Experimental Neurology 223 (2010) 119–127
Contents lists available at ScienceDirect
Experimental Neurology
j ourna l homepage: www.e lsev ie r.com/ locate /yexnr
A human neuron injury model for molecular studies of axonal regeneration
Lina Ziegler a, Yael Segal-Ruder b, Giovanni Coppola c, Arbel Reis a, Daniel Geschwind c,Mike Fainzilber b, Ronald S. Goldstein a,⁎a Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan, Israelb Department of Biological Chemistry, Weizmann Institute of Science, 76100 Rehovot, Israelc Program in Neurogenetics, Department of Neurology, School of Medicine, University of California Los Angeles, CA, USA
⁎ Corresponding author.E-mail address: [email protected] (R.S. Goldstein)
0014-4886/$ – see front matter © 2009 Elsevier Inc. Adoi:10.1016/j.expneurol.2009.09.019
a b s t r a c t
a r t i c l e i n f oArticle history:Received 15 April 2009Revised 24 September 2009Accepted 25 September 2009Available online 3 October 2009
Keywords:Axon regenerationSensory neuronMicroarrayHuman embryonic stem cells
The enhancement of regeneration of damaged axons in both the peripheral and central nervous systems isa widely pursued goal in clinical medicine. Although some of the molecular mechanisms involved in theintrinsic neurite regeneration program have been elucidated, much additional study is required fordevelopment of new therapeutics. The majority of studies in the field of axonal regeneration have utilizedanimal models due to obvious limitations of the accessibility of human neural tissues. Here we describethe use of human embryonic stem cell (hESC)-derived neurons as a novel model for studying neuronalresponses to axonal injury. Neurons were generated using PA6 induction and neurites injured in vitrousing trituration or laser microdissection. Lesioned neurons re-extended neurites with distinct growthcones. Expression of proteins associated with regeneration were observed in this human in vitro system,including appearance of importin β1 in processes after neuritomy. Laser-transected hESC-derived neuronalcultures were analyzed for their transcriptional response to injury using Affymetrix expressionmicroarrays. Profound changes in gene expression were observed over a time course of 2 to 24 hoursafter lesion. The expression of several genes reported to be involved in axonal injury responses in animalmodels changed following injury of hESC-derived neurons. Thus, hESC-derived neurons may be a useful invitro model system for mechanistic studies on human axonal injury and regeneration.
© 2009 Elsevier Inc. All rights reserved.
Introduction
Nerve injury elicits a complex series of events in the lesionedtissue, including axonal signaling, cell body reaction, glial activation,and systemic inflammation. The injured neuron must mobilizeintrinsic mechanisms causing profound changes in transcription,translation, and posttranslational modifications in the neuronal cellbody (Hanz and Fainzilber, 2006; Rossi et al., 2007; Abe and Cavalli,2008), as well as integrating extracellular cues, inhibitory signals,and physical barriers (Yamashita et al., 2005; Gervasi et al., 2008;Kim and Snider, 2008). The molecular mechanisms underlying theseresponses are a topic of intense research, with much still unknown(Rishal and Fainzilber, 2010). For obvious ethical reasons, theoverwhelming majority of studies in this field have been in animalmodels, while human studies have been limited to postmortemanalyses or very restricted studies of responses to intracutaneousaxotomy (Rajan et al., 2003; Polydefkis et al., 2004; Hahn et al.,2006). The latter allow diagnostic and pharmacological studies onperipheral innervation and collateral sprouting, but cannot be usedto elucidate neuronal cell body responses at either the cellular or
.
ll rights reserved.
molecular level. Here we describe the development of a stem cell-derived system that allows interrogation of the molecular mecha-nisms of axonal regeneration of human neurons.
The importance of human embryonic stem cells (hESC) to modernbiology and medicine derives from their pluripotency and the ability,under appropriate conditions, to be directed to differentiate into themyriad functional cell types of the organism while maintaining anormal karyotype (Reubinoff et al., 2000; Thomson et al., 1998).Neuronal cells are amongst the most studied hESC-derived pheno-types, and they replicate many of the developmental and maturefeatures of native neurons (i.e., spinal motoneurons and nigraldopaminergic neurons), and glia (i.e., oligodendroglia). In additionto their future potential in cell therapies, hESC-derived neurons can beused for elucidating molecular mechanisms of genetic diseases of thenervous system and development of drugs (Pouton and Haynes, 2007;Jensen et al., 2009).
Kitajima et al. (2005) demonstrated that PA6 stromal cells caninduce murine embryonic stem cells to form propagatable neuro-spheres, highly enriched for CNS neurons and neural progenitors. Thismethod was modified in our laboratory for hESC (Pomp et al., 2008).Replating these neurospheres on PA6 feeder layers results in theformation of colonies almost completely immunopositive for the earlyneuronal marker βIII-tubulin. Longer term cultures of the neuros-phere cells on laminin (8 weeks) contained electrically functional
120 L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
molecularly identified primary sensory neurons (Pomp et al., 2008).These easily generated PA6-induced hESC-derived neurospheres wereutilized as a source of human neuronal cells for this study.
