+ All Categories
Transcript
Page 1: Bioinformatics Why Can’t It Tell Us Everything?

BioinformaticsWhy Can’t It Tell Us Everything?

Page 2: Bioinformatics Why Can’t It Tell Us Everything?

BioinformaticsWhat are our Data Sets?

• Interested in information flow with cells

• Currently, the key information is mostly a matter of biological macromolecules

• Eventually, information of interest will also include flow of nutrients, energy, and impact of small molecules on macromolecular function

Page 3: Bioinformatics Why Can’t It Tell Us Everything?

BioinformaticsWhat are our Questions?

• What is in there?• What does it do?• How similar is it to something else?• How does it fold?• Where does it go in a cell?• What does it interact with?• How it is regulated?• Level of confidence?

Page 4: Bioinformatics Why Can’t It Tell Us Everything?

* Function of organism is determined by function of its cells  * Function of cells determined by chemical reactions that take place within them  * Chemical reactions occur or not according to presence and activity of enzymes * Enzymes are proteins  * Proteins are determined by genes  * Therefore, genes determine organismal function

BioinformaticsLogical Reasoning Behind Data Sets

Page 5: Bioinformatics Why Can’t It Tell Us Everything?

Genomics

Proteomics

Page 6: Bioinformatics Why Can’t It Tell Us Everything?

Central DogmaFlow of Information

Page 7: Bioinformatics Why Can’t It Tell Us Everything?

Central DogmaDNA as the Blueprint for Life?

Page 8: Bioinformatics Why Can’t It Tell Us Everything?

Central DogmaDNA as the Blueprint for Life?

Page 9: Bioinformatics Why Can’t It Tell Us Everything?

Central Dogma

DNA RNA Protein

Genes & proteins are different molecular languages,

but they are colinear

Page 10: Bioinformatics Why Can’t It Tell Us Everything?

DNA

Basic Unit (alphabet): Nucleotide (base) Only 4: A, T, G, and C

Double-stranded: A<>T and G<>C

5’..AGCTGCATGCTAGCTGACGTCA….3’ 3’..TCGACGTACGATCGACTGCAGT….5’

“Words” (genes) to encode proteins, RNA

Double helical

Page 11: Bioinformatics Why Can’t It Tell Us Everything?

DNA Tower in Perth, AUS

DNAStructure Connected to Information

Page 12: Bioinformatics Why Can’t It Tell Us Everything?

DNAReplication & Transcription as Algorithms

• With rare exceptions, all DNA is replicated

• Crucial tool is ability to go from one strand to another

• Transcription uses same base-pairing rules with U instead of T, but occurs in packets

Page 13: Bioinformatics Why Can’t It Tell Us Everything?

Transcription = DNA to RNAWhere to Start is a Big Question

Page 14: Bioinformatics Why Can’t It Tell Us Everything?

Protein

Alphabet: amino acids

There are 20 amino acids

Met Cys Ser Leu Ala Ala Val

Page 15: Bioinformatics Why Can’t It Tell Us Everything?

ProteinsNumber of Possible 100-mer Peptides?20 possible residues at each

position

For 2-mers, 20 possible at position 1 and 20 possible at position 2, so 20 x 20 = 202 = 400

Same logic for 100-mers, 20100 = 2100 x 10100 =

(210) 10 x 10100 =

~ (103) 10 x 10100 = 10130

Page 16: Bioinformatics Why Can’t It Tell Us Everything?

beta-pleated sheet

ProteinsFolding Starts Local

alpha-helix

Page 17: Bioinformatics Why Can’t It Tell Us Everything?

ProteinsFolding Goes Global

Page 18: Bioinformatics Why Can’t It Tell Us Everything?

ProteinsPredictive Protein Folding as Holy Grail

Page 19: Bioinformatics Why Can’t It Tell Us Everything?

Protein

Alphabet: amino acids

There are 20 amino acidsEncoded by codons (triplets of nucleotides)

Met Cys

ATGTGCAGCCTAGCTGCCGTC

Ser

CTAGCTGCCGTC

Leu Ala Ala Val

Page 20: Bioinformatics Why Can’t It Tell Us Everything?

Genetic Code Found on Earth:How Does It Work?

5’-UCGACCAUGGUUGACCAUUGAUUACCACG-3’

Page 21: Bioinformatics Why Can’t It Tell Us Everything?

Genetic Code

• Triplet• Nonoverlapping• Comma-less• Redundant

Page 22: Bioinformatics Why Can’t It Tell Us Everything?

Bioinformatics:Mining a Mountain of Data

Where are the putative genes?


Top Related