+ All Categories
Transcript
Page 1: Senior Lifestyles

SENIORLIFESTYLES

A supplement to The Record-Herald and Indianola Tribune • February 22, 2012

Page 2: Senior Lifestyles

Exclusively at Beltone

Hearing aids or hearing care?They’re not created equal.With 70 years of experience, Beltone is a hearing care company dedicated to helping people hear betterand live better. When you buy quality Beltone hearing instruments, you’ll continue to receive professional,prompt service at any one of over 1,500 Beltone locations nationwide!

Our relationship with our customers doesn’t stop with your purchase of a Beltone hearing instrument.You’ll also receive BelCare™, our on going commitment to customer satisfaction – and the reasonmillions of people have trusted Beltone with their hearing care for the last 70 plus years.

Why not experience it for yourself ?Call or come in today.

Benefits of hearing aids vary by type and degree of hearing loss, noise environment, accuracy of hearing evaluation and proper fit. ©2011 Beltone ElectronicsIW-900

0326

974

709 N. Jefferson Way (Next to Pizza Ranch) IndianolaCall Today! 1-800-999-1391

Seeus on

Page 3: Senior Lifestyles

IW-9000326652

Page 4: Senior Lifestyles

4 • Wednesday, February 22, 2012

Senior Living: LOCALThe Indianola Record-Herald

Bill Tomlinson, aretired United MethodistChurch pastor, keeps hisministry alive as afull-time volunteer atWesley Woods RetreatCenter in Indianola.

The Indianola residentspecializes in handymanand woodworking tasks.

“I tell everyone I’m thechair man of the staff – Ifix the chairs,” Tomlinson,who lives at The Village,said. “I do maintenancework and fix things. In thesummertime I keep thefishing poles fixed.”

Tomlinson said he hasbeen a volunteer at WesleyWoods for more than 20years.

“I enjoy it very much. Ienjoy being with the staffout there,” he said. “I likethe challenge – it’s alwaysa challenge to fix things.”

Tomlinson is one ofmany Village residentswho remain active in thecommunity.

“People living on ourcampus are so active,”said Julia Fitzhugh,spokeswoman for TheVillage. “We also have alot of people living on ourcampus who arepassionate aboutvolunteering and making adifference in people’slives.”

In addition toTomlinson, the followingVillage residents also areactive volunteers :Armetta Keeney, Paula

Arand, Jim Rush, DorisYoung, Bob Coffey andGeorge Gibson.

“We have many morevolunteers on campus, thisis just a few of them,”Fitzhugh said.

Keeney, who has won atleast 100 blue ribbons atthe Iowa State Fair for piemaking, made 700 cups ofcustard last year andshared them with friends,neighbors and people inthe Village’s HealthCenter. She is continuingthe custard give-awayproject this year, Fitzhughsaid.

Arand helped with therecent renovation at theNational Balloon Museumin Indianola. She alsocontinues to work hernormal, twice monthly,shift there.

Rush volunteers atIowa Methodist MedicalCenter in Des Moinesevery week.

Young volunteers at theMilo library and keepstheir genealogicalrecords.

Coffey delivers Mealson Wheels and Gibsonvolunteers for Habitat forHumanity.

Villagers volunteerthroughout lifeMeals on Wheels to WesleyWoods benefit from supportBy KEVIN [email protected]

%6-3 +))$#'545)3 67#&7)),)3' .4'"

+++1&7.&476#43)063.()34#.106!

$#!#) (! )"&*'%

*()0$ -2 6-/ 4/111

IW-9000317157

www.edwardjones.com Member SIPC

Quendy S. Sweeney,AAMS®, CRPC®

Financial Advisor1206 East 2nd AveIndianola, IA515-962-1949

Todd LappeAAMS®

Financial Advisor1509 N. 1st StreetIndianola, IA515-961-2056

Grant P. McGrawAAMS®

Financial Advisor115 N. BuxtonIndianola, IA515-962-2704

Phil LangstraatFinancial Advisor123 South HowardIndianola, IA515-961-5367

Doesn’t Mean You Retire from Life.Maybe your idea of retirement is having a secondcareer or working part time, volunteering or indulging inyour favorite hobbies. Doing the things you want to dois what retirement should be all about.

Learn how. For a free, personalized review of yourretirement, call or visit today.

Retirement

*((,-)1 3(& "/4 %4$" 3(& .(!& +(746 ()4#+.$"0)., /&%. /.(".% )$ -'% *'!#04$"7-42 5'&4 54)"4& 2'$ 3)!*5 ") 0'64786; %80<28!<284 '" "04 '**!', $"'"4 $!&64/ 3)& '$47)*5 7)*$47!".64 /4'&#

8,$) ,.$"45 '$ )*4 )3 "04 '843 &1642!5 -;"84 2! +;#);! *$.$ &8#4 )!: (;6,: /89;634 3)& "04 $47)*5 /4'&#

+))- *) 3!&"04&( "04 %4$" .$ &.10" 04&4#

IW-9000326640

Page 5: Senior Lifestyles

Wednesday, February 22, 2012 • 5The Indianola Record-Herald

Senior Living: LOCAL

In Christ’s LoveEveryone is Someone…

www.good-sam.com

Skilled Rehabilitative Nursing Facility(515) 961.2596

Meadow Glen Terrace Senior Housing(515) 962.2553

Good Samaritan Therapy(515) 962.2555

Good Samaritan Home Care(515) 962.2540

Your Choice-To Stay at Home with our Help.Good Samaritan Now Offers Home CareSkilled Nursing • Home Health Aides • Therapy Services

Supportive In-Home Services such as:Bathing •Medication Setup/Management

Laundry • Light Housekeeping•Meal Preparation• Dressing

• Comfortable one- andtwo-bedroom apartments

• Kitchen appliances, washerand dryer included

• Utilities plus extended basiccable TV included

• Weekly light housekeeping

• Daily noon meal in thecongregate dining room

• Social and recreationalopportunities

• Scheduled transportationfor local shopping

• Emergency assistanceavailable

Senior Living: Meadow Glen Terrace

IW-9000326634

Members of the Simpson mens basketball team met with residents at The Village during arecent visit on Feb. 6. Residents of The Village were invited to attend games Feb. 18.

A Villagepep rallyforStorm Venice Washington of the Simpson men’s

basketball team visited with residents atThe Village. PHOTOS SUBMITTED

Head coach Charles Zanders gives Village residents an update on the Simpson Stormmen’s basketball team. The men visited the new E Street Cafe at The Village. Residentswere invited to attend the Feb. 18 games, while the residents are planning anend-of-season pizza party for the team.

Page 6: Senior Lifestyles

6 • Wednesday, February 22, 2012

(ARA) - The kids arefinally on their own andyou’re ready to reclaimsome spaces in your homethat were previouslydedicated to child’s play.Even though asempty-nesters youprobably won’t spend somuch on food, educationand gas money, you’re stillnot ready to go into debt toredecorate theonce-kid-centric rooms inyour home.