In order to investigate the molecular responses of human neurons tothe severing of their processes, we used trituration and laser microdis-section to lesion putative axons of hESC-derived neurons in culture andexamined biochemical events in their regenerating neurites by immu-nostaining and gene expression in their cell bodies by whole genomemicroarrays. Our findings reveal both similarities and differencesbetween our system and previous rodent data and establish a novelhuman in vitro neuronal system for studies of neuronal regeneration.
Methods
Cell culture
Human embryonic stem cells (hESC) (HUES9 line (Cowan et al.,2004)) were cultured on human fibroblasts as described for lineHES-1 (Pomp et al., 2005). The PA6 murine stromal cell line wasobtained from the Riken Cell Bank and grown as described inBrokhman et al. (2008).
Neuronal differentiation of hESC-derived neurospheres
hESC-derived neurospheres containing a mixture of neurons andneural and glial progenitors were generated by PA6 induction asdescribed in Pomp et al. (2008). For neuronal differentiation beforetrituration (see below), the neurospheres were cut into pieces using amicrosurgical scalpel and then dissociated mechanically by passingthrough a 22-gauge needle. Neurosphere cells were then seeded onpoly-lysine/laminin-coated coverslips/glass chamber slides (Nunc) asaggregates in neurogenic medium consisting of DMEM/F12 (1:1), B27supplement (1:50), glutamine 2 mM, 50 U/ml penicillin, 50 μg/mlstreptomycin, and 10 ng/ml NGF. The medium was changed every3 days over a period of 3–4weeks. In lasermicrodissection experiments,neurospheres were cut into 0.5-mm-diameter pieces with a micro-scalpel, plated inwells of glass chamber slides (Nunc) coatedwith poly-L-lysine/laminin, and allowed to differentiate and extend neurites for 3to 4 weeks. The aggregates extended large numbers of neurites radiallythat stained with the neuronal cytoskeleton marker β-III-tubulin andthe axonal marker Tau. Many also stained for MAP2ab.
Under these conditions, 1 month after withdrawal of the mitogenbFGF, there was little cell division at the time of axotomy, as shown byKi67 immunostaining (Supplementary Figure 1A). A serial confocal Z-series showed that more than 95% of the cells in the cultures werepositive for theneuronalmarkerβIII-tubulin (not shown). The fewGFAP+presumptive glial cells present (approximately 2% of total cells) werefound in between the “clumps” (Supplementary Figure 1B), and mostwere unlikely to have been affected by laser lesions (see below).
Staining cultures with antibodies to peripherin and Brn3a showedthat about 1/3 of the colonies contained many double-positiveneurons and were therefore of the peripheral sensory phenotype.These culture conditions do not support survival/differentiation ofspinal motoneurons or sympathetic neurons (Pomp et al., 2008, andnot shown). We have not further characterized these neurons withadditional markers, but assume that the rest of the neurons are likelyto be a mixture of CNS phenotypes.
Neuritomy techniques
TriturationThe hESC-derived neurosphere colonies were cultured for appro-
ximately 3–4 weeks in neurogenic conditions until relatively longprocesses were formed. Then, the cells were detached from thecoverslips with 0.25% trypsin–EDTA, triturated mechanically for5 min to separate the somata from the processes and centrifuged for
2 min at 200×g to precipitate the somata. Finally, the cells wereseeded on poly-L-lysine/laminin-coated coverslips in the samemedium used for the initial neuronal differentiation culture.Morphological changes after axotomy were monitored daily using aphase-contrast microscope and recorded photographically. Three tofour days following trituration, coverslips were fixed for immuno-cytochemical analysis or RNA was extracted for RT–PCR analysis.
Laser microdissectionNeurites forming a “halo” around the plated neurospheres were
transected with a laser beam around the circumferences of thecolonies using a P.A.L.Mmicrobeam device (Zeiss). RNAwas extractedfrom the cells in the chambers at 2, 6, and 24 hours after the laseraxotomy and used for subsequent microarray expression analysis.RNA extracted fromwells containing nonlesioned cultures served as acontrols. All of the approximately 10 neurospheres in each well werelaser-transected in each experimental condition. High-quality RNAwas obtained in 3 complete repetitions of the experiment (unlesionedand 2, 6, and 24 hours postlesion cultures).
Immunocytochemistry
Coverslipswere rinsed twice in phosphate-buffered saline (PBS) andfixed with 4% paraformaldehyde for 30 min. After rinsing in PBS with0.5% Triton X-100 (PBST), the coverslips were incubated for 1 hour inblocking solution containing 1% bovine serum albumin and 5% bovineserum in PBST. The following antibodies were used at the indicateddilutions: importin α4 (1:500, a gift from Karsten Weis), importin β1(1:100, Sigma), βIII-tubulin (1:500, Neomarkers), Tau (1:700, Sigma)MAP2ab (1:300 ThermoFisher, USA). The coverslips were incubatedwithprimary antibodies overnight at4 °C. Secondary antibodies coupledto Cy2 or Alexa 594 were applied for detection for 30 min, followed bystaining with Hoechst to visualize nuclei. Coverslips were then rinsedand mounted on slides in 90% glycerol/10% PBS with 1% n-propyl-gallate as anti-fade, and attached with nail polish.
