Plant Cell Physiol. 40(11): 1160-1166 (1999)JSPP © 1999

AtUCP2: a Novel Isoform of the Mitochondrial Uncoupling Protein ofArabidopsis thaliana

Akio Watanabe, Mikio Nakazono, Nobuhiro Tsutsumi and Atsushi Hirai1

Laboratory of Plant Molecular Genetics, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1,Bunkyo-ku, Tokyo, 113-8657 Japan

Mitochondrial uncoupling proteins (UCPs) play acentral role in adaptive thermogenesis in mammals. TheUCPs dissipate the proton gradient formed through respi-ration without ATP synthesis, and the freed energy is rea-dily converted to heat, helping the animals to maintaintheir body temperature in cold environments. Recently, itwas found that UCPs also function in plant mitochondria.Subsequently, a cDNA clone encoding a UCP in potatowas isolated. Whereas the UCP gene constitutes a mul-tigene family in mammals, only a single cDNA sequencehas been reported so far for the potato UCP. Moreover, ithas been recently suggested that Arabidopsis has only asingle nuclear gene for UCP. Here we report the existenceof another UCP gene in the Arabidopsis genome, showingfor the first time the occurrence of a multigene family forthe protein in higher plants. A cDNA analysis of this geneshowed that the novel isoform possesses all typical featuresreported for known UCPs. However, the new gene, unlikethe other gene in Arabidopsis and the gene in potato, didnot appear to respond to low temperature.

Key words: Arabidopsis — Gene expression — Low tem-perature — Mitochondria — Uncoupling protein.

Certain types of plants generate heat during flowering(for review, see Seymour 1997). However, relatively little isknown at present about the molecular mechanism enablingthe heat generation in higher plants. In mammals, mito-chondrial uncoupling proteins (UCPs) play a central role inthe heat generation in response to low temperature (termedadaptive thermogenesis). These proteins, encoded in thenuclear genome, contain six transmembrane domains andare imported into the mitochondrial inner membrane with-out the help of any transit sequences (Liu et al. 1988). Inmitochondria, they dissipate the proton gradient formedthrough respiration without the synthesis of ATP. Theresulting freed energy is readily converted to heat, helping

Abbreviations: BAT, brown adipose tissue; EST, expressedsequence tag; ORF, open reading frame; UCP, uncoupling pro-tein.

The nucleotide sequence reported in this paper has beensubmitted to DDBJ under accession number AB021706.1 Corresponding author.

the animals to maintain their body temperature in coldenvironments. One of the major expression sites of theproteins, brown adipose tissue (BAT), is known as a centerof heat generation during cold adaptation in rodents(Nicholls and Locke 1984).

Recently, a biochemical approach toward the dissec-tion of plant mitochondria has revealed an uncouplingprotein functioning in potato mitochondria (Vercesi etal. 1995). Subsequently, a potato cDNA for this protein(named StUCP) was isolated (Laloi et al. 1997). StUCPwas shown to possess all the typical features reported formammalian UCPs, and also to function as an uncouplingprotein when overexpressed in yeast (Laloi et al. 1997). Ithas also been shown that cold treatment enhances expres-sion of the gene in the plant.

In mammals, the UCP gene constitutes a small mul-tigene family consisting of at least three members (Bosset al. 1997a, b). These UCP gene members have differentexpression sites and different responses to low tempera-ture. In rodents, the UCP1 gene is expressed mainly inBAT, and cold treatment enhances the accumulation of thetranscripts (for a review, see Ricquier et al. 1991). UCP2mRNA is found in most types of tissues of rodents, as wellas humans (Boss et al. 1997a, b), while human UCP3transcripts accumulate specifically in skeletal muscle (Bosset al. 1997a). Unlike the occurrence of the multigene familyfor mammalian UCPs, only a single species of UCP cDNAhas been isolated in potato so far. Moreover, the lateststudy, published in the midst of our study, has suggestedthat Arabidopsis has only a single gene to encode its UCP(Maia et al. 1998). In the present study, we found a novelUCP gene in the Arabidopsis genome, demonstrating forthe first time in higher plants the occurrence of multiplegenes for the protein. A Northern blotting analysis sug-gested that low temperature does not directly induce theexpression of the novel UCP gene of Arabidopsis.

