRs, which facilitate albumin uptake into astrocytes and downregulation of Kir currents. This, in turn, causes abnormal
accumulation of [K+]o and consequent NMDA-receptor-
dependent pathological plasticity. Since a wide spectrum of
common neurological disorders is associated with BBB
disruption, we propose that amelioration of neural injury in
these conditions may be achieved via targeting the TGF-bRs.
AcknowledgementsThe authors thank K. Froehlich, J. Mahlo and H. Levy for
technical assistance. This study was supported by the
Sonderforschungsbereich 507 and TR3 (AF and UH), the
German-Israeli Foundation for Scientific Research and
Development (AF) and the Mary Elizabeth Rennie Epilepsy
Foundation research grant (DK). Funding to pay the Open
Access publication charges for this article was provided by
the Sonderforschungsbereich 507.
References
Abbott NJ, Ronnback L, Hansson E. Astrocyte-endothelial interactions at the
blood-brain barrier. Nat Rev Neurosci 2006; 7: 4153.
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 545
by guest on May 4, 2015
Dow
nloaded from
Anderova M, Antonova T, Petrik D, Neprasova H, Chvatal A, Sykova E.
Voltage-dependent potassium currents in hypertrophied rat astrocytes
after a cortical stab wound. Glia 2004; 48: 31126.
Avivi E, Tomkins O, Korn A, Pavlovsky L, Shelef I, Friedman A. Blood-brain-
barrier disruption in humans: a window to neurodegenerative diseases. In:
Silman I, Fisher A, Anglister L, Michaelson D, Soreq H, editors. Cholinergic
mechanisms. London: Martin Dunitz; 2004. p. 4239.
Ballabh P, Braun A, Nedergaard M. The blood-brain barrier: an overview:
structure, regulation, and clinical implications. Neurobiol Dis 2004;
16: 113.
Barkai E, Grossmann Y, Gutnick MJ. Long-term changes in neocortical
activity after chemical kindling with systemic pentylenetetrazole: an
in vitro study. J Neurophysiol 1994; 72: 7283.
Bechmann I, Lossau S, Steiner B, Mor G, Gimsa U, Nitsch R. Reactive
astrocytes upregulate Fas (CD95) and Fas ligand (CD95L) expression but
do not undergo programmed cell death during the course of anterograde
degeneration. Glia 2000; 32: 2541.
Bechmann I, Kwidzinski E, Kovac AD, Simburger E, Horvath T, Gimsa U, et al.
Turnover of rat brain perivascular cells. Exp Neurol 2001; 168: 2429.
Bordey A, Sontheimer H. Properties of human glial cells associated with
epileptic seizure foci. Epilepsy Res 1998; 32: 286303.
Bordey A, Lyons SA, Hablitz JJ, Sontheimer H. Electrophysiological
characteristics of reactive astrocytes in experimental cortical dysplasia.
J Neurophysiol 2001; 85: 171931.
Cornford EM. Epilepsy and the blood brain barrier: endothelial cell responses
to seizures. Adv Neurol 1999; 79: 84562.
Cornford EM, Oldendorf WH. Epilepsy and the blood-brain barrier. Adv
Neurol 1986; 44: 787812.
DAmbrosio R, Maris DO, Grady MS, Winn HR, Janigro D. Impaired K+
homeostasis and altered electrophysiological properties of post-traumatic
hippocampal glia. J Neurosci 1999; 19: 815262.
Ehrlich P. Das Sauerstoffbeduerfnis des Organismus: Eine Farbenanalytische
Studie. Hirschwald 1885; 8: 167.
Eid T, Lee TS, ThomasMJ, Amiry-MoghaddamM, Bjornsen LP, Spencer DD,
et al. Loss of perivascular aquaporin 4 may underlie deficient water and
K+ homeostasis in the human epileptogenic hippocampus. Proc Natl Acad
Sci USA 2005; 102: 11938.
Friedman A, Kaufer D, Shemer J, Hendler I, Soreq H, Tur-Kaspa I, et al.
Pyridostigmine brain penetration under stress enhances neuronal
excitability and induces early immediate transcriptional response. Nat
Med 1996; 2: 13825.
