Review session for exam-II
Lectures 6-9
DNA Replication
Q1. An assay used to determine carcinogenic potential is the ____________ test.
DNA Replication
Q2. The Watson and Crick model of DNA is called __________-DNA
DNA Replication
Q3. E. coli DNA polymerase III: can initiate replication without a primer. is efficient at nick translation. is the principal DNA polymerase in
chromosomal DNA replication. requires a free 5'-hydroxyl group as a
primer.
DNA Replication
Q4. The primer for DNA synthesis is an RNA molecule formed by the enzyme _______________.
DNA Replication
Q5. The DNA strand that is replicated continuously is known as the _____________ strand.
DNA Replication
Q6. UV light causes damage to DNA by forming __________________.
DNA Replication
Q7. The human, genetic skin disease, caused by a mutation in components of the human nucleotide-excision-repair pathway is called ___________________.
DNA Replication
Q8. An Okazaki fragment is a: fragment of DNA resulting from endonuclease
action. fragment of RNA that is a subunit of the 30S
ribosome. piece of DNA that is synthesized in the 3' ® 5'
direction. segment of DNA that is an intermediate in the
synthesis of the lagging strand. segment of mRNA synthesized by RNA
polymerase.
DNA Replication
Q9. What is the formula for linking? A)Lk = Wr − Tw B)Lk = Wr + Tw C)Tw = Wr + Lk D)All of the above. E)None of the above.
DNA Replication
Q10. What is true about DNA polymerases? A)There are five structural classes. B)All have finger and thumb domains that
wrap around the DNA. C)All catalyze the same reaction, which
requires metal cofactors. D)a and c. E)a, b, and c.
DNA Replication
Q11. The proofreading function of DNA polymerase involves all of the following except: a 3' ® 5' exonuclease. base pairing. detection of mismatched base pairs. phosphodiester bond hydrolysis. reversal of the polymerization reaction.
DNA Replication
Q12. At replication forks in E. coli: DNA helicases make endonucleolytic
cuts in DNA. DNA primers are degraded by
exonucleases. DNA topoisomerases make
endonucleolytic cuts in DNA. RNA primers are removed by primase. RNA primers are synthesized by primase.
DNA Replication
Q13. The Ames test is used to: detect bacterial viruses. determine the rate of DNA replication. examine the potency of antibiotics. measure the mutagenic effects of various
chemical compounds. quantify the damaging effects of UV light
on DNA molecules.
DNA Replication
Q14.The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis.
(5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')
DNA Replication
Q15. DNA replication in E. coli begins at a site in the DNA called the (a) ___________. At the replication fork the (b) ___________ strand is synthesized continuously while the (c) _________ strand is synthesized discontinuously. On the strand synthesized discontinuously, the short pieces are called (d) ____________ fragments. An RNA primer for each of the fragments is synthesized by an enzyme called (e) __________, and this RNA primer is removed after the fragment is synthesized by the enzyme (f) ___________, using its (g) _____________ activity. The nicks left behind in this process are sealed by the enzyme (h) _____________.
DNA Replication
Q16. Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli: (a) DNA helicase; (b) primase; (c) the 3' ® 5' exonuclease activity of DNA
polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' ® 3' exonuclease activity of DNA
polymerase I.
DNA Repair
Q17. The high fidelity of DNA replication is due primarily to immediate error correction by the 3' —> 5' exonuclease (proofreading) activity of the DNA polymerase. Some incorrectly paired bases escape this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA. List some of repair mechanisms that the cell can use to help correct such errors.
Exploring genes
Q18. 2’,3’-dideoxyribonucleotides are used in Sanger sequencing methods. Which of the following best describes the mechanism by which 2’,3’-dideoxyribonucleotides cause chain termination in these reactions? 2’,3’-dideoxyribonucleotides act as allosteric inhibitors of DNA
polymerase. 2’,3’-dideoxyribonucleotides act as suicide inhibitors of DNA
polymerase. 2’,3’-dideoxyribonucleotides destabilize DNA by base-catalyzed
hydrolysis. 2’,3’-dideoxyribonucleotides cannot be incorporated into
elongating DNA molecules. 2’,3’-dideoxyribonucleotides can be incorporated into DNA but
prevent subsequent chain elongation.
