2017
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA VEGETAL
Genomic deletions in Escherichia coli K-12 MG1655 for
plasmid DNA production
Diana Tamára Vaz Cipriano
Mestrado em Microbiologia Aplicada
Dissertação orientada por:
Prof. Doutor Francisco Dionísio
Prof. Doutor Gabriel Monteiro
Genomic deletions in Escherichia coli K-12 MG1655 for
plasmid DNA production
Diana Tamára Vaz Cipriano
2017
This thesis was fully performed at the Institute of Bioengineering and Biosciences in Instituto
Superior Técnico under the direct supervision of Professor Dr. Gabriel Monteiro in the scope of
the Master in Applied Microbiology of the Faculty of Sciences of the University of Lisbon.
“Failure is not an option” – Eugene Francis Kranz
iv
Acknowledgment
I would first like to thank my thesis extern supervisor Professor Doctor Gabriel Monteiro of the
Instituto Superior Técnico at Universidade de Lisboa, for having accepted me in your group, iBB
group. The door to Prof. Gabriel Monteiro office was always open whenever I ran into a trouble
spot or had a question about my research or writing. He consistently allowed this paper to be my
own work, but steered me in the right the direction whenever he thought I needed it.
I would also like to thank my intern supervisor Professor Doctor Francisco Dionísio for having
accepted to be my supervisor.
To the people of the iBB group, my sincere thanks, for all the sharing of knowledge at each lab
meeting, and for all the fun times.
Sofia Duarte, thank you so much for all the professional and personal teachings. You were,
without doubt, a great guide, who allowed me to concretize this project. Furthermore, thank you
for the sincere and fun friendship that we have created. You are the best.
Maria Martins and Cláudia Alves, thank you so much for your participation in this project, for
your help in my doubts and for all teachings. Thank you so much for your friendship.
Marisa Santos, thank you so much for all teachings about HPLC, was a good experience.
Thanks to Professora Leonilde Moreira and to Inês Silva, for all clarifications regarding
sequencing of strains.
Also, to Ricardo Pereira for his work and dedication to the 7th floor and Rosa Gonçalves for the
sympathy, affection and for maintaining the lab material clean and organized.
Soraia Guerreiro, one more time, we are together in this stage. Thank you for all your support and
help in hard moments.
The most important thanks, I must express my very profound gratitude to my parents, my brother
and all my family for providing me with unfailing support and continuous encouragement
throughout my years of study and through the process of researching and writing this thesis.
Thank you for hanging on to my unwanted absence. This accomplishment would not have been
possible without them. Thank you.
Last but not least, my friends. Thank you so much to the friends who accompanied me and
supported me in this stage of my life. The names are not important, the quantity much less. It
matters that I have the best with me.
Now it is time to celebrate.
v
Abstract
The interest in plasmid DNA (pDNA) as a biopharmaceutical has been increasing over the last
few years, especially after the approval of the first DNA vaccines. Gene therapy and DNA
vaccines represent a promise in the treatment of diseases like viral infections, genetic and acquired
diseases. From the point of view of manufacture, it is important to establish a profitable process
with a low cost-production relation. So, over the last years the investigation has optimized and
improved the production conditions as well as genetically modifying some bacterial strains to turn
the production of hypothetical vectors profitable.
pDNA vectors offer considerable benefits over viral systems in gene-based therapy and
vaccination applications, including higher shelf stability, low immunogenicity and toxicity, and
simple manufacture in large scale. However, also shows low transfection efficacy, and requires
milligram scale of pharmaceutical-grade pDNA per patient, which implies extensive production
efforts. In order to fulfil high pDNA production requirements, genetically engineered strains
specially designed to achieve high pDNA yields are required.
This master thesis was a follow up on a previous work aiming at genetically modifying
Escherichia coli strains. To explore the effect of strain genetic background, a new pDNA
production strain, mutated in of three genes pgi, endA and recA (GALG20), was previously
constructed. However, as an unintentional genomic deletion of the 20 kb, derived from rac
prophage, appeared in GALG20, a new derivative from MG1655 deleted in pgi, endA and recA
genes was constructed (GALGNEW) using λ-Red System described by Datsenko and Wanner
[1]. This new strain was compared with GALG20, and with the wild-type strain MG1655.
However, contrary to expected, GALG20 and GALGNEW strains show slight differences in
growth kinetics (31.4 ± 2.0 and 32.6 ± 2.7, respectively) and plasmid production yields [169.2 ±
14.3 (mg/ L) and 204.3 ± 44.3 (mg/ L), respectively]. As expected, these two mutant strains show
higher volumetric and specific plasmid production yields, when comparing with E. coli MG1655.
An additional goal of this work was to construct zwf deletion mutants of GALGNEW, using the
CRISPR- Cas9 System instead of the λ-Red method. This last goal was not concluded.
Keywords:
Gene therapy
DNA vaccination
Plasmid DNA
Strain engineering
Escherichia coli
vi
Resumo
A terapia genética e as vacinas de DNA representam um avanço no tratamento de doenças como
infeções virais, doenças genéticas e adquiridas. Do ponto de vista de produção, é importante
estabelecer um processo rentável com uma relação custo-produção reduzida. Assim, nos últimos
anos a investigação tem otimizado e melhorado as condições de produção, bem como modificado
geneticamente algumas estirpes bacterianas para tornar rentável a produção de vetores
hipotéticos.
Os vetores de DNA plasmídico (pDNA) proporcionam benefícios consideráveis em relação aos
sistemas virais em aplicações de terapia e vacinação baseadas em genes, incluindo maior
estabilidade, baixa imunogenicidade e toxicidade e produção simples em grande escala. No
entanto, também mostra baixa eficácia de transfeção e requer o uso à escala de miligramas de
pDNA de qualidade farmacêutica por paciente, o que implica esforços de produção extensivos. A
fim de satisfazer os requisitos de produção de pDNA elevada, são necessárias estirpes
geneticamente modificadas especialmente concebidas para alcançar rendimentos elevados na
produção de pDNA.
Esta dissertação de mestrado deu continuidade a um trabalho anterior com o objetivo de modificar
geneticamente estirpes de Escherichia coli (E. coli) MG1655 através da deleção de genes alvo
(pgi, endA e recA), recorrendo ao método λ-Red descrito por Datsenko e Wanner, e
posteriormente, comparar os seus padrões de cinética de crescimento com a estirpe original.
Os genes selecionados para deleção desempenham diferentes funções no metabolismo de E. coli
estando diretamente relacionados com a produção de nucleótidos e produção de DNA plasmídico.
O gene pgi é responsável por codificar a enzima fosfoglucose isomerase, a qual catalisa a
conversão da glucose-6-fosfato em frutose-6-fosfato, correspondendo à primeira etapa da
glicólise. A deleção deste gene conduz a um redireccionamento do fluxo de carbono para a via
dos fosfatos de pentose, o que leva a um aumento da síntese de nucleótidos (R5P e E4P),
necessários para a síntese de DNA plasmídico. Esta alteração fornece ainda elevadas quantidades
de poder redutor (NADPH). O gene endA é responsável por codificar uma endonuclease não
especifica, enquanto o gene recA participa no sistema de reparação da estirpe por recombinação
homóloga de sequências. A deleção dos genes endA e recA minimiza a digestão inespecífica do
DNA plasmídico bem como a sua recombinação. O resultado da deleção dos três genes descritos
anteriormente foi a criação da estirpe GALGNEW. Esta estirpe foi comparada com a estirpe
mutante previamente criada, GALG20, bem como com a estirpe original MG1655. Antes de
realizados os ensaios de crescimento, todas as estirpes foram transformadas com o plasmídeo
pVAX1GFP.
Neste projeto foi investigada a natureza e a frequência da deleção genómica não intencional de
20 kb, derivada do prófago rac. Esta deleção surge quando estirpes de E. coli K-12 MG1655 são
deletadas no gene pgi, usando o método λ-Red descrito por Datsenko e Wanner. Este fenómeno
foi verificado após a criação da estirpe GALG20 por sequenciação, não tendo sido encontrada
nenhuma leitura de amplificação “read” no genoma da estirpe naquele local. Através de métodos
de análise molecular, nomeadamente: reação em cadeia da polimerase (PCR) e sequenciação de
nova geração (NGS) MiSeq®, a presença da sequência rac foi confirmada no genoma da nova
estirpe GALGNEW. As reações de PCR realizadas envolveram pares de oligonucleótidos
sintetizados a montante, a jusante e na própria região de 20 kb.
vii
Tal como descrito por Liu et al. (2015), a presença de genes de prófagos fornece múltiplos
benefícios ao hospedeiro, afim deste sobreviver em ambientes com condições adversas, sendo
exemplos: sob stresses oxidativo, ácido, osmótico e sob stress causado pela presença de
antibióticos no meio de crescimento. A deleção da sequência rac conduz a um decréscimo da
resistência do hospedeiro aos stresses mencionados, tornando a estirpe mais suscetível.
Um objetivo adicional deste trabalho foi a construção de uma nova estirpe deletada no gene zwf
a partir da estirpe GALGNEW, aplicando um método designado CRISPR- Cas9 descrito por
Reish e Prather. Este último objetivo não foi concluído.
Diversas diferenças foram encontradas entre os dois métodos de deleção de genes. Contrariamente
ao método λ-Red descrito por Datsenko e Wanner, este novo método (CRISPR-Cas9) não requer
a síntese por PCR de uma sequência portadora do gene que fornece resistência ao antibiótico
canamicina, designada cassete de canamicina, e são utilizados três plasmídeos para
transformação. O método CRISPR-Cas9 tem por base a transformação da estirpe hospedeira com
um plasmídeo que carrega o gene cas9, o qual codifica uma endonuclease responsável por fazer
um “nick” em cadeia simples. O local onde a enzima corta é específico e definido pela escolha de
uma região composta por um tripleto (NGG) designada PAM, a qual se localiza na região do gene
a deletar. No fim de confirmada a deleção do gene alvo, a estirpe é transformada com um terceiro
plasmídeo (pKDsg-p15) para curar o primeiro (pCas9cr4). Contudo, existem características
comuns a estes dois métodos, sendo exemplos: (a) a presença dos genes λ-Red (exo, bet e gam),
introduzidos num segundo plasmídeo (pKD46 no método λ-Red e pKDsg-xxx método CRISPR-
Cas9) e que vão permitir a recombinação entre o fragmento de interesse e o genoma da estirpe
hospedeira e (b) a termossensibilidade do segundo plasmídeo.
Relativamente ao gene zwf, este é responsável por codificar a enzima glucose-6-fosfato
desidrogenase (G6PDH), sendo esta fundamental no metabolismo central uma vez que se encontra
envolvida na divisão do carbono entre a glicólise e a via dos fosfatos de pentose. Com a deleção
deste gene é esperado uma restruturação do fluxo de carbono de E. coli para vias alternativas.
Apresentando dados mais concretos, as estirpes mutadas no gene zwf conseguem direcionar
98.9% e 87.0% do fluxo total de carbono através da primeira etapa da glicólise e do ciclo dos
ácidos tricarboxílicos (pela conversão de acetil-coenzima A em citrato). Quando feita a mesma
análise na estirpe original não mutada, verifica-se que o fluxo de carbono é menor na primeira
etapa da glicólise (78.6%) e na mesma etapa do ciclo dos ácidos tricarboxílicos (73.1%).
Todavia, as estirpes GALG20 e GALGNEW apresentam ligeiras diferenças ao nível de cinética
de crescimento (31.4 ± 2.0 and 32.6 ± 2.7, respectivamente) e de rendimento de produção de
plasmídeos [169.2 ± 14.3 (mg/ L) e 204.3 ± 44.3 (mg/ L), respetivamente]. Tal como era
expectável, estas duas estirpes mutantes mostram rendimentos volumétricos e de produção de
plasmídeo mais elevados, quando comparadas com a estirpe original E. coli MG1655.
Palavras-chave:
Terapia genética, Vacinas de DNA, DNA plasmídico, Engenharia de estirpes, Escherichia coli
viii
9
Contents
ACKNOWLEDGMENT ____________________________________________________________ IV
ABSTRACT ________________________________________________________________________ V
RESUMO __________________________________________________________________________ VI
LIST OF FIGURES ________________________________________________________________ 11
LIST OF ABBREVIATIONS ________________________________________________________ 15
THESIS MOTIVATION ____________________________________________________________ 16
1. INTRODUCTION____________________________________________________________ 17
1.1. Escherichia coli: The host strain _____________________________________________ 17 1.2. Plasmid DNA and Therapeutic Applications ___________________________________ 20
1.2.1. Types of Vaccines: Evolution and characteristics _____________________________ 21 1.2.2. Design of Plasmids for Gene Therapy and Vaccination ________________________ 23 1.2.3. Plasmid Structural Stability ______________________________________________ 26
1.2.3.1 Plasmid Size _________________________________________________________________ 27 1.2.3.2 DNA structure ________________________________________________________________ 28
1.2.4. Stability in Replication Process ___________________________________________ 28 1.2.5. Advantages of DNA vaccines ____________________________________________ 29 1.2.6. pVAX1-GFP plasmid ___________________________________________________ 29
1.3. Effect of plasmid DNA synthesis on E. coli central carbon metabolism ______________ 30 1.4. Relevant genes for E. coli strain engineering aiming to increase pDNA production _____ 31
2. MATERIALS AND METHODS ________________________________________________ 33
2.1. Media, Chemicals and Other Reagents ________________________________________ 33 2.2. Preparation of Competent cells_______________________________________________ 34
2.2.1. Electrocompetent cells __________________________________________________ 34 A. Transformation by electroporation_____________________________________________________ 34
2.2.2. Chemical competent cells ________________________________________________ 35 B. Transformation by heat shock ________________________________________________________ 35
2.3. Red Disruption System _____________________________________________________ 36 2.3.1. Strains and plasmids ____________________________________________________ 36 2.3.2. Oligonucleotides _______________________________________________________ 37 2.3.3. Generation of kanamycin cassette _________________________________________ 39 2.3.4. Gene disruption strategy _________________________________________________ 40
2.4. CRISPR Cas9-System method _______________________________________________ 42 2.4.1. Strains and plasmids ____________________________________________________ 42 2.4.2. Oligonucleotides _______________________________________________________ 43 2.4.3. Plasmid construction and protospacer design _________________________________ 43 2.4.4. Gene disruption strategy _________________________________________________ 46
2.5. Gel extraction and purification ________________________________________________ 46 2.6. Plasmid DNA purification ____________________________________________________ 47 2.7. Plasmid DNA restriction _____________________________________________________ 47 2.8. General PCR parameters _____________________________________________________ 48 2.9. Agarose electrophoresis ______________________________________________________ 48 2.10. Shake flask cultivation _______________________________________________________ 48 2.11. Measurement of glucose ______________________________________________________ 49 2.12. Plasmid DNA quantification __________________________________________________ 49 2.13. Cells banks preparations _____________________________________________________ 49 2.14. Genomic deletion analysis ____________________________________________________ 50 2.15. DNA sequencing ____________________________________________________________ 51
10
3. RESULTS AND DISCUSSION _________________________________________________ 52
Plasmid DNA profile _________________________________________________________ 52 3.2. Knockouts by Red Disruption System _________________________________________ 54
3.2.1. Kanamycin cassette generation ______________________________________________ 54 3.2.2. pgi gene knockout ________________________________________________________ 55 3.2.3. recA gene knockout ______________________________________________________ 57 3.2.4. fnr and ralR genes ________________________________________________________ 59
3.3. CRISPR Cas9- System method _______________________________________________ 64 3.3.1. Construction of plasmid pKDsg-zwf _________________________________________ 64
3.4. Shake flask cultivation ______________________________________________________ 65 3.5. Measurement of glucose and plasmid DNA quantification _________________________ 68 3.6. Genomic deletion analysis____________________________________________________ 71 3.7. DNA sequencing results ____________________________________________________ 73
4. CONCLUSION AND FUTURE WORK _____________________________________________ 74
5. REFERENCES __________________________________________________________________ 75
11
List of Figures
Figure 1. Phylogenetic tree based on glucose-6-phosphate isomerase encoded by pgi gene. The selected
sequences were aligned by Muscle Alignment Software. The topology was inferred using the Neighbor-
Joining method and the evolutionary distances were computed using the Poisson correction method
implemented in the software MEGA 7.0.18. The orange square ( ) in center represent the root of the
circular tree, the red circular forms ( ), the green squares ( ) and the yellow triangle ( ) represent 3 of
15 orders of class Gammaproteobacteria: Enterobacteriales, Vibrionales and Pseudomonadales,
respectively. _______________________________________________________________________ 17 Figure 2. E. coli K-12 and derivatives: creation of new strains and relationship between different strains.
Lineage of MG1655 and W3110, close relatives of wild-type E.coli K-12 (green box). Generation of
strains containing multiple mutations from MC1061, DH1 and JM101. Dark boxes represent commonly
used E. coli strains for plasmid DNA production and recent developments in E. coli strains designed for
high yield pDNA processes. Full line arrows represent the relationship between the strains and dashed
line arrows represent mutations carried from one strain to the other. Schematic representation adapted
from [9]–[11]. ______________________________________________________________________ 19 Figure 3. Indications addressed by gene therapy clinical trials. Data updated in August 2016 [19]. ___ 20 Figure 4. Geographical distribution of gene therapy clinical trials by continent. Data updated in August
2016 [19]. _________________________________________________________________________ 21 Figure 5. The various vaccine technologies developed over time. _____________________________ 22 Figure 6. Vectors used in Gene Therapy clinical trials. Data updated in August 2016 [19]. _________ 23 Figure 7. The main stages for pDNA vaccine design, production and vaccination. Adapted from [12],
[18], [32]. _________________________________________________________________________ 24 Figure 8. Genetic elements of a pDNA vector. The plasmid consists of a Plasmid Propagation Unit (PPU)
that operate in the microbial host and a Eukaryotic Expression Unit (EEU) that drives the protein
synthesis in the eukaryotic cells [28]. ____________________________________________________ 25 Figure 9. Ranking of alternative plasmid selection approaches according to plasmid size and
transformation efficiency. Adapted from [38]. _____________________________________________ 27 Figure 10. The Central Carbohydrate Metabolic Network [85]. _______________________________ 30 Figure 11. Schematic map of the plasmids used in Red system. (A) plasmid pKD13 (image created in
SnapGene® software) [5], (B) plasmid pKD46 [86] and (C) plasmid pCP20 [7].__________________ 36 Figure 12. Schematic representation of construction of the primers: to generate kanamycin cassette
(forward and reverse primers) and to confirm the insertion of the kanamycin cassette (primers check)
[51]. ______________________________________________________________________________ 38 Figure 13. Kanamycin resistance cassette generated by PCR: Schematic representation created in the
SnapGene software [36]. ______________________________________________________________ 39 Figure 14. Gene disruption strategy. H1 and H2 are the homology extensions or regions, P1 and P2 are
the priming sites. Strategy described by Datsenko and Wanner [53]. ___________________________ 40 Figure 15. Schematic map of the no-SCAR plasmids. (A) Plasmid pCas9cr4. (B) Plasmid pKDsg-xxx
[54]. ______________________________________________________________________________ 42 Figure 16. A schematic diagram of the proposed CPEC mechanism for cloning an individual gene. The
fragment 1 (orange line) and the fragment 2 (blue line) share overlapping regions at the ends. The
hybridized fragments extend using each other as a template until they complete a full circle (black line)
and reach their own 5’-ends. The assembled plasmid has two nicks, one on each strand. They can be used
for transformation with or without further purification. Adapted from [71], [87]. _________________ 44 Figure 17. Schematic representation of main steps of no-SCAR method. Adapted from [54]. _______ 46 Figure 18. Schematic representation of location of the oligonucleotides in the genome of MG1655 strain.
__________________________________________________________________________________ 50
Figure 19. Agarose gel expressing the band profile of plasmid pKD13 digested with BglII (lane 1) and
non- digested (lane 2).________________________________________________________________ 52 Figure 20. Qualitative analysis of plasmid pKD46: Plasmid DNA isoforms [88] and agarose gel analysis
of restriction digestion reactions of plasmid pKD46. Lane 1 – purified plasmid digested with EcoRI, lane
2 - purified plasmid digested with BamHI, lane 3 - purified plasmid undigested. The last lane (M)
corresponds to molecular weight marker NZYDNA ladder III. ________________________________ 53
12
Figure 21. Agarose gel analysis of digestion reactions of pKDsg-ack, pKDsg-p15 and pCas9cr4 plasmids
with restriction enzymes. The first lane (M) is molecular weight marker ladder III. Lane 1 is a plasmid
pKDsg-ack non-digested, lane 2 is plasmid pKDsg-p15 digested with HindIII, lane 3 is plasmid pKDsg-
p15 non-digested, lane 4 is pKDsg-ack digested with HindIII, lane 5 is plasmid pCas9cr4 non-digested
and lane 6 is plasmid pCas9cr4 digested with BamHI. ______________________________________ 53 Figure 22. Agarose gel obtained from the PCR using to generate the KanR cassette for recA gene
knockout. In lane (1) PCR product and in lane (M) molecular weight marker NZYDNA Ladder III. __ 55 Figure 23. Agarose gel electrophoresis showing the result of colony PCR of strain MG1655 ΔendA::kan.
