+ All Categories
Transcript
Page 1: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

GENES OUT, VIRUS IN Making designer mice

Dianne Langford, PhD Temple University School of Medicine

Department of Neuroscience Philadelphia, PA

Page 2: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

GENES OUT

Page 3: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Types of Gene Alterations

Page 4: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Inversions

Page 5: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Inversions

INVERSION INVERSION

In humans, inversions most frequently occur in chromosome 9. Usually inversions are not deleterious. Make cause decreased fertility. Some genes on chromosome 9 that are disrupted cause disease.

tubersclerosis

Page 6: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Translocations

Leukemia

Presenter
Presentation Notes
In myelogenous leukemia a translocation occurs between chromosome 9 and 22. the rearrangement of genetic material creates a fusion gene called Bcr-Abl that promotes development of leukemia. A drug called Gleevec blocks the acitivy tof Brc-Abl
Page 7: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Deletions

Page 8: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

CRE-LOX Technology

General Knockouts, Conditional Knockouts and Reporter Strains

Page 9: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Cre-Lox requires two components LoxP sites: specific 34 base pair sequence consisting of a core 8 bp sequence , where recombination takes place and two flanking 13 bp inverted repeats.

ATAACTTCGTATAGCATACATTATACGAAGTTAT

Cre-recombinase: enzyme that catalyzes recombination between two loxP sites

Page 10: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Utility of Cre-Lox

• General Knockouts

hairless

Embryonic lethal

Presenter
Presentation Notes
Hairless or can be embryonic lethal, in which case you need an inducible system
Page 11: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Utility of Cre-Lox

• Conditional Knockouts (cell type, stimulus induced or both)

Presenter
Presentation Notes
Two types of mice: one with floxed gene and one with cre recombinanse enzyme under control of a cardiac gene promoter.
Page 12: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Cre-recombinase

Page 13: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Utility of Cre-Lox

Reporter Strains

Presenter
Presentation Notes
Cre reporter strains allow the user to assess the function (degree of excision) of an individual cre line. These strains are engineered to express a reporter gene (LacZ or GFP) following removal of a lox-P flanked cassette, thus marking the cell lineages that can be targeted with a given CRE line. Some lines also express a distinct reporter prior to Cre-mediated excision.
Page 14: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Types of gene alterations

INVERSION

INVERSION

tubersclerosis

Page 15: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Types of gene alterations

Translocations

Page 16: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Types of gene alterations

• Deletions: MOST COMMON

Page 17: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Autism Research

Hotspots for gene deletions that may be associated with Autism

If loss of one gene is deleterious, knocking out a second gene may rescue phenotype

Page 18: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Why do we need to use tamoxifen?

• Cross of the floxed mouse with the cre mouse

• Inducible and Conditional

Page 19: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

knockout of a particular gene in adult mice using tamoxifen

promoter CRE ER HSP

CRE ER

HSP

GENE DNA DNA

DNA

TM

TM

Page 20: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

What are the hazards?

Page 21: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Tamoxifen

Binds the Estrogen Receptor by competing with Estrogen. Tamoxifen is metabolized by the liver and two of the metabolites, α-hydroxy-tamoxifen & α-hydroxy-N-desmethyl-tamoxifen have the potential to be hydroxylated and become highly toxic.

Page 22: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Tamoxifen

Carcinogenic Tetragenic Genotoxic Reproductive Toxin

Page 23: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Window of risk = 72 h post injection

Potential Routes of Exposure: aerosol, ingestion, injection, absorption through skin.

WHO IS AT RISK? • Everyone who comes in contact with mice, bedding and feces

HOW TO MANAGE PROJECTS? • Restricted access Trained personnel will change bedding/food /water the

day of injection. • Provide enhanced PPE for those in contact with mice. • Yellow CARD with date of admin and all clear date. • Cages will be taped with YELLOW chemo tape • Will provide YELLOW bags for Chemo Waste: carcass disposal in yellow

bags • Place SIGN on DOOR

Page 24: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of
Page 25: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

VIRUS IN

Page 26: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Effects of HIV on the CNS

Pseudotyped HIV in the mouse model

Page 27: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Why do we need to generate a pseudotype virus?

• Biological barriers

• Cell receptors

Page 28: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Plasmid vector driven HIV production via pYU2 or pYK-JRCSF

(10ug plasmid DNA into 1.5 x 10^6 293T cells)

Human cell specific envelope proteins

Mouse cell specific envelope protein (15ug plasmid DNA into 293T cells)

Page 29: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Pseudotype virus

293T

Cell permissive for transfection

Page 30: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Cell free supernatants with 10^4-10^5 pg p24 in 0.1Ml saline

Cocaine + Pseudotype virus

0 14 21 28 7 29

Page 31: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Window of risk =22 days WHO IS AT RISK? • Everyone who comes in contact with mice

HOW TO MANAGE PROJECT? • Restricted access

• Have trained personnel change bedding/food /water

• Provide enhanced PPE for those in contact with mice

Page 32: GENES OUT, VIRUS IN - MABSAmabsa.org/docs/presentations/2015-6-11-genes-out-virus-in.pdf · Cre-recombinase: enzyme that catalyzes recombination between two loxP sites . Utility of

Top Related