Materials and Methods

Isolation of a genomic clone for an Arabidopsis UCP—Toamplify a genomic fragment encoding Arabidopsis UCP, we syn-thesized the TM3 and the TM6 degenerative primers, based on theamino acid sequences found in the third and the sixth transmem-brane domains of potato UCP (ITIANPTDL and GSWNVIMF,respectively). PCR conditions consisted of preheating at 94°C fornine min, 30 cycles of one min at 94°C, two min at 45°C, and two

1160

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

Novel isoform of Arabidopsis uncoupling protein 1161

min at 72°C, and final extension at 72°C for nine and a half min.The sequences of the primers were:TM3: T(T/C/A)AC(A/T)AT(A/T)GCAAATCC(CVT)AC(A/T)-

GATCTTM6: AAACAT(A/G)AT(T/G)AC(A/G)TTCCA(A/T)GAGCC

Amplification of cDNA fragments encoding a novel UCPisoform, AtUCP2—For the amplification of AtUCP2 cDNA frag-ments, total RNA was extracted from 14-day-old seedlings of Arabi-dopsis thaliana (Columbia gll) kept at 4°C in darkness for 48 h.In this experiment the seedlings were grown on MS medium con-taining MS salts (Murashige and Skoog 1962) and 2% sucrose at24°C under continuous light. They were subjected to the coldtreatment two weeks after germination. First strand cDNA wassynthesized from three ptg of total RNA extracted from the seed-lings, using an oligo dT primer and Superscript II RT (GIBCOBRL). With this cDNA as a template, we amplified three cDNAfragments, which together covered the whole open reading frame(ORF) of AtUCP2. All the primers used in the reaction (SP1 toSP3 and SP3C, see the underlined sequences in Fig. 2) were de-signed based on the sequence on chromosome 5 deposited in thedatabase (DDBJ accession no. AB016885). First, a fragment spe-cifying the central portion of the protein (the SP2-SP3 region) wasamplified by PCR using the SP2 and the SP3 primers. Next, afragment covering the C-terminal portion (the region downstreamof SP3) was obtained similarly through two rounds of PCR (usingthe SP2 primer and an oligo dT primer first, and then the SP3Cand the oligo dT primers). Finally, the N-terminal portion (SP1-SP3) was amplified as follows. Since we found in the genome se-quence a perfect consensus sequence around the translation initi-ation sites (AACAATGGC, Liitcke et al. 1987), we consideredthis ATG as a putative start site of the ORF. Using the SP1 primercovering this site and the SP3 primer, the cDNA fragment ofthe N-terminal portion was amplified. In all PCR experiments,AmpliTaq GOLD (Perkin Elmer CETUS) was used. The PCRconditions consisted of preheating for nine min at 94°C, 35 cyclesof 30 s at 94°C, 30 s at 54°C and one min at 72°C, and final ex-tension at 72°C for nine min. The primers used in this experimentwere:SP1: GGGATCCTATAGCATAACAATGGCGGAT

(underline shows a BamHl site introduced in the sequence)SP2: GAAAGATTCCCACTGGAGATGGTGAGASP3: GACTGTGTTTCGGTAAGTAGAGSP3C: complimentary to SP3

Determination of nucleotide sequence—The nucleotide se-quence was determined using an automatic DNA sequencer model373S (Perkin Elmer ABD). In the analysis of the PCR products,we sequenced several independent clones in order to eliminate thevariance introduced by the DNA polymerase.

Amino acid sequence alignment of AtUCP2 with other knownUCPs—AtUCP2 was aligned with other known UCPs using theCLUSTAL W algorithm (Thompson et al. 1994). For shadingresidues in the aligned sequences, we used the BOXSHADE pro-gram (ISRC Bioinformatics Group).