Fortunately, it’s easy tofind redecorating optionsthat pack grown-up appealwithout a grown-ups onlyprice tag. You can makeover bedrooms and playrooms with a fewbudget-friendly tricks.

Not sure where tostart? Here are a fewhelpful hints:

Your teen barred youfrom making decoratordecisions about her roomlong ago. Now that she’smoved out, it’s time to teardown those rock bandposters, empty the closetof clothes she’ll neverwear again, and dosomething more sedatewith those awful candypink walls.

Whether you’replanning to sell yourempty nest anddowngrade to somethingsmaller, or just want toenjoy all the rooms in yourhome again, redecoratinga child’s room has manyadvantages.

Start by repaintingwalls in neutral,sophisticated tones. Then,spice things up - in amature, adult way - withan accent wall. For thosethat are afraid ofcommitting to wallpaper,repositionable peel andstick wallpaper is a greatoption for creating aunique decorator featurein a room. Whether you’relooking for beach wallmurals to evoke therelaxed feeling of yourlast tropical vacation, or acity skyline to create asophisticated aura, youcan find many optionsonline at websites likeDecorPlace.com.

Clear all the excess

toys out of the playroom,and put their X-box oneBay. (If they reallywanted it, they’d havetaken it with them.) Nowyou’re ready to put thatspace to adult use - as ahome theater, craft roomor office.

Bring in thatbig-screen, high-def TVyou didn’t buy beforebecause you couldn’t bearthe thought of stickyfingerprints all over it.Buy that awesomesurround-sound systemyou passed on for yearsbecause you feared how itwould sound with yourkids’ favorite cartoonblasting out of thespeakers.

Finally, don’t overlookthe bathroom. If you’veheld off on buying new

towels, bath mat and ashower curtain until therewere no more teenagers inthe house to mess themup, it’s time to treatyourself. While you’re atit, replace the utilitarianshower head with aluxurious multi-head unitor a rainfall shower head.Install a towel warmingrack now that theelectrical outlets are freeof curling - orstraightening - irons.Choose a serene,comforting color and paintover the cartoon fishdecals.

Studies show thatredecorating an adultchild’s room so they knowthey can’t go home againactually helps them bettermake the transition toindependence.

Reclaiming an empty nest into your own nestSenior Living: HOME The Indianola Record-Herald

2012012012020120120112020010000000000000 W.WW.W.WWWWW.W.WWWWWWWWWW.W.WW.W.W 4th4th4th4th4th4th4ththth4th4th4th4th4th4th4th4th4th4th4t4th4th4th4t4tthhth4th4t4t4t4t4ththhh4thth444th44th444th4thhhth4tththth AvAvAvAvAvAvAvAvAvAvAvAvAvAvAvAvAvAvAAvAvAvAvAvAvAAAvAAvAAAvAvAvAvAvAvAAvAvAvAvAvAvAvAvAvAAAvAvAvAAAAAveeeeeeee.,e.,e.,e.,ee.,e.,ee.,e.,eee.,e.,.,.,.,e.,.,.,,.,,,,,.,, IndIndIndndndddIndIndIndnddIndInIndIndIndIndIndIndIndIndndIndIIndIndIndIndIndIndndInIndIndIndInddddddIndInndddIndIndnddIndIndddndndIndndnddInIndnddIndIndInnnnddIndddndnddianianianiananianianianianiaaniaiaianianiananianianianianianaiananiannnniianianianianaanniaiaanaianiannaianianianananiaianananananannnnaananananolaolaolaolaolalaolaolaolalalaolalaolaolaaaolaaoolaooolaolalaaolaolaolaoolaolalaolaolaolaololalaaaaolaolaolaolaaaaaololalaolaola • Of• Of• O• Of• OfO• Of• Of• O• Of• OfOf• Of• Of• Of• Of• O• OfOfO• OfOff• Of• OfOf• Of• O• Of• Of• O• O• O• Of• Of• Of•• Of• Of• Of• Of• OOOOff• Of• Of• OfOfOOOfOfOfOfOfOfOfOfOfOfffficeficeficeficeficeficeficeeceficeficeficeficeficeficeficeficeficeficeficeficeficeficefificeficeficeficeeeeeficeficeficeficeficficeficeficeficcecficeceficfifificeficecficcececeficeficefificececeeeeficeficccee HrsHrsHrsHHrsHrsHrsHrHrsHrsHrsHrsHrsHrsHrsHrsHrsHrsHrsHrsHrsHrsHHrsHrsrsHrsHrsHHrsssHrHrHrsHrHrsHHHHrrsHrsHHrsHrHrsHrsHrrsrsssrsrs: Mo: Mo: Mo: Mo: Mo: MoMoMoMo: Mo: Mo: MoMo: MoMo: Mo: Mo: MoMMMMo: M: MoM: Mo: MoMo: MMo: MoMo: MoMMMoMM: MoMo: MoMoMMMMoMoMoMMo: MoMoMoMMon-Fn-Fn-Fn-FFn-Fn-Fn-Fn-Fn Fn-Fn-Fn-Fn Fn-FFn-Fn-Fn-Fn-Fn-Fn-Fn-Fn FFFFn-F-Fn-Fn-Fn-Fn-Fn--Fn-Fn-Fn-FFn--n-n-Fnn Fnn Fn-FFFn Fn- ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8riri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8ri 8riri 8ri 888rirri 88ri 88ri 8ri 8ririii 8ri 8ririri 8riiiriri 88rriri 8rri 8rii 888ri 8ri 8riri 88ri 88888:30:30:303:30:30:330:3030:30:30:30:3:3:30:30:30:30:3030:3033:30:303030303030:300:303030:30:3:30:30:30: 0333030:30:303030:30 a.ma.ma.ma.ma.ma.ma ma.ma maa.ma m.ma.ma.ma.ma.ma maa.ma mmma.mma.ma.mma.ma.ma.ma.mma.a.mma.mma.ma.ma.ma.mm.-5.-5.-5.-5.-5.-5.-5.-5-5-5.-5.-5.-55.--.---5-5.-5-5-5-5-5-5.-.-.-.-.-5555 p.p.p.p.p.p.p.p.pp m.m.m.mm.m.m.m.m.m

• Fr• Fr• FrFr• Fr• Fr• Fr• Freeeeeeeeeeeeeeee WaWaWaWaWaWaWWaterterterterterterter!!!!!!• Fr• Fr• Fr• Fr• Fr• Fr• Fr• Fr• Frree Eee Eee Eee Eee Eee Eee Eee leclecleclecelecleclectritritritriitritritricitcitcitcitcitcitcitcityyy!yyyyyy• Sn• Sn• Sn• SnSnSnSn• SnSnSnSnow Row Row Row Row Row Row Row Row Rw Remoemoemoemoemoemoemoemoemoemmomoem valvalvalvvalvalalvv andanddandanda ddLawLawLawawLawLawLawLaLa n Sn Sen Sen Sn Sn SeSen rrvirrrvir cecescesescesses ProProProProPPP vvidvidvidvidvvidv ededededed

