+ All Categories

Download - Exon Table

Transcript
Page 1: Exon Table
Top Related
Prevalence of Mutation in BRCA1 gene, exons-2, 3, 5, 11 ... · exon 20 . were 94% homologous with USA; (Gene Bank . exon 20 from ACCESSION Number DQ478408.1) (Table 2). D. ISCUSSION.
Prevalence of Mutation in BRCA1 gene, exons-2, 3, 5, 11 ... · exon 20 . were 94% homologous with USA; (Gene Bank . exon 20 from ACCESSION Number DQ478408.1) (Table 2). D. ISCUSSION.

Documents

Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon
Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon

Documents

 · Gefitinib Gefitinib 1. Non-small cell lung cancer EGFR DNA EGF-R exon 19 deletion, exon 21 [1.858R] substitution mutations, L861Q G719X EGFR exon 20
 · Gefitinib Gefitinib 1. Non-small cell lung cancer EGFR DNA EGF-R exon 19 deletion, exon 21 [1.858R] substitution mutations, L861Q G719X EGFR exon 20

Documents

Response Heterogeneity of EGFR and HER2 Exon 20 Insertions to … · exon 20 mutations were identified (Table 1). The most common mutation resulted in a duplication of codon 772
Response Heterogeneity of EGFR and HER2 Exon 20 Insertions to … · exon 20 mutations were identified (Table 1). The most common mutation resulted in a duplication of codon 772

Documents

Exon Mobil Interest Netting
Exon Mobil Interest Netting

Documents

Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT.
Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT.

Documents

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.
GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

Documents

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping
CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

Documents