Why study (organic) evolution? Evolution: descent with modification
• To understand natural history of life on earth
• To understand disease processes and public health risks– Immunity– Host-specificity– Risk assessment
Observation Propose Hypothesis
Refine HypothesisRepeat Experiment
Determine if Data are Bias
Collect and Analyze Data
Design Experiment
Redesign Experiment
Repeatable
Not repeatable
Data are Bias
Propose Alternate Hypothesis
Accept as Theory
Original population
Population after selection
Spectrum of characteristics in population
Different selection processes
Effects of Natural Selection on Populations
Darwin’s Disadvantages
• Didn’t have knowledge of principles of inheritance (but made very good predictions)
• Made analogy between natural selection and artificial selection (a good hypothesis) but didn’t have the skills to test it thoroughly
Advances in Evolutionary Science:Contributions to the Neo-Darwinian Synthesis
• Principles of inheritance
• Linkage and mutation
• ‘Genes’ are the basis for inheritance and are found within chromosomes
• Discovery that DNA is the molecular material of genes, cracking genetic code
• Molecular mechanisms worked out for DNA replication and protein synthesis
• Multiple methods invented to study genetic variation and evolution
Cross-sectional data
• Cross-sectional data (snap-shot in time) can be used scientifically to make deductions about a process
Evolutionary science is like criminal forensics
• The crime may not have any witnesses
• The evidence is often patchy and comes in many forms
• In the absence of eyewitness accounts, DNA is often the most convincing evidence
• The best evidence is based on DNA sequence variation
Genetic Variation Results from MutationMost mutations are either harmful, or neutral, but sometimes they are beneficial.
If the mutations are not too harmful, they will be passed on to their progeny (offspring). This is the hereditary basis of evolution.
These heritable changes in a lineage or populations of organisms over generations contribute to micro-evolution
the red fox ran out
the red fax ran out
thr edf oxr ano ut
Point mutation
Frame shift
Mutations Analogy
Variation by Mutation is Compounded by Genetic Recombination
• Sexual reproduction
• Bacterial transformation
• Bacterial conjugation
• Virus-mediated gene transfer
• Other transfer between symbionts
DNA technology
• Facilitates the study of heritable characteristics between individuals, within populations and higher taxa
• Population genetics studies- field studies of evolutionary processes
• Phylogenetics- infer evolutionary relationships (family trees) from genetic similarity
Longitudinal vs cross-sectional
Phylogenetic analysis examines relationship from cross-section
Population genetic studies can follow gene flow over time
• DNA microarrays
• PCR based methods
Molecular (DNA) Methods• Restriction Enzyme Digestion
– RFLP– PFGE– Ribotyping
Combination of methods
• DNA sequencing
RFLP
RFLP-restriction fragment length polymorphisms
DNAOrganism A Organism B
Restriction Endonuclease- enzyme that cleaves DNA at palandromic sequences. Example: EcoRI cuts at GAATTC
RE
Gel Electrophoresis
Gel Made of Translucent, Porous Matrix
DNA samples added to wells in matrix
DNA migrates at a rate inversely related to log10 of amplicon size
+
-EtBr binds to DNA as it travels through the gel
Visualizing DNA with UV light
Large pieces of DNA
Small pieces of DNA
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L
_
+
Ribotyping
DNA EcoRIcells
Transfer to nylon membrane (Southern Blot)
1% Agarose Gel
Bind labeled 16S rDNA Probe
-
+Gel electrophoresis
Anti-probe Ab and enzyme-linked color reaction
PCRpolymerase chain reaction
• Invented by Kary Mullis in 1983
• As soon as 1984 it was used for identification of unknown DNA
• Now widely used for many types of scientific research
Concept
• Amplify small quantities of DNA by in vitro DNA replication
Target DNA
PCR
Copies of Target DNA
Generalized PCR cyclerepeated ca. 40 times
94 degrees Celsius-denaturation
Ca.45-60 degrees-primer annealing
72 degrees Celsius-extension
Target sequence
Taq
1st Cycle
2nd Cycle
Single copy of dsDNA target
3rd Cycle
Amplicons increase exponentially with each cycle
Variations of PCR technique
• Repetitive element PCR• RAPD PCR
Primers bind where ever there is a complemetary DNA sequence
Can be used to generate qualitative or quantitative data
L 1 2 3 - Positive Charge
Negative Charge
L 1 2 3 -
DGGEdenaturing gradient gel electrophoresis
Gel made of substance that denatures DNA molecules
Denaturing agent exists in a gradient from top to bottom
PCR amplicons with different sequences will denature at different distance from the top
DNA sequencing
• DNA usually in the form of PCR amplicon
• One strand at a time
• Most thorough method of studying variation
• Relatively expensive and time consuming
Extension (polymerization)
3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…
5’ATCGAACGGAGACTTACTCTTA
Taq
C A
A
T
G
C
A
T
A
G
T
T
A
3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…
Taq
5’ATCGAACGGAGACTTA
dNTPs are randomly- incorporated into new strand until a ‘stop’ is added