• Se• S•• Se• SeS• Se• Se• SSenionionionionioninioorr Hr Hor Hor Hor Hor Hor Hor Housiusiusiusiisisiusisius ngngngngngnnn• C• Cl• Cl• C•• Cl• Cl• oseoseoseseeose toto Sto Sto SSSto SSto SSSSto Shophophophophophophophopphoppppinpinpinpinpippippinp gggggg• PrP ofefeefeefessississiississsississionaonaonaonaonaonaonanal Mal Mal Mal Mal Mal Mal MaManagnagnagnagnagnagnagnagemeemeemeemeemeemeemeementntntntntntntnt• Income-Based Rent *

SmarSmarSmarSmarSmSmSmSmaSmaSmarSmarmarSmarSmarmarSmarSmarmarmarSmarSmarmaSmarSmarSmarSmarmarmarSmarSmarSmSmSmSmarSmarSmamarmarmararSmarmarmarmarSmarSSSSSmSmarSmaSmarSmarSmmarSmarmamarmarmarmarSmarSmarSmarSmararSSmarSmSmarSmarSmarSmararrSmaSmarmarSmamarrSmarSSmarmSSmSmarSmSmamarmarmmamamarSmmaSmmmSmarmarmmamSmSmSmmaarmma t Mant Mtt Mant Mant Mant Mant Mant Mant ManMant Mant Mant ManMt Mant Mt Mant ManMat Mant Mant Mant Mant Mant Mat Mat Mat Mant Mant Mant Mantt Mt Mant Mant MMant Mt MaMt Mt MaMat Mant Mantt Mat Mt Mt Mant Mt Mt Mt Mt Mt Mt Mant Manant Mant Mant MMt ManManMt Mt Mt Mt Mat Mt Mt MManManManant Mant Mat Mttt Mt Mtt Mant MManMMMMat Mant Mantt Mt MMMt Mannt Mt Mt MMatt Mt MMMMttt Mt Mt Mt MMM ntt Mttt anagemagemagemagemagemagemagemagemageagemagemagemagemagemagegemgemagemagemagemagemagemagemagagemgeagegeemagemagemaggemgeagemagemgememgegeemgemagemagemegememmemagemagemagemgeeememgemagememagemaaggeagemagegegegegemgemeeagemgeement dent dent dent denent deent dent dent dent dent dntent dent dent dent dnt dent dnt dent dent dent dent ddent dent dentent dent denenent den ddnt dddt ddddddt ddddddddddt dddddt dddddnt ddddtt ddtt dttt doesooesoes nooesoeoes noes noes noes noes nees noes noes ns noes noesoes noes noes noes ns ns ns noes noes noesoes noes noeoesoesoes noes noes noes noooeoes noes ns noes noooeoesoes nnes nnoeoeoesoes nnoeoesesoes nnnoeses nss ns nno sess ot diot diot diot dioot dot dit diot diot diot diot diot dit didiot dit diot diot diot dit diot dot diot diot diot didit dit didiot diot didiot diit diot didddididott ddot dio didiot diiot dot ddididiiidd scriscriscriscriscriscriscscrcccscsccriscriscririscriscriscriscriscriscriscriscricscriscririiscrscscriscscrisccrcrriscriscriscriiscrisccscriisscccscriiscsccrrscrscscsccccrirriiccscriisc iscscsss iminaminammiminaminamminaminminaminaminaminaminaminaminaminaminammminaminammimiminaminammminaminamimimiminaminaminainminammiminainminaminammmminammmimmmiimiminminammmmmmminaimmmmmmmmmminmmmmmmmmimmmm te onte onte onte onte one onte onte onte one one one onte onoe one onte onte onte onte onte onte onte ote one ononte one one onooe oonone one onnteee the bththe bthe bthe bthe bthe bthe bthe bhe bhe bhe bhe bhe bhe bthe bthe bthe bthe bhe bthe bhe bhee be bthe bthe bthhehe be bthe be bthehe be bhe bhe bbbthe bbbeeee be bbbbbbbbbbbbbe bbhe asisasisasisasisasisasiasisasisasisasisasisisiasisasisasisasisasisasisasisasiasisisasisasiasisasisisasiasisasisasisaasiaaasasasiisaaaasasasasisasisassiaas of diof diof diof diof diof diof dof diof diofof dof diof diof diof diof dif diof diof diof diof diof diof dididiof diof diof diofofof dof diof dif dof didiof dif diofof diof dif diof didoof diof dof didddiof diddid sabsabisabsabisabisabisabisabisabisabababsabisabiabsabisabisabisabibiiisabiisabisabisabisabisabisabibisabisabiiisabissabsabiabsabsabiisabisabisabababsabiiisabisabisabsabisa iisabiiisabiiaa isaasabiabiia iaabbibis litlitylitylitylitylitylityitlitylitytlitylityitylitylitylitylitylitlitlitylilitylitylitylitylilililitylitylitylitylitllitylitytlitylityllitylitylitytitylitylitylitylitlitylitytytylityyytylitlitylitllittytytylityllitylitylittytyylityllityitlitlityliliityititititylitytylilililiititytytylitytytyitylitylilitytyyyyyyylityitytyyyyyyytyylliitittylityyyyyylilityyityyy ststststststststtatattatatatstastaatatstststststastststttaststttatatataataatstststtastaatatssstststtatatataaastaasstststttatastastaaatsststastaastststasstststtatsttstastastattastasttaastaststaatstatats atatatussssussssssssssssssssusssssusssssssssssssssssussuuussssusuusssin thin thinin thin thin thinin thn thn thin thin thinn thin thin thththin tin thin thin thin thin thin thin thn thin thin ththhin thin thin thn thin thin thin ththin thin thin thin thinin tn thnin thin thin ththin ththn thn ththin thn thn thn thin thin thin tinn thinin thn thin ththhin thin thin thin thinin thininn tn thn tn tn tttthin tn thin thin thin thin thin thin tin thin thin tin thnnin thn hn thnn thinin thnin thin tthin thiininninin hhe ae adme ade ae adeeee adme adme ae ade ae admee ae adme adme ae ae adme admadme ade adme ade ade adme adme adme adme adme adme admadme adme adme adme ae ae adade ade admde adme admee aee ae admeee ae adme admee ae adme admeeee adme ae adme admee mmadmmissiissiissiissiissiissiissiissiissiissiissiissiissiissiissiissiissiississssississississiiissiissiississisissiisissiissiissiissisisiississiiis on oron oron oron oron oron oron oron oron oron oron oron oron oron oron oron orn oron oron oron ororon oron ororon oron orororon oron oon oron oron ororon oron ororon oroon oron oron orrrroon ororrrro ooroororn oornn oorn or acceacceacceacceacceacceacacacceacceacceacceacceacceceacceacceacceacceacceacacceacceacacceacceacceaccecececececeacccececceacccea cececececeeacceceea ess toss toss toss toss toss toss toss toss toss toss toss toss toss toss toss tss toss toss toss tossss tss totooos toos toss tootoss toos tototttottototos totoss tttos ttss o, or t, or t, or t, or t, or t, or, or tor tor tor tooor, or t, or t, or t, or t, or t, or tor t, or t, or t, or t, or tor tor tor, or t, or tor t, or t, or tor toror t, or t, oror tororror tor tr tooor t, or t, or t, or t, or t, or tr tr t, or t, or t, or ttoror tor tor tt, o reatreatreatreatreatreareateatreatreateatreatreatreatreatreatreatreatrereatreareateatreatatreatrereatreatttreatrearreatrrrreerrrre trrrreatatateaattrererereeaeaeaa mentmentmentmentmmentmenmentmentmentmentmentmentmentmentmentmentmentmentntmentmentmentmentmemmentmentntentmentmentmemmenmentmementmemeentmementmemmmemememementmmmmenmementeeemememmeeemeeeeeee or emor emor emor emor emor emor emor emor emor emor emor emor emor emor ememor emor emor emor emor emor emoror emr emmor emrr emr eror emmoror emrrrrror mororrrorrororororr e ployployploployployployployployployployploployployoyployployployployployployployployployployplploployploploplployloyploloyployplloyyloyplopl yyyoyployyoymentmentmenmenmentmenmenmenmentmentmentmentmentmenmentmentmenmenmennmentmententmentmenmentmeentenenentntntmentmmmentmenentmenenentmentmenmententenenenmenmenentntenententenenenntentntnentententenentntenmentntntntenmenenenenmenmeenenteennenennmennnnntttm ttnttnnnttmentmentmentt inin,in, iin, iin, iinin, iin,in, iinin, in,n,in, iin, iiiin, iin, iin iin, iin, iin, iiiin, iininin, iin, in,in iiiin, iin, iinn,inin, iin iin, iininininn, iin, iin, iii, iiininnin, i, iin, iin, iin, iiiiininininn,n, in, in, iiiin,inininin,in, iinn in,inininininninnnn, i,iin,nnn, in, in,,n,inn,,,,,, ts fts fets fetstststs fts fts fs feststs fts fts ftsts ffets fts fffefeffefefeeeets fets fetttststs fes ffts fts fts fefefefefefefeeees fts fts ffets fefefeetsts fets fts fs fts fefefefefets fets fefefefefefefefeets fes ffefeeeefets fes fffefefefefets fets fes ffefets feees fefees ffefefefeeeeets es eetsssts feefeets feederadderaderaderaderadederadderaderaderaderaderaeraderaderaderaderaderaderaderaderaderaderadederadereraderaderaderdederaeraderderderaderaderadddederdderderderadddederaderadederderaderaderaeradederdererderaderadederderaderadderdederarraeraaaaadd aaaaaraderaderadeerrrrrrararaaaaaaaadeederaaaddeeee aaallylllllllllyllylylylyllyllyllllyllyllyllyllyllllylylylyyyllyllyllyllyllylllllllyllyllylylllllllyllylylylllllyllylllllllylllylllllllyllllylylllllllyllyllyllyllyllylylyllylyyyyllyylyyyyyyllylyyyy

