+ All Categories
Transcript
Page 1: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 1/14

RNAi-Mediated Inhibition Of HIV-1 By Targeting

Partially Complimentary Viral Sequences

Ying Poi Liu, Jens Groober, Joost Hasnoot, Pavlina Constantinova and Ben Berkhout

Presented By - : K.Rahul and P.Shamina

INTRODUCTION :

AIDS is one of the most prevalent and dangerous

diseases in the world caused by the Human

Immunodefiency Virus. This virus has foiledmany an attempt to inhibit either its genomic

function or its entry and infection due its ability

to mutate and give rise to new variants of HIV.

Inhibition of HIV replication post-infection can

lead to a possible permanent cure/temporary

suppression. This is achieved by RNA

interference.

AIM :

To produce significant inhibition of replication in

both the wild type and mutant escape viruses of 

HIV-1 by utilizing an miRNA and shRNA

combinatorial approach.

MATERIALS AND METHODS :

�Construction of DNA constructs using HIV-1

pLAI plasmid.

�Inductionof mutations using Fusion PCR.

�Construction of luciferase reporter constructs

using pGL3-Nef vector.

�Culturing of Hek293T cells for transfection.

�Construction of respective miRNA¶s and

shRNA¶s.

�Luciferase reporter assay system and ELISA to

record results.

�miRanda algorithn to determine putative target

sites.

RESULTS :

Efficient inhibition of HIV-1 replication [60%] is

observed when a combinatorial approach of 

miRNA¶s and shRNA¶s are used. Inhibition of 

both wild type and mutant variants of HIV-1 is

observed along with prolonged inhibition of HIV-

1 replication which ensures the suppression ordelay of further mutant strains of HIV-1 from

being generated.

C : Inhibition of luciferase expression with pBS as control [100%]

D : Inhibition of virus replication with pBS as control [100%]

CONCLUSION:

�Durable HIV-1 inhibition is achieved using miRNA + shRNA.

�Targeting of conserved sequences ensures inhibition of even

mutant escape forms of HIV-1 virus.

� Usage of a combinatorial miRNA + shRNA approach results in

better inhibition of HIV-1 replication.

�Method of delivery and RNAi suppression are still important

aspects to consider.

�Hematopoeitic stem cell transplants can be engineered to

produce stem cells that express these specific miRNA¶s and

shRNA¶s. This can give rise to permanent immunity to HIV-1.

�Off target effects are also of concern and need to be minimized.

�Combinations of various approaches that results in a multi

pronged attack can result in efficient HIV-1 replication inhibition.

REFERENCES:

�Karin Jasmijn von Eije, Olivier ter Brake, and Ben Berkhout, HIV-1

Escape Is Restricted When Conserved Genome Sequences Are Targetedby RNA Interferenc,JOURNAL OF VIROLOGY, Mar. 2008, p. 2895± 

2903 Vol. 82, No. 6

Liu,Y.P., Haasnoot,J., Ter Brake,O., Berkhout,B. and Konstantinova,P.

(2008) Inhibition of HIV-1 by multiple siRNAs expressed from a singlemicroRNApolycistron. NucleicAcids Res., 36, 2811±2824.

Page 2: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 2/14

RNAiRNAi--mediated Inhibition Of HIVmediated Inhibition Of HIV--11

By Targeting Partially ComplementaryBy Targeting Partially Complementary

Viral SequencesViral Sequences

RNAiRNAi--mediated Inhibition Of HIVmediated Inhibition Of HIV--11

By

Targeting Partially ComplementaryBy Targeting Partially Complementary

Viral SequencesViral Sequences

 Ying  Ying PoiPoi Liu,Liu, JensJens Gruber,Gruber, JoostJoost HaasnootHaasnoot,, PavlinaPavlina

KonstantinovaKonstantinova andand BenBen BerkhoutBerkhout

[[61946194± ±62046204 NucleicNucleic AcidsAcids Research,Research, 20092009,, VolVol.. 3737,, NoNo.. 1818 oioi::1010..10931093/ /nar nar/gkp /gkp644644]]

Presented By Presented By ±± RahulRahul KuncheKunche

ShaminaShamina PathanPathan

Page 3: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 3/14

RNA INTERFERENCE AND ITS MECHANISM

�� InherentInherent phenomenonphenomenon presentpresent inin almostalmost allall eukaryoticeukaryotic organisms,organisms, andand

humanhuman cellcell lineslines..

��AlsoAlso knownknown asas PostPost TranscriptionalTranscriptional GeneGene SilencingSilencing [PTGS][PTGS].. RNAiRNAi --

protectionprotection of of thethe genomegenome againstagainst invasioninvasion byby mobilemobile geneticgenetic elementselements suchsuch

asas virusesviruses andand transposontransposonss..

