+ All Categories
Transcript
Page 1: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

BioinformaticsWhy Can’t It Tell Us Everything?

Page 2: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

BioinformaticsWhat are our Data Sets?

• Interested in information flow with cells

• Currently, the key information is mostly a matter of biological macromolecules

• Eventually, information of interest will also include flow of nutrients, energy, and impact of small molecules on macromolecular function

Page 3: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

BioinformaticsWhat are our Questions?

• What is in there?• What does it do?• How similar is it to something else?• How does it fold?• Where does it go in a cell?• What does it interact with?• How it is regulated?• Level of confidence?

Page 4: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

* Function of organism is determined by function of its cells  * Function of cells determined by chemical reactions that take place within them  * Chemical reactions occur or not according to presence and activity of enzymes * Enzymes are proteins  * Proteins are determined by genes  * Therefore, genes determine organismal function

BioinformaticsLogical Reasoning Behind Data Sets

Page 5: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Genomics

Proteomics

Page 6: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Central DogmaFlow of Information

Page 7: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Central DogmaDNA as the Blueprint for Life?

Page 8: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Central DogmaDNA as the Blueprint for Life?

Page 9: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Central Dogma

DNA RNA Protein

Genes & proteins are different molecular languages,

but they are colinear

Page 10: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

DNA

Basic Unit (alphabet): Nucleotide (base) Only 4: A, T, G, and C

Double-stranded: A<>T and G<>C

5’..AGCTGCATGCTAGCTGACGTCA….3’ 3’..TCGACGTACGATCGACTGCAGT….5’

“Words” (genes) to encode proteins, RNA

Double helical

Page 11: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

DNA Tower in Perth, AUS

DNAStructure Connected to Information

Page 12: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

DNAReplication & Transcription as Algorithms

• With rare exceptions, all DNA is replicated

• Crucial tool is ability to go from one strand to another

• Transcription uses same base-pairing rules with U instead of T, but occurs in packets

Page 13: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Transcription = DNA to RNAWhere to Start is a Big Question

Page 14: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Protein

Alphabet: amino acids

There are 20 amino acids

Met Cys Ser Leu Ala Ala Val

Page 15: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

ProteinsNumber of Possible 100-mer Peptides?20 possible residues at each

position

For 2-mers, 20 possible at position 1 and 20 possible at position 2, so 20 x 20 = 202 = 400

Same logic for 100-mers, 20100 = 2100 x 10100 =

(210) 10 x 10100 =

~ (103) 10 x 10100 = 10130

Page 16: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

beta-pleated sheet

ProteinsFolding Starts Local

alpha-helix

Page 17: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

ProteinsFolding Goes Global

Page 18: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

ProteinsPredictive Protein Folding as Holy Grail

Page 19: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Protein

Alphabet: amino acids

There are 20 amino acidsEncoded by codons (triplets of nucleotides)

Met Cys

ATGTGCAGCCTAGCTGCCGTC

Ser

CTAGCTGCCGTC

Leu Ala Ala Val

Page 20: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Genetic Code Found on Earth:How Does It Work?

5’-UCGACCAUGGUUGACCAUUGAUUACCACG-3’

Page 21: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Genetic Code

• Triplet• Nonoverlapping• Comma-less• Redundant

Page 22: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.

Bioinformatics:Mining a Mountain of Data

Where are the putative genes?


Top Related