RT–PCR analyses
Total RNA was extracted from neuronal cultures using the RNeasyMini Kit (Qiagen) according to the manufacturer's protocol. Severalgenes that were observed to be expressed differentially in themicroarray analyses were subsequently amplified by conventionaland real-time RT–PCR. Estimation of expression levels was performedusing densitometric analysis with the program ImageJ (NIH). Inconventional RT-PCR, 40 cycles of amplification were used for allgenes examined. The annealing temperature was 55 °C for all genesexcept GAPDH, for which 53.5 °C was used.
Primer sequences (forward, reverse) and lengths of the amplifi-cation products for conventional RT–PCR were as follows:
ANXA11 (CCCCATCGGGCTGGATAAC, GTTGGGCATGTTGGCTCCT, 112 bp)GFRA1 (CCAAAGGGAACAACTGCCTG, AGAAGAGCATTCCGTAGCTGT, 195 bp)NMI (TTGAAACGGAGTTACAAGAGGC, GACAACTGGCTGTCATTCTCA, 112 bp)TIMP1 (CTTCTGCAATTCCGACCTCGT, CCCTAAGGCTTGGAACCCTTT, 127 bp)CDK5R1 (GAAGGCCACGCTGTTTGAG, CGGCCACGATTCTCTTCCA, 137 bp)NPAS4 (AAGGTCCGGCTGTCCTACC, GCCGCTACGATGTCCTCAA, 140 bp)SH3GL3 (GACGACAGGTTCTAACATTCCC, CCCGATTCTCCGTGTATCATTC, 165 bp)SOX11 (AGCAAGAAATGCGGCAAGC, ATCCAGAAACACGCACTTGAC, 180 bp)GAP43 (AACCTGAGGCTGACCAAGAA, CTAGTGGGTGGGAAAGGACA, 165 bp)GAPDH (CTTTTAACTCTGGTAAAGTGG, TTTTGGCTCCCCCCTGCAAAT, 287 bp)
Quantitative real-time RT–PCR (qRT–PCR)
Unamplified total RNA was reverse-transcribed using an oligo dTprimer and the cDNA was used as a template for qRT–PCR. Real-time
121L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
PCR was performed for two upregulated (SOX11 and NPAS4) and twodownregulated (GFRA1 and NMI) genes using the TaqMan geneexpression Master Mix (Applied Biosystems, Foster City, CA). Primersand TaqMan fluorogenic probes were designed by the manufacturer(Applied Biosystems):
FiconglF)exM
Gene symbol
g. 1. hESC-derivenditions, extenseuronal marker βial precursor cellsThe processes etensive and exteAP2− processes
Gene name
d neuronal aggregates extend extensive neuritesive outgrowth of projections was observed from aIII-tubulin (B, red). Hoechst nuclear stain (blue) s. (C) Intense and extensive stainingwith the axonaxtending furthest from the clump shown in panends further away from the cell bodies than the MAat higher magnification. Scale bars=50 μm.
Assay ID
NPAS4
Neuronal PAS domain protein 4 Hs00698866_m1 SOX11 SRY (sex determining region Y)-box 11 Hs00846583_s1 GFRA1 GDNF family receptor alpha 1 Hs00237133_m1 NMI N-myc (and STAT) interactor Hs00190768_m1 GAPDH Glyceraldehyde-3-phosphate dehydrogenase Hs99999905_m1Amplification conditions were 2 min of incubation at 50 °C then10min at 95 °C, followed by 40 cycles of; 95 °C for 15 sec and 60 °C for1 min on a StepOnePlus™ sequence detection system (AppliedBiosystems).
Expression was normalized using the comparative thresholdcycle method with GAPDH serving as a reference. Quantification ofgene expression was based on the Ct (cycle threshold) value foreach sample. The Ct, which represents the PCR cycle at which anincrease in reporter fluorescence above background is firstdetected, was determined by the software, based on the generatedstandard curves and calculated as the average of duplicatemeasurements.
Microscopic observation and photography
Preparations were viewed with Olympus BX60 and CK40microscopes and photographed using digital cameras (Scion) andImageJ software. Images were enhanced using ImageJ and Paint-Shop-Pro software. All changes in the images (contrast, brightness,
. (A, B) Neuronal differenll plated neuronal precurhows that some cells are nlmarker Tau (green) suggl C double-stained for TaP2ab staining (F) (some p
gamma, sharpening) were made evenly across the entire field, andno features were removed or added digitally.
