+ All Categories
Transcript
Page 1: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

A T G T G C T G A C T G T A G C T G A T C G A T C0 1 1 0 0 1 1 1 1 0 1 0 1 0 1 0 0 1 1 1 0 1 0 1w w w . o c i m u m b i o . c o m

Page 2: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

Company Profi le

Ocimum Biosolutions is a life sciences R&D enabling company with three focus areas, BioIT, BioMolecules, and BioResearch. Ocimum delivers end to end genomic products and services out of three strategic locations worldwide, Indianapolis (United States), IJsselstien (The Netherlands), Hyderabad (India). All labs and software facilities are ISO 9001:2000 certifi ed. Strict adherence to quality practices and prompt delivery times, not to mention the greatest respect for clients’ proprietary and confi dential information, have further reinforced our position as one of the fastest growing, most dependable companies in the biotechnology industry.

The BioIT Division provides key, ready to use, reliable, cost-effective software solutions for the biotech/pharma industry. This division includes three 21 CFR Part 11 & GLP compliant, Lab Information Management Systems (LIMS) products - BiotrackerTM, PharmatrackerTM and ToxchekTM and a suite of bioinformatics products, Genchek™ (sequence analysis), OptGene™ (gene design), Genowiz™ (microarray data analysis) and iRNAchek™ (iRNA template design). The division also offers data mining, literature mining, algorithm development, gene identifi cation, multiple-platform software development, database creation and manipulation, and tools for image analysis.

The BioMolecules Division produces microarrays and oligonucleotides. The Microarray Division has been recently acquired from MWG Biotech (Germany) and produces catalog OciChip™ arrays, Custom OciChip™ arrays and offers microarray hybridization services. The Oligonucleotides Division, which has been acquired from Isogen Lifescience (The Netherlands), makes standard and modifi ed DNA, RNA oligonucletoides.

The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis.

With a growing list of very satisfi ed big pharma to small academic clients worldwide, Ocimum strives to be a strategic partner in enabling your R&D.

www.ocimumbio.com

Page 3: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

United States: Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +1 317 228 0600, Fax: +1 317 228 0700, Email: [email protected]

India: Ocimum Biosolutions Ltd, 6th Floor, Reliance Classic, Road No. 1, Banjara Hills, Hyderabad 500 034, A.P., IndiaPhone: +91 40 666 27200 Fax: +91 40 666 27205, Email: [email protected]

The Isogen Biosolutions (An Ocimum Biosolutions Company), Lagedijk Noord 18, Postbus 220, Netherlands: NL -3400 AE IJselstein, Phone: +31 30 68 78 788, Fax: +31 30 68 88 009, Email: [email protected]

United States:Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +

Microarrays

Ocimum Biosolutions offers complete solutions in microarray technology – from oligonucleotide design to data analysis. Based on MWG Biotech’s proven technology and superior probe design that combines absolute specifi city with highest sensitivity, our proprietary concept creates OciChipTMOciChipTMOciChip DNA microarrays of very high quality. We have the fl exibility to produce a wide range of arrays, from catalog arrays covering 40,000 genes to custom arrays with as low as 25 individual genes, in extremely short lead times. With our expertise in this technology we have built a short lead times. With our expertise in this technology we have built a portfolio holding a number of catalog arrays and created custom arrays for portfolio holding a number of catalog arrays and created custom arrays for researchers. We can provide oligosets to investigators and enable them to print their own microarrays; we also We can provide oligosets to investigators and enable them to print their own microarrays; we also offer hybridization services from the beginning. The oligosets have 50mer probes that are of the offer hybridization services from the beginning. The oligosets have 50mer probes that are of the same high quality, and optimally balanced for specifi city and sensitivity. Probes are suitable for same high quality, and optimally balanced for specifi city and sensitivity. Probes are suitable for most coupling chemistries and slide surfaces. Depending on the amounts of total RNA supplied, we most coupling chemistries and slide surfaces. Depending on the amounts of total RNA supplied, we perform direct labeling, T7 amplifi cation-labeling or low RNA labeling perform direct labeling, T7 amplifi cation-labeling or low RNA labeling using highly standardized protocols. We perform a variety of microarray using highly standardized protocols. We perform a variety of microarray hyrbidizations – single-dye hybridizations or co-hybridizations using salt hyrbidizations – single-dye hybridizations or co-hybridizations using salt based buffers in highly automated procedures. These assure the highest based buffers in highly automated procedures. These assure the highest possible signal intensity and uniformity, and lowest possible background possible signal intensity and uniformity, and lowest possible background noise. Sample hybridized arrays are scanned in all the channels (Cy3, Cy5) noise. Sample hybridized arrays are scanned in all the channels (Cy3, Cy5) with a laser scanner at three different PMT gain settings producing 16-bit with a laser scanner at three different PMT gain settings producing 16-bit tiff images. Ocimum’s versatile analysis tool – Genowiztiff images. Ocimum’s versatile analysis tool – GenowizTMtiff images. Ocimum’s versatile analysis tool – GenowizTMtiff images. Ocimum’s versatile analysis tool – Genowiz – is used for image analysis, data analysis and annotation.image analysis, data analysis and annotation.Compact Gene Index (CGX) is a search engine to facilitate selection of subsets of oligonucleotides Compact Gene Index (CGX) is a search engine to facilitate selection of subsets of oligonucleotides for spotting on custom arrays. This search tool also allows to look at possible cross hybridization for spotting on custom arrays. This search tool also allows to look at possible cross hybridization for highly related protein families. The search engine allows searching of OciChip™ by accession for highly related protein families. The search engine allows searching of OciChip™ by accession number, keywords or Ocimum Biosolutions oligo numbers. number, keywords or Ocimum Biosolutions oligo numbers.