Genomic Southern blotting analysis—In the Southern blot-ting analysis, three /jg of Arabidopsis DNA were digested witheither EcoRl or Xbal. The restricted DNA was separated onan agarose gel, and blotted onto a nylon membrane. Either theAtUCPl or the AtUCP2 cDNA fragment encompassing the C-terminal and the 3' untranslated regions was labeled with a DIGDNA Labeling and Detection Kit (Roche Diagnostics GmbH,Swiss). These labeled fragments were used as gene-specific probesfor hybridization. Hybridization was carried out as describedpreviously (Ito et al. 1997). To detect the fragments related to

UCP genes, another probe was prepared by amplifying and la-beling an AtUCP2 cDNA spanning the region between the SP1sequence and the C terminus of the ORF.

Northern blotting analysis—The response of the UCP genesto low temperature was tested using two groups of Arabidopsisseedlings. First, a group of the plants (Columbia, wild type) wasgrown for four weeks on vermiculite beds at 24°C under contin-uous light, and then transferred into a cold room set at 4°C. After24, 48 and 72 h of incubation, total RNA was extracted from theplants. During the cold treatment, the plants were kept underweak light to avoid dark-induced yellowing of the leaves. We alsogrew another group of plants (Columbia gll). These seedlingswere planted on MS medium containing MS salts (Murashige andSkoog 1962) and 2% sucrose at 24°C under continuous light. Twoweeks after germination, the seedlings were cold-treated at 4°C indarkness. Total RNA was prepared from seedlings that had beencold-treated for 0, 24 and 48 h. Hybridization was carried out asdescribed previously (Ito et al. 1997), using the gene-specific probefor either AtUCPl or AtUCP2.

Results and Discussion

Isolation of a genomic clone for an ArabidopsisUCP, AtUCPl, and its gene structure—When we startedthis study, no nucleotide sequence had been reported forArabidopsis UCPs. Although a few expressed sequence tag(EST) clones showed homology to known UCP genes, itwas unclear where and when such a possible UCP gene wasexpressed in the plants. So, we started our study by iso-lating the genomic clone for the gene, aiming to first clarifythe whole ORF sequence. To obtain a probe for screening,we carried out PCR as described above, with ArabidopsisDNA as a template. Also, taking into account the pos-sibility of multiple genes, we used degenerative primersthat covered the regions conserved among various UCPs.In this experiment, we could obtain only a single DNAfragment, even though degenerative primers were used inthe reaction. However, sequence analysis of the amplifiedfragment strongly suggested that it was a part of a gene foran Arabidopsis UCP (data not shown). With this fragmentas a probe, we screened a library, and isolated several ge-nomic clones for the gene. At this time, Maia et al. (1998)reported a complete mRNA sequence for an ArabidopsisUCP, and they referred to the protein as AtPUMP for aplant uncoupling mitochondrial protein (EMBL accessionno. AJ223983). We then knew that the gene we isolatedencoded their AtPUMP. In this report, though, we desig-nate this protein as AtUCPl for convenience, since wedescribe in the following sections a novel isoform ofArabidopsis UCP, AtUCP2. Comparison of the deter-mined genomic sequence with the AtUCPl mRNA se-quence revealed the whole gene structure of the AtUCPlgene, as shown in Fig. 1. In most mammalian UCP genes,the sequence coding the protein is found to be separatedinto six regions, each of which contains a transmembranedomain (Kozak et al. 1988, Cassard et al. 1990). The figurealso depicts the gene structure of mouse UCP1 (Kozak et

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

1162 Novel isoform of Arabidopsis uncoupling protein

Mouse UCP1IV V VI

IV V VI 100 bp

AtUCPl

AWCP2

Fig. 1 Comparison of the gene structures of AtUCPl andAtUCP2 of Arabidopsis. For comparison, the structure of MouseUCP1 gene is shown in parentheses. Open boxes with Arabicnumerals show the regions encoding the UCP ORFs. The boldlines above the boxes show respective transmembrane domains (Ito VI).

al. 1988) for comparison. Unlike the mammalian gene, thesequence encoding AtUCPl was found separated into asmuch as nine short regions. Thus, we could not find acorrespondence between the respective coding regions andthe transmembrane domains in the plant gene. On theother hand, we noted that excision of all the introns fol-lowed the GU/AG rule (Brown et al. 1996) in this gene(data not shown).