Microarray analysis
Concentration and quality of RNA samples was determined usinga NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies,Rockland, DE) and an Agilent 2100 Bioanalyzer (Agilent Technolo-gies, Inc., Santa Clara, CA). RNA samples (unamplified) werereverse-transcribed and labeled according to manufacturer's instruc-tions and then hybridized to Affymetrix high-density oligonucleo-tide HG-U133A Plus 2.0 Human Arrays (Affymetrix, Santa Clara, CA).A total of 12 microarrays were used in this study, 3 independentarrays for each time point after injury (2, 6, and 24 hours) and anarray for the unlesioned, control cultures. Array data analysis wascarried out in the R computing environment (http://www.r-project.org) using Bioconductor (http://www. bioconductor.org).Raw data were processed using robust multi-array (RMA),normalization (Irizarry et al., 2003). To eliminate batch effects,additional normalization was performed using the R package“ComBat” (http://statistics.byu.edu/johnson/ComBat/; Johnson etal., 2007) with default parameters. Contrast analysis of differentialexpression was performed using the LIMMA package (Smyth,2005). After linear model fitting, a Bayesian estimate of differentialexpression was calculated using a modified t-test. The thresholdfor statistical significance was set at pb0.05 and pb0.01 fordifferential expression analysis and pb0.02 for explorative analyses(gene ontology and pathway analysis). Gene ontology andpathway analysis were carried out using the Database forAnnotation, Visualization and Integrated Discovery (DAVID). Forheat map visualization, significant genes were selected by criteriaof 1.5-fold change (linear scale) in either direction and p value
tiation of hESC-derived neural precursors. (A) After 3 weeks of culture under permissivesor aggregates. The aggregates and the processes were strongly immunopositive for theot part of the aggregates, these could be somata that have migrated away, or neuronal orests that the bundles of neurites extending from the aggregates are axons or axon-like. (D–u (green) and MAP2ab (red). The outgrowth of Tau-staining processes (E) is both morerocesses stained only by Tau are indicated by arrowheads). The insets show a few Tau+/
122 L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
≤0.05 in at least one of the time points. A heat map wasgenerated using the program “Gene Cluster” and visualized withthe program “TreeView.”
Results
Neuronal cells derived from hESC regenerate neurites
Human neurospheres containing primarily neural precursorswere generated from hESC using PA6 induction (Pomp et al.,2008). The neurospheres were then differentiated by plating onlaminin, resulting in the generation of colonies of neuronsextending a halo of neurites (Fig. 1A). More than 95% of thecells were positive for βIII-tubulin (Fig. 1B). The extensive neuriteoutgrowths surrounding the clumps were immunopositive for theaxonal marker Tau (Fig. 1C,E), indicating that the neuritesdisplayed this molecular characteristic of axons. Many of theprocesses coexpressed the dendritic proteins MAP2, but there weremore and longer processes containing Tau than MAP2 (Figs. 1D–F).
Fig. 2. Injury-triggered changes in the expression pattern of importin α and β in humimmunostained for the early neuronal marker βIII-tubulin (red) and importinα (green). Thedouble-stained for importin α (green) and importin β (red). Importin αwas observed in bouninjured neuronal cells (F). (G–I) Three days after trituration importin α was observed iimportin β was expressed in some cells in the somata and the processes (I), as opposed to ittypical neurite expressing importin β. Panels (A), (D), and (G) show merged fields. Nuclei
In initial experiments, colonies were detached from the platesand mechanically triturated (Hanz et al., 2003) in order to lesionneuronal processes. Triturated cells were then replated and neuriteoutgrowth was monitored morphologically for up to 7 days.Although many cells did not survive trituration, neurons thatreattached to the substrate exhibited neurite outgrowth, growthcone formation, and migration of their somata. RT–PCR for GAP43, aregeneration marker (Chong et al., 1994; Schreyer and Skene, 1991),showed a 6-fold increase of expression following trituration andreplating (data not shown), consistent with regenerative outgrowth.
Importin regulation in injured human neurons
Upon lesion of the sciatic nerve in rodents, importin β1 axonalmRNA is locally translated and initiates formation of a retrogradelytransported injury signaling complex (Hanz et al., 2003). In orderto examine whether this mechanism might also be found inhuman neurons upon axotomy, intact and triturated hESC-derivedneurons were stained with antibodies against importin α4 and β1
an neurons. (A–C) Intact cultures containing hESC-derived neurons were double-expression of bothmarkers was observed in somata and processes. (D–F) Neuronal cellsth somata and processes (E), while importin β was observed primarily in the somata ofn the somata and neurites (H), similar to the expression pattern of intact cells, whiles expression primarily in the somata of uninjured cultures. Arrowhead in (I) points to aare stained blue with Hoechst. Scale bar=50 μm.
123L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
(hereafter referred to as importin α and importin β). Expression ofimportin α was observed in nontriturated somata and in processesof hESC-derived neurons, their neuronal identity was confirmed bythe coexpression of βIII-tubulin (Figs. 2A–C). Importin β protein,on the other hand, was observed primarily in the somata of theseneurons (Figs. 2D–F). In contrast, some of the neurons 3 days aftertrituration expressed importin β in their processes as well as intheir somata (Figs. 2G–I), while the neuronal expression pattern ofimportin α was unchanged by injury. These observations areconsistent with injury-triggered local upregulation of importin β inthe processes via localized translation as previously reported forrodent sensory neurons (Hanz et al., 2003; Yudin et al., 2008).
