+ All Categories
Transcript
Page 1: Coding Documents using Alternative Techniques

Coding Documents using Alternative Techniques

Mircea-Florin Vaida, Tatiana HodorogeaTechnical University of Cluj-Napoca, Baritiu Street No.26-28, 400027,

Cluj-Napoca, [email protected], [email protected]

Page 2: Coding Documents using Alternative Techniques

Content

1. Introduction2. DNA Steganography3. DNA Cryptography4. Public Key Infrastructure (PKI) with DNA

Cryptography5. The algorithm by steps

5.1. The Technique of Deriving DNA Private Keys from Blood Analysis 5.2. Biological Principles of CDMB

6. Conclusions7. References

Page 3: Coding Documents using Alternative Techniques

1. Introduction

• Protecting medical information and other data assets using a technique of deriving DNA private keys from blood analysis, into the common PKI scenario.

• Synergetic minerals are used as a supplementary security technique in the coding process of data.

• A DNA encryption technique is further developed here in which a person’s medical data is encrypted in DNA strands based on the Central Dogma of Molecular Biology (CDMB).

• Protection of the data is enhanced by using a patient’s own blood mineral levels as a seed for selecting, transmitting and recovering that person’s private key.

Page 4: Coding Documents using Alternative Techniques

2. DNA Steganography

• Recent research considers the use of the Human genome in cryptography

•The spiritual concepts based on trinity and complementary that is considered in the DNA structure is able to be used in the cryptography process as an alternative technique.•The genetic code is based considering codons (consists of 3 nucleic acids from possible 4, as a 64 possible triplets) organised as a dual helix with complementary strands.

• In 2000, the Junior Nobel Prize was awarded to a young Romanian-American student, Viviana Risca, for her work in DNA steganography.

Page 5: Coding Documents using Alternative Techniques

1. Viviana Risca encoded a message in a strand of DNA

2. A prototypical ‘secret message’ DNA strand contains an encoded message flanked by primer sequences

3. Viviana Risca confined the sample to an area no larger than a microdot.

Page 6: Coding Documents using Alternative Techniques

3. DNA Cryptography

• We propose to introduce DNA cryptography into the common PKI scenario

• And encode the medical records of an individual in DNA data strand

• Flanked by unique primer sequences

• Unique primer sequences we obtain in the process of :

Deriving DNA Private Key from blood analysis.

Page 7: Coding Documents using Alternative Techniques

• Using an information conversion program Stefani encodes the medical records of an individual according to CDMB in

DNA data strand

flanked by unique primer sequences S1

mixes it among other decoy DNA strands and sends to the receiver through a public channel

Page 8: Coding Documents using Alternative Techniques

• Otto then obtains the unique primer sequences

• That mark the beginning and the end of secret data DNA strand hidden among the decoy strands.

• In this last step, he uses the information conversion program and reads the medical record of the individual.

Page 9: Coding Documents using Alternative Techniques

4. Public Key Infrastructure with DNA Cryptography

Page 10: Coding Documents using Alternative Techniques

Start:

Step 1. Stefani (the sender) provides Otto (the receiver) her public key which will constitute each unique blood analysis of the specific person.

5. The algorithm by steps

Page 11: Coding Documents using Alternative Techniques

Step 2. A secret DNA data strand contains 3 parts: - Secret DNA data strand in the

middle- Unique primer sequences on each

side S1.

Page 12: Coding Documents using Alternative Techniques

Step 3. Stefani uses the technique of deriving DNA private key from blood analysis.

3.1 In this process Stefani uses a program which associates to a specific mineral the nucleotide sequence based on the medical results of a specific person

-which will constitute the unique primer sequences S1

Page 13: Coding Documents using Alternative Techniques

5.1. The Technique of Deriving DNA Private Keys from Blood Analysis

1. Starting from the idea that the DNA alphabet having 4 letters corresponding to the four nucleotides, A, C, G, T there are 64 possible triplet sequences or codons (4x4x4).

Page 14: Coding Documents using Alternative Techniques
Page 15: Coding Documents using Alternative Techniques

A computer program generates a nucleotide sequence S, of length

L, according to the Genetic Code.

We choose a number n (dependent of the specific mineral value

from the particular individual’s blood analysis),

n represents the number of codons

By a random combination of codons results :L=3*n (1) (Ex. L=3*5=15)

2. Then we associate a specific mineral M, with the corresponding nucleotide sequence S.

Page 16: Coding Documents using Alternative Techniques

3. Then we associate a specific mineral, M (like calcium), based on its concentration level CL (Ex. 2.81mmol/l) , with the new nucleotide sequence S1

We derive S1 from nucleotide sequence S, based on unique CL with value V .

• This value represents a unique concentration level of a certain M.

V= x.y1y2 (Ex. 2.81) (2)

• Where x.y1y2 is the number that represent the value V.