In the first lane (M) is molecular weight marker NZYDNA I from NZYTech. The lanes 1-6 correspond to
different six colonies analyzed. Lane 7 corresponds to a negative control performed without DNA. ___ 55 Figure 24. Agarose gel obtained from final colony PCR used to verify the knockout mutants and the
removal of the KanR cassette. In the first lane (M) is molecular weight marker NZYDNA Ladder III. In
the following lanes (1- 4) are the different colonies analized. The last lane correspond to the negative
control. ___________________________________________________________________________ 56 Figure 25. Agarose gel analysis of colony PCR to confirm the endA and pgi genes knockouts using check
primers. In the first lane (M) is molecular weight marker NZYDNA Ladder III. Lanes 1 and 2
corresponding to colonies analyzed with primers to check pgi gene knockout. Lane 3 is the positive
control. Lane 4 is the negative control using primers check for pgi gene knockout. Lanes 5 and 6
corresponding to colonies analyzed with primers to check endA gene knockout. Lane 7 is the positive
control. Lane 8 is the negative control using primers check for endA gene knockout. ______________ 57 Figure 26. Agarose gel with the amplified fragments from colony PCR to confirm the insertion of KanR
cassette. In first lane (M) is the molecular weight molecular NZYDNA ladder III and in following lanes
are the PCR products. The lanes 1-6 correspond to the colonies chosen from LB+ kan plate. In the lanes 7
and 8 are the positive control and the negative control, respectively. ___________________________ 58 Figure 27. Agarose gel analysis of colony PCR to confirm the recA gene disruption. The lanes 1 -6 are
the PCR products amplified using check primers for recA gene. The lane 7 correspond to the negative
control of the reaction. The last lane (M) is molecular weight marker NZYDNA ladder III. _________ 59
Figure 28. Agarose gel analysis of colony PCR to confirm the insertion of KanR cassette in MG1655
∆endA + pKD46 cells and to test the presence of rac. _______________________________________ 60 Figure 29. Agarose gel analysis of colony PCR to assess the cure of the plasmids and consequently
deletion of pgi gene in MG1655 ∆endAΔpgi cells and to test the presence of rac. _________________ 61 Figure 30. Agarose gel analyses of PCR reaction in order to test the presence of the rac sequence using
primers for fnr and ralR genes. In the first lane (M) is molecular weight marker ladder III. The lanes 1
and 2 are the amplified products with primers for the fnr gene. The lane 3 is the negative control prepared
with water and primers for fnr gene. The lanes 4 and 5 are the amplified products using primers for the
ralR gene. The lane 6 is the negative control prepared with water and primers for ralR gene. ________ 62 Figure 31. Agarose gel analyses of PCR reaction in order to test the presence of the rac sequence using
primers for fnr and ralR genes. _________________________________________________________ 62 Figure 32. Agarose gel analyses of PCR reaction in order to test the presence of the rac sequence, using
primers for fnr and ralR genes, and to assess the cure of the plasmids and consequently deletion of recA
gene. _____________________________________________________________________________ 63 Figure 33. Agarose gel analyses of PCR reaction in order to test the presence of the rac sequence, using
primers for ralR (A) and fnr (B) genes. __________________________________________________ 64 Figure 34. Agarose gel analyses: (A) result of PCR reaction to generate, separately, two fragments that
constitute the pKDsg-zwf plasmid. In the first lane (M) is molecular weight marker ladder III. The lanes 1
and 2 are the amplified products. (B) After CPEC reaction, the pKDsg-zwf was transformed into DH5α
cells, purified and quantified. 1,000 ng of purified plasmid was analized in 1% agarose gel. In the first
lane (M) is molecular weight marker ladder III. The lane 1 is the amplified product corresponding to the
pKDsg-zwf plasmid. _________________________________________________________________ 65 Figure 35. Effect of endA, recA and pgi genes knockout on biomass production and variation of medium
pH, following three strategies of shake flask cultivations (C1, C2 and C3). (A) Biomass produced in
GALG20 and GALGNEW strains following strategy C1. Optical density was measured at 0 h, 4 h, 8 h,
10 h and 24 h of growth. Plots depict mean values ± standard error of mean (SEM) of the four
independent experiments. (B) Variation of medium pH during growth of GALG20 and GALGNEW
strains following strategy C1. pH was measured at 0 h, 4 h, 8 h, 10 h and 24 h of growth. Plots depict
mean values ± standard error of mean (SEM) of the four independent experiments. (C) Biomass produced
13
in GALG20 and GALGNEW strains following strategy C2. Optical density was measured at 24 h of
growth, during six days. (D) Variation of medium pH during growth of GALG20 and GALGNEW strains
following strategy C2. pH was measured at 24 h of growth. Plots depict mean values ± standard error of
mean (SEM) of the six independent experiments. (E) Biomass produced in GALG20, GALGNEW and
MG1655 strains following strategy C3. Optical density was measured at 0 h, 4 h, 8 h, 10 h, 17 h and 24 h
of growth. Plots depict mean values ± standard error of mean (SEM) of the one independent experiment.
(F) Variation of medium pH during growth of GALG20, GALGNEW and MG1655 strains following
strategy C3. pH was measured at 24 h of growth. Plots depict mean values ± standard error of mean
(SEM) of the one independent experiment. _______________________________________________ 67 Figure 36. Results of the quantification of glucose consumption throughout the growth versus biomass
(OD600 nm) for GALG20 and GALGNEW. The presented results derived from average values of 4 days
of growth. Glucose concentration was measured in duplicates by HPLC. ________________________ 69 Figure 37. Quantification of plasmid DNA yield volumetric (g/L) using two pgi mutant strains: GALG20
and GALGNEW grown in glucose, following strategy C1. Strains were grown for 24 h in shake flasks (37
°C, 250 rpm) with rich medium supplemented with 20 g/L of glucose. Plots depict mean values ±
standard error of mean (SEM) of the four independent experiments. ___________________________ 69 Figure 38. Quantification of plasmid DNA yield volumetric (g/L) using two pgi mutant strains: GALG20
and GALGNEW, and wild-type strain: MG1655, grown in glucose, following strategy C3. Strains were
grown for 24 h in shake flasks (37 °C, 250 rpm) with rich medium supplemented with 20 g/L of glucose.
Plots depict mean values of the one independent experiment. _________________________________ 70 Figure 39. Agarose gel analyses of PCR reaction to screen for the genomic deletion in GALG20 strain.
The ninth lane (L) is molecular weight marker ladder III. Lanes 1 -8 are amplified DNA from fresh
colony of one subculture. Lanes 9 -16 are amplified DNA from fresh colony of twelve subcultures. Lanes
17- 24 are negative controls prepared without DNA. Lane 25 is a positive control prepared with primers
for recA gene. ______________________________________________________________________ 71 Figure 40. Output of genomic DNA sequencing of mutant strains. Analysis of genomic deletion
sequence. Top figure: Segment of genomic DNA of GALGNEW strain. Bottom figure: Segment of
genomic DNA of GALG20 strain. ______________________________________________________ 73
14
List of Tables
Table 1. New generation of vaccines: main characteristics. __________________________________ 22 Table 2. Overview of major factors affecting plasmid structural stability. Adapted from [39]. _______ 27 Table 3. Plasmid pVAX1-GFP: elements and their purposes. The schematic representation was created
with the SnapGene software. __________________________________________________________ 29 Table 4. Plasmid pVAX1-GFP and their main characteristics. ________________________________ 30 Table 5. Strains used in study and main characteristics. _____________________________________ 36
Table 6. Plasmids used in this work and main characteristics. ________________________________ 37 Table 7. Primer sequence and characteristics used to generate kan cassette (F and R) and to check
(check_F and check_R) for endA, pgi and recA genes knockouts.Lowercase letters represent the sequence
from the template plasmid pKD13 and uppercase letters correspond to the sequence from the genome of
wild-type strain. ____________________________________________________________________ 38 Table 8. Oligonucleotides sequences and characteristics used. ________________________________ 39 Table 9. PCR reaction and program used to generate KanR cassette in pgi, endA and recA genes
knockouts. _________________________________________________________________________ 39 Table 10. PCR reaction and respective program used in colony PCR. __________________________ 41 Table 11. Strains used in this study with method described by Reisch and Prather [55] . ___________ 42 Table 12. Plasmids used in this study and their main characteristics. ___________________________ 43 Table 13. Primer sequence and characteristics used to generate the pKDsg-zwf plasmid [69], to generate
homologous arms (E and F) and to check (G and H) for zwf gene knockout. Lowercase letters represent
the sequence from the template plasmid pKDsg-ack and uppercase letters correspond to the protospacer,
in the gene zwf, preceded for a PAM site. ________________________________________________ 43 Table 14. PCR reaction and program to generate the two fragments of pKDsg plasmid. ____________ 44 Table 15. PCR reaction and program to generate the pKDsg-zwf plasmid. ______________________ 45 Table 16. Restriction enzymes and their characteristics used in plasmids DNA digestions reactions. __ 47 Table 17. Composition of Restriction Enzyme Reaction Buffers [80]. _________________________ 48 Table 18. Synthesis of the differences between the various strategies of shake flask cultivation. _____ 49 Table 19. Oligonucleotides used to test the absence or presence of unintentional genomic deletion. Some
characteristics of these oligonucleotides are present. ________________________________________ 50 Table 20. PCR program and PCR reaction using to assess the absence of rac sequence in GALG20. __ 51 Table 21. Expected and obtained results for the PCR reaction to test the genomic deletion in GALG20
strain. _____________________________________________________________________________ 72
15
List of Abbreviations
Amp Ampicillin
bp Basepairs
Cm Chloramphenicol
CMV Cytomegalovirus
DNA Deoxyribonucleic acid
FTR FLP recognition target
gDNA Genomic DNA
GFP Green Fluorescent Protein
Kan Kanamycin
kb Kilo basepairs
KmR Kanamycin Resistance
LB Luria- Bertani
OC DNA Open Circular DNA
OD Optical Density
Ori Origin of replication
PCR Polymerase Chain Reactions
pDNA Plasmid DNA
Primer F Primer forward
Primer R Primer reverse
RCF / G Relative centrifugal force / acceleration relative
RNA Ribonucleic acid
SC pDNA Super Coiled DNA
sgRNA Single-guide RNA
Spec Spectinomycin
Tris Trizma® (TRIS base)
˚C Degree Celsius
16
Thesis motivation
The plasmid DNA production is becoming increasingly important as therapeutic approach make
their way into clinical trials and eventually into the pharmaceutical product. The numerous
clinical trials for plasmid DNA products have demonstrated the safety of the DNA vaccination
method and indicate the potential of this relatively new field of therapeutics. This powerful
bioproduct has become a viable option to treatment of cancer, as well as for the gene therapy and
even for bacterial and viral diseases. Thus, research community have focused on the development
integrate process between the upstream and downstream processing. However, the quality of final
product is ultimately determined by fermentation strategy.
For these reasons, the biomass yield, plasmid yield and plasmid quality improvement can be
reached through optimization of the growth environment and of the plasmid-producing organism.
Therefore, the objective of this work was quantify the yield of plasmid DNA by culture of
Escherichia coli K-12 with several deletions (∆pgi∆endA∆recA), named GALGNEW, comparing
with two other strains, wild-type and GALG20. These gene knockouts have a positive impact in
the yield of this bioproduct.
17
1. INTRODUCTION
1.1. Escherichia coli: The host strain
The genus Escherichia is one of the key genera of enteric bacteria included in a total of 346 genera
within the Gammaproteobacteria [3] (Figure 1). Enteric bacteria group involves Gram-negative,
non-spore forming rod, facultative aerobic, oxidase-negative, catalase-positive, denitrifying
bacteria, glucose-fermenting bacteria and motile by peritrichous flagella or non-motile [4].
Although, many species of the genus Escherichia are pathogenic to humans and animals, they are
of extreme industrial importance [4].
Escherichia coli (E. coli) is a commensal bacterium found in the digestive tract of warm-blood
animals and humans. E. coli strains constitute about 1% of the bacterial population of the gut [5].
E. coli consists of a diverse group of bacteria. Most E. coli strains are harmless, however, some
E. coli strains are pathogenic to humans being categorized into pathotypes [5]. Six pathovars are
Figure 1. Phylogenetic tree based on glucose-6-phosphate isomerase encoded by pgi gene. The selected sequences were aligned by Muscle Alignment Software. The topology was inferred using the Neighbor-Joining method and the
evolutionary distances were computed using the Poisson correction method implemented in the software MEGA 7.0.18.
The orange square ( ) in center represent the root of the circular tree, the red circular forms ( ), the green squares ( )
and the yellow triangle ( ) represent 3 of 15 orders of class Gammaproteobacteria: Enterobacteriales, Vibrionales and Pseudomonadales, respectively.
18
associated with enteric/ diarrhoeal disease, urinary tract infections (UTIs) and pulmonary system
infections (meningitis). These pathovars are: enteropathogenic E. coli (EPEC),
enterohaemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli
(EAEC), enteroinvasive E. coli (EIEC) and diffusely adherent E. coli (DAEC) [6].
Nevertheless, E. coli has an extreme medical and biotechnological importance. Around fifty
approved recombinant therapeutic proteins are produced in this model organism, for example:
insulin for diabetes treatment, monoclonal antibodies (mAbs), growth hormone to humans and
farm animals, interferons against viral diseases, erythropoietin used in patients with severe anemia
and deoxyribonuclease I (DNase I) commonly used in hereditary disease cystic fibrosis (CF).
Products of recombinant DNA technology from E. coli are very useful in production of vaccines
[7], [8].
E. coli K-12 was one of the first organisms suggested for whole genome sequencing after having
been isolated from diphtheria patient, in 1922 [9], [10]. Since that a lot of mutant strains have
been created such as MG1655 and W3110, closely related E. coli K-12 “wild types” [11], DH1,
DH5, DH5α, DH5α ∆fruR, DH10B, JM101 ∆pykF ∆pykA and JM108 strains, typically used for
pDNA production [12], [13].
The creation of these strains and relationship between them are illustrated in Figure 2.
19
DH5α strain was constructed by sequential introduction of the ∆(lacZYAargF)U169 deletion from strain SH210 and Φ80dlacZ∆M15 from strain TB1.
Several advantages are known for the use of this bacterium in plasmid DNA (pDNA) production, such as, their ability to grow quickly under minimal
growth conditions, high pDNA yields, complete genome sequenced and easy manipulation at laboratory and industrial scales [13].
E. coli K-12 MG1655 and E. coli DH5α strains were used in this work as the hosts strains for the construction of the GALGNEW strain using the Datensko
and Wanner protocol, and for the construction of the deletion mutant (∆zwf) by CRIPSR Cas9 System method, respectively. The MG1655 strain also was
used for comparison purposes (plasmid DNA production and growth kinetics) with two mutant strains: GALG20 and GALGNEW.
“Cavalli Hfr λ-” Hfr
λ- relA1 spoT1 metB1
cre-510 PO2A
X
“W208 λ-” F
-
thr-1 leuB6 lacZ4 supE44
rfbD1 thi-1
Figure 2. E. coli K-12 and derivatives: creation of new strains and relationship between different strains. Lineage of MG1655 and W3110, close relatives of wild-type E.coli K-12 (green
box). Generation of strains containing multiple mutations from MC1061, DH1 and JM101. Dark boxes represent commonly used E. coli strains for plasmid DNA production and recent developments in E. coli strains designed for high yield pDNA processes. Full line arrows represent the relationship between the strains and dashed line arrows represent mutations carried
from one strain to the other. Schematic representation adapted from [11]–[13].
20
1.2. Plasmid DNA and Therapeutic Applications
A plasmid is a small, circular and double-stranded DNA molecule that is separate from a cell’s
chromosomal DNA. This extrachromosomal DNA, occurs naturally in archaea, bacteria, yeast
and some higher eukaryotic cells. Another property of this fragment of DNA is the ability to self-
replicate [14], [15]. This ability is due to the presence of at least one origin of replication (ORI).
The plasmid requires some elements that allow the propagation of the plasmid within host, such
as: origin of replication and an antibiotic resistance gene or a selectable marker [16] .
Plasmids have taken on a crucial role in the biotechnology and pharmaceutical domains being
implemented for DNA manipulation, gene expression and heterologous proteins production.
Heterologous proteins should substitute proteins or provide a lost function in patient due to
defective or absent activity [14]. More recently, an alternative to treat diseases is the
administration of the gene of interest to the patient. The plasmids are used as vectors in the
immune system, carrying of antigen to elicit immune responses in higher order animals [14], [17].
This strategy is designated as gene therapy or genetic medicine. In the early 1990s the transfer of
genes to humans was reported and since then allowed as a new approach for vaccination. Plasmid
DNA (pDNA) is the base for promising DNA vaccines and gene therapies against many
infections, acquired, and genetic diseases, including HIV-AIDS, Ebola, Malaria, Dengue, and
different types of cancer (the highest percentage – 64.5%), enteric pathogens, and seasonal
influenza viruses [18] (Figure 3). In clinical, a particular application of DNA vaccines is the
generation of the therapeutic vaccines for tumor control, which are induced by human papilloma
virus. These improvements lead to increase safety without compromising efficacy [19].
In veterinary domain, some products are licensed for application [13]. This includes two
infectious disease vaccines for West Nile virus in horses, infectious haematopoietic necrosis virus
in salmon, a melanoma cancer vaccine for dogs and a growth hormone releasing factor therapy
for pigs [20].
Figure 3. Indications addressed by gene therapy clinical trials. Data updated in August 2016 [21].
21
Last year, over 2400 clinical trials have been completed, are ongoing or have been approved
worldwide. More than 65% of the trials have been performed in America and almost 24% in
Europe, as represent in Figure 4 [21].
1.2.1. Types of Vaccines: Evolution and characteristics
In literature, the opinions about the types of vaccines organized in groups are variable. Some
authors regard as first generation vaccines for humans were developed against diseases with
high mortality rate, for example: smallpox, cholera, typhoid fever, plague, yellow fever, polio and
rubella, consisting mostly of killed/ inactivated or live/ attenuated microorganisms, very reactive
and in some cases, inefficient [19], [22], [23] (Figure 5). During the 20th century, with technology
advances, more new types of vaccines were developed leading to the second generation vaccines
including toxoid vaccines, polysaccharides vaccines and purified proteins vaccines [19]. The
subunit vaccines are considered as an extension of the toxoid approach and the third and newest
generation of vaccines, together DNA vaccines and recombinant vector vaccine [19], [23].
Other authors consider the subunit vaccines as the first approach of vaccines, together killed/
inactivated and live/ attenuated vaccines and the new generation of vaccines include DNA
vaccines to induce a more effective cellular and humoral responses [24]–[26].
Figure 4. Geographical distribution of gene therapy clinical trials by continent. Data updated in August 2016 [21].
22
The main characteristics of the new generation of vaccines are presented in Table 1.
Table 1. New generation of vaccines: main characteristics.
Type of
vaccines Strategy Advantages Disadvantages Vaccines
Sub-unit
Production of recombinant
proteins in
heterologous
systems
Low adverse reactions;
Not infectious (safely
for immuno-
suppressed animals)
Antibodies may not recognize the antigens
(native structure);
Stimulation of
immune system inefficient
Influenza
Hepatitis B
HPV
Acellular
pertussis
DNA
recombi-
nant
Genetic
manipulation for insertion
of genes
encoding
antigens
Closely mimics a natural infection;
Resulting in a greater
immune response
Small chance that the
DNA vector could be integrated into the
host cells;
Still in experimental
stages
Rabies
Measles
HIV
Dengue fever*
BCG*
Typhoid
fever*
Adenovirus
*
DNA
vaccines
Immunization
with recombinant
plasmids
Do not contain any form of pathogen;
No risk of infection;
More stable;
More affordable costs;
Produces humoral and
cellular immune response
Production antibodies
against DNA
(hypothesis);
Chance of inducing
mutation; Plasmids may be
integrated into the cell
and can lead to
transfer of resistance gene
Toxoplasmosis
Leishmaniosis
Anaplasmosis
Malaria
Herpes
HIV
Influenza
Melanoma
vaccine**
Figure 5. The various vaccine technologies developed over time.