A human neuron injury model using laser microdissection
The ability of neurons to regenerate damaged axonal projec-tions depends largely on their ability to initiate an appropriate,regeneration-associated transcriptional program. Even in the CNS,where regeneration is limited by an inhibitory environment, intrin-sic regeneration programs have been shown to be important (Rossiet al., 2007; Hollis et al., 2009). Microarray technology allowscross-genome expression studies, providing a comprehensive view
Fig. 3. Laser microdissection of human neurites. (A) An aggregate of human nerve cells afteculture substrate. (B) Lesion is shown at higher magnification. (C, D) View of neurites beforeafter the laser dissection and (F) 24 hours later. Processes have completely re-crossed the zothe lesion zone. Scale bars=50 μm.
of gene activity after injury and during regeneration. Gene expres-sion profiles following neuronal injury are available to date onlyfor animal models (Xiao et al., 2002; Costigan et al., 2002; Nilssonet al., 2005; Di et al., 2005; Stam et al., 2007). In order to performan initial microarray analysis of human neurons after processtransection, we needed a technique that would allow simultaneouslesioning of many neurites with high levels of neuronal survival.We therefore established a protocol for performing neuritomy ofhuman neurons in culture by laser microdissection. This techniquepermits the simultaneous severing of large numbers of neuritesradiating outward from aggregates of cell bodies in a simple anddirect manner (Fig. 3). Cultures survived well after laser transec-tion of neurites, and regrowth was observed over a 7-day period.Figs. 3E–F show re-extension of neurites from a laser-transectedaggregate 24 hours after lesion.
Transcriptional changes in human neurons following neurite injury
We explored the temporal transcriptional changes triggered byneurite injury in human neurons by whole genome microarrayexpression analyses. Total RNA from cultures was extracted 2, 6, and24 hours after injury and analyzed using Affymetrix microarrays
r laser neuritomy is seen at low magnification. A dark cut line is left by the laser in theand after a laser cut from another aggregate. (E) Zone of process outgrowth immediatelyne of the cut, consistent with extensive regeneration of neurites. Arrowheads designate
124 L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
(Affy_HGU133). Expression patterns at each time point after laserdissectionwere compared to those of control, non-transected cultures.
Profound changes in gene expression were observed as soon as2 hours after injury, peaking at 6 hours after transection (Fig. 4A). Farfewer genes were differentially expressed at 24 hours after lesioncompared to the earlier time points. Clustering of expression dataaccording to fold changes confirms that the most robust changes in
Fig. 4. Gene expression analysis of human neurons after neuritomy. RNA from laser-transectand analyzed using Affymetrix expression microarrays. Expression at each time point was cotime point vs. control (INJvsC.2/6/24); the green bars show the number of downregulated ge(B) Heatmapdepicting the differentially expressed genes (fold change≥1.5, p≤0.05) after nered represent upregulation, shades of green represent downregulation. Genes and samples6 hours, and the direction of change is consistent across time points for almost all the differe8 differentially expressed genes. (C) The left column showsRT–PCRdata for expression of 4 gedownregulated following injury (inj.=neuritomy, cont.=uninjured control cultures). ExprRNA quantity. (D) Fold changes of genes as determined bymicroarray (black columns), densitreal-time RT–PCR (qRT–PCR). qRT–PCR and densitometric analysis of bands from conventiodownregulation compared to control, uninjured cultures.
gene expression occurred at 6 hours and demonstrates thatexpression patterns are more similar for 2 and 6, hours than for24 hours. This pattern is especially clear for downregulated genes (Fig.4B). The aggregates contained more than 95% βIII-tubulin+ cells andno GFAP+ cells. Therefore, the changes in gene expression were likelyto be almost exclusively due to injury to transected neurites and not toglial cells. A table of all the genes whose expression changed
ed neuronal cultures was extracted at three time points after injury (2, 6, and 24 hours)mpared to the expression of non-injured cultures. (A) Gene expression changes at eachnes, the red bars show the number of upregulated at pb0.005 (left) and pb0.01 (right).urite injury at different time points. Samples are in columns, genes are in rows. Shades ofare clustered by similarity. The majority of the changes in gene expression occurred atntially expressed genes. (C, D) Validation of the microarray data by RT–PCR analysis fornes shown to be upregulated after injury in themicroarrays, and the right column4genesession of the GAPDH housekeeping gene (lower panel) served as an internal control forometric analysis of gels from conventional RT–PCR analysis (open bars) and quantitativenal RT–PCR were normalized to a common reference gene (GAPDH) and depict up- or
125L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
significantly (pb0.05) with the fold changes (≥1.5) and levels ofsignificance is available as supplementary data (SupplementaryTables 1–3).
These changes are much more rapid than those previouslyreported in rodents after sciatic nerve lesion in vivo. This is pre-sumably because of the much shorter distance between the neuritelesion site and the somata in our cultures. The direction of changes ingene expression observed in the expression arrays was validated byRT–PCR for four upregulated and four downregulated genes (Figs. 4Cand D). Quantitative real-time RT–PCR (qRT–PCR) for four of thesegenes also confirmed the direction of the changes (Fig. 4D).