assiassaassaaassiassiassiassiasassiasassssiassiassiassiassassiassiassiiassiasassiaasssissiassiassassiassassiassiiiassiassassiassiissiissiassaasasassiassiaasassissassasaasassiassassiiassiaassassiassasssssassassissasssssiassaasasssiasaaaassasasssssis iasssss stedstestedststestetestststedtestestetestedstedstedstedstedstedstedstedstedstedstedstestedststestededstedstestestestesssttedtestedsteststtestedtedsteedstedteteetedteddstedstedstededdstedstessststtestesteddtedssstststeddee progprogprogprogprogprogprogprogprogprogogprogprogprogprogprogprogprogprogproprogrogprogprogprogogprogprogppprogprogogogprogogrogggogprogrogrogoggrogrrogprorrogogprogprogprogrogogogogoggoggggroogogrogogggogoggogpp gramsramramsramsramsramsramramsraramsramramamramamramsramsramsamsamsrammsramsramsamsamsmsramsmsmsramsramsrarararararamrammsmsraramraamamrammmsmsmsramramamramramramrararamammramammsmsrararaamramramamrammsmsrrararamrammsramsmsrrarararamrammmsramramsrrraammsramsmsmmsmsmsmsrrammsmsmsmsmsmsramsmsramsms and aand aand aand aand aandanandanndand and and and adnd ad andnd ad and andndnd and aand aand aand aanananandnd and andnd and and ad and aannd and ad aaand aand andnddndndand aand and and aand aand andanndndd and and aand aanndndndnd ad and aand aand andnd aaand aaand and and aannd and aaaananndaanananan aannnannnnd aa ctivctivccctivctivctivctivctivctictivctivctivtivtivctivctivivctivctivivctivctivctctctctivctivctivctcttivtictivctictctctctivtivctitivtivctivivctctictictivctivivivctccctctctctctctictivctivcctctictitivtitivtivivivvctivtivivctivtitiivccctcttitiivivivctivctcttivivvcttivivctct itieitieitieitieitieitieitieitieitieitietieitieitieitieitieitieiitiiitieitieeittieitieitietieieeitieeitieiittiitittittiititieti ieitiitieietiieitieiti s.ss.s.s.s..s.s.s.s.s.s..s.s.....s.s.s.