IPV – Inactivated Polio Vaccine; OPV – Oral Polio Vaccine; HPV – Human Papillomavirus [22].
* Vaccines not yet available for use in humans; ** Vaccine for use in dogs [19], [27]–[29] .
23
Compared to conventional vaccines, DNA vaccines have many advantages such as high stability,
not being infectious, focusing the immune response to only those antigens desired for
immunization and long-term persistence of the vaccine protection.
DNA vaccines are constructed by one gene or by a combination of different genes encoding
different antigens [18]. Conventional vaccines are based on whole pathogens and typically induce
immune responses against a several components of the organism.
1.2.2. Design of Plasmids for Gene Therapy and Vaccination
Gene therapy and DNA vaccination involve the injection of vector in vivo, which contain the gene
of interest to the patient, to elicit an immune response to a protein encoded on the plasmid [14],
[19], [25], [26]. Viral vectors are considered as the most effective of all gene delivery methods
for in vivo gene transfer. There are several vectors available to introduce the gene of interest into
human cells, as shown in Figure 6.
Commonly used viral vectors for brain cancer gene therapy includes retrovirus (18.2%), herpes
simplex virus (3.6%), adenovirus (21.4%) and adeno-associated virus (7.0%). Apart from these,
the most used is pDNA (21.8%). Over 17% of the trials for human gene therapy have been based
on naked pDNA, whereas lipofection (which also requires pDNA production) counts for 4.6% of
the trials [21].
The biotechnological production of pDNA is performed into two parts: upstream and
downstream. Upstream (stage 1) is a stage processing during which pDNA is produced by
transformed cells and the downstream (stages 2, 3 and 4) is the isolation and purification of the
bioproduct, as represented in Figure 7.
Figure 6. Vectors used in Gene Therapy clinical trials. Data updated in August 2016 [21].
24
The first stage in planning an efficient process of DNA vaccination (and also in gene therapy)
should be the identification of the target gene, the vector design [30], the cloning of target gene
into a vector (pDNA) and its transformation into a bacterial cell, typically E. coli [20].
The plasmid used as vector contains some elements that allow its propagation in the bacterial host
(plasmid propagation unit) and expression of the vaccine gene in the eukaryotic cells of the
recipient organism (eukaryotic expression unit. The organization of these elements reflects the
plasmid’s functionality [16]. The unit responsible for plasmid propagation (prokaryotic
expression) contains a replication region and a selection marker as an antibiotic resistance gene,
and the unit responsible for vaccine synthesis (eukaryotic expression) that comprises a target
gene encoding an antigen (transgene), a promoter, a terminator and sometimes sequences like
introns, signal sequences and immune stimulatory sequences (ISS) [16], [18] (Figure 8).
Figure 7. The main stages for pDNA vaccine design, production and vaccination. Adapted from [14], [20], [34].
Stage 4
Eukaryotic Expression
Immunogenicity
Stage 3
Delivery
Stage 2
Purification
Formulation
Stability
Stage 1
Vector Design
Bacterial Transformation
Bacterial Cultivation
25
The replication region allows the maintenance and propagation of the plasmid (multiple copies)
in host cells [16]. For this purpose, the most commonly used plasmids are derived from the
pBR322 or pUC plasmids [31], being used origins of replication that provide large number of
copies of DNA plasmids in bacteria, such as the E. coli’s ColE1 origin of replication [14], [31].
The ColE1 origin of replication produces a relatively low copy number (20-40 copies per cell),
so some modifications were made, using pUC vector with ColE1 as origin of replication
increasing the copy number to 500 per cell [14]. Selectable markers such as, antibiotic resistance
genes, ensure a stable inheritance of plasmids during bacterial growth, also being a powerful
selector important in cloning steps [31].
The eukaryotic expression unit consists of the elements necessary for high-level expression and
targeting of the therapeutic component. Promoters are essential in plasmids to drive high
expression of the target gene in mammalian cells. Viral-derived promoters, such as the
cytomegalovirus (CMV), the simian virus 40 (SV40) and the Rous sarcoma virus (RSV) are the
most widely used promoters [31]. These plasmids also contain a terminator, a polyadenylation
signal sequence, coupled to termination and processing of the therapeutic gene [14]. The introns
are introduced to augment the promoter activity because demonstrate a beneficial effect on the in
vivo expression of the transgene. Intron A from CMV is widely used. A signal sequence is a
sequence that codes for a signal peptide with approximately 20-40 amino acids. This signal
peptide is responsible for secretion of the synthesized peptide to the extra-cellular milieu, and is
located upstream of the vaccine gene. The function of the ISS is increase the potency of a DNA
vaccine. These are nucleotide hexamers that interact with toll-like receptors and add adjuvanticity
[30]. The ability of the host to recognize bacterial DNA depends of unmethylated cytosine–
guanine(CpG) dinucleotides in particular sequences, called CpG motifs [32]. These dinucleotides
are covalently linked CG dinucleotides. The frequency of these motifs is extensively suppressed
in vertebrates, including mammals. The bacterial immunostimulatory DNA sequences (ISS) and
CpG motifs are synonyms, in which are defined functionally and structurally, respectively [33].
Figure 8. Genetic elements of a pDNA vector. The plasmid consists of a Plasmid Propagation Unit (PPU) that operate
in the microbial host and a Eukaryotic Expression Unit (EEU) that drives the protein synthesis in the eukaryotic cells [30].
26
In the second stage of the process, the plasmid DNA is typically extracted using alkaline lysis,
purified to remove impurities such as protein, RNA, chromosomal DNA, and endotoxins to
acceptable levels and formulated for delivery. Of these impurities, chromosomal DNA is the most
difficult to remove due to similar properties to the plasmid product [34]. At formulation step, the
purified antigen is combined with adjuvants, stabilizers and preservatives to form the final vaccine
preparation. Adjuvants are common to most licensed vaccines. The role of the adjuvants is to
enhance the immune responses elicited by vaccination. Examples of adjuvants tested for plasmid
DNA vaccines are: poly-lactide coglycolide (PLG), poloxamers and Vaxfectin® [18]. The
stabilizers increase the storage life, and preservatives allow the use of multi dose vials and prevent
fungal and/or bacterial contaminations [35].
In the third step, plasmid is delivery to a eukaryotic cells and in finally step, the gene of interest
is expressed [20]. Relative to the quantity of plasmid DNA required, it will differ between
therapies, and each disease is likely to have specific needs. Generally, for DNA vaccination the
dose will range from micrograms to milligrams [36] . For instance, therapeutic doses required for
cardiovascular diseases are often 1 mg to 10 mg of pDNA. Regarding oncology genes, dosages
range from 10 μg to 10 mg of pDNA. In the case of Hepatitis B infections, HIV infections, malaria
and tuberculosis therapeutic doses range from 10 μg to 100 μg of pDNA [37]. DNA vaccines
consist of a plasmid DNA back-bone containing a target gene (an antigen-encoding gene) and a
strong mammalian promoter, which controls its expression, as shown in Figure 8. When injected
intramuscularly or intradermally, the antigen is transcribed, translated and presented to the
immune system [38]. The response of immune system is initiated and expanded by antigen
presentation. The antigen is taken up by antigen-presenting cells (macrophages and dendritic
cells). The role of these cells in the immune response is to present the peptide fragments of the
antigen on their surface in the context of major histocompatibility complex (MHC) class II
molecules, forming a peptide-class II complex. These complexes are transported to the surface
and are recognized by specific CD4+ T cells [32].
The structural characteristics of plasmids are important from a therapeutic point of view, since
stability and efficacy depend in part of the topology of the plasmid [14].
1.2.3. Plasmid Structural Stability
One of the major problems encountered during the design of a DNA vaccine is assurance of its
structural integrity [39]. The pDNA required for a therapeutic product should be homogeneous
relatively to structural form and DNA sequence. Some sequences can be harmful to the production
of high-quality supercoiled plasmid. Hence, some elements should be avoided as purine-
pyrimidine/oligopurine-oligopyrimidine tracts, Chi sequences, G-rich sequences, direct repeats,
inverted repeats, poly-A sequence, nuclease sensitive regions, regions similar to genomic DNA,
and insertion sequences [39]. The main consequences of these determinants are summarized in
Table 2.
27
1.2.3.1 Plasmid Size
Plasmid size is a critical criterion in vector
design, because tends to correlate with a
higher propensity for intramolecular
recombination and/or genome integration
events [39]. The plasmids should be as small
as possible, containing only the essentials
elements for the therapeutic applications
[30]. The pDNA vectors for therapeutic
applications with reduced size have as
additional advantage the capacity of result in
higher amounts of pDNA produced by
bacterial cultivation. Another advantage of
the shorter plasmids is the increased of the
transfection efficiency making easier the
purification, especially at large scale [14].
Regarding on diffusion of DNA in the
cytoplasm of cells is strongly size
dependent, with little or no diffusion for
DNA upper 2,000 base pairs (bp).
Minicircles are an example of the successful
transformation, comparing with longer conventional plasmids (Figure 9). Minicircles are double-
stranded, supercoiled expression cassettes devoid of the bacterial pDNA backbone. The
transfection of cells by a minicircle 2.9 kb in size is 77 times more efficient than a plasmid 52.5
kb in length [40]. Therefore, the minicircles are also a promising tool regarding safety [40].
Figure 9. Ranking of alternative plasmid selection approaches according to plasmid size and transformation efficiency.
Adapted from [40].
Table 2. Overview of major factors affecting plasmid structural stability. Adapted from [39].
28
1.2.3.2 DNA structure
Dynamic structure of DNA is also important characteristic since plasmids can assume several
conformations apart from the most common negatively supercoiled B-form [39]. Several non-
Watson- Crick DNA structures have been discovered such as, C-DNA, D-DNA, P-DNA and T-
DNA. However, the most prevalent of these is the Z-form. Examples of other unusual structures
are intrinsic bends, triplexes and quadriplexis [41]. These conformations usually derived from the
presence of repeated DNA motifs such as direct repeats, inverted repeats, purine-pyrimidine and
G-rich sequences (Table 2), which are prone to genetic rearrangements (deletions, duplications,
inversions, translocations and insertions) [39].
In order to determine the implications such unusual structural features have on plasmid
production, Cooke and co-workers evaluated the influence of specific non- Watson-Crick DNA
structures on the stability, yield and topology of the general cloning pBluescript vector [39], [41].
The authors found that plasmid containing Z-DNA forming regions is more unstable comparing
with other structures (triplexes, bends and quadruplexes). Furthermore, the triplexes structure
led to decreased amounts of supercoiled plasmid by 5% in the 3.8 kb plasmid [41].
Relative to the plasmid topology, it is knowing that plasmid DNAs that constitute DNA vaccines
are produced in bacteria as supercoiled (SC) or covalently close circular (CCC) plasmid DNA.
Single strand nicking results in the relaxation of supercoiled DNA into another isoform, named
open circular DNA (OC). Immunization studies done by Pillai et al. [42], reveal SC and OC
DNAs having different biological activities for in vivo immunizations, being the amount of SC
plasmid DNA in a vaccine preparation the best predictor, presented 3-times higher ability than
the OC DNA.
1.2.4. Stability in Replication Process
A plasmid is defined as a DNA molecule capable of autonomous replication. Many natural
plasmids are stably maintained at their characteristic copy number within the growing bacterial
population, controlling their concentration and regulating the rate of replication [43]. Some
elements can be considered within plasmid: (a) origin(s) of replication (ori), which is
characteristic of each replicon, (b) many plasmids encode a protein involved in the initiation of
replication, named Rep protein and (c) the genes involved in the control of replication [44]. The
plasmid copy number may vary depending on the host strain and on the growth conditions, but
any particular plasmid has a characteristic copy number. Replication by the Theta mechanism
has been most extensively studied among the prototype circular plasmids of gram-negative
bacteria. This mechanism involves melting of the parental strands, synthesis of a primer RNA
(pRNA), and initiation of DNA synthesis by covalent extension of the pRNA [44].
29
1.2.5. Advantages of DNA vaccines
Whereas traditional vaccines rely on the production of antibodies through the injection of live
attenuated virus, killed viral particles or recombinant viral proteins, DNA vaccine plasmids are
non-live, non-replicating and nonspreading, there is little risk of either reversion to a disease-
causing form or secondary infection. Thus, DNA vaccination present many advantages in terms
of safety (not being infectious does not have capacity to revert to virulent forms, does not require
use of toxic treatments and no significant adverse events in any clinical trial), simple construction
and rapid production (synthetic and PCR methods allow simple engineering design modifications,
optimization of the plasmid depending of the target gene and rapid formulation, reproducible,
large-scale production), high stability (long shelf life and more temperature-stable),
immunogenicity (induction of T and B cell-specific antigen) and mobility (ease of storage and
transport) [14], [31], [45]. A significant advantage, mainly for emerging pathogens is that this
new generation of vaccines do not require the handling of potentially deadly infectious agents
[18].
1.2.6. pVAX1-GFP plasmid
pVAX1-GFP is a 3.7 kb plasmid vector designed for use in the development of DNA vaccines.
pVAX1 contains no eukaryotic or bacterial region optimizations, and consequently has relatively
low manufacturing yield and expression in vitro [34]. The elements that compose this vector, their
purposes and schematic representation of pVAX1-GFP plasmid are illustrated in Table 3 [46].
Table 3. Plasmid pVAX1-GFP: elements and their purposes. The schematic representation was created with the
SnapGene software.
Elements Purpose
Human
cytomegalovirus
immediate-early
(CMV) promoter
High-level expression in a wide range of
mammalian cells
Bovine growth
hormone
Polyadenylation signal for efficient
transcription termination and
polyadenylation of mRNA
Kanamycin
resistance gene Selection in E. coli (host strain)
pUC origin High-copy number replication and growth
in E. coli
Green Fluorescent
Protein (GFP)
The expression could be observed by
fluorescence microscopy or by flow
cytometry
Plasmid pVAX1GFP derived from pVAX1LacZ (Invitrogen, Carlsbad, CA). The plasmid
pVAX1GFP and their main features are in Table 4.
30
Table 4. Plasmid pVAX1-GFP and their main characteristics.
1.3. Effect of plasmid DNA synthesis on E. coli central carbon metabolism
Plasmid DNA synthesis can perturb the E. coli global gene regulation, leading to significant
changes in central metabolic pathways and altering levels of gene expression, in the host. Many
researchers observed that plasmid maintenance retards host growth rate and biomass yield,
comparing with plasmid-free cells. For plasmid replication and expression of the antibiotic
resistance gene, the required nutrients and energy levels imposes a higher metabolic burden on
the host cells [13], [47]. In E. coli, the central metabolic pathways provide some important
elements, like precursors (nucleotide precursors), cofactors and energy, for the biosynthesis and
other metabolic processes [28]. Therefore, the central carbon metabolism is a target for genetic
engineering
strategies to
increase pDNA
yields [13].
The main
central
metabolic
pathways of E.
coli are
glycolysis, the
tricarboxylic
acid (TCA)
cycle and the
pentose
phosphate (PP)
(Figure 10).
Glycolysis is
the main
catabolic
pathway of
carbohydrates,
using glucose
for the
provision of
energy and building precursors. The final product of this pathway is pyruvate having as
intermediate product fructose diphosphate. Glycolysis is composed of ten reactions catalyzed by
Plasmid Size
(bp)
Antibiotic resistance
genes
Origin of
replication Purpose
pVAX1GFP 3697 Kanamycin pUC ori Bacterial
cultivations
Figure 10. The Central Carbohydrate Metabolic Network [85].
31
specific enzymes that are coded by individual genes, which are downregulated, in plasmid-
bearing-cells, excepted gapA gene. The most important control of the glycolysis resides in only
two irreversible steps, catalyzed by phosphofructokinase and pyruvate kinase, coded by pfk and
pyk genes.
The pentose phosphate pathway (PPP) is the second major route for carbohydrate and performs
several functions such as: (1) catabolism of carbon sources including sugars like xylose and
ribose, (2) synthesis of reducing power (NADPH) and (3) biosynthesis of the nucleotide
precursors, nucleic acids, amino acids, vitamins and lipopolysaccharides [47]. Are examples of
nucleotide precursors: ribose-5-phosphate (R5P) and erythrose-4-phosphate (E4P) [13]. The
reducing power and nucleotides are essential for biomass and pDNA production and they are
directly related in this pathway. Plasmid-bearing cells carrying high copy number, require a level
of nucleotides higher and in this case the PP pathway may be insufficient considering the cell’s
metabolic needs [48].
The other pathway with important roles in metabolism of E. coli is tricarboxylic acid (TCA)
cycle, being essential for the complete oxidization of acetyl coenzyme A (CoA) from glycolysis,
occurring in eight reactions. Some intermediates of this cycle play an important role in amino
acids synthesis such as, oxaloacetate (OAA) and alpha-ketoglutarate (AKG). In plasmid-bearing
cells, most of the TCA cycle participants’ genes are up-regulated for different E. coli strains, such
as fumA, aceB, sucBCD and sdhCD genes. This up-regulation could indicate a greater
accumulation of carbon in the cycle due to the reduced growth rate [13], [47].
1.4. Relevant genes for E. coli strain engineering aiming to increase
pDNA production
Phosphoglucose isomerase (Pgi) is an enzyme coded by pgi gene and catalyzes the conversion of
glucose-6-phosphate into fructose-6-phosphate, being a reserve reaction of glycolysis (box with
dash blue line in Figure 10). The knockout of the pgi gene leads to the redirection of the carbon
flux into the PP pathway, increasing the synthesis of nucleotides (R5P and E4P) required for the
pDNA synthesis. Also provide high amounts of reducing power (NADPH) [49].
Other relevant gene is endA that encodes for DNA-specific endonuclease I. Endonuclease I is a
periplasmic enzyme that cleaves within duplex DNA [50]. A knockout of this gene leads to a
decrease non-specific digestion of plasmid, improving the quality of plasmid preparations [13].
In E. coli K-12 strain, the recA gene codes for a polypeptide essential for the recBCD pathway of
homologous recombination, more specifically, DNA strand exchange and recombination protein
with protease and nuclease activity [13]. The RecA protein performs many functions: (1)
catalyzes homologous pairing and strand exchange of DNA molecules necessary for DNA
recombination repair, (2) ATP and DNA-dependent co-proteolytic processing of effector proteins
and (3) interaction with mutagenic protein factors to facilitate error-prone DNA synthesis past
DNA lesions. Mutations in recA affect not only recombination, but also DNA repair, mutagenesis,
and cell division [51], having been observed to have a positive impact on pDNA yield [13].
32
However, the effect of some mutations, such as ΔendA and ΔrecA, are very strain and/or plasmid
dependent [52].
Another mutant was constructed by disruption of zwf gene, which encodes glucose-6-phosphate
dehydrogenase (G6PDH) [53], following the CRISPR Cas9 system. G6PDH catalyzes the first
reaction of the PP pathway (represented into box with dash red line in Figure 10). This knockout
led to restructuring of the carbon flux through central metabolism in E. coli, allowing alternative
routes. Previous studies concluded that the distribution of carbon fluxes in the zwf mutants
showed that the anabolic requirements for nucleotide R5P and E4P were satisfied by the reverse
activity of the non-oxidative branch of the PP pathway, in which, ribulose-5-phosphate is
converted into fructose-6-phosphate and glyceraldehyde-3-phosphate. The consequence of this
restructuring of metabolic fluxes is a virtually unchanged rate of NADPH synthesis as compared
with wild-type [54]. More specifically, the zwf mutant directed 98.9% and 87.0% of the total
carbon flux through the first step of glycolysis (from G6P to F6P) and TCA cycle [from acetyl-
coenzyme A (AcA) to citrate (CIT)], respectively, whereas the parent strain showed an obviously
lower flux through the first step of the glycolysis (78.6%) and TCA cycle (73.1%) [53].
33
2. MATERIALS AND METHODS
In this study two strategies were used for genome editing in E. coli: λ-Red-mediated gene
replacement technique described by Datsenko and Wanner [1] and the CRISCP Cas9-System
described by Reisch and Prather [55].