��NobelNobel prizeprize awardedawarded toto AndrewAndrew FireFire andand CraigCraig MelloMello inin 20062006 forfor theirtheir

discoverydiscovery of of RNARNA interferenceinterference inin thethe nematodenematode wormworm CaenorhabditisCaenorhabditiseleganselegans..

��ExperimentExperiment involvedinvolved injectioninjection of of dsds--RNARNA intointo CC..elegans¶selegans¶s bodybody cavitycavity..

TheThe wormsworms injectedinjected withwith thethe RNARNA exhibitedexhibited aberrantaberrant twitchingtwitching

movementsmovements duedue toto thethe silencingsilencing of of uncunc2222 genegene codingcoding forfor thethe myofilamentmyofilament

proteinprotein ..

��ExogenousExogenous dsds--RNARNA DicerDicer cleavagecleavage siRNA¶ssiRNA¶s siRNsiRNA+RISCA+RISC GuideGuide

ssRNA+RISCssRNA+RISC BindBind toto mRNAmRNA CleavageCleavage PTGSPTGS..

��MicroRNA¶sMicroRNA¶s ((miRNAsmiRNAs)) areare genomicallygenomically encodedencoded nonnon--codingcoding RNAsRNAs andand

shRNA¶sshRNA¶s areare RNA¶sRNA¶s withwith tighttight hairpinhairpin turnsturns ..

�� InherentInherent phenomenonphenomenon presentpresent inin almostalmost allall eukaryoticeukaryotic organisms,organisms, andand

humanhuman cellcell lineslines..

��AlsoAlso knownknown asas PostPost TranscriptionalTranscriptional GeneGene SilencingSilencing [PTGS][PTGS].. RNAiRNAi --

protectionprotection of of thethe genomegenome againstagainst invasioninvasion byby mobilemobile geneticgenetic elementselements suchsuch

asas virusesviruses andand transposontransposonss..

��NobelNobel prizeprize awardedawarded toto AndrewAndrew FireFire andand CraigCraig MelloMello inin 20062006 forfor theirtheir

discoverydiscovery of of RNARNA interferenceinterference inin thethe nematodenematode wormworm CaenorhabditisCaenorhabditiseleganselegans..

��ExperimentExperiment involvedinvolved injectioninjection of of dsds--RNARNA intointo CC..elegans¶selegans¶s bodybody cavitycavity..

TheThe wormsworms injectedinjected withwith thethe RNARNA exhibitedexhibited aberrantaberrant twitchingtwitching

movementsmovements duedue toto thethe silencingsilencing of of uncunc2222 genegene codingcoding forfor thethe myofilamentmyofilament

proteinprotein ..

��ExogenousExogenous dsds--RNARNA DicerDicer cleavagecleavage siRNA¶ssiRNA¶s siRNsiRNA+RISCA+RISC GuideGuide

ssRNA+RISCssRNA+RISC BindBind toto mRNAmRNA CleavageCleavage PTGSPTGS..

��MicroRNA¶sMicroRNA¶s ((miRNAsmiRNAs)) areare genomicallygenomically encodedencoded nonnon--codingcoding RNAsRNAs andand

shRNA¶sshRNA¶s areare RNA¶sRNA¶s withwith tighttight hairpinhairpin turnsturns ..

Page 4: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 4/14

�Pri-miRNA Pre-miRNA Mature miRNA PTGS�shRNA Exported to cytoplasm siRNA PTGS

�Since the discovery of RNAi scientists have tried to implement this method to

produce different silencing effects in various organisms and also to cure

diseases.

�In this research by Ying Poi Liu et. al, HIV is the targeted disease for PTGS.

�Pri-miRNA Pre-miRNA Mature miRNA PTGS�shRNA Exported to cytoplasm siRNA PTGS

�Since the discovery of RNAi scientists have tried to implement this method to

produce different silencing effects in various organisms and also to cure

diseases.

�In this research by Ying Poi Liu et. al, HIV is the targeted disease for PTGS.

Page 5: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 5/14

HIVHIV--1 THE ELUSIVE VIRUS1 THE ELUSIVE VIRUS

��HIVHIV--1 is a retro1 is a retro--virus belonging to Family :virus belonging to Family : retroviridaeretroviridae,,

Genus :Genus : LentivirusLentivirus..

��Attacks cells of the host immune systemAttacks cells of the host immune system ±  ± TThh cells andcells and

macrophages.macrophages.

