+ All Categories
Transcript
Page 1: Personized hiv therapy ppt

PERSONALIZED HIV THERAPY

Seminar Guide: Megha.P.M

Done by: Sreelakshmi.S.Menon

S8 BT It’s far more important to know what person the

disease has than what disease the person has. –

Hippocrates

Page 2: Personized hiv therapy ppt

OVERVIEW OF HIV• Its an Rna based virus that causes AIDS

• Attack immune system and destroys body’s defence against disease

• Creates vulnerability and cancer that’s not seen in common beings.

HIV Capsule

HIV Healthy T Cell & Infected T Cell

Two Key Parts of the Immune System

CD4 Cell

Antibodies

HIV

Page 3: Personized hiv therapy ppt

HIV TRANSMISSION • HIV attachment to T4 cell

• Virus RNA into the cell

• RNA to DNA conversion

• Entry to cell nucleus and integration with host

• Programs T cell to produce more virus

• New virus bud off host T cell, killing T cell, and enters the blood cell

Page 4: Personized hiv therapy ppt

SOME QUESTIONS THAT BIND IN OUR MIND•Window period??The time period between a person’s exposure & actual

infection with HIV and until antibodies are detectable in the body.• what’s AIDS?? How is it blown??•The late stage of HIV infection •A group of symptoms & signs of disease that occur together.•Severe immune system breakdown•Less than 200 T cells (or CD4 cells) ;

Usually transmitted by direct mating, sharing needles, contaminated needles, infected blood, pregnancy, breast feeding

Page 5: Personized hiv therapy ppt

DIAGNOSIS:Direct tests• ELISA (enzyme-linked-

immunosorbent serologic assay)• Viral isolation in culture• PcrIndirect tests• CD4 counts• Lymphopenia• Lymphnode biopsy

TREATMENT:• HIV vaccine : preventive measure• Antiretroviral therapy

• HIV is treated using a combination of medicines to fight HIV infection.

•  ART isn’t a cure, but it can control the virus

• Having less HIV in your body gives your immune system a chance to recover and fight off infections and cancers

• By reducing the amount of HIV in your body, HIV medicines also reduce the risk of transmitting the virus to others.

Page 6: Personized hiv therapy ppt

WHAT HAPPENS TO SOMEONE WITH FULLY INVOLVED AIDS?• Immune system breaks down• Phases of HIV infection : phase 1 , middle chronic phase , fluid blown AIDS• Problems with treatment : • A. Have to take lots of pills B. Pills can make people sick – side effects C. Pills don’t work for everyone – or forever D. Pills cost lots of money!

Page 7: Personized hiv therapy ppt

APPROVED ARV DRUGS• Nucleoside reverse transcriptase

inhibitors : these drugs block step 4, where the HIV genetic material is used to create DNA from RNA. Eg: Zidovudine, Didanoside

•  Non-nucleoside reverse transcriptase inhibitors: (NNRTIS)  block the HIV genetic material (RNA) is used by the reverse transcriptase enzyme to build HIV DNA. Eg: Nevirapine, Delavirdine.

•  Protease inhibitors :(PIS)  block raw materials cut by the protease enzyme into specific pieces. Eg: Indinavir, Ritonavir

• Entry inhibitors : prevent HIV from entering a cell. Eg: Maraviroc

• HIV integrase inhibitors : prevent HIV from inserting its genetic code into the human cell's code. Eg: Raltigravir, Elvitigravir.

Page 8: Personized hiv therapy ppt

Personalized medicine, sometimes referred to as precision or individualized medicine, is an emerging field of medicine that uses diagnostic tools to identify specific biological markers, often genetic, to help assess which medical treatments and procedures will be best for each patient.

Page 9: Personized hiv therapy ppt

• The way they eat

• The environment

• Types and amount of stress

• Their DNA

… about making the treatment as

individualized as the disease.

… the ability to predict an individual's susceptibility

to diseases.

… a young but rapidly advancing

field.

… the use of new methods of molecular

analysis.

… people vary from one another in many ways:

Many of these variations play a role in health and disease

} … because these factors are different for every person,

the nature of diseases is as individual as the people who have them.

}

Page 10: Personized hiv therapy ppt

PERSONALIZED MEDICINE: COMBINE GENOMIC AND OTHER OMIC INFORMATION

GENOMICGGTTCCAAAAGTTTATTGGATGCCGTTTCAGTACATTTATCGTTTGCTTTGGATGCCCTAATTAAAAGTGACCCTTTCAAACTGAAATTCATGATACACCAATGGATATCCTTAGTCGATAAAATTTGCGAGTACTTTCAAAGCCAAATGAAATTATCTATGGTAGACAAAACATTGACCAATTTCATATCGATCCTCCTGAATTTATTGGCGTTAGACACAGTTGGTATATTTCAAGTGACAAGGACAATTACTTGGACCGTAATAGATTTTTTGAGGCTCAGCAAAAAAGAAAATGGAAATTAATTTTGAAGTGCCATTGA….