Page 4: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

United States: Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +1 317 228 0600, Fax: +1 317 228 0700, Email: [email protected]

India: Ocimum Biosolutions Ltd, 6th Floor, Reliance Classic, Road No. 1, Banjara Hills, Hyderabad 500 034, A.P., IndiaPhone: +91 40 666 27200 Fax: +91 40 666 27205, Email: [email protected]

The Isogen Biosolutions (An Ocimum Biosolutions Company), Lagedijk Noord 18, Postbus 220, Netherlands: NL -3400 AE IJselstein, Phone: +31 30 68 78 788, Fax: +31 30 68 88 009, Email: [email protected]

United States:Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +

Human OciChip™Human Starter Kit (10 slides)Human 30K AHuman 30K BHuman 30K CHuman 30K (A+B+C)Human 40K AHuman 40K BHuman 40K (A+B)

Topic OciChip™Human Infl ammation Mouse Infl ammation Human Cancer Rat Liver

Model Organism OciChip™Model Organism OciChip™Mouse 30K AMouse 30K BMouse 30K CMouse 30K (A+B+C)Mouse 30K(V2) Rat 10K Rat 30K Zebrafi sh 14K Arabidopsis 25KArabidopsis 25KArabidopsis

Microrganism OciChip™E. coli K12 V2 E. coli 0157 E. coli 0157 E. coliH. pyloriH. hepaticusC. jejunii S. pneumoniaeS. coelicolorYeast

Starter KitsMouse (10 slides)Rat (10 slides)Zebrafi sh (10 slides)Arabidposis (10 slides)Arabidposis (10 slides)ArabidposisE. coli (10 slides)E. coli (10 slides)E. coli

Human 40K Functional Plating Oligo Sets Cell communication + mobilityDevelopment + nucleotideNucleic acid metabolismEnzymeEnzyme activator + inhibitor + kinase- RegulatorExtracellular + membrane (A)Extracellular + membrane ( B)Hydrolase (A)

Hydrolase (B)Ion + electron transporterLigandsNucleic acid + nucleotide bindingMetabolismProtein + peptide bindingProtein binding + transcription cofactorProtein metabolismReceptorReceptor bindingResponse to external stimulus + other EnzymeTranscription factor (A)Transcription factor (B)Transferase (A)Transferase (B)TransporterTumor antigen + suppressor + apoptosis-inhibitor + DNA repair protein + receptor-signalling proteinDiverse functions (A)Diverse functions (B)Human 40K Functional Plating Set (26 plates)

Catalog Arrays & Oligo Sets

Page 5: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

United States: Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +1 317 228 0600, Fax: +1 317 228 0700, Email: [email protected]

India: Ocimum Biosolutions Ltd, 6th Floor, Reliance Classic, Road No. 1, Banjara Hills, Hyderabad 500 034, A.P., IndiaPhone: +91 40 666 27200 Fax: +91 40 666 27205, Email: [email protected]

The Isogen Biosolutions (An Ocimum Biosolutions Company), Lagedijk Noord 18, Postbus 220, Netherlands: NL -3400 AE IJselstein, Phone: +31 30 68 78 788, Fax: +31 30 68 88 009, Email: [email protected]

United States:Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +

Oligonucleotides

Ocimum Biosolutions, an ISO 9001: 2000 company, has strengthened its position in the ever growing market of custom oligomers - DNA (OcigoTMmarket of custom oligomers - DNA (OcigoTMmarket of custom oligomers - DNA (Ocigo ), RNA, and peptides. Ocimum has made a big entry in the oligomer industry with its establishment of oligonucleotide production units both in USA and India. Now, Ocimum also has a European presence with the of the state-of-art subsidiary, and major contributor of oligomer provider in Europe - Isogen Biosolutions in the Netherlands.Ocimum’s USPs: Very fast turnaround time, very competitive and economical Very fast turnaround time, very competitive and economical

in the industry, and very high purity.in the industry, and very high purity. Best platforms for synthesis: Polyplex, Mermade IV Best platforms for synthesis: Polyplex, Mermade IV

synthesizers. ABI synthesizers for special oligonucleotides synthesizers. ABI synthesizers for special oligonucleotides and RNA synthesis.