Open to persons 62 years of age or older,or disabled persons of any age

MCCORDMANOR APARTMENTS

2010W. 4th Ave.,Indianola

Call today for an appointment! •961-6533

1 bedroom

RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRReeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd ooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccccccccccccccccccccccccccccccccccccccccccccccooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooommmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee************************************************************************************************ PrPrPrPrPrPrPrPrPrPrPrPrPrPPrPrPrPrPrPrPrPPrPPrPrPrPrPrPPrPrPrPrPrPrPrPPrPPPrPrPrPrPrrPrPrPrPrPrrPrPrPrPrPPPrPPrPrPPPPrPrrPrPrPrPrrPrPrPrPrPrPrPPrrrPrefeeffefefefefefeffefefefeffefefefefefefefefefefefefefefefefefefefefefefefefeffefefefefefeffefefeefeffefeffefefefefeefefefefefefefeeffeferereererererererererererererererererreerererrererererereereerereerererereeerererfffffffffffffferffffffffffffff eenceenceenceenceenceencenenceenceenceenncncnceenceenceenceenceenceenceenceeeenceenenceenceenceenncnceenenceenceenceenceenceenceenceenceenenncncenceenceencencenceenceencenceencenenencenceencceencncenceenenenenceceenenncencncenceceenceenenenencncencececeenncncencenceenceenenenencncncenceenenceencencenenn eencee e isisisisisisisisisisisisiiisisisisisisisisisisisisisissisiisisisisisisisississsisisssisississsisisiisisissiisisiississisiss givgivgivgivgivgivgivivivgivgivgivgivggivgivgivgivgivgivgivgivgivgivgivgivgivgivgivigivgivgivgivgivvgivgivgivgivgivgivivgivivivgivgivgigiivivivivvgigiivivvivvgivivgigiivgivgg eeneenenenenenenenenenenennnenenenenenenenenenennneneneneneenennnnneenenenenenenenenenenneneneneennneneneneneenennenennnen totototototototototototototototootooootooototototootooottotoo lolololololololololololoolololollolooolooloololololowwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww incoincoincoincoincoincoincinconconconconcoincoincincoincoincoincoincoconcoinconcoinincoincoincnconcoincinincincincoincnncincoinincncocoincoincoiinncoincnconcoiincoinconcoinconcoiininnconcoiinncincoinnciinconcncnccooincooi ooii memememememememememememememememmmmemememmmemememememmmmmmememememmmmemmemmmemememmmemeeemmemememmmmmmemmmmmeme indiindiindiindiinindiindiindiindiindiindiindiindiindiindindiindiindiindiindindidndindiindndiininindindindinin viduviduviduviduvidvivividuduviduviduviduuviduviduviduviduviduviduidviduviduvidviduvidviduidduviduduviduviduvividdualals;als;als;als;als;lsls;lsals;als;als;als;als;als;als;als;als;alsalsalalalals;ls;alsalsalsals;als;alsals;ls;;lsals;;ls;;;aal ;s; contconcontcontcontcontonconcontcontcontcontcontontontcontcontconcontcontcontcontcontconttcontcontntconttntcontcontcontontntttntnttnontactactactactactactactactactactacactacactactactttactactactaactactactactactacacaactaacacactacaca taactactacac officofficofficofficofficffiofficoffiofficofficofficofficofficofficofficfficofficofficofficofficofficofficoffiofficofficoffiofficofficofficofficofficofficffifficffiffiofficofficofficofficffiofficofficoffiffifficfficffiofofoffiofficficficcooofoffficfificoffficofficficficficofficficffifiofficfio eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee forforforforforforforforforforforfforforforforforforforforfofoorforfofoforfoororforfofofo dedetadetadetadetadetadetadetadetadetaetattatadetadetadetaetaetadetatadetatadetadetaettadetadetaaadetaaadetadetadetatadetataaaetaaaaaaadededetaaataailsilililililsililililsilsilsilsililililsilsilsilsilsilsilsilssilsilsilsilsilsilsilsilsilslssilililsililsilsilslsilsililsilssilililslssssilsililssslsss......

IW-9000326608

It’s not an unusual thing to do.In fact, pre-selecting your monument is one of the

nicest things you can do for your family.

Select a memorial from one of thelargest displays in Iowa.

Open Mon.-Sat. • Sun. & Evenings by Appt.

Pre-Selection for Peace of Mind.

Indianola Memorial WorksMartin & Tanya Hall, Owners

Hwy. 65/69 South • 706 S. Jefferson Way

Indianola • 961-3103 or 800-525-3349

SAVE NOW

during our

Winter Sale!

IW-9000326820

Page 7: Senior Lifestyles

Wednesday, February 22, 2012 • 7Indianola Record-Herald Senior LIving: PROFILE

Ask most anyone aboutlocal musician TonyValdez and they’ll saythey’ve heard him withone of his many bandsperforming at local hotspots like SummersetWinery and events aroundDes Moines over the past45 years.

But there is much moreto the 60-year-old guitaristand singer. He’s up mostdays at 4 a.m. and off tothe downtown YMCAwhere he works out andteaches a spin class twice

a week. He loves to cookand often makes dinnerwith his wife, Eileen, inthe kitchen of their DesMoines townhome. He isin the thick of a rigorousfour-year process tobecome a deacon in theCatholic Church. He’sbeen a radio show host,and he’s the father of twogrown children, daughterHeidi Valdez, a socialworker in Des Moines, andson Aaron, a chef at theThirsty Whale Bar andGrill in Algonquin, Ill.

But at the heart of theDowling Catholic HighSchool grad, is music. He’s

made a living entertaininglocal and regional fans formost of his life.

“I am so totally amazedI have been able to dowhat I totally love for solong,” says Valdez, whosethick wavy hair is adistinguished silver gray.

Music is just a part ofhis DNA, Eileen Valdezsays.

“When we’re drivinghis fingers are movinglike he’s playing a guitareven if there is no musicplaying,” she says.

With keyboardist and

Des Moines musician Tony Valdez has been performing throughout Iowa for more than 45years and he has no plans of stopping anytime soon. ANDREA MELENDEZ/THE REGISTER

VALDEZ KEEPSROCKIN’AFTER 45 YEARS, THEDES MOINES MUSICIANSTILL LONGS FOR THE STAGEBY PATT [email protected]

See VALDEZ, Page 8D

ABCM Healthy Living Home CareA new, value-added service of Westview Care Center

! '()#+3609%- .(+3 5%$3

! 5(+&%)0()"20&

! .(+3+%/3$ 73$8093

! .%)61+%) 73$8093 * ,)9063)!%- 4$%)"&($!%!0()

Compassionate care for as little as 90 minutes aday or as often as 24 hours a day, 7 days a week

Westview Care Center ! Indianola, IA(515) 442-3544 ! www.abcmcorp.com

IW-9000326646

Page 8: Senior Lifestyles

8 • Wednesday, February 22, 2012 Senior Living:PROFILE Indianola Record-Herald

singer Carey Crowson,Tony Valdez performsweekly gigs at Sam andGabe’s bistro in Urbandaleand the CosmopolitanLounge downtown. Thepair also play at localwineries and privateparties.

He also performs withThe Tony Valdez LargeBand, which consists ofValdez and nine otherlocal musicians who play avariety of music styles,including jazz.

A third group, theRetro Rockets, is Valdezand four other musicianswho play music from thelate 1960s through the1970s. It’s a return to hisroots, he says.

He grew up the oldestof three children in WestDes Moines’ ValleyJunction neighborhood.His dad, Manuel Valdez,

worked at a cementcompany and his mother,Helen, worked for theDepartment ofAgriculture.

Manuel also was amusician. “There wasalways a guitar around thehouse,” Valdez says. Hisfather played traditionalMexican-American musicin a band that entertainedat dances and otherevents. A young Tonywould accompany theband by shaking maracas.