Gene ontology analysis of genes expressed differentially at eachtime point revealed that expression of genes involved in biologicalprocesses related to growth, such as axogenesis, microtubule-basedprocesses, and axon cargo transport was upregulated (Fig. 5), con-sistent with a neuritic regenerative response. A number of path-ways previously reported to regulate axonal regeneration inrodents are activated upon injury in hESC-derived neurons,including MAPK, cAMP, and NFκB signaling pathways (Fig. 5).Furthermore, the expression of several genes that had been pre-viously reported to facilitate neuronal survival and axonal regen-eration in studies on rodents also exhibited changes in hESC-derived neurons (Supplementary Tables 4 and 5), suggesting thatsome of the axonal regeneration mechanisms reported in animalsalso regulate neuronal regeneration in human neurons. Cell cycle-related genes were strikingly unaffected, consistent with thegrowth of neurites being a regenerative response, rather thanoutgrowth from newly generated neurons. Importantly, althoughboth the axonal marker Tau and the dendrite/soma marker MAP2were present in the neurites, only Tau was upregulated by thelesions (fold change 4.53 at 6 hours after injury, pb0.02), sug-gesting that the regeneration response was indeed axonal.
Discussion
We demonstrate here the potential of a novel model for the studyof regeneration of human neurons after axotomy using hESC-derivedneurons. Amolecular pathway shown in lower animals to be activated
Fig. 5. GO analysis of differentially expressed genes at each time point compared to controDatabase for Annotation, Visualization and Integrated Discovery (DAVID, http://daviddownregulated (b0) genes.
by axotomy, local translation of importin β was observed after tritu-ration neuritomy. Significant changes in gene expression after lesionof Tau+ processes by laser were obtained in a repeatable manner.Many of the processes that were lesioned were also MAP2ab-positive.However, in some neurons, such as those of the murine DRG, MAP2abis coexpressed with Tau in all processes and is not a specific dendritemarker (Lerman et al., 2007). We therefore believe that the majorityof Tau+ processes lesioned by the laser are likely to be axons, oraxonal-like, and can serve as a model for axotomy.
The neurites lesioned in this study extended from amixture of CNSand PNS neurons (Pomp et al., 2008). Future efforts will improve thisnovel human axonal regeneration model by using establishedmethods for purification of specific neuronal phenotypes fromhESC-derived neurons. For example, using hESC engineered toexpress GFP under the control of a motoneuron-specific transcriptionfactor (i.e., Singh et al., 2005), pure populations of motoneurons couldbe obtained, aggregated, allowed to grow out axons, and axotomizedto provide microarray data for this specific, clinically importantneuronal phenotype. Similar methods are being developed in ourlaboratory to purify peripheral sensory neurons, and it will be inte-resting to compare the expression patterns of these two differenttypes of neurons after axotomy to find common and exclusive mecha-nisms of regeneration.
We and others have shown that neurons derived from hESC inculture are electrophysiologically active, make synaptic connections,and express neurotransmitters. However, to date, there have not beenextensive characterizations of hESC neurons in terms of whether theyresemble embryonic or adult neurons. In the case of hESC-derivedcardiomyocytes, it has been shown that many are spontaneouslyactive and similar to embryonic heart cells rather than adult. It iscertainly possible that the neurons that we axotomize are moresimilar to embryonic than adult neurons. However, future use ofhESC-derived neurons in therapeutic applications will require a tho-rough understanding of their outgrowth and regeneration characte-ristics, regardless of their precise level of maturity.
Cycling precursor cells are a component of early stage neuro-spheres while passaged in suspension. After 1 month of differen-tiation in adherent and nonmitogenic conditions, the cultures used
l (fold change≥1.5 at either direction, pb0.02). The analysis was carried out using the.abcc.ncifcrf.gov/). The x-axis represents fold enrichment of upregulated (N0) or
126 L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
for neuritomy in this study contained few dividing cells. Most ofthe cells in the cultures were present in large colonies, whichcontained more than 95% βIII-tubulin+ neurons, and there werefew cells in the aggregates immunopositive for the mitotic marker,Ki67. In addition, the microarray data showed that the expressionof the vast majority of genes involved in cell cycle were unchangedafter neuritomy. Finally, the changes in gene expression weremaximal at 6 hours after lesion, and effects on dividing cells wouldprobably continue or increase past this time point if due tocessation/increase of division and/or new differentiation. Therefore,it is likely that changes in gene expression observed reflect theresult of regrowth of injured processes and not of initial growth ofnewly differentiated neurons.
Basic research on the mechanisms of nerve regeneration usingrodents and invertebrates has yielded numerous insights. Veryrecently, a new in vitro method was proposed for studying axonalregeneration of motoneurons using murine tissues (Vyas et al.,2010), but this and other models are limited by definition in theircapacity to predict human outcomes in injuries (Blesch andTuszynski, 2009). Previous attempts to model injury and regenera-tion in humans have been carried out by Rajan et al. (2003) usingdenervation of small patches of skin by surgical section or chemicallesion. This technique has been exploited to study collateralsprouting of human nerve fibers (Hahn et al., 2006), and to exploredifferences in regeneration of axons between normal volunteers andpatients with diabetic neuropathy (Polydefkis et al., 2004), or withHIV-induced peripheral neuropathy (Hahn et al., 2007). Theperipheral skin lesion approach has the advantage of an in vivosystem, but it obviously cannot be used to examine molecular res-ponses in the somata of injured neurons as carried out in the presentwork.
hESC are of value in drug discovery (Jensen et al., 2009) and in theelucidation of mechanisms of genetic disease (Friedrich Ben-Nun andBenvenisty, 2006). Our current study adds another significantapplication of these versatile cells, the study of human axonalregeneration. The model described above will help bridge the gapbetweenmechanistic studies in animal models and the preclinical andclinical trials required for development of new therapies to enhanceaxonal regeneration in humans. Since hESCs can be selectivelydifferentiated to a diversity of neuronal subtypes, this approach willallow mechanistic studies on injury responses of specific types ofhuman neurons, currently impossible by any other means.