Backed by in-house oligonucleotide designing software, Backed by in-house oligonucleotide designing software, OligoStarTMOligoStarTMOligoStar , and oligonucleotide design specialists., and oligonucleotide design specialists.

Two kinds of documentation – Standard or QC Two kinds of documentation – Standard or QC documentation.

Close proximity to our clients across various geographies. Close proximity to our clients across various geographies. Order your oligos through website, fax or email. Order your oligos through website, fax or email.

Production details

Scales of synthesis 0.01 µM, 0.05 µM, 0.05 µ µM, 0.2 µM, 0.2 µ µM, 1 µM, 1 µ µM, 2 µM, 2 µ µM, 5 µM, 5 µ µM, 10 µM, 10 µ µM and 15 µM and 15 µ µMµMµ

Purifi cation methods Desalted (RP Cartridge), HPLC, Elchrom Submarine Electrophoresis, PAGE

Quality Analysis Capillary Gel Electrophoresis, PAGE, Analytical HPLC, Pyrosequencing

Page 6: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

United States: Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +1 317 228 0600, Fax: +1 317 228 0700, Email: [email protected]

India: Ocimum Biosolutions Ltd, 6th Floor, Reliance Classic, Road No. 1, Banjara Hills, Hyderabad 500 034, A.P., IndiaPhone: +91 40 666 27200 Fax: +91 40 666 27205, Email: [email protected]

The Isogen Biosolutions (An Ocimum Biosolutions Company), Lagedijk Noord 18, Postbus 220, Netherlands: NL -3400 AE IJselstein, Phone: +31 30 68 78 788, Fax: +31 30 68 88 009, Email: [email protected]

United States:Ocimum Biosolutions Inc. Fortune Park VI, 8765, Guion Road, Suite G, Indianapolis, IN, 46268, Phone: +

Oligonucleotides modifi cationsStandard modifi cations 5’ 3’ InternalAminolink-C6 (TFA), Aminolink-C6 (MMT), Disulfi de Aminolink-C3, Aminolink-C7 Phosphorylation, Aminolink-C12 Digoxigenin, Thiol C6, Biotin Dye Cy2, Cy3, Cy3.5, Cy5, Cy5.5, HEX, TETCy2, Cy3, Cy3.5, Cy5, Cy5.5, HEX, TET BH Quencher 1, BH Quencher 2, DabcylBH Quencher 1, BH Quencher 2, Dabcyl IR Dy681, IR Dy781, Dy547 (Cy3 alternative), Dy647 (Cy5 IR Dy681, IR Dy781, Dy547 (Cy3 alternative), Dy647 (Cy5 alternative), Dy554, Texas Red, Rhodamine, CAL Fluor alternative), Dy554, Texas Red, Rhodamine, CAL Fluor Orange 650,

JOE, ROX, Tamra, 6 FAM, FluoresceinJOE, ROX, Tamra, 6 FAM, Fluorescein Base Modifi cation Bromo-deoxyUridin Uridine, Uracyl, DeoxyinosineUridine, Uracyl, Deoxyinosine AntisensePTO Molecular Beacons/ TaqMan probes Molecular Beacons/ TaqMan probes FAM, HEX, TET, ROX, JOE, Cy Dyes, Texas Red, OthersFAM, HEX, TET, ROX, JOE, Cy Dyes, Texas Red, Others

For large quantities, custom modifi cations, and special analysis please contact For large quantities, custom modifi cations, and special analysis please contact [email protected] | +91 40 [email protected] | +91 40 66564416

Page 7: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

Contact

United StatesOcimum Biosolutions Inc.Fortune Park VI8765, Guion Road, Suite GIndianapolis, IN, 46268Phone:1-317-228-0600Fax: 1-317-228-0700Email: [email protected]

IndiaOcimum Biosolutions Ltd6th Floor, Reliance Classic,Road No. 1, Banjara Hills,Hyderabad 500 034, A.P., IndiaPhone: +91 40 66627200Fax: +91 40 666 27205Email: [email protected]

The NetherlandsIsogen Biosolutions(An Ocimum Biosolutions Company)Lagedijk Noord 18, Postbus 220NL -3400 AE IJsselsteinPhone: +31 30 68 78 788Fax: +31 30 68 88 009Email: [email protected]

www.ocimumbio.com

B I O S O L U T I O N S(An Ocimum Biosolutions Company)

Page 8: ATGTGCTGACTGTAGCTGATCGATC … · The BioResearch Division provides molecular biology services like GMO testing, nucleic acid purifi cation, DNA extractions and gene synthesis. With

United StatesPhone: +1 317 228 0600Fax: +1 317 228 0700Email: [email protected]

IndiaPhone: +91 40 666 27200Fax: +91 40 666 27205Email: [email protected]

The NetherlandsPhone: +31 30 68 78 788Fax: +31 30 68 88 009Email: [email protected]

A T G T G C T G A C T G T A G C T G A T C G A T C0 1 1 0 0 1 1 1 1 0 1 0 1 0 1 0 0 1 1 1 0 1 0 1w w w . o c i m u m b i o . c o m


Top Related