As a freshman in highschool, Valdez remembershis mother asking him ifhe’d heard a song by anup-and-coming bandnamed the Beatles. “Ilistened to it on the radio,”he says. The song was “IWant to Hold Your Hand.”

“I ran down the alley tothe record shop andbought the 45,” he says.He was mesmerized bythe entire British Invasion

and its sound.Valdez taught himself

how to play the guitar(though he’s never learnedto read music except for afew chords) and formed aband with four other boysin his freshman class. TheEchos V played at sockhops, proms, graduationand other school events.The group consisted ofValdez on lead guitar,brothers Rick and GaryChase on rhythm guitarand drums, respectively,Bruce Cameron onkeyboards and RickBreuss on bass guitar.Their reach grew beyondDes Moines as they landedgigs in surrounding citiesand counties.

“My dad would haul usand our equipmentaround,” he says. “It keptus out of trouble.”

He married at 20 andhad two children. Echos Vhad disbanded and Valdez

was working in inventorycontrol at a warehouse andlater as a customerservice trainer while stillplaying gigs four or fivenights a week with variousbands.

He divorced and latermet Eileen. Valdez’s sisterintroduced him to theCleveland transplant.They married in 1991.

Eileen, humanresources director for theDiocese of Des Moines,convinced him to “take aleap of faith” in 1998 andmake music a full-timecareer.

“I struck out on myown and it was a strugglegetting started,” he says.He was a one-man band, ofsorts. He had to find gigs,do the booking and finalizecontracts on top ofpreparing music andfinding musicians to helpout when needed.

“The two keys to Tony’ssuccess are that he’s agood musician and he’s avery personable humanbeing,” says MyronPeterson, a trombonistwho plays in The TonyValdez Large Band and isband director atUrbandale High School.

Peterson says Valdez’ssincerity makes himsuccessful.

“We played at the sameevent a year apart. Whenwe walked in to set up,Tony rememberedeveryone’s name andwithout pause, spoke tothem,” Peterson says. “Healways has a genuinepersonal touch that makespeople feel like they arepart of the process.”

The two first met whenValdez hired Peterson aspart of a band that openedfor Latin jazz musicianPancho Sanchez at the Val

Air Ballroom in 2001.“He said he was putting

together a larger band andneeded a tromboneplayer,” Peterson says.“The rest is history.”

Valdez’s musicalaccomplishments includebeing inducted into theIowa Rock’n Roll MusicAssociation hall of fame,an honor he says bringsattention to Iowamusicians.

He also played as a duoact with Don Jaques for 14years until the pair splitamicably in 2010. Valdezand Crowson, who alsoowns Crowson PianoService, paired up. It wasa change Valdez says hewas ready for. Crowsonwas a singer, somethingJaques was not.

“I like singing harmonyand with Carey we canoffer crowds anothervoice,” Valdez says. “Thisnew duo is kind ofpumping fresh blood inme.”

Along with his music,Valdez is preparing tobecome a deacon. Therigorous four-year processincludes monthly trips to aseminary in Missouri forclasses.

“Tony is very humble,”says Eileen, who is goingthrough the process withher husband. “Thingsmove him. He’s verycaring. He has a servant’sheart.”

Continued from Page 7D

Longtime Des Moines musician Tony Valdez and his wife,Eileen, cook dinner. She encouraged him to pursue musicfull time. ANDREA MELENDEZ/DES MOINES REGISTER

Call today toarrange for yourpersonal tour andask about our

Move In Specials!Our staff is readyto sit down withyou and help getyour reservation

arrangements made.

608 S. 15th St., Indianola, IA 50125

Call 515-961-8900or visit our website at www.windsor-manor.com

IW-9000326674IW-9000326703

Wellmark Medicare supplement insurance plans are not affiliated with any government agency.Wellmark Blue Cross and Blue Shield of Iowa is an Independent Licensee of the Blue Cross andBlue Shield Association. © 2011Wellmark, Inc., Des Moines, IA

AUTHORIZEDINDEPENDENT

AGENTS FOR

You’re one call awayfrom a greatMedicare supplementplan from The Blues®.

Mary Donaghy

22P009-2012-IA

206 N. Buxton St.Indianola, IA 50125(515) 961-3669

[email protected]

Page 9: Senior Lifestyles

Wednesday, February 22, 2012 • 9

(ARA) - There areplenty of reasons torejoice about retirement -more time to spend withyour family, the ability totravel more and theopportunity to pursueyour true passions. Andtoday’s retirees can alsoappreciate the fact that onaverage, people continueto outlive previousgenerations.

Most people enjoyretirement even morethan they expect. A recentstudy by The Hartford andthe MIT AgeLabconfirmed that 64 percentof people less than 10years away fromretirement said theyexpected to feel happier inretirement. And whenthose who were alreadyretired were surveyed, 77percent said they werehappier in retirement thanthey were when they wereworking.

But that doesn’t meanretirement comes withoutits challenges. Throughhis research on the topic,Dr. Robert Pokorski, chiefmedical strategist for The

Hartford’s individual lifeinsurance business, hasidentified the four mostcommon nonfinancialchallenges that mostretirees face:

» Climbing health-carecosts. Health problems aremore common duringretirement, and theassociated costs are oftenmuch higher thanexpected.

» Widowhood. It’s notpleasant to imagine lifeafter the death of yourspouse but three in fourmarried people arewidowed for five years ormore.

» Needing long-termcare for a chronic illness.Many retirees don’t planon the need for chroniccare but three in five menand four in five womenwill need care later in life.

» Outliving yourretirement savings. Morepeople are living to age 90and beyond, and that’s agood thing. However, thisalso means more folkshave to stretch theirretirement savings over alonger period of time.

Addressing thesechallenges

Given these manychallenges, most peoplefind it difficult to saveenough to guaranteefinancial security duringretirement. Fortunately,there are new options thataddress these commonissues.

Medicare supplementinsurance can helpaddress the challenges ofrising health-care costs.Medicare supplementinsurance pays for somehealth care not covered byMedicare, according toPokorski.

Ways to address theother challenges Pokorskiidentified are availablethrough new lifeinsurance and annuityproducts that providegreater financialflexibility to help meetchanging financial needsas people age. There arelife insurance policies onthe market that canprovide funds for chroniccare needs or be tapped asa source of cash during

retirement. Any lifetimebenefits taken from theseproducts during life willreduce the remainingdeath benefit available tothe policy’s beneficiaries.Annuities can be a sourceof guaranteed income thatcan last as long as the

retiree lives.Everyone has different

financial planning needsand goals, Pokorski pointsout, so it makes sense toconsult a professionalfinancial advisor aboutyour financial needs asyou age. While you can’t

predict exactly whatchallenges you may facein retirement, you canprepare for commonissues and protect yourfinances by building asmuch flexibility into yourfinancial planning aspossible, he said.

