+ All Categories
Transcript
Page 1: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Biological WeaponsA Counterterrorism Perspective

University of CaliforniaLawrence Livermore National Laboratory

J. Patrick Fitch, Ph.D.Program Leader

Chemical & Biological National Security

October 19, 2005

UCRL-PRES-151152 Version 051019

For additional information contact J.P. Fitch at [email protected]

This work was performed under the auspices of the U.S. Department of Energy by the University of California, Lawrence Livermore National Laboratory under Contract No. W-7405-Eng-48.

Page 2: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 2

The public is exposed to a lot of information about potential biological attacks

Initiation of BioWatch at the State of the Union on January 28, 2003: “…deploying the nation's first early warning network of sensors to detect biological attack”

What are the key issues around BW and BW defense? What are distractions?

What are the key issues around BW and BW defense? What are distractions?

Page 3: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 3

Biosecurity is a multifaceted problem that requires integrating many disparate components

Link all of these components into a coherent architecture

Link all of these components into a coherent architecture

Vaccines• Development• Efficacy• Deployment

Pathogen biology• Infectivity• Signatures• Manipulation

Data• Collections• All source• Directed

discovery

Validation• Signatures• Assays• Processes• Chain-of-custody

Threats• Weaponized• GM• Individual• State sponsored

Epidemiology• Early detection• Privacy

Interpretation• Feasibility• Intent

Backgrounds• Natural• Manufacturing

Surveillance• Sensitivity• Specificity• Response

ThreatAssessments

S&T

Knowledge Management

Biosecurity ComponentsAnticipate Prepare Prevent Detect Response Attribute

Page 4: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 4

We would like to know even more!

BW attacks sound scary Genetically modified threat Bio Terror & Bio Error

“Mother Nature” as terrorist Re-emergent diseases Influenza

Discovery of 5 virulence-associated signatures

Northern Arizona University studenttesting prairie dog colony

Page 5: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 5

Dif

ficu

lty

Impact

Endemic

CleverUse

Modified• Genetic mods• Weaponized

The human and economic impact of endemic pathogens can be amplified

The systems-level challenge is to counter numerous potential threats

The systems-level challenge is to counter numerous potential threats

Page 6: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 6

A stratified view of bioterrorist threats

Level II (1000 – 10,000)

Level I (1 – 1000)

Level III (>10,000)

• Scale?

To Prevent

To Protect

To Treat & / or Isolate

• Detect?

Contagious

Non-Contagious

Treatable (Plague)

Non-Treatable (Ebola)

Treatable (Anthrax)

Non-Treatable (EEV)

• Agent?AerosolFood supplyWater supplyCarrier

Page 7: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 7

Looking for solutions: there are significant benefits to early detection of a biological attack

Treatments and quarantines must be administered early

13 to 4Plague

32 to 5Influenza

1 to 25 to 7Pulmonary

Anthrax

3 to 412 to 14Smallpox

Intervention window (days)

Incubation period (days)

Disease

A combination of complementary strategies are needed for early detection

A combination of complementary strategies are needed for early detection

Page 8: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 8

Contagious

Exposed

Examples for preventing, detecting, and responding to WMD events

Time

Prevent Environmental detection Response and restoration

Page 9: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 9

Contagious

Exposed

Examples for preventing, detecting, and responding to WMD events

Signatures

Backgrounds

Forensics andattribution

Prevent Environmental detection Response and restoration

Page 10: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 10

Contagious

Exposed

Examples for preventing, detecting, and responding to WMD events

Signatures

Backgrounds

Forensics andattribution

Detect to prophylax

Detect to warn

Prevent Environmental detection Response and restoration

Page 11: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 11

Contagious

Exposed

Examples for preventing, detecting, and responding to WMD events

Signatures

Backgrounds

Forensics andattribution

Detect to prophylax

Detect to warn

Epidemiology to treat

Consequencemanagement

Triage Dx

New strategies?

EmergingThreat

Prevent Environmental detection Response and restoration

Page 12: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 12

Developing new operational capabilities took several years and integration across multiple disciplines

nn

tt NT

Cepheid

Smiths

GACAAAAGCGACAAAGGTTTTGTTCTTGGTCAATCCTCTCCTTTGCACGCCGTGGGACCATAGCTACAGATCACTTTACCTGCG.TGGGTGAACGCCGTGTGCGG

Tech

Genomics

Validated assays

Enablinginstrumentation

Page 13: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 13

Early detection combined with models of dispersion are valuable

Bio attacks may not be visible Want to act before symptoms present Identify affected area / people / livestock Prophylax, treat and clean-up

BUT timelines are not short enough!

>15- and >150-g/m3 contours

Staten Island Fire(Feb. 21, 2003)

Page 14: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 14

What community norms can be established, promoted or enforced?

Biological Weapons Convention is intent-based

US offensive BW program terminated in 1969

- ‘Frozen’ perspective on BW

- Recent investments in biodefense

Are BW the “poor man’s” nuke?

- Role of deterrence?

- What value does attribution provide?

- When would a nation turn to BW?

- When would a terrorist group?

- Latency?

Contrast to other areas

- OPCW, for example

Organization for the Prohibition of

Chemical Weapons

Page 15: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 15

There are critical shortfalls in the nation’s infrastructure for dealing with bio-terrorism Life science R&D exploding

- Inherent “dual benefit”- Proliferating- 1969 out-of-date reference- BWC

Countermeasures not keeping up- Large cost and time from concept

to regulatory approval- Increasing antibiotic and antiviral

resistance- Few novel antibiotics in the

pipeline- Vaccines not commercially

attractive Similar issues in agriculture and

food

Time

L

Lif

e S

cien

ces

Pro

du

ct

Ad

vers

ary

1

Ad

vers

ary

2

Countermeasure

Ca

pab

ility

Countermeasure developers must adopt more rapidly than adversaries

Countermeasure developers must adopt more rapidly than adversaries

Page 16: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 16

An example of rapid response2003 Exotic Newcastle Disease Virus outbreak

Page 17: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader.

Lawrence Livermore National Laboratory 17

Disclaimer

This document was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor the University of California nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights.

Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or the University of California. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or the University of California, and shall not be used for advertising or product endorsement purposes.

This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W-7405-Eng-48.


Top Related