2.1. Media, Chemicals and Other Reagents
For cell cultures, LB (Luria-Bertani) broth (25 g/ L) from NZYTech was used. When required the
culture medium was supplemented with ampicillin [(100 µg/ mL) (Sigma-Aldrich®)], kanamycin
[(30 µg/ mL) (aMRESCO®)], chloramphenicol [(50 µg/ mL) (Sigma-Aldrich®)] or
spectinomycin [(50 µg/ mL) (Fluka® Analytical). The solid media were prepared using LB agar
(40 g/ L) from NZYTech.
To increase plasmid production a complex medium was used in shake flask cultivation. This
medium is composed by basal cultivation medium [Peptone (Fluka® Analytical) (10 g/ L), yeast
extract (10 g/ L) (Liofilchem®), (NH4)2SO4 (3 g/ L) (PanReac), K2HPO4 (3.5 g/ L) (PanReac),
KH2PO4 (3.5 g/ L) (PanReac), pH 7.1], trace elements solution [FeCl3∙6H2O (27 g/ L) (Sigma
Aldrich, ZnCl2 (2 g/ L) (Sigma-Aldrich), CoCl3∙6H2O (2 g/ L) (Sigma-Aldrich), Na2MoO4∙2H2O
(2 g/ L) (Fluka Analytical), CaCl2∙2H2O (1 g/ L) (Merck), CuCl2∙2H2O (1.3 g/ L) (Sigma-Aldrich),
N3BO3 (0.5 g/ L) (Fisher Scientific), HCl 1.2 M (Riedel-deHaën)], glucose solution [(20 g/ L)
(Fisher Scientific)] and seed supplement solution [MgSO4∙7H2O (240 g/ L) (Merck), thiamine (24
g/ L) (Sigma-Aldrich)] [56]. The trace elements solution and seed supplement solution were filter-
sterilized while basal cultivation medium was autoclaved in the shake flask. Glucose solution was
autoclaved. After sterilization, the remaining solutions were added to 250 mL shake flasks in the
following quantities per flask: 50 mL (basal cultivation medium), 50 µL (trace elements solution),
2 mL (glucose) and 415 µL (seed supplement solution). This complex medium was supplemented
with 50 µL kanamycin (30 µg /mL).
For polymerase chain reactions (PCR) three DNA polymerase kits were used: NovaTaq™ Hot
Start Master Mix Kit (Novagen®), KOD Hot Start DNA Polymerase (Novagen®) and Platinum®
PCR SuperMix High Fidelity (Invitrogen®). The termocyclers used were ThermoHybaid Px2 or
TGradient from Biometra.
All agarose gel electrophoreses, were performed with agarose (Low-EEO/Multi-Purpose) from
Fisher Scientific, in a concentration of 1% (w/ v).
The molecular weight marker used were NZYDNA ladder I (Size Range: 0.2 – 1.8 kb) NZYDNA
ladder III (Size Range: 0.2 – 10 kb) from NZYTech and HyperLadder™ 50 bp (Size Range: 0.05
– 2.0 kb) from Bioline.
To induce the recombinase expression, L-arabinose 20% w/ v was prepared (Merck) [1].
Chemical competent cells were prepared using the Transformation and Storage Solution (TSS)
buffer [MgCl2∙6H2O (1.670 g/ L) (Fagron), Poly(ethylene glycol) with average mol wt 8,000
(Sigma- Aldrich), LB broth (25 g/ L) (NZYTech)], pH 6.5, adjusted with HCl 1 M v/ v (Riedel-
deHaën) . This solution was filter-sterilized (0.22 µm). Dimethyl sulfoxide (DMSO) (Sigma-
Aldrich) was added to TSS in proportion 1:10 final volume.
Plasmid DNAs were digested using appropriate restriction enzymes with the respective buffers
from Promega.
34
Glycerol 99%, ACROS Organics-Fisher Scientific was used to preserve the frozen cell banks at -
80 ˚C in a final concentration of 20%.
2.2. Preparation of Competent cells
2.2.1. Electrocompetent cells
Before the introduction of the KanR cassette in host cells, electrocompetent cells were prepared.
Shake flasks with autoclaved LB (50 mL) were inoculated with 30 µL from a frozen stock of the
desired strain and incubated with orbital shaking at 37 ˚C, 250 rpm. Cells were harvested at the
end of an overnight growth (OD600nm = 1-2). Each bacterial culture was divided into five Falcon
15 mL Conical Centrifuge Tubes and centrifuged at 6,000 g, 3 min, 4 ˚C.
Supernatant was discarded under aseptic conditions. Each pellet was re-suspended in 1 mL cold
sterile milli-Q H2O and transferred to 1.5 mL Eppendorf. The centrifugations (1 min on
microcentrifuge, MiniStar silverline from VWR) and washing steps were repeated four times. In
the last wash, the supernatant was discarded and bacterial pellet was re-suspended, in 100 μL cold
sterile milli-Q H2O. The bacterial suspension was ready to eletroporate.
A. Transformation by electroporation
Electroporation is a transfection method based on an electrical pulse to create temporary pores in
cell membranes. Through these pores, some substances like plasmids or other nucleic acids forms
can pass into cells [57]. Electroporation cuvettes with 2 mm gap width were used for this
efficiently process. Before using, the cuvettes were cleaned with ethanol 70% (v/ v) and dried
with absorbent paper. Electrocompetent cells and the selected DNA molecules were mixed in 1.5
mL Eppendorf and transferred to an electroporation cuvette and incubated 30 min on ice. A 2500
V electric shock was applied to cells by the electroporator ECM 399 from BTX. The
transformants were recovered after adding of 900 µL LB broth. The recover conditions were
optimized depending of the DNA molecule used to transform the cells.
In this work, the electroporation protocol was applied to transform electrocompetent cells as
suggested by Datsenko and Wanner strategy [1] and in third step of the CRISPR/Cas9 System
[55].
I. Transformation with KanR cassette: Transformants were recovered by incubating on
orbital shaking at 37 ˚C, 250 rpm, 2 h, allowing expression of antibiotic resistance gene.
100 µL of recovered cells was plated on LB- agar plate supplemented with kanamycin
(30 µg/ mL) and incubated overnight at 37 ˚C. (The remaining LB-cell mixture was left
on the laboratory bench overnight. On next day, if there were no transformants on plate,
the remaining LB-cell mixture was plated).
II. Transformation with pKD46 plasmid: Transformants were recovered by incubating on
orbital shaking at 30 ºC, during 1 h. The recovered cells were plated in LB supplemented
with ampicillin (100 µg/ mL) and incubated at 30 ˚C, overnight.
35
III. Transformation with pCP20 plasmid: Transformants were recovered by incubating on
orbital shaking at 30 ˚C during 1 h. The recovered cells were centrifuged and the pellet
was plated on LB plate supplemented with chloramphenicol (50 µg/ mL) and grown
overnight at 30 ˚C.
IV. Transformation with oligonucleotides (dsDNA): Transformants were recovered by
incubating with orbital shaking at 30 ºC, during 1-2 h. Then, recovered cells were plated
on LB agar with chloramphenicol (50 µg/ mL), spectinomycin (50 µg/ mL) and
anhydrotetracycline (100 ng/ mL). Plates were incubated at 30 ºC, overnight.
2.2.2. Chemical competent cells
Chemical competent cells protocol was performed with DH5α strain. Falcon 15 mL Conical
Centrifuge Tube with 5 mL autoclaved LB was inoculated with a 30 µL of the aliquot of strain
and incubated on orbital shaking incubator at 37 ˚C, 250 rpm. On the next day, a shake flask with
autoclaved LB (20 mL) was inoculated with an OD600nm = 0.1 from pre-inoculate. The inoculated
shake flask was incubated on orbital shaking incubator at 37 ˚C, 250 rpm. Cells were harvested
at OD600nm = 1. Bacterial suspension was divided in two Falcon 15 mL Conical Centrifuge Tubes
and each was centrifuged at 1,000 g, 10 min, 4 ˚C.
Supernatant was discarded under sterile conditions. Each pellet was re-suspended in TSS +
DMSO solution (1,900 µL: 100 µL) and kept on ice for 10 min. Successively, aliquots were
prepared for cryopreservation.
B. Transformation by heat shock
This technique was used to introduce the pVAX-GFP plasmid and the three plasmids used in
CRISPR Cas9 System into chemically competent cells.
Each plasmid DNA was gently mixed with chilled cells and the mixture was incubated 30 min on
ice to allow the plasmid to come into close contact with the cells. The plasmid-cell mixture is then
briefly heated at 42 °C for 1 min, allowing the DNA to enter the cell through the transiently
disrupted membrane. The heated mixture is then placed back on ice for 2 min in order to retain
the plasmids inside the bacteria [58]. To recover, 900 µL of LB broth, was added, immediately.
The recover conditions were optimized depending on the selected molecule to transform the cells.
I. Transformation with pVAX-GFP: 10 ng of pVAX-GFP plasmid was used. Transformants
were recovered by incubating on orbital shaking at 37 ˚C, for 1 h. 100 µL of recovered cells
was plated on LB- agar plate supplemented with kanamycin (30 µg/ mL) and incubated
overnight at 37 ˚C.
II. Transformation with CRISPR Cas9 System Plasmids: Transformants were recovered by
incubating on orbital shaking at 30 ºC, for 1 h. After, the mixture was centrifuged and the
pellet was re-suspended in 100 µL of supernatant and plated on LB agar plate supplemented
with chloramphenicol (50 µg/ mL) and spectinomycin (50 µg/ mL), for pCas9cr4 or pKDsg
plasmids, respectively.
36
2.3. Red Disruption System
2.3.1. Strains and plasmids
The bacterial strains used in this method and their genotypes are indicated in the Table 5.
Table 5. Strains used in study and main characteristics.
Strain Genotype References
K-12 MG1655 F- λ- ilvG rfb- 50 rph1 [59]
K-12 MG1655 ∆endA F- λ- ilvG rfb- 50 rph1 ΔendA [59]
K-12 MG1655 ∆endA∆pgi F- λ- ilvG rfb- 50 rph1 ΔendA Δpgi [59]
GALG20 F- λ- ilvG rfb- 50 rph1 ΔendA Δpgi ΔrecA rac- [48]
GALGNEW F- λ- ilvG rfb- 50 rph1 ΔendA Δpgi ΔrecA This study
(not published)
Bacterial strain E. coli K-12 MG1655 was from the Prather Lab, MIT. This strain was used as a
starting point for the derivative strains GALG20 and GALGNEW. Strain GALG20 was
constructed by Geisa Gonçalves, a former PhD student at IST. The difference between GALG20
and GALGNEW is an unintended secondary genomic deletion of approximately 20 kb. For gene
knockouts three plasmids were used: pKD13, pKD46 and pCP20 (Figure 11).
In pKD46 and pCP20 plasmids, the oriR101 and the repA101-ts are derived from pSC101
replication origin. These are low copy number plasmids vectors [60].
The pKD13 plasmid is the template plasmid for gene disruption. It contains a kanamycin
resistance gene (KanR) flanked by flippase recombination targets (FRT) and ampicillin resistance
gene (AmpR). This plasmid is used to make an insertion cassette containing kanamycin resistance
(B)
(C)
(A)
Figure 11. Schematic map of the plasmids used in Red system. (A) plasmid pKD13 (image created in SnapGene®
software) [5], (B) plasmid pKD46 [86] and (C) plasmid pCP20 [7].
37
gene (KanR cassette) [1]. The pKD46 plasmid is a λ-Red recombinase expression plasmid, which
includes three genes: exo, β and γ, whose products are Exo, Beta and Gam, respectively [61]. Gam
inhibits the host RecBCD exonuclease V, which degrades linear DNA avoiding E. coli
transformation [1]. Thus, Beta and Exo can promote recombination. The λ-Red recombinase
genes are under the control of the araB promoter [1]. The Red recombinase expression is induced
by arabinose, promoting the integration of the cassette. This plasmid carries an ampicillin
resistance gene. Other feature of pKD46 is the temperature-sensitive replicon, so it can be cured
by raising the temperature [1].
pCP20 is an ampicillin and chloramphenicol resistant plasmid, is temperature-sensitive the level
of replication and thermal induction of FLP synthesis [1]. This helper plasmid expressing the FLP
recombinase can eliminate the resistance gene, acting on the directly repeated FRT sites flanking
the KanR cassette [1], [62]. Expression of the λ- Red recombinase or FLP recombinase is required
from helper plasmids such as pKD46 and pCP20, respectively [62].
The main characteristics of the used plasmids are summarized in Table 6.
Table 6. Plasmids used in this work and main characteristics.
Plasmids Size
(bp)
Antibiotic
resistance genes
Origin of
replication
Copy
Number Purpose
pKD13 3,434 Kanamycin
Ampicillin R6K gamma ~15-20
Construction by PCR of
insertion cassette
containing KanR
pKD46 6,329 Ampicillin oriR101 ~5 Promotes the action of
recombination
pCP20 9,332 Chloramphenicol
Ampicillin repA101ts ~5
Eliminates resistance
cassette
2.3.2. Oligonucleotides
Oligonucleotides were designed in ApE plasmid editor software and synthesized by Stabvida.
The schematic design of the primers is represented in Figure 12. The forward primer was
designed using a sequence homologous to the upstream region flanking the gene and the ‘priming
site 1’. For the design of the reverse primer it was used a sequence homologous to the downstream
region flanking the gene and the ‘priming site 2’. The priming sites are fragments homologous to
the pKD13 plasmid [63]. The 60 bp homology sites flanking the gene of interest just include the
primers to generate KanR cassette.
38
Check primers were designed to confirm the total gene disruption.
The oligonucleotides used in Red Disruption System method are indicated in Table 7.
Table 7. Primer sequence and characteristics used to generate kan cassette (F and R) and to check (check_F and
check_R) for endA, pgi and recA genes knockouts.Lowercase letters represent the sequence from the template
plasmid pKD13 and uppercase letters correspond to the sequence from the genome of wild-type strain.
Gene Primer Sequence (5’ 3’) Size
(bp)
Tm
( ͦC)
%
G-C
endA
F AGGAACTTTCCTGATCTGGCTGATTGCATACCAAAACAG
CTTTCGCTACGTTGCTGGCTCgtgtaggctggagctgcttc 80 79 51
R TAGTTAAAAATCCGCGTCGTCTCCCCACGCGGTTGTACGC
GTGGGGTAGGGGTTAACAAAtccgtcgacctgcagtt 77 79 51
check
_F CGTCTATCGCTGTGTTCAC 19 54 53
check
_R CGCATTTATCATCCTGAACC 20 52 45
pgi
F ACTAAAACCATCACATTTTTCTGTGACTGGCGCTACAATC
TTCCAAAGTCACAATTCTCAgtgtaggctggagctgctt 80 75 44
R TAAGACGCGACCGCGTCGCATCAGGCATCGGTTGCCGGA
TGCGGCGTGAACGCCTTATCCtccgtcgacctgcagtt 77 84 62
check
_F AATGCTTCACTGCGCTAAGG 20 57 50
check
_R CGTCGGCATTGTTATTAAGG 20 43 55
recA
F ATACTGTATGAGCATACAGTATAATTGCTTCAACAGAAC
ATATTGACTATCCGGTATTACgtgtaggctggagctgcttc 80 73 40
R TGATTCTGTCATGGCATATCCTTACAACTTAAAAAAGCAA
AAGGGCCGCAGATGCGACCCtccgtcgacctgcagtt 77 78 48
check
_F TCGTCAGGCTACTGCGTATGC 21 60 57
check _R
CAGTGAGCAAGAACTGCGACG 21 60 57
Primers for genes fnr and ralR were also designed in order to distinguish the GALG20 and
GALGNEW strains (Table 8). These genes are included in an unintended secondary genomic
fragment of approximately 20 kb present in GALGNEW strain.
Homology to the
target (60 bp) Priming site
1 (20 bp) Homology to the
target (60 bp)
Priming site
2 (17 bp) Kanamycin cassette FRT FRT
Target Gene
Kanamycin cassette
Primer check F (~20 bp) Primer check R (~20 bp)
Figure 12. Schematic representation of construction of the primers: to generate kanamycin cassette (forward
and reverse primers) and to confirm the insertion of the kanamycin cassette (primers check) [51].
39
Table 8. Oligonucleotides sequences and characteristics used.
Gene Primer Sequence (5’ 3’) Size
(bp)
Tm
( ͦC) %G+C
fnr F TCAGTCTGGCGGTTGTGCTATC 22 60 55
R AGAAACCATCAGCCGTCTGC 20 59 55
ralR F TTCAGCCTGGCGGTGTAATG 20 59 55
R AAGGTGGCACTCCTACTAAC 20 55 50
2.3.3. Generation of kanamycin cassette
For the construction of the KanR cassette, a PCR was performed using the different primers, to
make the linear recombination cassette (Table 7). The Figure 13 is a schematic representation of
KanR cassette.
The composition and conditions of PCR reactions are indicated in
Table 9. After the PCR reactions, the resulting products were analyzed by 1% (w/ v) agarose gel
electrophoresis, dividing the volume into 2 lanes (5 µL+ 15 µL). After electrophoresis, agarose
gel was cut into two parts. To minimize damage to the DNA, the right part of the gel (lane with
15 µL of PCR product) was not exposed to ethidium bromide solution and UV light. Cut out the
band was required to purify the DNA fragment. The excised fragment was transferred to a 15 mL
Falcon. The extraction of the fragment corresponding to KanR cassette from the gel was performed
using NZYGelpure Kit from NZYTech. The concentrations of the purified product were measured
using NanoVue Plus Spectrophotometer (GE Healthcare).
Table 9. PCR reaction and program used to generate KanR cassette in pgi, endA and recA genes knockouts.
PCR reaction PCR program
pgi
endA
recA
Platinum PCR Supermix High
Fidelity 22.5 μL
Incubation 94 ˚C 2 min
1
cycle
pKD13 plasmid 10 ng Denaturation 94 ˚C 5 s
35
cycl
es
Primer F 0.5 μL Annealing 55 ˚C 25 s
Primer R 0.5 μL Extension 72 ˚C 90 s
H2O Up to
25 μL
Figure 13. Kanamycin resistance cassette generated by PCR: Schematic representation created in the SnapGene software [36].
40
2.3.4. Gene disruption strategy
The strategy used in this work was adapted from Red System described by Datsenko and Wanner,
performed in four steps. The basic strategy is to replace a chromosomal sequence with a selectable
antibiotic resistance gene. PCR is used to make an insertion cassette which contains a selectable
marker, usually kanamycin resistance, using primers with a homology extensions (H1 and H2)
(Step 1 in Figure 14) [1]. Antibiotic resistance is flanked by FTR sites to allow later excision of
the marker (Step 1 in Figure 14).
The first step was the generation of the cassette. Purification of pKD13 plasmid was made and
primers to amplify the selectable marker, FRT and custom mutation cassette were designed, as
represent in Table 7. Then a PCR was performed to generate the cassette (Table 9). Subsequently,
the PCR product was resolved in an agarose gel and the fragment was excised and purified.
The second step was the chromosomal integration. pKD46 plasmid (promotes the
recombination) was purified and electrocompetent cells were transformed by electroporation as
described in point A of section 2.2.1..
Transformants carrying pKD46 plasmid (recombineering-cells) were grown in 5 mL of LB
medium with ampicillin at 30 ˚C, 250 rpm. On next day, 50 mL of LB supplemented with
ampicillin in 250 mL shake flasks were inoculated to an OD600nm = 0.1. Cells were grown at 30
˚C, 250 rpm during 4 h. Then, 385 µL L-arabinose 20% (w/ v) was added to culture and incubated
at 30 ˚C, 250 rpm during 2 h. L-arabinose binds AraC, that is encoded by the gene araC present
in pKD46 plasmid. This protein allows the transcription of Lambda Red genes from the ParaB
promoter, expressing recombinase genes [64].
Figure 14. Gene disruption strategy. H1 and H2 are the homology extensions or regions, P1 and P2 are the priming sites. Strategy
described by Datsenko and Wanner [1].
41
100 µL of electrocompetent transformants carrying the Red helper plasmid were electroporated,
as described in point A of section 2.2.1, with 1 μL of the PCR amplified KmR cassette.
Colony PCR analysis was the third step. Three to six freshly isolated colonies were suspended in
70 µL sterile water by pipetting. The DNA extraction was performed by thermal lysis placing 50
µL of the mixture at 99 ˚C for 5 min and immediately after in ice. The PCR reaction composition
and program are described in Table 10.
Table 10. PCR reaction and respective program used in colony PCR.
The last step was the elimination of the antibiotic resistance gene. A freshly KmR colony was
grown in 5 mL LB supplemented with kanamycin (30 µg/ ml). On next day, 50 mL of LB
supplemented with kanamycin in 250 mL Erlenmeyer flask were inoculated to an OD600nm = 0.1.