A novel gene for a UCP isoform of Arabidopsis—According to Maia et al. (1998), Arabidopsis has only asingle gene to encode its UCP. In agreement with this no-tion, we could amplify only a single DNA fragment fromArabidopsis DNA in the previous experiment. However, asa result of a database search, based on the AtUCPl ge-nomic and mRNA sequences, we found another possibleUCP gene in a partial sequence deposited for chromosome5 of Arabidopsis (77.8 kb, DDBJ, accession no. AB016885).The nucleotide sequence of the possible UCP gene wasapparently different from the sequence we determined forthe AtUCPl gene (the AtUCPl gene was not located in the77.8 kb region of chromosome 5), but the predicted geneproduct showed high homology with AtUCPl and otherknown UCPs on an amino acid sequence basis. Consider-ing that the nucleotide sequence for the sixth transmem-brane domain of the product differs slightly from that ofAtUCPl (the domain structure of AtUCP2 is also shownby bold lines (I to VI) in Fig. 1), we assume that thisdifference prevented the TM6 primer used in the previousPCR experiment from annealing to the gene on the chro-mosome.

Isolation of cDNA fragments coding AtUCP2, anisoform of Arabidopsis UCP—To determine whether thesequence on chromosome 5 is actually transcribed in theplants, we tried to amplify the cDNA fragments originatingfrom its transcripts. As a template for the amplification, wesynthesized 1st strand cDNA from the total RNA extract-

TCCTATAGCAIA>CAATGGCCG*TTTCMACCMGGATCCAGATITCtiTTCCTIGAAACCTTCAITTCCAGCGCrTIC 78

" " ' H A D F K P R I E I S F L E T F I C S A F

GCTGCTTGTTTTGCIGAGTTATGTACTATACCGTTGGACACAGCCAAAGTTAGACTTCAGCTTCAAAGAAAIiATTCCC 156

A A C F A E L C T I P L O T A K V R L O I Q R K I P 1 0 * '