Exploring genes
Q19. Assume that a mRNA molecule has the following sequence: 5’AUGCUCACUUCAGGGAGAAGC
What are the coding and template strands of the DNA?
Exploring genes
Q20. Name the following steps in the flow of genetic information? DNA----- DNA DNA----- RNA RNA---- DNA RNA---- Protein
RNA synthesis
Q21. In which direction does mRNA synthesis by RNA polymerase occur?
5’ 3’ 3’ 5’ N C C N A U
RNA synthesis
Q22. Which of the following best describes the TATA box?
It is a sequence in chromosomes that marks replication origins.
It is a sequence in the promoter region of genes that marks transcription start sites.
It is a sequence in primary transcripts that marks cleavage and polyadenylation sites.
It is a sequence in primary transcripts that marks splice sites.
It is a sequence in mRNAs that marks translation start sites.
RNA synthesis
Q23. Which of the following best characterizes the termination of transcription?
The sequence signals for termination of transcription are contained within the transcript itself.
The transcriptional termination sequence is a site in the DNA approximately 30 base pairs downstream of the actual termination point.
Transcription terminates when the polymerase reaches a stop codon.
Transcription terminates when the polymerase reaches the promoter of the adjacent downstream gene.
Transcription terminates when the polymerase reaches the start codon of the adjacent downstream gene.
RNA synthesis
Q24. Which of the following enzymes catalyzes the synthesis of DNA at the ends of linear chromosomes, using an RNA template complexed with the enzyme?
DNA ligase DNA polymerase Helicase Nuclease Telomerase
RNA synthesis
Q25. Which of the following best describes the structure of the mRNA cap?
guanosine, attached via a 5’-3’ monophosphate linkage
guanosine, attached via a 5’-5’ triphosphate linkage
7-methylguanosine, attached via a 5’-3’ monophosphate linkage
7-methylguanosine, attached via a 5’-3’ triphosphate linkage
7-methylguanosine, attached via a 5’-5’ triphosphate linkage
RNA synthesis
Q26. Spliceosomes are primarily composed of which of the following types of RNA?
miRNA siRNA snRNA rRNA tRNA
DNA repair
Q27. Which of the following processes involves DNA ligase?
Homologous recombination Nucleotide-excision repair Telomere extension Topoisomerization Transcription
DNA, RNA, tRNA general
Q28. Which of the following most accurately describes the relative abundance (by total mass) of RNA species inside cells?
mRNA < rRNA < tRNA mRNA < tRNA < rRNA rRNA < tRNA < mRNA tRNA < mRNA < rRNA tRNA < rRNA < mRNA
DNA, RNA, tRNA general
Q29. How many amino acids are there in the standard genetic code?
3 4 16 20 64
DNA, RNA, tRNA general
Q30. Which of the following best describes the degeneracy of the genetic code?
Some codons are specified by multiple amino acids; these amino acids are usually similar in chemical properties.
Some amino acids are specified by multiple codons; these codons usually differ only at the first position.
Some amino acids are specified by multiple codons; these codons usually differ only at the second position.
Some amino acids are specified by multiple codons; these codons usually differ only at the third position.
Some amino acids are specified by multiple codons; these codons are usually unrelated in sequence.
DNA, RNA, tRNA general
Q31. The insertion of one nucleotide in the coding sequence of a gene is most likely to lead to which of the following mutations?
Frameshift mutation Missense mutation Nonsense mutation Silent mutation Transversion mutation
Exploring genes
Q32. Which of the following reactions is catalyzed by reverse transcriptase?
3’ 5’ polymerization of DNA from an RNA template
3’ 5’ polymerization of RNA from a DNA template
3’ 5’ polymerization of RNA from a polypeptide template
5’ 3’ polymerization of DNA from an RNA template
5’ 3’ polymerization of RNA from a polypeptide template
Protein synthesis
Q33. Which of the following best characterizes the relationship between amino acids and tRNAs?
The activation of an amino acid by formation of an aminoacyl-tRNA is coupled to the hydrolysis of ATP to AMP + 2 Pi.
