+ All Categories

Download - Strips.blogged

Transcript
Page 1: Strips.blogged

As one of the first studies leading to emergence of reverse hybridization strip assays to be used as diagnostic tools in

screening cardiovascular disease risks.

Page 2: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

• 35 bi-allelic sites on 15 genes as an estimate of genetic risk factors for cardiovascular disease. It was called The “CVD35” assay.

Page 3: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Page 4: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Page 5: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Steps of the actual work: • Estimating the genes and variations [mutations, polymorphisms] as

cardiovascular disease risk markers. (35 variations on 15 genes).• Identifying the genome sequences that are needed to be amplified in PCR. • Designing suitable primers for constructing multiplex PCR reactions to

amplify many sequences simultaneously. Mix A and Mix B for 14 and 13 amplificons, respectively.

• Designing two sets of probes for each variation. 70 probes in total, which have to be able to discriminate between single base differences under common stringency conditions.

• Immobilizing these probes onto a nylon membrane. • Genotyping of 1190 control individuals as well as;

– 496 unrelated individuals in order to obtain population frequencies. – 142 individuals for whom quantitative angiography data were available in order

to investigate disease associations.• Biostatistics: Linkage disequilibrium, allele-frequencies, disease

associations.

Page 6: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Challenges in multiplexing the PCR reactions

• PCR products shown here ranges from 95 to 395 bp for mix A and 105 to 535 bp for mix B. Difference in product length is necessary to be able to visualize each region on gel.

• Annealing temperatures of the primers in a reaction mix can not differ more than 5 C.

• Differences in GC contents of the regions which are aimed to be amplified cause problems. (e.g. high GC content of apoE region results in low PCR product…)

Page 7: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Challenges in designing multiple probes; achieving the same Tm values

Page 8: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Challenges in designing multiple probes; achieving the same Tm values

• Probes may differ between 16 to 30 bases.

• They may have mismatching points.

• Each line observed on the strip represents a region where probes with a specific sequence has been immobilized.

• Tm values of some arbitrary oligos:

Probe Sequence -mer GC% Tm (°C)

CAGTGCATGCGAGACGCTAG20 60.00% 63.23

GGGGTCACACCGCGGGCAT19 73.68% 72.96

ATTTACCAAAATTGCTCTAGAA22 27.27% 52.92

CGATGCTAGCATGCATGCATGCTAGCTA28 50.00% 72.11

Page 9: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

Results and discussions

• Strip assays are used as diagnostic tools for rapid screening of multiple genetic risk factors for cardiovascular disease.

• There are same challenges of designing strip tests for multiple loci. These challenges may render the strip tests prone to some complications during the applications.

• These complications can be divided into two groups: – problems with PCR reaction and, – problems with hybridization.

Page 10: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

• Keeping in mind the nature of the primers, probes and the dynamics of oligonucleotide hybridization, the followings are the ways of how to overcome the possible complications when using strip tests;

– Hybridization solutions should be stored properly [!] and any precipitate in any solution should be considered as a serious problem.

– PCR products should be monitored with agarose gel electrophoresis. A “working amplification profile” should be set, hence, each new banding profile can be compared with that profile.

– When properly stored hybridization solutions are used and a working amplification profile has been obtained, and if any suspicious results are observed, hybridization procedure should be reassessed.

• Low stringency conditions may result in false positive band(s) whereas high stringency conditions may result in weak signal(s).

• Poor application of wash steps may result in “noise” colors on strips even at points where there are no immobilized probes.

Results and discussions

Page 11: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital

• There are still some limitations of the strip tests like most of the other genotyping procedures apart from direct-sequencing techniques. For example, any rare mutations at primer or probe sites might result in false positive results, false negative results or no results at all.

Results and discussions

Page 12: Strips.blogged

Genetics and Genomic Sciences Center at American Hospital