Cells were grown at 37 ˚C, 250 rpm. Cells were harvested at OD600nm = 1 and eletrocompetent
cells were prepared. The electrocompetent cells were transformed with pCP20 plasmid by
electroporation (point A of section 2.2.1). The pCP20 plasmid presents ampicillin and
chloramphenicol selection markers and shows temperature-sensitivity for replication. This
plasmid carries the gene flp encoding the FLP recombinase.
On the next day, four colonies were separately re-suspended, in 10 µL sterile water and plated on
LB plates without antibiotics. The plates were incubated at 43 ˚C, overnight. The KmR cassette
can be removed by FLP action, leaving behind a short nucleotide sequence with one FRT site,
[1]. The Red recombinase and FLP helper plasmids can be cured by growing cells at 43 ̊ C because
they have temperature-sensitive replicons [1].
After one overnight, the colony PCR was accomplished selecting one colony from each portion
of LB plates (4 colonies in total). The check primers and primers for genes fnr and ralR were
used. When the PCR result was the expected, 20 µL of 70 µL which were not used for DNA
extraction, were plated on LB plate without antibiotic, LB with chloramphenicol, LB with
kanamycin and LB with ampicillin, divided into 4 parts. The plates were incubated at 30 ˚C,
overnight. A final colony PCR analysis was made, selecting 2 colonies from LB plate. The
colonies having the expected profile were grown and cell banks were performed.
PCR reaction (Vfinal= 25 μL) PCR program
pgi
endA
recA
NovaTaq Polymerase 12.5 μL Incubation 95 ˚C 5min 1
cycle
DNA 10.0 μL Denaturation 94 ˚C 1 min
35
cycl
es
Primer F 1.0 μL Annealing 60 ˚C 1 min
Primer R 1.0 μL Extension 72 ˚C 2 min
Water 0.5 μL Final Extension 72 ˚C 10 min 1
cycle
42
2.4. CRISPR Cas9-System method
2.4.1. Strains and plasmids
The bacterial strains used in this method and their genotypes are presented in the Table 11.
Table 11. Strains used in this study with method described by Reisch and Prather [55] .
Bacterial strain E. coli DH5α was obtained from Invitrogen. This strain was used as a starting
point for the construction of the single-guide RNA [55]. GALGNEW was transformed with three
plasmids: pCas9cr4, pKDsg-zwf and pKDsg-p15, which are represented in Figure 15 and were
obtained from Addgene. The plasmid pKDsg-zwf was constructed from pKDsg-ack in this work.
The main characteristics of these plasmids are indicated in Table 12. E. coli DH5α was used to
test the transformations with the several plasmids.
pCas9cr4 plasmid carries a Cas9 nuclease gene, which is under the control of Tet promoter, a tetR
constitutively expressed and a chloramphenicol resistance gene [55]. Cas9 is a endonuclease that
targets a specific DNA sequence and the only requirement of this nuclease is that the protospacer
be adjacent to the triplet NGG designated protospacer adjacent motif (PAM) [55].
Plasmid pKDsg-xxx which has the sgRNA expressed under control of the PTET promoter and has
λ-Red recombinase genes, under control of the arabinose inducible promoter ParaB. This plasmid
was the base for the construction of pKDsg-ack [66], pKDsg-zwf and pKDsg-p15 plasmids.
Plasmid pKDsg-p15 was created which targeted the p15A origin of replication of pCas9cr4, since
the plasmid pCas9cr4 does not possess the capacity that allow curing of the plasmid [67].
The origin of replication/replicon defines that these plasmids occur in low copy number, as shown
in Table 12 [68].
Strain Genotype Reference
E. coli DH5α F- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1
hsdR17 (rK-, mK+) phoA supE44 thi-1 gyrA96 relA1 [65]
GALGNEW F- λ- ilvG rfb- 50 rph1 Δpgi ΔendA ΔrecA This work
(A) (B)
Figure 15. Schematic map of the no-SCAR plasmids. (A) Plasmid pCas9cr4. (B) Plasmid pKDsg-xxx [55].
43
Table 12. Plasmids used in this study and their main characteristics.
2.4.2. Oligonucleotides
Oligonucleotides were designed using ApE plasmid editor software and synthesized by Stabvida.
The oligonucleotides used in this method are indicated in Table 13.
Table 13. Primer sequence and characteristics used to generate the pKDsg-zwf plasmid [69], to generate homologous arms (E and F) and to check (G and H) for zwf gene knockout. Lowercase letters represent the sequence from the
template plasmid pKDsg-ack and uppercase letters correspond to the protospacer, in the gene zwf, preceded for a
PAM site.
Name Primer Sequence Size
(bp)
T
(˚C)
%
G+C
zwf-
pfragfwd F CTTTCGCGCCGAAAATGACCgttttagagctagaaatagcaag 43 68 44
zwf-
pfragrev R GGTCATTTTCGGCGCGAAAGgtgctcagtatctctatcactga 43 71 49
pKDsgRNA
-frag2fwd F ccaattgtccatattgcatca 21 53 38
pKDsgRNA
-frag1rev R tcgagctctaaggaggttataaa 23 54 39
E F
TTAAGTACCGGGTTAGTTAACTTAAGGAGAATG
ACTATCTGCGCTTATCCTTTATGGTTATTTTACCGGT
70 71 37
F R ACCGGTAAAATAACCATAAAGGATAAGCGCAGA TAGTCATTCTCCTTAAGTTAACTAACCCGGTACT
TAA
70 71 37
G F TGACTGAAACGCCTGTAACC 20 56 50
H R CCTGTGTGCCGTGTTAATGA 20 56 50
2.4.3. Plasmid construction and protospacer design
All plasmids used in this work are listed in Table 12. The plasmid pKDsg-zwf was created using
circular polymerase extension cloning (CPEC) [55][69]. Two PCR reactions were performed to
amplify the plasmid in two fragments under the conditions presented in Table 14.
Plasmids Size
(bp)
Antibiotic
resistance genes
Origin of
replication
Copy
Number Purpose
pCas9cr4 6,770 Chloramphenicol p15A ~10
Cas9 nuclease under control of PTET
promoter with ssrA tag and constitutive
tetR
pKDsg-ack 6,959 Spectinomycin ori101 ~5 Template to create the plasmid pKDsg-zwf
pKDsg-zwf 6,959 Spectinomycin ori101 ~5
With homologous regions to the target
gene. Arabinose inducible λ-red and
anhydrotetracycline inducible sgRNA expression
pKDsg-p15 6,962 Spectinomycin ori101 ~5 Eliminate resistance of the plasmid
pCas9cr4
44
Table 14. PCR reaction and program to generate the two fragments of pKDsg plasmid.
The two linear dsDNA products
were digested with restriction
enzyme DpnI for 1 h at 37ºC and then
resolved in agarose gel [55]. DpnI is
a restriction enzyme that cleaves
only when its recognition site is
methylated (Dam methylated),
therefore it digests the template
plasmid but not the PCR product
[70], [71].
The digested products were resolved
in 1% agarose gel and the correct
fragments were excised, purified and
quantified.
The two-purified linear ssDNA were
used as template for a CPEC
reaction. CPEC reaction is a method
to extend overlapping regions
between the insert and vector
fragments to form a complete
circular plasmid (Figure 16) [72]. In
this case, the two fragments that
result from the PCR reaction and
digestion with DpnI, share
overlapping sequences on both ends.
Therefore, these two fragments can
hybridize and extend using each
other as a template in order to form a
complete double- stranded plasmid
[72].
PCR reaction PCR program
KOD Hot Start DNA Polymerase 1.0 μL Incubation 95 ˚C 2
min
1
cycle MgSO4 2.3 μL
pDNA 10 ng Denaturation 95 ˚C 30 s
35 c
ycl
es Primer F 1.3 μL
Primer R 1.3 μL Annealing 59 ˚C 30 s
dNTPs 2.5 μL
10x buffer for KOD DNA Polymerase 1.0 μL Extension 70 ˚C 1
min Water Up to 25 μL
Figure 16. A schematic diagram of the proposed CPEC mechanism for
cloning an individual gene. The fragment 1 (orange line) and the fragment 2 (blue line) share overlapping regions at the ends. The hybridized
fragments extend using each other as a template until they complete a full
circle (black line) and reach their own 5’-ends. The assembled plasmid
has two nicks, one on each strand. They can be used for transformation with or without further purification. Adapted from [72], [87].
45
CPEC reaction was carried out in a thermocycler. The PCR reaction and program are present in
Table 15.
Table 15. PCR reaction and program to generate the pKDsg-zwf plasmid.
PCR reaction PCR program
KOD Hot Start DNA Polymerase 1.0 µL Denaturation 95°C 1 min
35 c
ycl
es MgSO4 2.3 µL
Fragment 1 10 µL Annealing 55°C 30 s
Fragment 2 10 µL
dNTPs 2.5 µL Extension 70°C 1 min
10x buffer for KOD DNA Polymerase 2.5 µL
Water Up to 30 µL
4 µL of the CPEC reaction product were added to 100 μl of chemical competent DH5α cells
aliquot and transformed as described in section 2.2.2. A colony from LB + spectinomycin plate
was selected and grown in 5 mL LB broth supplemented with 25 µL spectinomycin, overnight.
On the next day, the bacterial suspension was centrifuged, the pellet was purified to collect the
plasmid. The purified plasmid was quantified and 1,000 ng of the constructed plasmid (pKDsg-
zwf) was analyzed in 1 % agarose gel. The protospacer (target) was designed from pKDsg-ack
plasmid. The protospacer (target) must precede a triplet NGG site known as the protospacer
adjacent motif (PAM) and consist in a 20 bp targeting sequence. The PAM is necessary for Cas9
nuclease to bind target DNA [55]. Primers for cloning the protospacer into the pKDsgRNA
plasmid are represent in Table 13.
46
2.4.4. Gene disruption strategy
The strategy used in this work was adapted
from no-SCAR (Scarless Cas9 Assisted
Recombineering) system described by Reisch
and Prather [55]. It is a new tool that can edit
the genome of E. coli without chromosomal
markers, using λ-Red system, as used by
Datsenko and Wanner [1]. λ-Red system
facilitates genomic integration of donor DNA
and dsDNA cleavage by Cas9 nuclease to
countselect against wild-type cells [55]. The
plasmids used in this strategy (Table 12) have
temperature sensitive origin of replication can
easily be cured.
CRISPR/Cas9 system to deletion of the zwf
gene is composed by 4 main steps,
represented in Figure 17:
1) Transformation of E. coli strain
GALGNEW with pCas9cr4 plasmid.
2) Transformation of E. coli strain
GALGNEW with pKDsg-zwf
plasmid.
3) Recombineering.
4) Plasmid curing.
The first step of this method was the
transformation of pCas9cr4 plasmid into
chemically competent GALGNEW by heat
shock, as described in point B of section
2.2.2. On the next day, transformants were
grown in 5 mL LB broth supplemented with
25 µL of spectinomycin (50 µg/ mL) and
chemically competent cells were prepared.
The second step was the transformation of the chemically competent GALGNEW + pCas9cr4 by
heat shock with pKDsg-zwf plasmid which contains the protospacer (target gene).
The steps 3 and 4 were not performed.
2.5. Gel extraction and purification
When the product of PCR’s amplification is used to transform cells, the product was verified and
extracted from an agarose gel, dividing the volume into two lanes (5 µL + 15 µL). After
Figure 17. Schematic representation of main steps of no-SCAR method. Adapted from [55].
47
electrophoresis, the agarose gel was cut into two parts. To minimize damage to the DNA, the right
part of the gel (lane with 15 µL of PCR product) was not exposed to ethidium bromide solution
and UV light. Cutting out the band was required to purify the DNA fragment. The excised
fragment was transferred to a 15 mL Falcon.
For the purification of DNA from TAE agarose gels, the commercial kit: QIAquick Gel Extraction
Kit from Qiagen was used. This kit can be used to purify DNA fragments from 70 bp to 10 kb
[73]. The steps 4 and 6 of the protocol are optional and were not performed.
2.6. Plasmid DNA purification
Plasmid DNA was purified from cells harvested at the end of overnight growth (OD600nm = 1-2)
and from cells harvested from shake flask cultivations (OD600nm =10), using the High Pure Plasmid
Isolation Kit (Roche) and their recommend protocol [74]. The optional steps were not performed.
DNA was eluted with water.
2.7. Plasmid DNA restriction
The purified plasmid DNAs were digested with one restriction enzyme (RE) selected to give a
distinct DNA band pattern or a band profile. The REs selected and respective buffers for the used
plasmids are illustrated in Table 16.
Each reaction was performed with 1,000 ng pDNA, 0.5 µL enzyme, respective buffer (10 % of
final volume) and milli-Q water up to the required final volume. The mixture was incubated at 37
˚C during 2 h. The digested products were separated in a 1 % agarose gel.
Table 16. Restriction enzymes and their characteristics used in plasmids DNA digestions reactions.
The composition of each restriction enzyme reaction buffer (1x) is present in Table 17.
Restriction
Enzymes
Buffer
(% Activity) Site Plasmid DNA Reference
BamHI E (100 %) 5’…A|GATCT…3’
3’… TCTAG|A…5’
pKD46 [75]
pCas9cr4
HindIII E (100 %) 5’…A|AGCTT…3’
3’…TTCGA|A…5’
pKDsg-p15
pKDsg-ack [76]
EcoRI H (100 %) 5’…G|AATTC…3’
3’…CTTAA|G…5’
pKD46 [77]
pVAX1-GFP
KpnI J (100 %) 5’…GGTAC|C…3’
3’…C|CATGG…5’ pCas9cr4 [78]
BglII D (100 %) 5’…A|GATCT…3’
3’…TCTAG|A…5’ pKD13 [79]
48
Table 17. Composition of Restriction Enzyme Reaction Buffers [80].
Buffer pH
(at 37 °C)
Tris-HCl
(mM)
MgCl2
(mM)
NaCl
(mM) KCl (mM)
DTT
(mM)
D 7.9 6 6 150 — 1
E 7.5 6 6 100 — 1
H 7.5 90 10 50 — —
J 7.5 10 7 — 50 1
2.8. General PCR parameters
The PCR reactions were used to generate the kanamycin cassette and to show that all mutants
have the expected modification [1]. A freshly isolated colony was suspended in 70 µL sterile
water with a plastic tip. The DNA extraction was performed by thermal lysis placing 50 µL of the
mixture at 99 ˚C for 5 min and after kept in ice. The mixture was centrifuged at 12,000 g for 2
min. The reaction with all compounds was prepared. The PCR reactions were performed in a
thermal cycler Hybaid PX2 from Thermo Scientific. Each program was adapted depending on the
purpose.
2.9. Agarose electrophoresis
Gel electrophoresis analysis were performed using 1% (w/ v) agarose gel (500 bp to 1 kb of DNA)
in TAE buffer (40 mM Tris, 20 nM acetic acid and 1 mM EDTA, pH 8.0), in horizontal
electrophoresis tanks from VWR and Electrophoresis Power supply – EPS 301 from Amersham
Pharmacia Biotech. Electrophoresis was carried out for 1 h at 100 V (small agarose gel – 8 wells)
or 1 h 30 min at 120 V (medium or large agarose gels – 15 or 30 wells, respectively), using TAE
buffer 1x as the running buffer. Gels were stained with ethidium bromide (EtBr) (0.5 µg/ mL) and
visualized under UV light on an Eagle Eye II ® Stratagene trans-illuminator. The molecular
weight marker used was NZYDNA ladder III.
2.10. Shake flask cultivation
The inocula were prepared from frozen cell banks of transformed cells with pVAX1GFP plasmid)
in LB medium supplemented with kanamycin, grown overnight and then used to inoculate batch
culture to an initial OD600nm of approximately 0.1. Culture was grown at 37 ˚C for 24 h in 250 mL
shake flask containing 50 mL of the complex medium supplemented with kanamycin, at 250 rpm.
Glucose (20 g/ L) was used as the primary carbon source. Two replicates were prepared for each
strain. Samples were collected at 0, 4, 8, 10, 17 and 24 h to measure pH, glucose and bacterial
density (OD600nm).
49
In this work, based on the above description, three strategies of shake flask cultivation were
performed. These strategies differ in the number of the strains used, in the number of assays
performed and in the harvest time (hours of growth) of the cells to purification and quantification
of the pDNA, as demonstrated in Table 18.
Table 18. Synthesis of the differences between the various strategies of shake flask cultivation.
Strategy Strains Number of
test days
Harvest Time
(OD600nm =10)
C1 GALG20/ GALGNEW 4 8 h
C2 GALG20/GALGNEW 6 24 h
C3 GALG20/GALGNEW/MG1655 1 17 h
2.11. Measurement of glucose
Culture broth samples with a volume equivalent to OD600nm =10 were centrifuged, at 13,000 g for
10 min, and the supernatants were filtered through a 0.22 µm-pore-size filter. Glucose level was
quantified in a high performance liquid chromatography (HPLC) system (Merck Hitachi,
Darmstadt, Germany) equipped with a refractive index detector (L-7490, Merck Hitachi,
Darmstadt, Germany) and Rezex ROA Organic Acid H+ (8%) column (300 mm x 7.8 mm,
Phenomenex), at 65 ˚C. Compounds were quantified from 20 µL sample injections. Sulfuric acid
[(5 mM) (ACROS)] was used as mobile phase at 0.5 mL/ min.
2.12. Plasmid DNA quantification
After plasmid DNA purification, the quantification of the plasmid DNA was performed using
NanoVue Plus Spectrophotometer (GE Healthcare ®). Plasmid quality was assessed by gel
electrophoresis, to determine which were the predominant isoforms.
2.13. Cells banks preparations
Throughout the study frozen cells banks was prepared in a proportion 80 µL cells for 20 µL
glycerol 99 %. The frozen cells banks were store at -80 ͦ C.
50
2.14. Genomic deletion analysis
There are evidences showing that unintentional genomic deletions or mutations associated with
the λ -Red mutagenesis procedure such as those observed may be a feature of unstable genomic
regions in MG1655 that are centered around insertion sequence (IS) elements [81]. An example
of this feature is GALG20 strain. The presence of one unintended secondary genomic deletion of
approximately 20 kb in the genome of GALG20 strain was identified. This genomic element
coming from the prophage rac, which was the first prophage discovered in E. coli K-12 being
considered as a phage fossil, having been acquired over 4.5 million years ago. In E. coli K-12, rac
harbors 25 genes (intR, kilR, pinR, racC, racR, ralR, recE, recT, rzoR, sieB, stfR, tfaR, tmpR,
trkG, ydaC, ydaE, ydaF, ydaG, ydaQ, ydaS, ydaT, ydaU, ydaV, ynaE, ynaK) and 5 pseudogenes
(ydaW', rzpR', ydaY', ynaA', and lomR') [2], [82]. The elimination of this phagic element leads to
a decrease in resistance to acid stress, oxidate stress and antibiotic stress [2]. The nomenclature
allocated and which will be used throughout the work is rac sequence or genomic deletion.
To analyze this genomic deletion, several PCR reactions were performed throughout the
GALGNEW strain construction, using fnr and ralR oligonucleotides (Table 8). After completing
the elimination of endA, pgi and recA genes, new specific oligonucleotides were designed to test
the absence or presence of unintentional genomic deletion in GALG20 and GALGNEW (Table
19).
Table 19. Oligonucleotides used to test the absence or presence of unintentional genomic deletion. Some
characteristics of these oligonucleotides are present.
Name Primer Sequence (5’ 3’) Size Tm
(°C)
%
GC
GALG20_del1_fwd
(F1) F AGCCAGATACAAGGGGTTGCTGAA 24 62 50
GALG20_fwd2
(F2) F TGTAAATCCAGCTAAGAGGTGAGG 24 58 46
GALG20_del2_ rev
(R1) R CAATATTCCGCTGTCTGAGTGGAC 24 59 50
GALG20_del3_ rev
(R2) R ACTGTTCATAGCCTGCGCCATA 22 60 50
GALG20_rev3
(R3) R ACTCGGGCCTTGTCAGTTATTG 22 59 50
GALG20_rev4
(R4) R TTTCCGATATGCACCAGGCAC 21 59 52
These oligonucleotides were designed from the genome of MG1655 strain and are schematically
represented in Figure 18.
Figure 18. Schematic representation of location of the oligonucleotides in the genome of MG1655 strain.