Transcriptomic, Proteomic, Metabolomic

1. Predict risk2. Diagnose3. Monitor4. Treat &5. Understand6. Disease States

Page 11: Personized hiv therapy ppt

PM INVOLVES IDENTIFYING:• Genetic info • Genomic info allows• Clinical info

• DNA POLYMORPHISMS:

• It is the natural variations in our genes that plays a role in our risk of getting or not getting certain diseases. The combination of these variations across several genes affects each individual’s risk.

• … The same drug works well in one individual and not another. So how to know??

• Dna polymorphism leads to differences in:

• How drugs are used, metabolized and absorbed by the body

} predictions to be made about a person's susceptibility of :

• developing disease • its response to treatment

• course of disease } In PM we study DNA

polymorphisms }

Page 12: Personized hiv therapy ppt
Page 13: Personized hiv therapy ppt

PERSONISED HIV THERAPY• HIV is one of the fastest evolving pathogens known, and

as yet, there is no vaccine for HIV• Because the patient, once infected, cannot be cured of the

virus, the goal of therapy is to suppress virus replication, ease symptoms, and prolong life.•  Drugs inhibit a variety of steps in the viral replication

cycle. Although a certain drug therapy can be effective for quite a long time, even several years, the virus eventually manages to evolve into a resistant variant, leading to therapy failure.• When this happens, a new drug combination has to be

selected that effectively counters the resistance profile manifested by the virus population presently in the patient. This is a difficult task to accomplish, but suitable software can help to select efficient therapy options for these patients.

Page 14: Personized hiv therapy ppt

• The therapy of HIV patients is characterized by both the high genomic diversity of the virus population harboured by the patient and a substantial volume of therapy options.• The virus population is unique for each patient and time

point.• The large number of therapy options makes it difficult

to select an optimal or near optimal therapy, especially with therapy-experienced patients.• Hiv/aids is another area where the principles of

personalized medicine have made great progress. “The virus mutates differently in each patient,” “Now we can understand the viral load and analyze it, then prescribe the right cocktail of medicine to treat it. This is the progress we’ve seen taking AIDS from a death sentence to a chronic condition. But that’s understanding the virus, not the person.”

Page 15: Personized hiv therapy ppt

•Today, genotypic resistance testing is performed routinely in developed countries as companion diagnostics in HIV therapy

Page 16: Personized hiv therapy ppt

A CASE STUDY• HIV positive patient -- antiretroviral therapy

for over 10 years -- leukemia in 2007•  Acute myeloid leukemia (AML) --too many white

blood cells in the bone marrow• Chemotherapy and radiation are used to treat AML

by wiping out all of the cells in the bone marrow• Brown's doctors then replaced the cells in the bone

marrow with non-cancerous bone marrow cells of a donor.  This is called a stem cell transplant• After diagnosis: with the personalized information:

TIMOTHY RAY BROWN

Page 17: Personized hiv therapy ppt

• Brown's doctor selected bone marrow from a donor that had a mutation in the gene CCR5• CCR5 protein is found on the outside of the cells that the

HIV virus infects• CCR5 is REQUIRED for the virus to get inside the cell,

replicate and kill the cell. Without CCR5, HIV is harmless• Blocking HIV from getting into the cell prevents HIV

infection.  In fact, it's been found that some people are naturally resistant to HIV infection because they have this deletion.• So brown's doctors repopulated his bone marrow with cells

that had the ccr5-delta32 mutation. • This didn't just cure his leukemia but it also prevented the

hiv from infecting his new blood cells, curing his hiv.

University of Pennsylvania Perelman

School of Medicine

researchers, Pablo Tebas, Carl June, and

Bruce Levine,

Page 18: Personized hiv therapy ppt

SOLVING MYSTERY DISEASES:

CHILD WITH VARIETY OF CONDITIONS

DEVELOPMENTALLY DELAYED, SIGNIFICANT

HEALTH ISSUES

F M

A1

FatherSNVs: 3,119,588Indels:750,522

MotherSNVs: 3,125,880Indels: 723,379

ChildSNVs:3,118,638Indels:673,809

SNVs: Single nucleotide variantsIndels: = Insertions/deletions (~<100bp)

Page 19: Personized hiv therapy ppt

PERSONALIZED MEDICINE DATA IN WEB OF KNOWLEDGE

Page 20: Personized hiv therapy ppt

REFERENCE1.Joanne M Meyer and Geoffrey S Ginsburg ,The path to personalized medicine, 6 June 2002

2. Michael Pazzani and Ranjit Iyer, Edison Schroeder and Jeremiah Tilles, CTSHIV: A Knowledge-Based System For the Management of HIV-infected Patients.

3. Thomas Lengauer, Nico Pfeifer, Rolf Kaiser ,Personalized HIV therapy to control drug resistance,

4. David Stein, Winson W. Tang , Ian Frank Penn, Shelley Q. Wang, Gary Lee Researchers Used Zinc Finger Technology to Safely Build Up Army of Modified T Cells to Repel VirusMarch 5, 2014

5. Nadia Dowshen , Lisa M Kuhns, Amy Johnson, Brian James Holoyda, and Robert Garofalo ,Craig Improving Adherence to Antiretroviral Therapy for Youth Living with HIV/AIDS: A Pilot Study Using Personalized, Interactive -Dalsimer Division of Adolescent Medicine, March-April, 2012

Page 21: Personized hiv therapy ppt

Top Related