��Replicates via Reverse Transcription and by utilizing hostReplicates via Reverse Transcription and by utilizing host

chromosome machinery .chromosome machinery .

��Sometimes HIVSometimes HIV--1 replicates1 replicates

with errors that get stabilized.with errors that get stabilized.

��HIVHIV--1 is a retro1 is a retro--virus belonging to Family :virus belonging to Family : retroviridaeretroviridae,,

Genus :Genus : LentivirusLentivirus..

��Attacks cells of the host immune systemAttacks cells of the host immune system ±  ± TThh cells andcells and

macrophages.macrophages.

��Replicates via Reverse Transcription and by utilizing hostReplicates via Reverse Transcription and by utilizing host

chromosome machinery .chromosome machinery .

��Sometimes HIVSometimes HIV--1 replicates1 replicates

with errors that get stabilized.with errors that get stabilized.

Page 6: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 6/14

HIVHIV--1 INFECTION MECHANISM1 INFECTION MECHANISM

Page 7: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 7/14

InhibitionInhibition Of Of HIVHIV--11 ByBy RNAiRNAi MediatedMediated TargetingTargeting Of Of 

PartiallyPartially ComplementaryComplementary SequencesSequences

��ThoughThough siRNA¶ssiRNA¶s cancan efficientlyefficiently inhibitinhibit translation,translation, errorerror proneprone HIVHIV--11

escapesescapes thisthis byby targettarget mutationmutation..

��TheThe aimaim of of thisthis researchresearch waswas toto targettarget errorerror proneprone HIVHIV--11 escapeescape

mutantsmutants byby usingusing miRNA¶smiRNA¶s andand shRNA¶sshRNA¶s insteadinstead of of siRNA¶ssiRNA¶s..

��YingYing PoiPoi LuiLui etet.. alal utilizedutilized thisthis abilityability of of miRNA¶smiRNA¶s toto partiallypartially pairpair withwith

targettarget sequencessequences resultingresulting inin inhibitioninhibition of of HIVHIV--11 escapeescape mutantsmutants..

��TheThe pLAIpLAI plasmidplasmid encodingencoding thethe HIVHIV--11 isolateisolate LAILAI isis usedused toto produceproduce

virusvirus..

��MutationsMutations introducedintroduced byby FusionFusion PCR PCR usingusing oligonucleotideoligonucleotide withwith thethe

mutationsmutations..

��AA mutantmutant ±  ± SingleSingle oror DoubleDouble mutationmutation inin pLAIpLAI [[88A/A/1515A]A]

��DD mutantmutant ±  ± SingleSingle mutationmutation inin 66//1111 andand DoubleDouble mutationmutation inin 88//1111 andand

1313//1515

��

FireflyFirefly luciferaseluciferase expressionexpression vectorvector pGLpGL33--Nef Nef constructconstruct usedused totoconstructconstruct luciferaseluciferase reporterreporter constructsconstructs..

Page 8: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 8/14

��HivHiv--11 fragmentfragment of of 600600,,10001000 andand 16001600 bpbp isis PCR PCR amplifiedamplified usingusing fullfull

lengthlength molecularmolecular cloneclone pLAIpLAI asas templatetemplate..

��PrimersPrimers usedused ±  ± 

LucLuc--II f f:: GGAATTCATTATCGTTTCAGACCCACCTCGGAATTCATTATCGTTTCAGACCCACCTCLucLuc--II rr:: AACTGCAGGCTGCCTTGTAAGTCATTGGTCAACTGCAGGCTGCCTTGTAAGTCATTGGTC

LucLuc--IIII f f:: GGAATTCCACACCTCAGGTACCTTTAAGACGGAATTCCACACCTCAGGTACCTTTAAGAC

LucLuc--IIII rr:: AACTGCAGTCACCAGCGTTTCTGGGTGAGCAACTGCAGTCACCAGCGTTTCTGGGTGAGC

LucLuc--II f f andand LucLuc--IIIIII rr..

��PurifiedPurified PCR PCR fragmentsfragments digesteddigested byby EcoR EcoR11 andand PstPst11 areare insertedinserted

intointo pGLpGL33--Nef Nef vectorvector..

��TheThe luciferaseluciferase reporterreporter constructsconstructs encodingencoding ACDEACDE wildwild--typetype targetstargets

ACDEACDEwtwt andand thethe mutatedmutated targetstargets ACDEACDEmm11 andand ACDEACDEmm22 areare

constructedconstructed..

��LuciferaseLuciferase reporterreporter ACDEACDEmm11 targettarget alteredaltered byby introductionintroduction of of 

observedobserved viralviral escapeescape mutationsmutations ::

GG88AA inin targettarget AA andand D,D,

AA66GG inin targettarget C,C, GG66AA inin targettarget EE..