Genomic DNA 5’ 3’
~19,880 bp
51
The origin of tested GALG20 colonies were different. Some colonies were from one sub-culture
and others were from 12 sub-cultures. All colonies were tested with several combinations of
oligonucleotides. PCR program and reaction followed the indications presented in Table 20.
The combinations of oligonucleotides were: F1R1, F1R2, F1R3, F1R4, F2R1, F2R2, F2R3 and
F2R4. Some negative and positive controls were prepared. The negative controls were prepared
replacing DNA for sterile milli-Q water, and positive controls were prepared using DNA from
the same colonies but using oligonucleotides for recA gene.
After all these PCR reactions, mutant strains were again sent for sequencing.
Table 20. PCR program and PCR reaction using to assess the absence of rac sequence in GALG20.
2.15. DNA sequencing
Plasmid DNA was sequenced by Stabvida and genomic DNA purified were sequenced by
MiSeq® System from Illumina [83] in Instituto Gulbenkian de Ciência (Oeiras).
PCR reaction (Vfinal= 25 μL) PCR program
F1R1
F1R2
F1R3
F1R4
F2R1
F2R2
F2R3
F2R4
NovaTaq Polymerase 12.5 μL Incubation 95 ˚C 7 min 1
cycle
DNA 10.0 μL Denaturation 94 ˚C 1 min
35
cycl
es
Primer F 1.0 μL Annealing 55 ˚C 1 min
Primer R 1.0 μL Extension 72 ˚C 1 min
Water 0.5 μL Final Extension 72 ˚C 10 min 1
cycle
52
3. RESULTS AND DISCUSSION
Plasmid DNA profile
To evaluate the distinct DNA band pattern or band profile of the several plasmids used in this
work, restriction analyses with restriction enzymes were made, as represented in Table 16.
Plasmid pCP20 was not evaluate because its sequence is not available.
The pKD13 plasmid is the template plasmid for gene disruption and was used to design a cassette
containing kanamycin resistance gene (KanR cassette). The band profile of the plasmid pKD13
was analyzed by restriction reaction with enzyme BglII, as represented in Figure 11. For this
reaction one single 3,434 bp fragment is expected. The result is represented in Figure 19.
Lane 1 shows a fragment with size between 3,000 and 4,000 bp, as expected. Lane 2 corresponds
to the non-digested purified plasmid that was used as template to generate the kanamycin cassette.
This demonstrates that the pKD13 plasmid’s sequence is correct.
The plasmid pKD46, as mentioned before, contains the gene that codes for the λ-Red recombinase
and was used to transform cells containing the KanR cassette. This plasmid is essential for the
homologous recombination between the KanR cassette and the genome to occur. Therefore, a
restriction analyses was performed with restriction enzymes BamHI and EcoRI (Figure 11 – B),
separately, to confirm the sequence of the plasmid. The plasmid pKD46 non- digested was also
analyzed in agarose gel.
In Figure 20 the restriction analyses of pKD46 plasmid is represented.
2 1 M
Figure 19. Agarose gel expressing the band profile of plasmid pKD13 digested with BglII (lane 1) and non- digested
(lane 2).
53
The result of digestion with EcoRI should be the presence of two fragments with 4,820 bp and
1,509 bp. However, in lane 1, three fragments are present with approximately, 10,000 bp, 6,000
bp and 5,000 bp. Alternatively, digestion with BamHI is expected to linearize the plasmid into
one single 6,329 bp fragment. In lane 2, only one band with size between 6,000- 7,500 bp can be
seen, as expected. So, it is possible to assume that digestion was successful and the profile
analyzed correspond to pKD46.
Relative to CRISPR Cas9-System’s plasmids, as mentioned before, the pCas9cr4 carries a Cas9
nuclease gene encoding Cas9 endonuclease, pKDsg-ack was used as template for the construction
of plasmid pKDsg-zwf and pKDsg-p15 to cure the first plasmid. The bands pattern for these
plasmids were analyzed by digestion with restriction enzymes BamHI and HindIII, as depicted in
Table 16. The PCR products were tested by agarose gel electrophoresis (Figure 21). The three
purified plasmids non-digested were also analyzed in an agarose gel.
Figure 20. Qualitative analysis of plasmid pKD46: Plasmid DNA isoforms and agarose gel analysis of restriction
digestion reactions of plasmid pKD46. Lane 1 – purified plasmid digested with EcoRI, lane 2 - purified plasmid
digested with BamHI, lane 3 - purified plasmid undigested. The last lane (M) corresponds to molecular weight marker NZYDNA ladder III.
1 2 3 M
Figure 21. Agarose gel analysis of digestion reactions of pKDsg-ack, pKDsg-p15 and pCas9cr4 plasmids with
restriction enzymes. The first lane (M) is molecular weight marker ladder III. Lane 1 is a plasmid pKDsg-ack non-
digested, lane 2 is plasmid pKDsg-p15 digested with HindIII, lane 3 is plasmid pKDsg-p15 non-digested, lane 4 is pKDsg-ack digested with HindIII, lane 5 is plasmid pCas9cr4 non-digested and lane 6 is plasmid pCas9cr4 digested
with BamHI.
6 5 4 3 2 1 M
54
The result of digestion of pCas9cr4 with BamHI, should be the presence of one fragment with
6,770 bp, as obtained in lane 6.
For the digestions of pKDsg-ack and pKDsg-p15 plasmids with HindIII were expected one single
6,959 bp and 6,962 bp fragments, respectively.
In lanes 2 and 4 a fragment between 6,000 bp and 7,500 bp can be seen, corresponding to the
expected size for the pKDsg-p15 and pKDsg-ack digested plasmids, respectively. Lane 6,
corresponds to the plasmid pCas9cr4 which was digested with BamHI. The possible fragment
between 6,000 bp and 7,500 bp can be observed, slightly below the obtained fragments for the
other two plasmids.
3.2. Knockouts by Red Disruption System
The protocol used is illustrated in Figure 14.
3.2.1. Kanamycin cassette generation
The first step for the endA (previously knockout by other members of our group), pgi and recA
genes knockouts by Red disruption system was the generation of a cassette with the KanR gene,
as described in section 2.3.3.. This KanR cassette is flanked by FLP recognition target (FRT).
PCR products were generated by using several pairs of 77- to 80-nt-long primers that included
60-nt homology extensions and 17- to 20-nt priming sequences for pKD13 as template,
represented in Table 7. The KanR cassette used to transform MG1655ΔendA to delete the pgi
gene was gently provided by Sofia Duarte, a former PhD student at IST, and Maria Martins, a
former MSc student at IST. The reaction and respective program PCR are represented in Table
9. The homology regions to the genes, the priming sites and the FRT regions in each extremity of
the KanR gene, compose the cassette, leading to a 1,414 bp sequence.
The PCR amplification was verified by agarose gel electrophoresis.
The result present in Figure 22 correspond to PCR reaction to generate KanR cassette for recA
gene knockout.
A band size of approximately 1,400 bp was obtained, corresponding to expected size for the
resistance cassette. The fragment contending KanR cassette present in right part of the agarose gel
was cut by comparison with left part of agarose gel (lane 1, Figure 19). Then, the excised fragment
was purified and the KanR cassette was used to transform MG1655ΔendAΔpgi recombineering-
ready cells.
55
3.2.2. pgi gene knockout
As mentioned in section 1.4., the pgi gene codes for phosphoglucose isomerase (Pgi), an enzyme
that catalyzes the conversion of glucose-6-phosphate into fructose-6-phosphate. Therefore, the
elimination of Pgi aims to redirect the carbon flux into the PPP, enhance the synthesis of
nucleotides, and also provide high amounts of reducing cofactors, such as NADPH, and
consequently, an increase in pDNA production [48], [59].
After purification of the kanamycin cassette, it was transformed by electroporation into the
recombineering-ready cells from strain MG1655ΔendA. Red-recombinase expressed by plasmid
pKD46, allow the insertion of KanR cassette by exchange with the wild-type pgi gene. To check
for the insertion of the KanR cassette, 6 colonies were selected and a colony PCR was performed,
using the PCR program and the check
primers designed for this purpose (Table
9 and Table 7, respectively). The result
can be seen in Figure 23. Using the
check primers described in Table 7, the
PCR product should be 1,949 bp
fragment, in case of no insertion of the
KanR cassette (corresponding to the pgi
gene size) or a fragment with a size of
1,553 bp, in case of insertion of the KanR
cassette (MG1655 ΔendA::kan).
Figure 22. Agarose gel obtained from the PCR using to generate the KanR cassette for recA gene knockout. In lane (1)
PCR product and in lane (M) molecular weight marker NZYDNA Ladder III.
M 1
1 2 3 4 5 6 7
Figure 23. Agarose gel electrophoresis showing the result of colony PCR of strain MG1655 ΔendA::kan. In the first lane (M)
is molecular weight marker NZYDNA I from NZYTech. The
lanes 1-6 correspond to different six colonies analyzed. Lane 7
corresponds to a negative control performed without DNA.
M
56
Only four colonies (lanes 3, 4, 5 and 6) exhibit the genotype corresponding to the insertion of the
KanR cassette. This means that the Red-mediated recombination was successful in these colonies
that correspond to these amplifications. The other two colonies (lanes 1 and 2) did not present any
amplification. However, in all lanes the band corresponding to the pgi gene amplification does
not appear. Considering that tested cells were previously selected for kanamycin resistance, after
transformation with KanR cassette, it was expected amplification of a fragment with size
corresponding to insertion of the KanR cassette.
The negative control has not shown amplification, as expected. One of these positive colonies
was grown in LB broth supplemented with kanamycin in order to prepare electrocompetent cells
as described in section 2.2.1. The eletrocompetent cells were electrotransformed with pCP20
plasmid that expresses FLP recombinase able to removes the KanR cassette. The cells transformed
were plated in LB plates supplemented with chloramphenicol. Six LB + Cm positive colonies
were plated in LB plates antibiotic-free and incubated overnight at 43 ˚C. The temperature rise
induces FLP recombinase expression and select for loss of pCP20. After this incubation, the cells
were tested in LB plate without antibiotics and LB plates supplemented with ampicillin,
kanamycin and chloramphenicol. This test is required to confirm complete loss of plasmid from
colonies. In case of cassette removal, the amplified product should be a fragment between 300-
400 bp, depending the cut location within the FRT sites as shown in Figure 24. This resultant
fragment is known as “scar”. As expected, all the colonies tested seem to have lost the KanR
cassette. The negative control has not shown amplification.
Cells banks from colony 2, represented in lane 2 of Figure 24, were made and stored at -80 ˚C.
Figure 24. Agarose gel obtained from final colony PCR used to verify the knockout mutants and the removal of the KanR cassette. In the first lane (M) is molecular weight marker NZYDNA Ladder III. In the following lanes (1- 4) are
the different colonies analized. The last lane correspond to the negative control.
1 2 3 4 5 M
57
3.2.3. recA gene knockout
The recA gene codes for a polypeptide essential for the recBCD pathway of homologous
recombination (section 1.4.). Thus, recA mutants have less undesirable homologous
recombination than wild-type cells [13].
For the construction of the GALGNEW strain, the MG1655ΔendAΔpgi cells were used as
recipients, specifically the cells stored at -80°C from the colony correspondent to lane 2 in Figure
24. 30 µL aliquot of frozen MG1655ΔendAΔpgi cells was plated in LB without antibiotics. To
confirm endA and pgi genes knockouts, a colony PCR was performed from two colonies using
primers check represented in Table 7. The PCR reaction program is present in Table 10. Controls
were made with both primer pairs: a negative control without DNA and a positive control with
DNA from GALG20. The PCR products were resolved in agarose gel electrophoresis (Figure
25).
The gene disruption method for the recA gene was similar to the previously presented for pgi
gene knockout.
The KanR cassette was generated and purified and then used to transform recombineering-ready
cells from strain MG1655ΔendAΔpgi by electroporation. The transformed cells with KanR
cassette (MG1655 ΔendAΔpgi::kan) were inoculated in LB plate supplemented with kanamycin,
and six colonies were chosen for colony PCR screening. A negative control without DNA and a
positive control choosing a colony MG1655ΔendAΔpgi transformed with pKD46 were prepared.
A colony PCR was accomplished using check primers for recA gene (Table 7). The PCR reaction
and program are described in Table 10.
In case of insertion of the KanR cassette it is expected an amplicon with 1,527 bp. If the insertion
was not successful, the result would be a fragment with 1,371 bp, corresponding to amplification
of recA original gene.
Figure 25. Agarose gel analysis of colony PCR to confirm the endA and pgi genes knockouts using check primers. In the first lane (M) is molecular weight marker NZYDNA Ladder III. Lanes 1 and 2 corresponding to colonies analyzed
with primers to check pgi gene knockout. Lane 3 is the positive control. Lane 4 is the negative control using primers
check for pgi gene knockout. Lanes 5 and 6 corresponding to colonies analyzed with primers to check endA gene knockout. Lane 7 is the positive control. Lane 8 is the negative control using primers check for endA gene knockout.
1 2 3 4 5 6 7 8 M
58
The size of the amplified fragment was screened by agarose gel electrophoresis (Figure 26).
Four attempts to insert the KanR cassette failed. Possible explanations are a contamination of the
primers, failure on the expression of recombinase encoded in plasmid pKD46 or due to the size
of KanR cassette (1,414 bp).
The obtained sizes were compared with the positive control (lane 7) that has 150 bp difference in
size comparing with length fragment of transformed with KanR cassette. The lane 6, for example,
shows that insertion of KanR cassette was successful. So the colony correspondent to the lane 6
was used to make the transformation with plasmid pCP20 protocol.
After transformation of cells with plasmid pCP20, the mixture was inoculated in LB
supplemented with chloramphenicol and then six colonies were streaked to LB plate without
antibiotics divided into six areas (one for each colony). This LB plate was incubated at 43 ˚C
overnight. On the next day, in order to confirm the mutation, one colony from each area was
selected for colony PCR analysis. For this reaction, the check primers for recA gene presented in
Table 7 were used. The PCR reaction conditions are represented in Table 10. A negative control
prepared with water was included in PCR reaction.
The PCR products were resolved in agarose gel electrophoresis (Figure 27).
Figure 26. Agarose gel with the amplified fragments from colony PCR to confirm the insertion of KanR cassette. In
first lane (M) is the molecular weight molecular NZYDNA ladder III and in following lanes are the PCR products. The lanes 1-6 correspond to the colonies chosen from LB+ kan plate. In the lanes 7 and 8 are the positive control and
the negative control, respectively.
8 7 6 5 4 3 2 1 M
59
In case of gene deletion, the “scar” corresponds to a fragment with size between 300 bp and 400
bp.
It is possible to verify that the size of the obtained fragments corresponds to “scar”, in other words,
the disruption of recA gene was achieved. Relative to the negative control, can be observed a
slight amplification.
Subsequently, genomic DNA was extracted and sequenced for confirm endA, pgi and recA genes
removal. The new strain MG1655 ΔendAΔpgiΔrecA rac+ was designated GALGNEW.
3.2.4. fnr and ralR genes
Over the course of work, the difference between GALG20 and GALGNEW was tested. As
previously said, GALG20 strain has a genomic deletion with a size of approximately 19.8 kb (rac
sequence). Two of the genes belonging to the rac sequence are fnr and ralR genes, having been
created primers for these two genes (Table 8), which will amplify the regions of interest with
approximately 611 bp, for fnr primer and 294 bp, for ralR primer.
To assess the presence of the rac sequence during GALGNEW strain construction, colony PCRs
were performed several times.
Figure 27. Agarose gel analysis of colony PCR to confirm the recA gene disruption. The lanes 1 -6 are the PCR products amplified using check primers for recA gene. The lane 7 correspond to the negative control of the reaction. The last lane
(M) is molecular weight marker NZYDNA ladder III.
7 6 5 4 3 2 1 M
60
a) Six colonies of MG1655ΔendA cells transformed with pKD46 from two LB plates
supplemented with kanamycin were selected.
The PCR products were resolved by agarose gel electrophoresis being possible to visualize the
result in the Figure 28.
Analyzing only the reactions used to test the presence of rac sequence, all colonies tested show a
positive result being represented a fragment of approximately 600 bp (lanes 8 to 13) and 400 bp
(lanes 15 to 20) which corresponds to the amplification of the fnr and ralR genes, correspondingly.
These results confirm the presence of rac sequence.
Figure 28. Agarose gel analysis of colony PCR to confirm the insertion of KanR cassette in MG1655 ∆endA + pKD46
cells and to test the presence of rac.
Lanes 1 -6 are the PCR products amplified using check primers for pgi gene.
Lane 7 corresponds to the negative control without DNA, using the same primers as in the previous samples. Lanes 8-13 and lanes 15-20 are the PCR products amplified using primers for fnr and ralR genes, respectively, in order
to confirm the presence of rac.
Lanes 14 and 21 correspond to the negative control of each of the combinations of primers.
Lanes M1, M2 and M3 are molecular weight marker NZYDNA ladder I, HyperLadder™ 50 bp and NZYDNA ladder III, respectively.
7 6 5 4 3 2 1 M2 M1 M3 8 9 10 11 12
M3 13 14 15 16 17 18 19 20 21
M1 M2
M3
61
b) Four colonies of MG1655ΔendAΔpgi cells from LB plate without antibiotics after
curing the plasmids at 43 ºC were selected.
The PCR products were resolved by agarose gel electrophoresis. The results are represented in
Figure 29.
Analyzing only the reactions used to test the presence of rac sequence, it is possible to verify that
the results are identical to the previous test.
The four colonies tested show a positive result presenting a fragment of approximately 600 bp
(lanes 1 to 4) correspondent to the amplification of the fnr gene, and 400 bp (lanes 6 to 9)
correspondent to the amplification of the ralR gene. These results confirm the presence of rac
sequence.
Posteriorly, the colonies tested were plated onto LB plate without antibiotics, LB plate
supplemented with kanamycin, LB plate supplemented with chloramphenicol and LB plate
supplemented with ampicillin and incubated at 30 ºC. On next day, a colony PCR was performed
7 6 5 4 3 2 1 M M 8 9 10
M 11 12 13 14 15
Figure 29. Agarose gel analysis of colony PCR to assess the cure of the plasmids and consequently deletion of pgi
gene in MG1655 ∆endAΔpgi cells and to test the presence of rac.
Lanes 1 -4 and 6-9 are the PCR products amplified using primers for fnr and ralR genes, respectively, to confirm the
presence of rac.
Lanes 5 and 10 correspond to the negative control of each of the combinations of primers. Lanes 11-14 are the PCR products amplified with check primers for pgi gene.
Lane 15 corresponds to the negative control without DNA, using the same primers as in the previous samples.
Lanes M are molecular weight marker NZYDNA ladder I.
62
to verify if the procedure was successful, selecting two colonies from LB plate. The resulting
product was analyzed in agarose gel electrophoresis, yielding the gel in Figure 30 .
The presence/ absence of rac sequence was assessed, one more time, using the colony
correspondent to lane 2 (MG1655ΔendAΔpgi cells) in Figure 24 and other one colony of
GALG20 strain (deletion confirmed by sequencing). A negative control without DNA was added
to PCR reaction for each primer pairs. The PCR products were resolved by agarose gel
electrophoresis (Figure 31). Therefore, it was expected that GALG20 strain does not have
amplify with primers for fnr and ralR genes.
Figure 30. Agarose gel analyses of PCR reaction to test the presence of the rac sequence using primers for fnr and
ralR genes. In the first lane (M) is molecular weight marker ladder III. The lanes 1 and 2 are the amplified products
with primers for the fnr gene. The lane 3 is the negative control prepared with water and primers for fnr gene. The
lanes 4 and 5 are the amplified products using primers for the ralR gene. The lane 6 is the negative control prepared with water and primers for ralR gene.
1 6 5 4 3 2 M
Figure 31. Agarose gel analyses of PCR reaction in order to test the presence of the rac sequence using primers for
fnr and ralR genes. In the first lane (M) is molecular weight marker ladder III.
Lanes 1 and 2 are the products resulting from amplification of DNA of the MG1655ΔendAΔpgi cells with primers
for the fnr gene.
Lane 3 is the product resulting from amplification of DNA of the GALG20 with primers for the fnr gene. Lane 4 is the negative control prepared with water and primers for fnr gene.
Lanes 5 and 6 are the amplified products using DNA of the MG1655ΔendAΔpgi cells and primers for the ralR gene.
Lane 7 is the product resulting from amplification of DNA of the MG1655ΔendAΔpgi cells and primers for ralR gene
Lane 8 is the negative control prepared with water and primers for ralR gene.