The conformation of an aminoacyl-tRNA facilitates the direct interaction between the amino acid and its appropriate codon in the mRNA-ribosome complex.
Formation of the ester linkages between a tRNA and its corresponding amino acid is catalyzed by the tRNA itself.
A tRNA binds to its appropriate amino acid through a covalent linkage of the amino acid’s side chain to the base of the nucleotide immediately 5’ of the anticodon.
A tRNA is a six-nucleotide RNA molecule consisting of an anticodon followed by a CCA sequence that accepts amino acids.
Exploring genes
Q34. Double stranded regions of RNA: A. do not occur B. can be observed in the lab but not in
cells C. can form between two self-
complementary regions of the same single strand of RNA
D. have the two strands arranged in parallel
Exploring genes
Q35. A major component of RNA but not of DNA is: A. adenine B. guanine C. cytosine D. uracil E. Thymine
Exploring genes
Q36. For the oligoribonucleotide pACGUAC:
A. the nucleotide at the 5’ end is a pyrimidine B. the nucleotide at the 3’ end has a
phosphate at its 3’ hydroxyl C. the nucleotide at the 5’ end has a
phosphate at its 5’ hydroxyl D. all of the above are true None of the above is true
DNA replication
Q37. Which enzyme is catalyzing the following reaction?
(DNA)n + dNTP----> (DNA)n+1 +Ppi Write two important functions of this enzyme.
Exploring genes
Q38. The biological role of restriction enzymes is to:
aid recombinant DNA research. degrade foreign DNA that enters a bacterium. make bacteria resistant to antibiotics. restrict the damage to DNA by ultraviolet light. restrict the size of DNA in certain bacteria.
Exploring genes
Q39. Certain restriction enzymes produce cohesive (sticky) ends. This means that they:
A. cut both DNA strands at the same base pair. B. cut in regions of high GC content, leaving ends that
can form more hydrogen bonds than ends of high AT content.
C. make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
D. make ends that can anneal to cohesive ends generated by any other restriction enzyme.
E. stick tightly to the ends of the DNA they have cut.
DNA replication
Q40. The proofreading function of DNA polymerase involves all of the following except: a 3' ® 5' exonuclease. base pairing. detection of mismatched base pairs. phosphodiester bond hydrolysis. reversal of the polymerization reaction.
DNA repair
Q41. In base-excision repair, the first enzyme to act is: AP endonuclease. Dam methylase. DNA glycosylase. DNA ligase. DNA polymerase.
DNA replication
Q42. Describe briefly how Sanger’s dideoxy method works for sequencing DNA.
DNA replication
Q43. A suitable substrate for DNA polymerase is shown below. Label the primer and template, and indicate which end of each strand must be 3' or 5'.
To observe DNA synthesis on this substrate in vitro, what additional reaction components must be added?
DNA-dependent synthesis of RNA
Q44. Which of the following statements about E. coli RNA polymerase (core enzyme) is false?
In the absence of the s subunit, core polymerase has little specificity for where initiation begins.
The core enzyme contains several different subunits. The core enzyme has no polymerizing activity until the s
subunit is bound. The RNA chain grows in a 5' ® 3' direction. The RNA product is complementary to the DNA template.
DNA-dependent synthesis of RNA
Q45. “Footprinting” or DNase protection is a technique used to identify:
a region of DNA that has been damaged by mutation.
E. coli cells that contain a desired, cloned piece of DNA.
the position of a particular gene of a chromosome.
the position of internally double-stranded regions in a single-stranded DNA molecule.
the specific binding site of a repressor, polymerase, or other protein on the DNA.
RNA processing
Q46. A branched (“lariat”) structure is formed during:
attachment of a 5' cap to mRNA. attachment of poly(A) tails to mRNA. processing of preribosomal RNA. splicing of introns.
RNA processing
Q47. Splicing of introns in nuclear mRNA primary transcripts requires:
a guanine nucleoside or nucleotide. endoribonucleases. polynucleotide phosphorylase. RNA polymerase II. small nuclear ribonucleoproteins (snurps).