The Indianola Record-Herald Senior Living: RETIREMENT

How to address the most commonchallenges following retirement

*,%% &- &#2&-42+ ,%!&&# $+" )%.!!&(&,'!

",3/ 0&,,&2.

(*0/-2%0&. 5#)1'$)).

Open to persons 62 years of age or older,or disabled persons

JAN MANOR APARTMENTS

810 S. “R” St,810 S. “R” St,IndianolaIndianola

Rent based on income** Preference is given to low income individuals; contact office for details.

Smart Management does not discriminate on the basis of disability status in the admissionor access to, or treatment or employment in, its federally assisted programs and activities.

• Free Water!

• Free Electricity!

• Snow Removal and

Lawn Services Provided

• Senior Housing

• Close to Shopping

• Professional Management

• Income-Based Rent *2010 W. 4th Ave., Indianola • Office Hrs: Mon-Fri 8:30 a.m.-5 p.m.Call today for anCall today for an appointment!appointment! ••961-6533961-6533

IW-9000326610

DoYou or SomeoneYou Know TakeMultiple Medications?

Or have trouble remembering to takemedications at the right time?

We Can Help!Our in-home compliance pack programcan help you or a loved one takethe right medications at the right time.

Benefits include:• Personalized prescription evaluation• Convenient home delivery• Easy to use bubble packaging

208 E. Euclid ! Indianola515.961.5303 2521 Sunset Dr. ! Norwalk

515.285.2026800 School Street ! Carlisle

515.989.3261

Contact Us

Today for More

Information

IW-9000326632

Page 10: Senior Lifestyles

10 • Wednesday, February 22, 2012

(ARA) - When it comesto fighting arthritis,there’s no arguing with theaxiom “move it or lose it.”Movement and physicalactivity have been proveneffective in relievingarthritis pain and, in somecases, delaying the onsetof symptoms. But ifyou’ve been recentlydiagnosed with arthritis,or have been battling thedisorder without muchsuccess, you may beunsure just what, or howmuch, physical activitywill help you.

One in five Americanadults has arthritis,according to the Centersfor Disease Control andPrevention. Yet only 16percent of those witharthritis strongly agreethat they are confidentthey can manage theirpain, according toresearch by the AdCouncil. Osteoarthritis isthe most common form ofarthritis, and it can makethe simplest activitiesdifficult.

“Arthritis is common,costly, disabling and oftenthought to be a reality ofthe aging process thatcannot be changed,” saysDr. Patience White, vicepresident of public healthfor the ArthritisFoundation. “However, thelimiting effects ofosteoarthritis can beminimized with an actionplan that includes physicalactivity.”

Regular exercise offerstwo important benefits forthose with osteoarthritis.It helps reduce the risk ofdeveloping other healthproblems, and helpsmanage the disease. Nomatter your ability level,you can engage inmeaningful, beneficialactivity to help fightarthritis pain and

symptoms.You should always

discuss your abilities andneeds with your healthcare provider beforestarting any exerciseregimen. In addition, theArthritis Foundationoffers some physicalactivity tips for people ofall mobility levels:

Low mobility

If you’ve beensedentary, starting outgently is essential. Talk toyour doctor about whattypes of activities will beappropriate for yourmobility level. He or shemay advise you to beginwith simple, low-impactexercises, such as walkingor water aerobics.

Don’t overlookopportunities to worklow-intensity exercise intoyour daily routine.Activities such assweeping, mopping,vacuuming and washingwindows are great ways toincorporate beneficialmovement into your day.Take the stairs rather thanthe elevator or escalatorwhen you’re shopping atthe mall, and park at thefar end of the lot andenjoy the stroll to the doorwhen you go groceryshopping.

Gentle stretching isessential for all abilitylevels, and definitelymanageable for those withlesser mobility. Stretchinghelps keep joints andmuscles limber. Inaddition to simple aerobicactivity, stretchingexercises such as tai chi oryoga can help fightarthritis pain.

Moderate mobility

The ArthritisFoundation recommends

at least two hours and 30minutes ofmoderate-intensityaerobic activity, or onehour and 15 minutes ofvigorous aerobic activityevery week. You should doat least 10 minutes at atime and spread youractivity throughout theweek. Those withmoderate levels ofmobility should be able toachieve this goal, providedthey choose activitiesappropriate for theiroverall health and fitnesslevel.

Moderate intensityphysical activity caninclude sports likebadminton, bowling andgolf. Walking faster than 3mph or while holdingweights also qualifies asmoderate activity. Youmay opt to incorporate inyour exercise regimenboth fun activities, such asdancing or cycling.

High mobility

If you exercisedregularly prior to yourdiagnosis you may havebetter mobility, and couldbenefit from increasingyour activity. Aim for fivehours ofmoderate-intensity or 150minutes ofvigorous-intensityphysical activity eachweek.

Incorporating a mix ofactivities will not onlyhelp keep you moving, butcan enhance yourenjoyment of exercise.Consider including in yourroutine exercise likejogging, swimming orcross country skiing andhigher-impact sports suchas basketball, tennis orvolleyball.

Learn more atwww.FightArthritisPain.org.

Fighting arthritis? Exercisetips for all ability levels

Senior LIving: HEALTH The Indianola Record-Herald

(ARA) - Losing weightis one of the mostcommonly maderesolutions, year afteryear. But it’s definitely notthe only health resolutionyou should have for 2012.

Consider jotting theseideas down as well:

1. Resolve to take care ofyour hearing health —About 10 percent ofAmericans report havinghearing difficulties, andthat includes about 1.4million children,according to the BetterHearing Institute. Youmay think you’re tooyoung to worry about yourhearing, but the BHI alsoreports that the majorityof people with hearing loss(65 percent) are youngerthan 65.

2. Resolve to take care ofyour emotional health —Stress seems like a naturalpart of our busy livesthese days, but too muchstress can be harmful toyour overall well-being.According to WebMD,stress can negativelyaffect your mental health,your immune system,heart, digestive system,skin, lungs andreproductive organs.

3. Resolve to take care ofyour bone health — Mostof your body’s calcium isstored in the bones andteeth. When your bodydoesn’t get enoughcalcium from outsidesources, it starts drawingwhat it needs fromstorage, and osteoporosisoccurs.

4. Resolve to take care ofyour feet — The conditionof your feet can clue youin to your overall health,and signs of seriousproblems like arthritis,diabetes and circulatoryissues can all be detectedin the feet.

5. Resolve to get more rest— To help ensure you getthe rest you need,maintain a regular sleepschedule, avoid caffeinefor at least four hoursbefore bedtime, don’t havea heavy meal or drinkalcohol before you sleep,and create a sleep-friendlyenvironment with minimallight and noise.