M 6 5 4 3 2 1 8 7
63
Once again, the obtained results allow to infer that the rac sequence is present in the genome of
the strain under construction. As expected, the colony of GALG20 tested shows a negative result
correspondent to the absence of rac sequence, as seen in lanes 3 and 6 of Figure 31.
c) Six colonies of MG1655ΔendAΔpgiΔrecA cells from LB plate without antibiotics
after curing the plasmids at 43 ºC were selected.
The PCR products were resolved by agarose gel electrophoresis being possible to visualize the
result in the Figure 32.
Subsequently, the positive results, correspondent to the recA gene elimination (“scar”), were re-
streaked onto a new LB plate. After this step, a new colony PCR reaction was performed selecting
three colonies from LB plate and using fnr and ralR primers. The resulting product was analyzed
in agarose gel electrophoresis, yielding the gel in Figure 33.
M 6 5 4 3 2 1 8 7 10 9
M 16 15 14 13 12 11 18 17 20 21 19
Figure 32. Agarose gel analyses of PCR reaction to test the presence of the rac sequence, using primers for fnr and ralR genes, and to assess the cure of the plasmids and consequently deletion of recA gene.
Lanes M are molecular weight marker ladder III.
Lanes 1-7 are the products resulting from amplification of DNA of the MG1655ΔendAΔpgiΔrecA cells with check primers for the recA gene.
Lanes 8-13 are the products resulting from amplification of DNA of the MG1655ΔendAΔpgiΔrecA cells with primers for
the fnr gene.
Lane 14 is the negative control prepared with water and primers for fnr gene. Lanes 15-20 are the amplified products using DNA of the MG1655ΔendAΔpgiΔrecA cells and primers for the ralR gene.
Lane 21 is the negative control prepared with water and primers for ralR gene.
64
As seen in Figure 32 and Figure 33, it is possible to conclude that the rac sequence is present in
new strain, GALGNEW, although a fragment is visible in the negative controls of each reaction
(Lane 14 in Figure 32 and lanes 4-(A) and 4-(B) in Figure 33).
These results also attest the difference between the two engineered strains (GALG20 and
GALGNEW), mentioned in section 2.14..
3.3. CRISPR Cas9- System method
3.3.1. Construction of plasmid pKDsg-zwf
As mentioned in section 2.4.3, the pKDsg-zwf plasmid was constructed from pKDsg-ack
plasmid, by cloning the specific target. For this, two PCR reactions and one CPEC reaction were
made. The two PCR products were separated by agarose gel electrophoresis. According to the
sequence of the pKDsg-ack plasmid analyzed by the ApE software, the expected fragment 1
should have 2,845 bp generated using oligonucleotides “zwf-pfragfwd” and “pKDsgRNA-
frag1rev”, and fragment 2 should have 4,414 bp, resulted from the amplification with
oligonucleotides “pKDsgRNA-frag2fwd” and “zwf-pfragrev”. These oligonucleotides are
presented in Table 13.
The obtained results were the expected and can be seen in Figure 34 – (A).
Figure 33. Agarose gel analyses of PCR reaction to test the presence of the rac sequence, using primers for ralR (A) and fnr (B) genes.
Lanes M are molecular weight marker ladder III.
Image (A): Lanes 1 to 3 are the products resulting from amplification of DNA of the MG1655ΔendAΔpgiΔrecA cells with primers for the ralR gene.
Lane 4 is the negative control prepared with water and primers for ralR gene.
Image (B): Lanes 1 to 3 are the products resulting from amplification of DNA of the MG1655ΔendAΔpgiΔrecA cells
with primers for the fnr gene.
Lane 4 is the negative control prepared with water and primers for fnr gene.
65
After excision and purification of the fragments a quantification of fragments concentration was
made, 20.5 ng/ µL for the fragment 1 and 35.0 ng/ µL for the fragment 2. Subsequently, these two
fragments were ligated by a CPEC reaction (section 2.4.3) and transformed into chemically
competent DH5α cells. The transformed cells were plated onto LB plate supplemented with
spectinomycin. 48 hours later, three colonies in the inoculated LB plate, supplemented with
spectinomycin, were observed. After purification, the concentration of 109.0 ng/ µL for pKDsg-
zwf was obtained and the size of the plasmid analyzed in 1 % agarose gel. The result is represented
in Figure 34 – (B). The ligation of these two fragments generated a fragment with approximately
4,000 – 5,000 bp, size slightly smaller than expected (6,959 bp).
3.4. Shake flask cultivation
The pgi gene of the wild type E. coli strain MG1655 was knocked out with the goal of redirecting
the carbon flux into the pentose phosphate pathway to increase nucleotide synthesis (R5P and
E4P) required for the pDNA synthesis and NADPH generation. The elimination of endA and recA
genes were made in wild-type strain (MG1655) to minimize recombination and nonspecific
digestion of DNA, as mentioned in section 1.4.
After the construction of the new strain (GALGNEW), it was necessary to evaluate cell growth
behavior as well as pDNA production. To do that, shake flask cultivations were performed
following three strategies (C1, C2 and C3), using complex medium supplemented with glucose
(20 g/ L) and kanamycin (30 µg/ mL) at pH 7.1, as described in section 2.10. The growth
parameters (OD600nm and pH) of the mutant strains (GALG20 and GALGNEW) (all strategies)
(A) (B)
Figure 34. Agarose gel analyses: (A) result of PCR reaction to generate, separately, two fragments that constitute the pKDsg-zwf plasmid. In the first lane (M) is molecular weight marker ladder III. The lanes 1 and 2 are the amplified
products. (B) After CPEC reaction, the pKDsg-zwf was transformed into DH5α cells, purified and quantified. 1,000
ng of purified plasmid was analized in 1% agarose gel. In the first lane (M) is molecular weight marker ladder III. The
lane 1 is the amplified product corresponding to the pKDsg-zwf plasmid.
2 1 M M 1
66
and wild type strain (MG1655) (strategy C3) were measured. All strains were transformed with
pVAX1GFP. In strategy C2, contrary to strategy C1, the growth parameters were measured only
at 24 h of growth. The results obtained in each of the strategies carried out were analyzed and
graphically represented Figure 35.
67
Figure 35. Effect of endA, recA and pgi genes knockout on biomass production and variation of medium pH, following three strategies of shake flask cultivations (C1, C2 and C3). (A) Biomass
produced in GALG20 and GALGNEW strains following strategy C1. Optical density was measured at 0 h, 4 h, 8 h, 10 h and 24 h of growth. Plots depict mean values ± standard error of mean (SEM) of the four independent experiments. (B) Variation of medium pH during growth of GALG20 and GALGNEW strains following strategy C1. pH was measured at 0 h, 4 h, 8 h, 10 h and
24 h of growth. Plots depict mean values ± standard error of mean (SEM) of the four independent experiments at 10 h and 24 h. (C) Biomass produced in GALG20 and GALGNEW strains
following strategy C2. Optical density was measured at 24 h of growth, during six days. (D) Variation of medium pH during growth of GALG20 and GALGNEW strains following strategy C2.
pH was measured at 24 h of growth. Plots depict mean values ± standard error of mean (SEM) of the six independent experiments. (E) Biomass produced in GALG20, GALGNEW and MG1655 strains following strategy C3. Optical density was measured at 0 h, 4 h, 8 h, 10 h, 17 h and 24 h of growth. Plots depict mean values ± standard error of mean (SEM) of the one independent
experiment. (F) Variation of medium pH during growth of GALG20, GALGNEW and MG1655 strains following strategy C3. pH was measured at 24 h of growth. Plots depict mean values ±
standard error of mean (SEM) of the one independent experiment at 10 h, 17 h and 24 h.
C A B
F E D
68
The data show that the mutant strains (GALG20 and GALGNEW) demonstrated to have a similar
growth behavior, reaching stationary phase after approximately 8 hours (Figure 35- A), as well
as the pH variation pattern of the medium (Figure 35- B). The optical density (OD600nm) of 26.9
was obtained for GALG20 after 10 h, value slightly below in comparison with previous studies,
which obtained an optical density of 30 for GALG20 [49]. The final OD600nm value achieved was
slightly higher for GALGNEW (32.6 ± 2.7) than for GALG20 (31.4 ± 2.0). These final OD600nm
values are similar to the values obtained by carrying out the C2 strategy (Figure 35- C), in which
it is possible verify higher values for the new strain (33.1 ± 1.0) comparing with GALG20 (30.8
± 0.9). Relatively to the pH analysis of the culture medium after 24 h of growth, a significant drop
(approximately 2%) between the strategy C1 (Figure 35- B) and C2 (Figure 35- D) is visible in
both of strains: (to 6.6 ± 0.07 for 6.45 ± 0.03, in GALGNEW, and to 6.4 ± 0.11 for 6.26 ± 0.02 in
GALG20).
To obtain a more complete evaluation of the behavior of the mutant strains in culture medium,
these were compared with MG1655, following the strategy C3. As seen in Figure 35- E, after 10
h, MG1655 did not surpass OD600nm values of 2, an unusual result when compared with previous
studies that indicate OD600nm value of approximately 10, for the same strain at the same time [49].
Nevertheless, the wild-type strain reached a final OD600nm value of 8.8 ± 0.2. As expected,
GALG20 demonstrates a higher growth kinetic when compared to MG1655 during the growth,
although the values obtained are much lower (OD600nm = 11 ± 0.8) than the expected values
(OD600nm = 30), at the 10 h of growth [49]. However, the GALGNEW surpassed the remaining
strains reaching OD600nm value at the same time (10 h) of 14.8 ± 1.2.
Analyzing the variation of pH in this strategy (Figure 35- F), it is possible observe a radically
decrease to 6.6 at 10 h for 4.8 at 24 h for MG1655. For the other two strains, the pH was constant
throughout the growth. As expected, the pH shows similar values between mutant strains because
both strains were deleted in pgi gene [49].
3.5. Measurement of glucose and plasmid DNA quantification
As mentioned in section 1.4., the knockout of the pgi gene redirects glycolytic flux, increasing
fluxes in the pentose phosphate pathway and enhancing nucleotide synthesis and NADPH
production. However, glycolysis would continue due to the generation of fructose-6-phosphate
and glyceraldeyde-3-phosphate [48]. Glucose is a preferred carbon source and was used in shake
flask cultivations. This experiment was conducted with an initial concentration of glucose of 20
g/ L. All samples were collected at 0, 4, 8, 10 and 24 h of growth during four days of independent
growth (strategy C1). As described in section 2.11, the samples were centrifuged and the glucose
level was quantified in a high performance liquid chromatography (HPLC) system and after the
glucose consumption was measured as a function of the cell density (OD600nm). Assays with the
wild-type strain were not performed. The results are represented in Figure 36.
69
The glucose consumption and the biomass formation profiles are similar between the two pgi
mutant strains (GALG20 and GALGNEW). For the same concentration of glucose (20 g/ L),
MG1655 ∆endA∆recA strain did not surpass of biomass of 3.5 ± 0.3 [48].
The strains carrying high-copy pDNA require extra synthesis of nucleotides and that the carbon
flux into the PP pathway may not be sufficient to meet cellular needs. To increase the synthesis
of these elements (nucleotides and reducing cofactors), the pgi gene was knockout [48].
To compare the pDNA production potential of mutant strains (GALG20 and GALGNEW),
samples were collected to an OD600nm = 10 at hour 8 of shake flask cultivation (samples from
strategy C1). Collected samples were centrifuged for cell recovery and then purified using the
High Pure Plasmid Isolation Kit (Roche) and its recommended protocol. After determination of
the concentration using Nanodrop Spectrophotometer, the data were graphically represented in
Figure 37.
The volumetric plasmid yield (mg/ L) is relative to the total productivity of the cell culture, and,
as seen in Figure 37, GALG20 appears to have higher productivity in comparison with
Figure 36. Results of the quantification of glucose consumption throughout the growth versus biomass (OD600nm) for
GALG20 and GALGNEW. The presented results derived from average values of 4 days of growth. Glucose
concentration was measured in duplicates by HPLC.
Figure 37. Quantification of plasmid DNA yield volumetric (mg/ L) using two pgi mutant strains: GALG20 and
GALGNEW grown in glucose, following strategy C1. Strains were grown for 24 h in shake flasks (37 °C, 250 rpm)
with rich medium supplemented with 20 g/ L of glucose. Plots depict mean values ± standard error of mean (SEM)
of the four independent experiments.
8 h of growth
70
GALGNEW, reaching values of 204.3 ± 44.3 (mg/ L) and 169.2 ± 14.3 (mg/ L), respectively.
The values of volumetric plasmid yield for GALG20 are much higher than the values described
in previous studies of 140.8 ± 0.8 (mg/ L) [48].
The pDNA production profiles between wild-type strains and mutant strains also were studied
(strategy C3). The main difference comparing the previous studies is the time of growth at
which the cells were harvested (hour 17 of growth). As is possible observe in Figure 36, it is
still possible to verify the presence of glucose in the growth medium. The results are present in
Figure 38.
Contrary to that observed in Figure 37, GALGNEW appears to have higher productivity in
comparison with GALG20. The expected result would be a higher plasmid DNA production in
GALG20 and in GALGNEW strains, in comparison to MG1655 cells. However, the differences
in pVAX1GFP production between the GALG20 and MG1655 strains are not as high as described
in previous studies, probably due to deletion of pgi gene.
According to the literature, the effect of glucose on pDNA production is not the same in all of
strains. In order to determine this effect, Gonçalves and co-workers [48] studied the influence of
the concentration of glucose on pDNA production in several strains, such as: MG1655
∆endA∆recA and GALG20, in three different conditions: 5 g/ L of glucose initially plus 10 g/ L
of glucose after 12 h, 10 g/ L of glucose initially plus 10 g/ L of glucose after 12 h and 20 g/ L
with no extra addition of glucose. The authors verified that MG1655 ∆endA∆recA produced 5-
fold more pVAX1GFP in 5 + 10 g/ L of glucose than 20 g/ L of glucose. However, the same result
was not obtained for GALG20, which appears to have higher productivity in 20 g/ L of glucose
[10.9 ± 0.2 (mg/ L)], when comparing with the other percentage of carbon sources. The deletion
of endA, recA and pgi genes contributed to an increase in pVAX1GFP production. A significant
difference between GALG20 and GALGNEW can be observed, where the new strain appears to
have higher productivity than other strains. This difference may be due to the presence of the rac
sequence in the genome of GALGNEW.
Figure 38. Quantification of plasmid DNA yield volumetric (mg/ L) using two pgi mutant strains: GALG20 and
GALGNEW, and wild-type strain: MG1655, grown in glucose, following strategy C3. Strains were grown for 24 h in shake flasks (37 °C, 250 rpm) with rich medium supplemented with 20 g/ L of glucose. Plots depict mean values of the
one independent experiment.
71
3.6. Genomic deletion analysis
The presence of one unintended secondary genomic deletion of approximately 20 kb in the
genome of GALG20 strain (rac sequence) was identified. As mentioned in section 2.14, several
PCR reactions were realized using primers for fnr and ralR genes. Posteriorly, new confirmations
to assess the absence of rac sequence in GALG20 were performed after 12 subcultures and one
subculture in LB plate, to achieve purer colonies. Several combinations of primers presented
inside and outside of genomic deletion were using, as illustrated in Figure 18.
The results obtained are present in Figure 39. In order to facilitate the analysis of the results, a
table was created with the expected results and the results obtained for each sample (Table 21).
Figure 39. Agarose gel analyses of PCR reaction to screen for the genomic deletion in GALG20 strain. The ninth
lane (L) is molecular weight marker ladder III. Lanes 1 -8 are amplified DNA from fresh colony of one subculture.
Lanes 9 -16 are amplified DNA from fresh colony of twelve subcultures. Lanes 17- 24 are negative controls prepared without DNA. Lane 25 is a positive control prepared with primers for recA gene.
72
Table 21. Expected and obtained results for the PCR reaction to test the genomic deletion in GALG20 strain.
When analyzing the obtained PCR
analysis results it is possible to verify
that the strain GALG20 presents a
dubious result (orange boxes) with
the possibility of mixed population in
the same colony, even after 12
continuous subcultures. These results
are contradictory with those obtained
in the first sequencing of GALG20,
which demonstrated the absence of
rac sequence.
To unravel this doubt, the genome of
the strain was again sequenced.
Relatively to GALGNEW, as
mentioned throughout the results
presented in section 3.2.4., the
presence of this phage sequence (rac
sequence) in its genome is
guaranteed.
Lanes
Combination
Primers
Expected
result
(bp)
Obtained
result (bp) G
AL
G2
0
(1 s
ub
cult
ure
)
1 F1R1 0 Inconclusive
2 F1R2 616 600
3 F1R3 0 Inconclusive
4 F1R4 859 >600
5 F2R1 0 >200
6 F2R2 0 800
7 F2R3 0 400
8 F2R4 0 0
GA
LG
20
(12
su
bcu
ltu
res)
9 F1R1 0 Inconclusive
10 F1R2 616 >600
11 F1R3 0 Inconclusive
12 F1R4 859 >600
13 F2R1 0 ~200
GA
LG
20
(12
subcu
ltu
res)
14 F2R2 0 0
15 F2R3 0 400
16 F2R4 0 0
Neg
ativ
e co
ntr
ols
17 F1R1 0 400-600
18 F1R2 0 600
19 F1R3 0 600-800
20 F1R4 0 600-800
21 F2R1 0 200
22 F2R2 0 0
23 F2R3 0 200-400
24 F2R4 0 0
Po
siti
ve
Co
ntr
ols
25 recA ~400 200-400
73
3.7. DNA sequencing results
GALG20 and GALGNEW strains were sequenced by Instituto Gulbenkian de Ciência.
The sequenced genome was analyzed in Geneious 6.1.8 software by Professor Leonilde Moreira
and doctor Inês Silva Nunes.
The genomic deletion region is located, approximately, between the position 1,397,239 bp and
the position 1,417,119 bp. When this genomic fragment, with around 20 kb, is present as in case
of GALGNEW strain, many reads are observed in this region (Figure 40).
The sequencing of the GALGNEW strain (Figure 40 – A) allowed not only to confirm the correct
deletion of the endA, pgi and recA genes but also to validate the results obtained in PCR reactions,
in which fnr and ralR primers were used. According to the results obtained by sequencing, the rac
sequence is not present in the GALG20 genome (Figure 40 – B), although this result was not
obtained in all PCR reactions carried out.
Figure 40. Output of genomic DNA sequencing of mutant strains. Analysis of genomic deletion sequence. Top
figure: Segment of genomic DNA of GALGNEW strain. Bottom figure: Segment of genomic DNA of GALG20
strain.
A
B
74
4. Conclusion and Future Work
Plasmid DNA market is expected to increase in the next years, being necessary to create a system
with high productivity and low costs. Several studies have been performed with the goal of
improving both upstream and downstream processes of plasmid DNA production process.
However, there is still no consensus on what strategy is the best in all parameters.
The goal of this project was to verify the influence of deleted target genes, such as pgi, endA and
recA, on plasmid DNA production on GALGNEW strain, comparing with GALG20 and
MG1655. There are a few previous studies that indicate that pgi gene deletion would have a
positive impact on pDNA production by increasing the reducing power available for pDNA [48],
[49]. This result was obtained when the three strains (MG1655, GALG20 and GALGNEW) were
grown under the same conditions and the plasmid DNA production yield was measured.
Differences in growth kinetics were also observed between wild-type strain and mutant strains.
The main difference found between mutant strains in the rac sequence, an unintended secondary
genomic deletion of approximately 20 kb was identified in the genome of GALG20 strain. The
presence of this phagic sequence was confirmed in the genome of GALGNEW strain. Rac
sequence may be the reason why the GALGNEW strain achieves OD600nm values and plasmid
produced values higher than the other two strains. As mentioned in Introduction, the deletion of
rac sequence leads to a decrease in resistance to acid stress, oxidate stress and antibiotic stress.
The second goal of this work was verify the influence of zwf gene deletion on plasmid DNA
production on GALGNEW strain. This objective has not been completed, but I hope to have the
opportunity to further develop it in the future. There are a few previous studies that indicate
several results, such as:
- That overexpression of this gene would have a positive impact on pDNA production by
increasing the reducing power available for pDNA [84].
- The flux distribution in the zwf- over -expressing mutant was similar to that obtained for
the wild-type parent strain [54].
In conclusion, there are still a lot of studies to perform in order to identify a strategy that increases
plasmid productivity and quality, reducing the production costs. In addition to modifying genes
related to plasmid productivity it is also necessary to increase stability and safety. It is known that
plasmid productivity reaches a plateau in which the cells cannot produce higher quantities.
