Types of RNAMessenger RNA (mRNA): copy of DNA
http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/transcription.html
Types of RNA
http://www.molecularassembler.com/KSRM/ListFigures.htm
http://www.chm.bris.ac.uk/motm/linezolid/linezolid.htm
Genetic code
20 a.a. But only 4 RNA bases… If 2 nucleotides, only 16 a.a. (42 = 16) 3 nucleotides is great 43 = 64
Exercices together
Transcribe this DNA into mRNA: ACGGTATTACCGCTA UGCCAUAAUGGCGAU (Answer) Now translate this mRNA into a protein: AUGCAUUGUAUGGGUUAAGCG Met, His, Cys, Met, Gly (stop)
Transcription
Initiation: 1) RNA polymerase binds to DNA at a
promoter region 2) DNA unwounded and template strand
exposed
Transcription
Elongation: 1) mRNA synthesized in 5’ to 3’ using
template strand 2) elongation continues and DNA
already transcribed rewinds into double-helix
Posttranscriptional modifications
In eucaryotic cells 5’ cap is added to the start. It’s a 7-
methyl guanosine which protects the mRNA from digestion by nucleases and phospohotases. See p. 244 fig. 3
Poly-A tail is added by poly-A polymerase to the 3’end. It’s to protect and helps initiate translation.
Posttranscriptional modifications Introns are removed by spliceosomes.
http://faculty.uca.edu/~johnc/rnaprot1440.htm
Control Mechanisms
42 000 genes in humans! Housekeeping genes : always needed
in a cell Transcription factors turn genes on
when required
4 levels of control of gene expression Transcriptional: controls which genes
are transcribed or rate of transcription Posttranscriptional: controls
posttranscription Translational: controls how often and
how fast translation happens Posttranslational: Controls passage
through membrane and rate of activation of proteins and time its remains functional.
Operon control
Operon: cluster of genes under the control of one promoter and one operator in prokaryotic cells
Operator: regulatory sequences of DNA to which a repressor protein binds