Gekle M, Knaus P, Nielsen R, Mildenberger S, Freudinger R, Wohlfarth V,
et al. Transforming growth factor-beta1 reduces megalin- and cubilin-
mediated endocytosis of albumin in proximal-tubule-derived opossum
kidney cells. J Physiol 2003; 552: 47181.
Geursen A, Grigor MR. Serum albumin secretion in rat milk. J Physiol 1987;
391: 41927.
Hibino H, Fujita A, Iwai K, Yamada M, Kurachi Y. Differential assembly of
inwardly rectifying K+ channel subunits, Kir4.1 and Kir5.1, in brain
astrocytes. J Biol Chem 2004; 279: 4406573.
Hickenbottom SL, Grotta J. Neuroprotective therapy. Semin Neurol 1998;
18: 48592.
Higashi K, Fujita A, Inanobe A, Tanemoto M, Doi K, Kubo T, et al. An
inwardly rectifying K+ channel, Kir4.1, expressed in astrocytes surrounds
synapses and blood vessels in brain. Am J Physiol Cell Physiol 2001;
281: C92231.
Hinterkeuser S, Schroder W, Hager G, Seifert G, Blumcke I, Elger CE, et al.
Astrocytes in the hippocampus of patients with temporal lobe epilepsy
display changes in potassium conductances. Eur J Neurosci 2000;
12: 208796.
Hoffman SN, Salin PA, Prince DA. Chronic neocortical epileptogenesis in
vitro. J Neurophysiol 1994; 71: 176273.
Jacobs KM, Gutnick MJ, Prince DA. Hyperexcitability in a model of cortical
maldevelopment. Cereb Cortex 1996; 6: 51423.
Jansen LA, Uhlmann EJ, Crino PB, Gutmann DH, Wong M. Epileptogenesis
and reduced inward rectifier potassium current in tuberous sclerosis
complex-1-deficient astrocytes. Epilepsia 2005; 46: 187180.
Jauch R, Windmuller O, Lehmann TN, Heinemann U, Gabriel S.
Effects of barium, furosemide, ouabaine and 4,40-diisothiocyanatostilbene-2,20-disulfonic acid (DIDS) on ionophoretically-induced changes inextracellular potassium concentration in hippocampal slices from rats
and from patients with epilepsy. Brain Res 2002; 925: 1827.
Kasantikul V, Brown WJ, Oldendorf WH, Crandall PC. Ultrastructural
parameters of limbic microvasculature in human psychomotor epilepsy.
Clin Neuropathol 1983; 2: 1718.
Kaufer D, Friedman A, Seidman S, Soreq H. Acute stress facilitates
long-lasting changes in cholinergic gene expression. Nature 1998;
393: 3737.
Koller H, Schroeter M, Jander S, Stoll G, Siebler M. Time course of inwardly
rectifying K+ current reduction in glial cells surrounding ischemic brain
lesions. Brain Res 2000; 872: 1948.
Korn A, Golan H, Melamed I, Pascual-Marqui R, Friedman A. Focal cortical
dysfunction and blood-brain barrier disruption in patients with
postconcussion syndrome. J Clin Neurophysiol 2005; 22: 19.
Kressin K, Kuprijanova E, Jabs R, Seifert G, Steinhauser C. Developmental
regulation of Na+ and K+ conductances in glial cells of mouse hippocampal
brain slices. Glia 1995; 15: 17387.
Kuffler SW, Potter DD. Glia in the leech central nervous system: physiological
properties and neuron-glia relationship. J Neurophysiol 1964; 27:
290320.
Li H, Prince DA. Synaptic activity in chronically injured, epileptogenic
sensory-motor neocortex. J Neurophysiol 2002; 88: 212.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods
2001; 25: 4028.
Lux HD, Neher E. The equilibration time course of [K+]o in cat cortex. Exp
Brain Res 1973; 17: 190205.
Morganti-Kossmann MC, Rancan M, Stahel PF, Kossmann T. Inflammatory
response in acute traumatic brain injury: a double-edged sword. Curr
Opin Crit Care 2002; 8: 1015.