Five must-follow resolutions

1I!B 8FD#.FH=J47 :<GG7"

1I!B 8FD#.FH=J47 :<GG7"

%%%(7>#A(JI#

63- +ID>? 9I%4DH & :<=>F 6'3 & 5!H=4!I74) 5/ 0'630

! C$"BF!! ;FAG=D4>ID" @DIH<J>A! ,4>? /=HA! 2?FF7 *?4=DA! 1=E> *?4=DA! /!H #<J? #IDF

'!$ #&%"+!#" '// ".0 )(1-%('*% #&!%$0,

IW-900

0326

614

Page 11: Senior Lifestyles

Wednesday, February 22, 2012 • 11

(ARA) - Say goodbye tothe McMansion.According to a leadingreal estate website,Trulia.com, 2010 wasofficially the year thathomes over 3,200 squarefeet ended theirdominance and appeal.But don’t think thatdownsizing meansdowngrading. In fact,homeowners are lookingto upsize their amenitiesto help them enjoy everyinch of their homes.

And, while manydifferent generations arefollowing this trend,boomers are a uniquegroup, looking to enjoytheir smaller nest nowthat the kids have flownthe coop - yet ensure thattheir homes are filled withthe many amenities they’llrequire for their goldenyears.

Anything but basicbaths

While they maypurchase a smaller floorplan, mature adults arelooking for ways to turnordinary rooms intoextraordinarily indulgentexperiences. In the bath,that means the ultimatespa experience - fromelaborate showers toheated floors and towelwarmers. But when itcomes to the bathroom, it’sjust as important to keep itsafe. Luckily, safe can alsoequate to stylish. Tryinstalling comfortableseating for the showerwith a beautiful fold-downshower seat made of teakand aluminum; or

updating common bathaccessories like a paperholder, towel bar or shelfwith a new integratedversion that combineseach accessory with agrab bar for added safety.

Kitchens that cook... and more

Different generationshave very specific desiresin terms of creating akitchen to meet theirneeds, and according tofindings from theResearch Institute forCooking and KitchenIntelligence, boomers arelooking for kitchens withamenities that will assistwith entertaining. Theseupgrades may includecooktops withspecial-purpose features,such as a built-in grill orwok; commercial orprofessional-gradeappliances; a built-incoffee pot connecteddirectly to plumbing or anoven that dramaticallyreduces cooking timeswithout microwaves.

Bedrooms thatsizzle

Mature adults stillknow how to spice up theirbedroom with hotamenities, includingfireplaces, heatedmattress pads andlarge-capacity warmingcabinets for blankets,robes, towels and clothing.Convenience-basedbedroom trends include alaundry room off of themaster suite,remote-controlled window

treatments and voicecontrolled lighting andelectronics, making yourmature boudoir muchmore magical than yourchildhood bedroom.

The greateroutdoors

No-mow lawns havesprouted up as a time-,water-, fuel- andmoney-saving alternativeto the traditional lawn.These lawns have beenaround for over a decadein parks and other publicspaces. Now they’recatching on withhomeowners - particularlywith the growingpopulation ofsecond-homeowners whodon’t want to spend theirprecious getawayweekends mowing thelawn. They’re alsobecoming popular withmature adults who aresimply tired of the rigorsand high cost of constantlawn upkeep.

For homeowners incolder climates who aretired of the hassles andhazards of snow removal,driveway heating systemsare an ideal amenity.Radiant driveway heatingsystems provide heatsimilar to indoor in-floorheating systems. Heat isdelivered with eitherelectric cable (electricsystems) or by hot waterpumped through plastictubing (hydronic systems)compacted in the surface.Most driveway heatingsystems have automaticsmart sensors that turnthe systems on when it

begins to snow, providinggreat consistency andreliability for snowremoval, whether you’rehome or not.

And, with safety alwaysa concern - both indoorsand out - driveway heatingsystems are not only

convenient; these systemsare potentially lifesavers,helping prevent heartattacks, frostbite and backpain commonly associatedwith snow removal.Driveway heating alsohelps reduce injuries dueto slips and falls, and

possibly liability due tosuch accidents.

Regardless of the sizeof your home, whether youbuild new or buy used,filling your empty nestwith amenities will help tomake your golden years asgood as gold.

Today’s boomersdownsize homes,but upsize amenities

The Indianola Record-Herald Senior Living: HOME

Eye Wouldn’t TakeEye Wouldn’t TakeThem For Granted...Them For Granted...

Get Your Eyes Checked Regularly.

Optometric AssociatesOptometric Associatesof Warren County, P.C.of Warren County, P.C.

Carlisle 989-0889Indianola 961-5305Norwalk 981-0224

On Site ConsultationWith Wolfe Clinic

Proudly serving all your optometric needs since 1965.Proudly serving all your optometric needs since 1965.CRAIGWINJUM, O.D. • JONATHAN ANDERSON, O.D. • MICHAELCRAIGWINJUM, O.D. • JONATHAN ANDERSON, O.D. • MICHAEL O’MEARA, O.D.O’MEARA, O.D.

IW-9000326612

Bathrooms are one of the rooms that mature adults are starting to spend more time,money and thought on.

Page 12: Senior Lifestyles

Information Center1011 N. Jefferson Way., Suite 300Indianola, IA 50125

(515) 962-2066Tues, Wed & Thurs ~ 9am - 5pm(Other times available by appt.)

C O O P E R A T I V E

Don’t Miss Out, 92% Reserved - Construction Starting Soon! - www.VintageHillsCoopIndianola.com

What:Showroom Open House

When:Leap Day—Wednesday, February 29,

2 p.m. to 6 p.m.

Where:Vintage Hills Information Center1011 N. Jefferson Ave., Suite 300,

Indianola, IA

Refreshments provided!

“We Reserved early andare excited to personalizeour home at Vintage Hills”

– Glenn & Arlette Kuehl

Exquisite NEW showroom featuringa display of personal home designchoices that are available in a VintageHills Cooperative home.

View a 3-dimensional tour of one of ouroutstanding floor plans

See first hand a sampling of interior finishesincluding a mock kitchen with appliances,flooring, countertop choices, and more

Visit with Vintage Hills specialists to learnmore about project construction and ourground breaking celebration

Early Buyers get to personalize their homes!

Join Us at Our NEW Showroom for aSNEAK PEAK Open House - Vintage Hills Cooperative!

IW-9000326668

MMaakkee tthhee mmoovvee ttoo VViinnttaaggee HHiillllss bbeeffoorree wwiinntteerr sseettss iinn!!Contact Malinda Patch-Gray today!

604 E. Hillcrest Ave. • Indianola, Iowa 50125515.961.1924 • www.vintagehillsrc.com

Where warmth, fun activities and friends abound!

You will love winterat Vintage Hills...

• Maintenance-freeliving.

• A calendar full ofsocial events.

• Visit a neighborwithout even steppingoutside!

• Share a warm mealwith friends.

• All utilities included.


Top Related