Acknowledgments
Supported by research grants from the Adelson Medical ResearchFoundation, the Israel Science Foundation (158/07 RSG), the KimmelInstitute for Stem Cell Research, the Harris Foundation and theSalzberg Foundation. M.F. is the incumbent of the Chaya ProfessorialChair inMolecular Neuroscience at theWeizmann Institute of Science.We thank Chaya Morgenstern for technical and administrativesupport and Dr. Doug Melton (Harvard University) for the generousgift of hESC line HUES9.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.expneurol.2009.09.019.
References
Abe, N., Cavalli, V., 2008. Nerve injury signaling. Curr. Opin. Neurobiol. 18, 276–283.Blesch, A., Tuszynski, M.H., 2009. Spinal cord injury: plasticity, regeneration and the
challenge of translational drug development. Trends Neurosci. 32, 41–47.Brokhman, I., Gamarnik-Ziegler, L., Pomp, O., Aharonowiz, M., Reubinoff, B.E., Goldstein,
R.S., 2008. Peripheral sensory neurons differentiate from neural precursors derivedfrom human embryonic stem cells. Differentia 76, 145–155.
Chong, M.S., Reynolds, M.L., Irwin, N., Coggeshall, R.E., Emson, P.C., Benowitz, L.I., Woolf,C.J., 1994. GAP-43 expression in primary sensory neurons following centralaxotomy. J. Neurosci. 14, 4375–4384.
Costigan, M., Befort, K., Karchewski, L., Griffin, R.S., D'Urso, D., Allchorne, A., Sitarski, J.,Mannion, J.W., Pratt, R.E., Woolf, C.J., 2002. Replicate high-density rat genomeoligonucleotide microarrays reveal hundreds of regulated genes in the dorsal rootganglion after peripheral nerve injury. BMC Neurosci. 3, 16.
Cowan, C.A., Klimanskaya, I., McMahon, J., Atienza, J., Witmyer, J., Zucker, J.P., Wang, S.,Morton, C.C., McMahon, A.P., Powers, D., Melton, D.A., 2004. Derivation ofembryonic stem-cell lines from human blastocysts. N. Engl. J. Med. 350, 1353–1356.
Di, G.S., De, B.A., Yakovlev, A., Finn, T., Beers, J., Hoffman, E.P., Faden, A.I., 2005. In vivoand in vitro characterization of novel neuronal plasticity factors identifiedfollowing spinal cord injury. J. Biol. Chem. 280, 2084–2091.
Friedrich Ben-Nun, I., Benvenisty, N., 2006. Human embryonic stem cells as a cellularmodel for human disorders. Mol. Cell. Endocrinol. 252, 154–159.
Gervasi, N.M., Kwok, J.C., Fawcett, J.W., 2008. Role of extracellular factors in axonregeneration in the CNS: implications for therapy. Regen. Med. 3, 907–923.
Hahn, K., Sirdofsky, M., Brown, A., Ebenezer, G., Hauer, P., Miller, C., Polydefkis, M., 2006.Collateral sprouting of human epidermal nerve fibers following intracutaneousaxotomy. J. Peripher. Nerv. Syst. 11, 142–147.
Hahn, K., Triolo, A., Hauer, P., McArthur, J.C., Polydefkis, M., 2007. Impairedreinnervation in HIV infection following experimental denervation. Neurology68, 1251–1256.
Hanz, S., Fainzilber, M., 2006. Retrograde signaling in injured nerve—the axon reactionrevisited. J. Neurochem. 99, 13–19.
Hanz, S., Perlson, E., Willis, D., Zheng, J.Q., Massarwa, R., Huerta, J.J., Koltzenburg, M.,Kohler, M., Van-Minnen, J., Twiss, J.L., Fainzilber, M., 2003. Axoplasmic importinsenable retrograde injury signaling in lesioned nerve. Neuron 40, 1095–1104.
Hollis, E.R., Jamshidi, P., Low, K., Blesch, A., Tuszynski, M.H., 2009. Induction ofcorticospinal regeneration by lentiviral trkB-induced Erk activation. Proc. Natl.Acad. Sci. U. S. A. 106, 7215–7220.
Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., Speed, T.P., 2003. Summariesof Affymetrix GeneChip probe level data. Nucleic Acids Res. 31, e15.
Jensen, J., Hyllner, J., Bjorquist, P., 2009. Human embryonic stem cell technologies anddrug discovery. J. Cell. Physiol. 219, 513–519.
Johnson, W.E., Li, C., Rabinovic, A., 2007. Adjusting batch effects in microarrayexpression data using empirical Bayes methods. Biostatistics 8, 118–127.
Kim, W.Y., Snider, W.D., 2008. Neuroscience. Overcoming inhibitions. Science 322,869–872.