Munger JS, Harpel JG, Gleizes PE, Mazzieri R, Nunes I, Rifkin DB. Latent
transforming growth factor-beta: structural features and mechanisms of
activation. Kidney Int 1997; 51: 137682.
Nadal A, Fuentes E, Pastor J, McNaughton PA. Plasma albumin is a potent
trigger of calcium signals and DNA synthesis in astrocytes. Proc Natl Acad
Sci USA 1995; 92: 142630.
Neuwelt EA. Mechanisms of disease: the blood-brain barrier. Neurosurgery
2004; 54: 13140.
Pavlovsky L, Browne RO, Friedman A. Pyridostigmine enhances
glutamatergic transmission in hippocampal CA1 neurons. Exp Neurol
2003; 179: 1817.
Perillan PR, Chen M, Potts EA, Simard JM. Transforming growth factor-
beta 1 regulates Kir2.3 inward rectifier K+ channels via phospholipase C
and protein kinase C-delta in reactive astrocytes from adult rat brain.
J Biol Chem 2002; 277: 197480.
Pollen DA, Trachtenberg MC. Neuroglia: gliosis and focal epilepsy. Science
1970; 167: 12523.
Prince DA, Tseng GF. Epileptogenesis in chronically injured cortex: in vitro
studies. J Neurophysiol 1993; 69: 127691.
Ransom CB, Sontheimer H. Biophysical and pharmacological characteriza-
tion of inwardly rectifying K+ currents in rat spinal cord astrocytes.
J Neurophysiol 1995; 73: 33346.
Sanabria ER, da Silva AV, Spreafico R, Cavalheiro EA. Damage,
reorganization, and abnormal neocortical hyperexcitability in the
pilocarpine model of temporal lobe epilepsy. Epilepsia 2002; 43
(Suppl 5): 96106.
Schroder W, Hager G, Kouprijanova E, Weber M, Schmitt AB, Seifert G, et al.
Lesion-induced changes of electrophysiological properties in astrocytes
of the rat dentate gyrus. Glia 1999; 28: 16674.
Seifert G, Schilling K, Steinhauser C. Astrocyte dysfunction in neurological
disorders: a molecular perspective. Nat Rev Neurosci 2006; 7: 194206.
Seiffert E, Dreier JP, Ivens S, Bechmann I, Tomkins O, Heinemann U, et al.
Lasting blood-brain barrier disruption induces epileptic focus in the rat
somatosensory cortex. J Neurosci 2004; 24: 782936.
546 Brain (2007), 130, 535547 S. Ivens et al.
by guest on May 4, 2015
Dow
nloaded from
Shao LR, Dudek FE. Increased excitatory synaptic activity and local
connectivity of hippocampal CA1 pyramidal cells in rats with kainate-
induced epilepsy. J Neurophysiol 2004; 92: 136673.
Siddiqui SS, Siddiqui ZK, Malik AB. Albumin endocytosis in endothelial
cells induces TGF-beta receptor II signaling. Am J Physiol Lung Cell Mol
Physiol 2004; 286: L101626.
Silver J, Miller JH. Regeneration beyond the glial scar. Nat Rev Neurosci 2004;
5: 14656.
Sonkusare SK, Kaul CL, Ramarao P. Dementia of Alzheimers disease and
other neurodegenerative disordersmemantine, a new hope. Pharmacol
Res 2005; 51: 117.
Tomkins O, Kaufer D, Korn A, Shelef I, Golan H, Reichenthal E, et al.
Frequent blood-brain barrier disruption in the human cerebral cortex.
Cell Mol Neurobiol 2001; 21: 67591.
Vivien D, Bernaudin M, Buisson A, Divoux D, MacKenzie ET, Nouvelot A.
Evidence of type I and type II transforming growth factor-beta receptors in
central nervous tissues: changes induced by focal cerebral ischemia.
J Neurochem 1998; 70: 2296304.
Warth A, Mittelbronn M, Wolburg H. Redistribution of the water channel
protein aquaporin-4 and the K+ channel protein Kir4.1 differs in low-
and high-grade human brain tumors. Acta Neuropathol (Berl) 2005;
109: 41826.
TGF-b receptors and epileptogenesis Brain (2007), 130, 535547 547
by guest on May 4, 2015
Dow
nloaded from