=> CL=x.y1y2 (3)

Page 17: Coding Documents using Alternative Techniques

S=

• The resultant new nucleotide sequence S1 will have the length L1 S1=L1

L1=x*S+ (L-(y1+y2)) (4)

Ex. L1=2*GCAAGAGATAATTGT+(15-(8+1))=> L1 =GCAAGAGATAATTGTGCAAGAGATAATTGT+( 6

nucleotide)=> L1= GCAAGAGATAATTGTGCAAGAGATAATTGT+GCAAGA=>

S1=GCAAGAGATAATTGTGCAAGAGATAATTGTGCAAGA

=> S1=x*S+ (L-(y1+y2)) (5)

S1 will constitute the unique primer sequence (private key )

Page 18: Coding Documents using Alternative Techniques

Step 4: According to CDMB, using an information conversion program

Stefani encodes the medical records of an individual

in DNA data strand

flanked by unique primer sequences S1 and mixes it

among other decoy DNA strands.

Page 19: Coding Documents using Alternative Techniques

5.2. Biological Principles of CDMB

Transcription and Splicing : the non-coding areas (introns) are removed

Translation: the mRNA sequence is translated into a sequence of amino acids

Page 20: Coding Documents using Alternative Techniques

4.1 According to CDMB during the process of transcription Stefani cuts out the introns from the data-encoded DNA,

resulting in Encryption key 1. E1= starting and pattern codes of introns

=> C1=E1(P), where P is plaintext and C is the ciphertext.

4.2 Stefani translates the resulted spliced form of the data

E2= the codon amino acids mapping => C=E2(C1)..

Page 21: Coding Documents using Alternative Techniques

4.3 Stefani obtains the data-encoded protein after the

translation process.

Step 5. Stefani sends to Otto through a public channel the encoded form of the data .

Step 6. Otto then obtains the unique primer sequences that mark the beginning and the end of secret data DNA strand hidden among the decoy strands.

Page 22: Coding Documents using Alternative Techniques

Comments: Otto will use programs that perform the reverse processes as those performed by Stefani: simulating the transcription, splicing, and translation per the Central Dogma of Molecular Biology (CDMB).

Step 6. Otto uses the key E2 to recover the mRNA form of

the data from protein form of the data. Decryption key D1=E2 => P1=D1(C).

Page 23: Coding Documents using Alternative Techniques

Step 7. Otto recovers the DNA form of the data in the

reverse order as Stefani encrypted it. Decryption key D2=E1=> P=D2(P1).

Step 8. In this last step, Otto uses the information conversion program and reads the medical record of the individual.

• Stop

Page 24: Coding Documents using Alternative Techniques

5. Future Work

• As an additional layer of security, we propose to associate each mineral with a corresponding mineral – which we will call here, a synergetic mineral pair – for example, Ca-Fe. In this process the primers could be synergetic minerals.

• An implementation mechanism based on an adequate language capable to offer String processing facilities will be realized (Java).

• We want to prove all this in practice not only in theory, comparing the results with the classical one’s. (dedicated packages are offered in Java)

Page 25: Coding Documents using Alternative Techniques

6. Conclusions

Blood analysis may prove to be a secure and cost effective biometric method of selecting private keys for use in DNA encryption techniques.

New implementation techniques, as number association to specific codons that DNA supports with a more subtle significance, could be realized.

Analyzing in a deeper mode some spiritual concepts (eneagrams, tetractis, I Ching, mandalas, morphic theory, etc.) from oriental philosophy and other ancient civilizations, it is possible to consider special properties that are in conjunction with the cryptology domain.

Page 26: Coding Documents using Alternative Techniques

6. References

1. BOREM Aluízio Fabricio, R.Santos, 2003 Understanding Biotechnology Publisher: Prentice Hall PTRPub Date: January 17, 2003.

2. GEHANI Ashish, La Bean, Thomas H. Reif, JohnH, 1999 “DNA-Based Cryptography”, Department of Computer Science, Duke University. June 1999,

3. CHUVAKIN Anton, Cyrus Peikari, 2004, Security Warrior, Publisher: O'Reilly, Pub Date: January 2004

4. HODOROGEA Tatiana, Mircea-Florin Vaida, 2005, Alternate Cryptography Techniques, ICCC 2005, Miskolc-Lillafured, Hungary, 24-27 may 2005, Vol. 1, pp. 513-518

5. GARFINKEL Simson, 2001, Web Security, Privacy & Commerce, 2nd Edition, Publisher, O’Reilly, November 2001

6. GARFINKEL Simson, Lorrie Faith Cranor, 2005, Security and Usability, Publisher, O’Reilly, August 2005

7. KAHN D., 1967, The Codebrakers, McMillan, New York, 19678. KANG Ning, A Pseudo DNA Cryptography Method Independent Research Study

Project for CS5231 9. TAYLOR Clelland Catherine, Viviana Risca, Carter Bancroft, 1999, “Hiding

Messages in DNA Micodots”. Nature Magazine Vol.. 399, June 10, 1999.10. VAIDA Mircea-Florin, 2004, Information Society Development and Human

Evolution, ICCC 2004, Baile Felix, May 27-29, 2004, pp. 414-42011. VAIDA Mircea-Florin, 2004, Security and Java, Conference at the Université

de Savoie, France, supported by Shuffle project, May 200412. VAIDA Mircea-Florin 2005, Teaching Computers As a Human Spiritual

Evolution, the 4th IASTED International Conference on Web-Based Education WBE’05, Grindelwald, Switzerland, pp. 667-672

Page 27: Coding Documents using Alternative Techniques

Thank you !


Top Related