DNA-dependent synthesis of RNA
Q48. Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence:
(5')ATCGTACCGTTA(3')
Protein synthesis
Q49. Which of the following are features of the wobble hypothesis? A naturally occurring tRNA exists in yeast that
can read both arginine and lysine codons. A tRNA can recognize only one codon. Some tRNAs can recognize codons that specify
two different amino acids, if both are nonpolar. The “wobble” occurs only in the first base of the
anticodon. The third base in a codon always forms a normal
Watson-Crick base pair.
Protein synthesis
Q50. Which of the following statements about tRNA molecules is false?
A, C, G, and U are the only bases present in the molecule.
Although composed of a single strand of RNA, each molecule contains several short, double-helical regions.
Any given tRNA will accept only one specific amino acid. The amino acid attachment is always to an A nucleotide
at the 3' end of the molecule. There is at least one tRNA for each of the 20 amino
acids.
Protein synthesis
Q51. Which of the following statements about the tRNA that normally accepts phenylalanine is false? (mRNA codons for phenylalanine are UUU and UUC.)
It interacts specificially with the Phe synthetase. It will accept only the amino acid phenylalanine. Its molecular weight is about 25,000. Phenylalanine can be specifically attached to an
—OH group at the 3' end. The tRNA must contain the sequence UUU.
Protein synthesis
Q52. Which of the following is not true of tRNA molecules?
The 3'-terminal sequence is —CCA. Their anticodons are complementary to the
triplet codon in the mRNA. They contain more than four different bases. They contain several short regions of double
helix. With the right enzyme, any given tRNA
molecule will accept any of the 20 amino acids.
Protein synthesis
Q53. In the “activation” of an amino acid for protein synthesis:
leucine can be attached to tRNAPhe, by the aminoacyl-tRNA synthetase specific for leucine.
methionine is first formylated, then attached to a specific tRNA.
the amino acid is attached to the 5' end of the tRNA through a phosphodiester bond.
there is at least one specific activating enzyme and one specific tRNA for each amino acid.
two separate enzymes are required, one to form the aminoacyl adenylate, the other to attach the amino acid to the tRNA.
Protein synthesis
Q54. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require:
EF-Tu. formylmethionyl tRNAfMet. GTP. initiation factor 2 (IF-2). mRNA.
Protein synthesis
Q55. In bacteria the elongation stage of protein synthesis does not involve:
aminoacyl-tRNAs. EF-Tu. GTP. IF-2. peptidyl transferase.
Protein targeting and degradation
Q56. Which of the following is true about the sorting pathway for proteins destined for incorporation into lysosomes or the plasma membrane of eukaryotic cells?
Binding of SRP to the signal peptide and the ribosome temporarily accelerates protein synthesis.
The newly synthesized polypeptides include a signal peptide at their carboxyl termini.
The signal peptide is cleaved off inside the mitochondria by signal peptidase.
The signal recognition particle (SRP) binds to the signal peptide soon after it appears outside the ribosome.
The signal sequence is added to the polypeptide in a posttranslational modification reaction.
Protein synthesis
Q57. Indicate whether the following statements are true (T) or false (F).
___A ribosome is the complex within which protein synthesis occurs.
___Ribosomes contain many separate proteins. ___The three ribosomal RNAs in a bacterial
ribosome are distributed in three separate, large ribosomal subunits.
___There are four binding sites for aminoacyl-tRNAs on a ribosome.
Protein synthesis
The process of charging tRNAs with their cognate amino acids involves multiple proofreading steps to increase the overall fidelity. Briefly describe these steps.
Protein synthesis
The recognition of an amino acid by its cognate aminoacyl-tRNA synthetase is said to involve a “second genetic code”. What is meant by this?
Protein synthesis
In 1961, Howard Dintzis carried out an experiment that defined the direction of polypeptide chain growth during protein synthesis in cells. The experiment involved the analysis of hemoglobin molecules that were being synthesized in reticulocytes in the presence of radioactive amino acids. Describe the analysis and how it demonstrated the direction of chain growth.
Protein synthesis
A given mRNA sequence might be translated in any of three reading frames. Describe how prokaryotes and eukaryotes determine the correct reading frame.