Therefore, as future work, it is necessary to investigate the influence of simultaneous deletion of
endA, pgi, recA and zwf genes in MG1655 strains following CRISPR- Cas9 System protocol [55].
There are several feeding strategies that can be used in the process of pDNA production by
varying the fermentation strategies (batch or fed-batch fermentation), medium composition,
carbon sources at several concentrations (glucose or glycerol), genes to be deleted (pykF, pykA,
ack-pta) and test the overexpression of some genes (zwf and rpiA) using several strains beyond
the wild-type strain (MG1655), such as highly mutagenized genetic background (DH5α) [48].
The single and double knockouts of pykF and pykA leads to an increase of pDNA synthesis in
different E. coli strains, once this deletion reduces the acetate production and increase carbon flux
into the PPP [48].
75
5. References
[1] K. A. Datsenko, B. L. Wanner, and J. Beckwith, “One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products.”
[2] X. Liu, Y. Li, Y. Guo, Z. Zeng, B. Li, T. K. Wood, X. Cai, and X. Wang, “Physiological Function
of Rac Prophage During Biofilm Formation and Regulation of Rac Excision in Escherichia coli
K-12.,” Sci. Rep., vol. 5, no. November, p. 16074, 2015.
[3] “Proteobacteria.” [Online]. Available: http://www.gbif.org/species/362. [Accessed: 22-Sep-2016].
[4] E. H. Halococcus, N. M. Methanocaldococcus, C. Archaeoglobus, M. Sulfolobus, M.
Methanospirillum, P. Thermococcus, P. Nanoarchaeum, M. Desulfurococcus, P. Thermoproteus,
and T. Ferroplasma, Biology of Microorganisms. .
[5] T. R. Callaway, M. A. Carr, T. S. Edrington, R. C. Anderson, D. J. Nisbet, F. Safety, and S. P.
Ag-, “Diet , Escherichia coli O157 : H7 , and Cattle : A Review After 10 Years,” vol. 1, no. 979,
pp. 67–80, 2007.
[6] J. B. Kaper, J. P. Nataro, and H. L. T. Mobley, “Pathogenic Escherichia coli,” Nat. Rev.
Microbiol., vol. 2, no. 2, pp. 123–140, 2004.
[7] C. H. Henry and L. Xiaoming, “Industrial production of recombinant therapeutics in Escherichia
coli and its recent advancements,” pp. 383–399, 2012.
[8] Nandkishor Jha, “Pharmaceutical Products of Recombinant DNA Technology.” [Online].
Available: http://www.biologydiscussion.com/dna/pharmaceutical-products-of-recombinant-dna-
technology/10015. [Accessed: 25-Sep-2016].
[9] B. J. Bachmann, “Pedigrees of some mutant strains of Escherichia coli K-12,” Bacteriol Rev, vol.
36, no. 4, pp. 525–557, 1972.
[10] F. R. Blattner, G. Plunkett, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-vides, J. D.
Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden,
D. J. Rose, B. Mau, and Y. Shao, “The Complete Genome Sequence of Escherichia coli K-12,”
Sci. Mag, vol. 277, no. September, pp. 1453–1462, 1997.
[11] B. J. Bachmann, “Derivations and Genotypes of Some Mutant Derivatives of Escherichia coli K-
12,” Escherichia coli Salmonella typhimurium Cell. Mol. Biol., no. 143, pp. 2460–2488, 1996.
[12] K. Hayashi, N. Morooka, Y. Yamamoto, K. Fujita, K. Isono, S. Choi, E. Ohtsubo, T. Baba, B. L.
Wanner, H. Mori, and T. Horiuchi, “Highly accurate genome sequences of Escherichia coli K-12
strains MG1655 and W3110,” Mol. Syst. Biol., vol. 2, no. 1, p. 2006.0007, 2006.
[13] G. A. L. Gonçalves, D. M. Bower, D. M. F. Prazeres, G. A. Monteiro, and K. L. J. Prather,
“Rational engineering of Escherichia coli strains for plasmid biopharmaceutical manufacturing,”
Biotechnol. J., vol. 7, no. 2, pp. 251–261, 2012.
[14] A. R. L. and O. T. Ramírez, Plasmid DNA Production for Therapeutic Applications, vol. 267.
2004.
[15] et al. Lodish H, Berk A, Zipursky SL, “DNA Cloning with Plasmid Vectors,” Molecular Cell
Biology. 4th edition. New York: W. H. Freeman, 2000. [Online]. Available:
https://www.ncbi.nlm.nih.gov/books/NBK21498/. [Accessed: 08-Oct-2016].
[16] J. Glenting and S. Wessels, “Ensuring safety of DNA vaccines.,” Microb. Cell Fact., vol. 4, p. 26,
2005.
[17] D. L. Montgomery and K. J. Prather, “Design of plasmid DNA constructs for vaccines.,” Methods
Mol. Med., vol. 127, pp. 11–22, 2006.
[18] R. B. Moss, “Prospects for control of emerging infectious diseases with plasmid DNA vaccines.,”
J. Immune Based Ther. Vaccines, vol. 7, p. 3, 2009.
[19] L. Pasteur, “the Development of Vaccines,” vol. 24, no. 70, pp. 19–30, 2010.
[20] and C. P. H. James A Williamsa,*, Aaron E Carnesa, “Plasmid DNA Vaccine vector design:
impact on efficacy, safety and upstream production,” Clin. Lymphoma, vol. 9, no. 1, pp. 19–22,
2010.
[21] “Gene therapy clinical trials worldwide.” [Online]. Available:
http://www.wiley.com//legacy/wileychi/genmed/clinical/. [Accessed: 11-Oct-2016].
[22] P. Bonanni and J. I. Santos, “Vaccine evolution,” Perspect. Vaccinol., vol. 1, no. 1, pp. 1–24,
2011.
[23] J. Gonçalves, “Adaptive immune system,” 2015.
[24] O. Finco and R. Rappuoli, “Designing vaccines for the twenty-first century society,” Front.
Immunol., vol. 5, no. JAN, pp. 865–872, 2014.
76
[25] B. Ferraro, M. P. Morrow, N. A. Hutnick, T. H. Shin, C. E. Lucke, and D. B. Weiner, “Clinical
applications of DNA vaccines: Current progress,” Clin. Infect. Dis., vol. 53, no. 3, pp. 296–302,
2011.
[26] R. Strugnell, F. Zepp, A. Cunningham, and T. Tantawichien, “Vaccine antigens,” Perspect.
Vaccinol., vol. 1, no. 1, pp. 61–88, 2011.
[27] K. D. and S. V. S. A.K. Singh, A.K. Verma, Neha , Ruchi Tiwari , K. Karthik, “Plant
Vaccine.Pdf,” Journal of Biological Sciences, vol. 14, no. 2. pp. 95–109, 2014.
[28] “UNDERSTANDING VACCINES.” [Online]. Available: http://www.publichealth.org/public-
awareness/understanding-vaccines/vaccines-work/. [Accessed: 08-Oct-2016].
[29] “Types of vaccines.” [Online]. Available: http://www.vaccines.gov/more_info/types/. [Accessed:
08-Oct-2016].
[30] A. Tejeda-Mansir and R. Montesinos, “Upstream Processing of Plasmid DNA for Vaccine and
Gene Therapy Applications,” Recent Pat. Biotechnol., vol. 2, no. 3, pp. 156–172, 2008.
[31] V. B. Pereira, M. Zurita-Turk, T. D. L. Saraiva, C. P. De Castro, B. M. Souza, P. Mancha Agresti,
F. A. Lima, V. N. Pfeiffer, M. S. P. Azevedo, C. S. Rocha, D. S. Pontes, V. Azevedo, and A.
Miyoshi, “DNA Vaccines Approach: From Concepts to Applications,” World J. Vaccines, vol. 4,
no. 2, pp. 50–71, 2014.
[32] D. A. Blanks, “Immunostimulatory sequences in immunotherapy,” Otolaryngol. Head Neck
Surg., pp. 281–285, 2007.
[33] J. H. Van Uden and E. Raz, “Immunostimulatory DNA Sequences,” Methods, vol. 29, pp. 145–
168.
[34] J. A. Williams, “Vector Design for Improved DNA Vaccine Efficacy, Safety and Production,”
Vaccines, vol. 1, pp. 225–249, 2013.
[35] “Vaccine components,” Natl. Cent. Immun. Res. Surveillanve, vol. 2013, no. May, pp. 1–5, 2013.
[36] M. S. Levy, R. D. O’Kennedy, P. Ayazi-Shamlou, and P. Dunnill, “Biochemical engineering
approaches to the challenges of producing pure plasmid DNA,” Trends Biotechnol., vol. 18, no. 7,
pp. 296–305, 2000.
[37] “Large Scale CGMP Manufacturing of pDNA for Gene Therapy.” [Online]. Available:
https://books.google.pt/books?id=iE-alhelixoC&lpg=PA151&ots=GfFJYmmEwt&dq=therapeutic
doses required for cardiovascular diseases are often 1 mg to 10 mg of pDNA&hl=pt-
PT&pg=PA151#v=onepage&q=therapeutic doses required for cardiovascular diseases are often.
[Accessed: 14-Oct-2016].
[38] G. Mor and M. Eliza, “Plasmid DNA Vaccines,” vol. 19, 2001.
[39] P. H. Oliveira, K. J. Prather, D. M. F. Prazeres, and G. A. Monteiro, “Structural instability of
plasmid biopharmaceuticals: challenges and implications,” Trends Biotechnol., vol. 27, no. 9, pp.
503–511, 2009.
[40] P. H. Oliveira and J. Mairhofer, “Marker-free plasmids for biotechnological applications -
implications and perspectives,” Trends Biotechnol., vol. 31, no. 9, pp. 539–547, 2013.
[41] J. R. Cooke, E. A. McKie, J. M. Ward, and E. Keshavarz-Moore, “Impact of intrinsic DNA
structure on processing of plasmids for gene therapy and DNA vaccines,” J. Biotechnol., vol. 114,
no. 3, pp. 239–254, 2004.
[42] V. B. Pillai, M. Hellerstein, T. Yul, R. R. Amara, and L. Robinson, “Comparative studies on in
vitro expression and in vivo immunogenicity of supercoiled and open circular forms of plasmid
DNA vaccines,” vol. 26, no. 8, pp. 1136–1141, 2009.
[43] A. Carattoli, “Plasmids in Gram negatives: Molecular typing of resistance plasmids,” Int. J. Med.
Microbiol., vol. 301, no. 8, pp. 654–658, 2011.
[44] G. del Solar, R. Giraldo, M. J. Ruiz-Echevarría, M. Espinosa, and R. Díaz-Orejas, “Replication
and control of circular bacterial plasmids.,” Microbiol. Mol. Biol. Rev., vol. 62, no. 2, pp. 434–
464, 1998.
[45] Michele A. Kutzler* and David B. Weiner‡, “DNA vaccines: ready for prime time?,” Biophys.
Chem., vol. 257, no. 5, pp. 2432–2437, 2005.
[46] “pVAX1.” [Online]. Available: http://www.yrgene.com/documents/vector/pvax1.pdf. [Accessed:
03-Oct-2016].
[47] D. S. W. Ow, P. M. Nissom, R. Philp, S. K. W. Oh, and M. G. S. Yap, “Global transcriptional
analysis of metabolic burden due to plasmid maintenance in Escherichia coli DH5α during batch
fermentation,” Enzyme Microb. Technol., vol. 39, no. 3, pp. 391–398, 2006.
[48] G. A. L. Gonçalves, D. M. F. Prazeres, G. A. Monteiro, and K. L. J. Prather, “De novo creation of
MG1655-derived E. coli strains specifically designed for plasmid DNA production,” Appl.
77
Microbiol. Biotechnol., 2013.
[49] C. P. A. Alves, O. D. Duarte, A. Gabriel, and M. F. Prazeres, “Use of an E. coli pgi Knockout
Strain as a Plasmid Producer,” BioPharm Int., no. February, pp. 2–6, 2016.
[50] “endA gene.” [Online]. Available: http://ecocyc.org/gene?orgid=ECOLI&id=EG11336.
[Accessed: 13-Oct-2016].
[51] T. Shibata, “recA protein,” Tanpakushitsu Kakusan Koso., vol. 32, no. 1, pp. 69–76, 1987.
[52] S. Y. Yau, E. Keshavarz-Moore, and J. Ward, “Host strain influences on supercoiled plasmid
DNA production in Escherichia coli: Implications for efficient design of large-scale processes,”
Biotechnol. Bioeng., vol. 101, no. 3, pp. 529–544, 2008.
[53] J. Zhao, T. Baba, H. Mori, and K. Shimizu, “Effect of zwf gene knockout on the metabolism of
Escherichia coli grown on glucose or acetate,” Metab. Eng., vol. 6, no. 2, pp. 164–174, 2004.
[54] C. Nicolas, P. Kiefer, F. Letisse, J. Krömer, S. Massou, P. Soucaille, C. Wittmann, N. D. Lindley,
and J. C. Portais, “Response of the central metabolism of Escherichia coli to modified expression
of the gene encoding the glucose-6-phosphate dehydrogenase,” FEBS Lett., vol. 581, no. 20, pp.
3771–3776, 2007.
[55] C. R. Reisch and K. L. J. Prather, “The no-SCAR (Scarless Cas9 Assisted Recombineering)
system for genome editing in Escherichia coli,” Nat. Publ. Gr., 2015.
[56] W. Saltzman, H. Shen, and J. Brandsma, Eds., DNA Vaccines Methods and protocols, Second.
New Jersey, 2006.
[57] “Electroporation.” [Online]. Available:
https://www.thermofisher.com/pt/en/home/references/gibco-cell-culture-basics/transfection-
basics/transfection-methods/electroporation.html. [Accessed: 19-Nov-2016].
[58] “Transformation by Heat Shock.” [Online]. Available:
https://worldwide.promega.com/resources/pubhub/enotes/how-are-competent-bacterial-cells-
transformed-with-a-plasmid/. [Accessed: 19-Nov-2016].
[59] G. A. L. Gonçalves, K. L. J. Prather, G. A. Monteiro, A. E. Carnes, and D. M. F. Prazeres,
“Plasmid DNA production with Escherichia coli GALG20, a pgi-gene knockout strain:
Fermentation strategies and impact on downstream processing,” J. Biotechnol., vol. 186, pp. 119–
127, 2014.
[60] “oriR101&repA101ts.” [Online]. Available: http://partsregistry.org/Part:BBa_K524000.
[Accessed: 13-Sep-2016].
[61] “Red recombinase plasmid pKD46, complete sequence.” [Online]. Available:
http://www.ncbi.nlm.nih.gov/nuccore/AY048746.1. [Accessed: 01-Aug-2016].
[62] B. Doublet, G. Douard, H. Targant, D. Meunier, J. Y. Madec, and A. Cloeckaert, “Antibiotic
marker modifications of λ- Red and FLP helper plasmids, pKD46 and pCP20, for inactivation of
chromosomal genes using PCR products in multidrug-resistant strains,” J. Microbiol. Methods,
vol. 75, no. 2, pp. 359–361, 2008.
[63] T. Baba, T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K. A. Datsenko, M. Tomita, B.
L. Wanner, and H. Mori, “Construction of Escherichia coli K-12 in-frame, single-gene knockout
mutants: the Keio collection.,” Mol. Syst. Biol., vol. 2, p. 2006.0008, 2006.
[64] R. Abdoli, S. Amirthalingam, a Lillquist, and J. Nutt, “Effect of L-arabinose on the specific
homologous recombination efficiency using the Lambda Red Recombinase system for gene
disruption of lacI in Escherichia coli C29 cells,” J. Exp. Microbiol. Immunol., vol. 11, no. April,
pp. 120–124, 2007.
[65] “Invitrogen.” [Online]. Available: https://www.thermofisher.com/pt/en/home/life-
science/cloning/competent-cells-for-transformation/chemically-competent/dh5alpha-
genotypes.html. [Accessed: 02-Aug-2016].
[66] “pKDsg-ack plasmid.” [Online]. Available: https://www.addgene.org/62654/. [Accessed: 18-
Aug-2016].
[67] “pKDsg-p15 plasmid.” [Online]. Available: https://www.addgene.org/62656/. [Accessed: 18-
Aug-2016].
[68] “Plasmids 101: Origin of Replication.” [Online]. Available: http://blog.addgene.org/plasmid-101-
origin-of-replication. [Accessed: 12-Sep-2016].
[69] “noSCAR Protocol.” [Online]. Available: https://www.addgene.org/62654/. [Accessed: 27-Sep-
2016].
[70] “DpnI.” [Online]. Available: https://www.neb.com/products/r0176-dpni. [Accessed: 18-Nov-
2016].
[71] I. Plasmid, D. Digest, and M. Primers, “Site Directed Mutagenesis Protocol,” Program, vol. 3, pp.
78
1–2, 2005.
[72] J. Q. and J. Tian and J. Quan, “Circular Polymerase Extension Cloning of Complex Gene
Libraries and Pathways,” PLoS One, vol. 4, no. 7, p. e6441, 2009.
[73] Qiagen, “QIAquick ® Gel Extraction Kit - Manual,” no. July, pp. 6–7, 2015.
[74] Roche, “High Pure Plasmid Isolation Kit, Version 8 (Handbuch),” Mannheim, Deutschl., 2011.
[75] “BamHI restriction enzymes.” [Online]. Available:
https://worldwide.promega.com/products/cloning-and-dna-markers/restriction-enzymes/bamhi/.
[Accessed: 31-Aug-2016].
[76] “HindIII restriction enzyme.” [Online]. Available:
https://worldwide.promega.com/products/cloning-and-dna-markers/restriction-enzymes/hindiii/.
[Accessed: 31-Aug-2016].
[77] “EcoRI restriction enzyme.” [Online]. Available:
https://worldwide.promega.com/products/cloning-and-dna-markers/restriction-enzymes/ecori/.
[Accessed: 31-Aug-2016].
[78] “KpnI restriction enzyme.” [Online]. Available:
https://worldwide.promega.com/products/cloning-and-dna-markers/restriction-enzymes/kpni/.
[Accessed: 31-Aug-2016].
[79] “BglII restriction enzymes.” [Online]. Available:
https://worldwide.promega.com/products/cloning-and-dna-markers/restriction-enzymes/bglii/.
[Accessed: 31-Aug-2016].
[80] “Composition of Promega Restriction Enzyme Reaction Buffers (1X).” [Online]. Available:
https://www.promega.com/-/media/files/resources/technical-references/restriction-enzyme-1x-
buffer-composition.pdf. [Accessed: 16-Dec-2016].
[81] J. L. Hobman, M. D. Patel, G. A. Hidalgo-Arroyo, S. J. L. Cariss, M. B. Avison, C. W. Penn, and
C. Constantinidou, “Comparative genomic hybridization detects secondary chromosomal
deletions in Escherichia coli K-12 MG1655 mutants and highlights instability in the flhDC
region,” J. Bacteriol., vol. 189, no. 24, pp. 8786–8792, 2007.
[82] “TopicPage for Rac of Escherichia coli K-12.” [Online]. Available:
http://www.ecogene.org/old/topic.php?topic_id=100. [Accessed: 17-Jan-2017].
[83] “Datasheet_Miseq.Pdf.” .
[84] D. S. Cunningham, R. R. Koepsel, M. M. Ataai, and M. M. Domach, “Factors affecting plasmid
production in Escherichia coli from a resource allocation standpoint.,” Microb. Cell Fact., vol. 8,
no. 1, p. 27, 2009.
[85] E. Noor, E. Eden, R. Milo, and U. Alon, “Central Carbon Metabolism as a Minimal Biochemical
Walk between Precursors for Biomass and Energy,” Mol. Cell, vol. 39, no. 5, pp. 809–820, 2010.
[86] S. Z. Geng, X. A. Jiao, Z. M. Pan, Q. Fang, Z. F. Wen, and X. Chen, “A simpler method for the
efficient and precise deletion of genes in Salmonella sp.,” J. Anim. Vet. Adv., vol. 10, no. 16, pp.
2090–2094, 2011.
[87] “CPEC reaction.” [Online]. Available: https://j5.jbei.org/j5manual/pages/22.html. [Accessed: 18-
Nov-2016].
[88] K. Reddy, M. Tam, R. P. Bowater, M. Barber, M. Tomlinson, K. Nichol Edamura, Y. H. Wang,
and C. E. Pearson, “Determinants of R-loop formation at convergent bidirectionally transcribed
trinucleotide repeats,” Nucleic Acids Res., vol. 39, no. 5, pp. 1749–1762, 2011.