Kitajima, H., Yoshimura, S., Kokuzawa, J., Kato, M., Iwama, T., Motohashi, T., Kunisada, T.,Sakai, N., 2005. Culture method for the induction of neurospheres from mouseembryonic stem cells by coculture with PA6 stromal cells. J. Neurosci. Res. 80,467–474.
Lerman, O., Ben-Zvi, A., Yagila, Z., Behar, O., 2007. Semaphorin3A accelerates neuronalpolarity in vitro and in its absence the orientation of DRG neuronal polarity in vivois distorted. Mol. Cell. Neurosci. 36, 222–234.
Nilsson, A., Moller, K., Dahlin, L., Lundborg, G., Kanje, M., 2005. Early changes in geneexpression in the dorsal root ganglia after transection of the sciatic nerve; effects ofamphiregulin and PAI-1 on regeneration. Brain Res. Mol. Brain Res. 136, 65–74.
Polydefkis, M., Hauer, P., Sheth, S., Sirdofsky, M., Griffin, J.W., McArthur, J.C., 2004. Thetime course of epidermal nerve fibre regeneration: studies in normal controls andin people with diabetes, with and without neuropathy. Brain 127, 1606–1615.
Pomp, O., Brokhman, I., Ben-Dor, I., Reubinoff, B., Goldstein, R.S., 2005. Generation ofperipheral sensory and sympathetic neurons and neural crest cells from humanembryonic stem cells. Stem Cells 23, 923–930.
Pomp, O., Brokhman, I., Ziegler, L., Almog, M., Korngreen, A., Tavian, M., Goldstein, R.S.,2008. PA6-induced human embryonic stem cell-derived neurospheres: a newsource of human peripheral sensory neurons and neural crest cells. Brain Res. 1230,50–60.
Pouton, C.W., Haynes, J.M., 2007. Embryonic stem cells as a source of models for drugdiscovery. Nat. Rev., Drug Discov. 6, 605–616.
Rajan, B., Polydefkis, M., Hauer, P., Griffin, J.W., McArthur, J.C., 2003. Epidermalreinnervation after intracutaneous axotomy in man. J. Comp. Neurol. 457,24–36.
Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., Bongso, A., 2000. Embryonic stem celllines from human blastocysts: somatic differentiation in vitro. Nat. Biotech. 18,399–404.
Rishal, I., Fainzilber, M., 2010. Retrograde signaling in axonal regeneration. Exp. Neurol.223, 5–10.
Rossi, F., Gianola, S., Corvetti, L., 2007. Regulation of intrinsic neuronal properties foraxon growth and regeneration. Prog. Neurobiol. 81, 1–28.
Schreyer, D.J., Skene, J.H., 1991. Fate of GAP-43 in ascending spinal axons of DRGneurons after peripheral nerve injury: delayed accumulation and correlation withregenerative potential. J. Neurosci. 11, 3738–3751.
Singh, R.N., Nakano, T., Xuing, L., Kang, J., Nedergaard, M., Goldman, S.A., 2005.Enhancer-specified GFP-based FACS purification of human spinal motor neuronsfrom embryonic stem cells. Exp. Neurol. 196, 224–234.
Smyth, G.K., 2005. Limma: Linear models for microarray data. Bioinformatics andComputational Biology Solutions Using R and Bioconductor. Springer, New York,pp. 397–420.
Stam, F.J., MacGillavry, H.D., Armstrong, N.J., de Gunst, M.C., Zhang, Y., van Kesteren,R.E., Smit, A.B., Verhaagen, J., 2007. Identification of candidate transcriptionalmodulators involved in successful regeneration after nerve injury. Eur. J.Neurosci. 25, 3629–3637.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., et al., 1998.Embryonic stemcell lines derived fromhumanblastocysts. Science 282, 1145–1147.
127L. Ziegler et al. / Experimental Neurology 223 (2010) 119–127
Vyas, A., Li, Z., Aspalter, M., Feiner, J., Hoke, A., Zhou, C., O'Daly, A., Abdullah, M., Rohde, C.,Brushart, T.M., 2010. An in vitro model of adult mammalian nerve repair. Exp. Neurol.223, 112–118.
Xiao, H.S., Huang, Q.H., Zhang, F.X., Bao, L., Lu, Y.J., Guo, C., Yang, L., Huang, W.J., Fu, G.,Xu, S.H., Cheng, X.P., Yan, Q., Zhu, Z.D., Zhang, X., Chen, Z., Han, Z.G., Zhang, X., 2002.Identification of gene expression profile of dorsal root ganglion in the rat peripheralaxotomy model of neuropathic pain. Proc. Natl. Acad. Sci. U. S. A. 99, 8360–8365.
Yamashita, T., Fujitani, M., Yamagishi, S., Hata, K., Mimura, F., 2005. Multiple signalsregulate axon regeneration through the Nogo receptor complex. Mol. Neurobiol.32, 105–111.
Yudin, D., Hanz, S., Yoo, S., Iavnilovitch, E., Willis, D., Gradus, T., Vuppalanchi, D.,Segal-Ruder, Y., Ben-Yaakov, K., Hieda, M., Yoneda, Y., Twiss, J.L., Fainzilber, M.,2008. Localized regulation of axonal RanGTPase controls retrograde injurysignaling in peripheral nerve. Neuron 59, 241–252.