��LuciferaseLuciferase reporterreporter ACDEACDEmm22 encodesencodes thethe ACDEACDE targettarget withwith aa pointpoint

mutationmutation atat positionposition 1515 inin eacheach targettarget..

Page 9: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 9/14

��Hek Hek293293TT cellscells culturedcultured inin DMEMDMEM.. ForFor luciferaseluciferase andand HIVHIV--11

inhibitioninhibition assays,assays, HEK HEK 293293TT cellscells seededseeded inin 2424--wellwell withoutwithout

antibioticsantibiotics.. TransfectionsTransfections werewere performedperformed usingusing LipofectamineLipofectamine 20002000

reagentreagent..

��HEK HEK 293293TT cellscells werewere coco--transfectedtransfected withwith 100100 ngng of of fireflyfirefly luciferaseluciferase

reporterreporter plasmidsplasmids (pGL(pGL33),), 11 ngng of of renillarenilla luciferaseluciferase expressionexpression

plasmidplasmid ((pRLpRL--CMV)CMV) andand differentdifferent amountsamounts of of hairpinhairpin RNARNA

expressionexpression constructsconstructs..

��TwoTwo daysdays postpost--transfectiontransfection,, luciferaseluciferase andand renillarenilla expressionexpression werewere

measuredmeasured withwith thethe DualDual--LuciferaseLuciferase ReporterReporter AssayAssay SystemSystem andand

relativerelative luciferaseluciferase activityactivity waswas calculatedcalculated..

��InhibitionInhibition of of virusvirus productionproduction waswas determineddetermined byby coco--transfectiontransfection of of 

250250 ngng HIVHIV pLAIpLAI,, 11 ngng pRLpRL--CMVCMV andand differentdifferent amountsamounts of of hairpinhairpin

RNARNA constructsconstructs intointo HEK HEK 293293TT cellscells..

��Two days postTwo days post--transfectiontransfection, the CA, the CA--p24 levels in the culturep24 levels in the culture

supernatant was determined by ELISA.supernatant was determined by ELISA. RenillaRenilla luciferaseluciferase expressionexpression

of of transfectedtransfected cells and relative virus production was calculated.cells and relative virus production was calculated.

��Putative target sites forPutative target sites for miRNAsmiRNAs in the 3in the 3dd UTR of the HIVUTR of the HIV--1 RNA1 RNA

genome are determined using thegenome are determined using the miRandamiRanda algorithm.algorithm.

Page 10: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 10/14

Results And DiscussionResults And Discussion

Page 11: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 11/14

Page 12: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 12/14

Page 13: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 13/14

CricticalCrictical Analysis And ConclusionAnalysis And ConclusionCricticalCrictical Analysis And ConclusionAnalysis And Conclusion

�For durable HIV inhibition prevention of viral escape is important.

siRNA

perfectly complimentary sequences. Combinatorial miRNA+ shRNA approach targeting partially complenetary sequences.

�miRNA Partial complimentarity [Only downregulates]

�shRNA Complete complimentarity + Inherited Through vector

[Interferon response]

�Targeted conserved sequences. HIV replication inhibited irrespective

of mutant form.

�First tested against luciferase reporter constructs. Low amount of 

inhibition constructs High inhibition [60%]

�Off-target effects, RNAi suppression by Tat protein and Delivery

method are a few of the concerns.

�Can genetically alter stem cells and Target HIV-1 target cells instead.

�Though much progress is seen in usage of RNAi for HIV inhibition a

lot more research is required prior to actual clinical application.

�For durable HIV inhibition prevention of viral escape is important.

siRNA

perfectly complimentary sequences. Combinatorial miRNA+ shRNA approach targeting partially complenetary sequences.

�miRNA Partial complimentarity [Only downregulates]

�shRNA Complete complimentarity + Inherited Through vector

[Interferon response]

�Targeted conserved sequences. HIV replication inhibited irrespective

of mutant form.

�First tested against luciferase reporter constructs. Low amount of 

inhibition constructs High inhibition [60%]

�Off-target effects, RNAi suppression by Tat protein and Delivery

method are a few of the concerns.

�Can genetically alter stem cells and Target HIV-1 target cells instead.

�Though much progress is seen in usage of RNAi for HIV inhibition a

lot more research is required prior to actual clinical application.

Page 14: RNAi-mediated Inhibition Of HIV-1  By Targeting Partially Complementary  Viral Sequences

8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences

http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 14/14


Top Related