ACTGGAGATGGTGAGAATTTGCCCAAGTATAGAGGArCAATTGOIACTCTAGCTACCATAGCIAGAGAAGAAGGTATT 234

T G 0 G E N L P K Y R G S I G T L A T I A R E £ G I

rCAGGTCTTTGGAAAGGTGrTATTGCAGGACTTCAICGCCAATGTATCTATGGTGCCTTAAGGATTGGGTTATATGAG 312

S G L 1 K G V I A G L H R 0 C I Y G G I R I G L Y E

CCTGTGAAGACACTTITGOnGGAAGTGACTIIAITGGCGATATTCCTTTAIATCAAAAGAIICTTGCAGCTTTGTTA 3 9 0

P V K T L L V G S D F I G O I P L Y O K I L A A L L

ACTGGAGCTATAGCTATTATTGTAGCTAAICCAACTGATCTTGTTAAAGTTCGGCTTCAATCAGAAGGAAAGTTACCG 468

T G A I A I I V A H P I D L V K V R L O S E G K L P

GCTGGGGTICCTAGGCGTTATGCAGGAGCTGTAGACGCTIAITTCACCATTGIGAAGCIGGAAGGAGTTAGTGCGCIA 546

A G V P R R r A G A V D A T F T I V K L E G V S A L

TGGACTGGACITGGTCCCAATATTGCCCGGAATGCTATTGTAAATGCTGCAGAGTTAGCIAGTTATGATCAAATAAAG 624

• T G L G P N I A R N A I V N A A E L A S Y O O I K

GAGACAATTATGAAAATTCCGTTCTTCAGAGACAGTGTTTTAACTCATCIACTAGCTGGTTTAGCTGCAGGCTTCTTC 702

E T I U K I P F F R D S V L T H L L A G I A A G F F

GCTGrCTGCATCGGITCTCCAATTGATGTGGTGAAAICTAGAATGATGGGAGACTCrACTTACCGAAACACAGTCGAT 780

A V C I G S P I O V V K S R H H O D S T Y R H T V O " " 1

rGCTTCATCAAAACGAIGAAGACCGAGGGGATIATGGCAITCTACAAAGGATTTCTCCCGAATITTACACGGCTAGGA 858

C F I K T U K T E G I I I A F T K G F . L P N F T R L G

ACCTGGAATGCCATTATGTTCCTCACATTAGAACAAGTGAAAAAAGTGTTTCTAAGAGAAGTCTTGTACGATTGATTC 936

T » N A I » F L T I E O V K K V F L R E V L Y O «

TCAGATCCCIAGTCGAAAACCATACCTTATTACAIAATCCCTTCTATAAAACTTTGAATTGTTAGAATTAAAACATAT 1014

ATACTTTCTATGTJt]»TGTGAGCTTTGTTATTTAGATTAGTATAGAAACATTTTATCCAAAAAAAAAITCTTTG§AAGA 1092

ACAGTTTATACGAACGGTCTCTTTATTT§ poly (A)

Fig. 2 Nucleotide sequence of the ORF encoding a novel UCPisoform of Arabidopsis, AtUCP2. The regions to which the spe-cific primers (SP1 to SP3) anneal are underlined. The amino acidsdeduced from the cDNA sequence are given as single letters. Theasterisk shows a stop codon. Nucleotides shown in boxes aremultiple polyadenylation sites.

ed from the plants kept at 4°C for 48 h. As described inMaterials and Methods, we obtained several partial cDNAfragments which, together, covered the whole ORF. Fig. 2shows the ORF and its amino acid sequence. The proteinencoded by the ORF consists of 305 amino acids (which isalmost the same number as in other plant UCPs), and ex-hibited 85% homology with both AtUCPl and the potatoUCP, and around 60% homology with other mammalianUCPs. We therefore concluded that the sequence found onchromosome 5 is actually functioning as a gene for a novelUCP isoform. We designated here the protein encoded bythe gene as AtUCP2. An alignment of AtUCP2 with otherUCPs in Fig. 3 showed that AtUCP2 possesses typical fea-tures of UCPs, i.e. six transmembrane domains, the typicalmitochondrial carrier signatures, and a possible nucleotidebinding region (Bouillaud et al. 1994). Also, the N-terminalportion of the protein shares high homology with the cor-responding parts of AtUCPl and StUCP. This makes itmore likely that the translation initiation site that we ten-tatively identified is correct.

Genomic organization of the AtUCP2 gene—Subse-quently, we clarified the genomic organization of the genefor AtUCP2 by aligning its cDNA sequence with the ge-

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

Novel isoform of Arabidopsis uncoupling protein 1163

TH 2

AtUCP2 1 —tMFKPRIEISFLETfl lCS,AtUCPIStUCP

HsUCPlMmUCPIHsUCP2MmUCP2HsUCP3IMJCP3

NBS

Fig. 3 Comparison of AtUCP2 with other known UCPs. Identical amino acids are shown in black, and similar ones in outlined letters.The regions with single broken lines correspond to transmembrane domains (from TMl to TM6). The residues with a double underlineare a predicted nucleotide binding site (NBS). The vertical lines connect the typical mitochondrial carrier signature found in eachrepeating unit (PxD/ExxKxR-(20-30 residues)-D/EG-(four amino acids)-(an aromatic amino acid)-KG). Additional gaps were in-troduced, besides the ones that the program did, into the alignment in order to place respective repeating units in parallel. All the aminoacid sequences of known UCPs were obtained from the databases. Respective accession numbers are as follows: StUCP (potato UCP,EMBL Y11220); HsUCPl (human UCP1, GenBank U28480); HsUCP2 (human UCP2, GenBank U82819); HsUCP3 (human UCP3,GenBank NM0O3356); MmUCPI (mouse UCP1, GenBank U63419); MmUCP2 (mouse UCP2, GenBank U69135); MmUCP3 (mouseUCP3, GenBank AF032902).

nomic sequence of chromosome 5. In Fig. 1, the genomicorganization of the AtUCP2 gene is aligned with that ofthe AtUCPI gene. The sequence encoding AtUCP2 wasfound to be separated into nine regions, as was foundpreviously in the AtUCPI gene. So, unlike mammalianUCP genes, we could not find a correspondence between

the respective coding regions and the transmembrane do-mains in this gene, as well as in the AtUCPI gene. In-terestingly, the ORFs for both AtUCPs were interruptedby introns at exactly the same sites with respect to theirdomain structures. We speculate that such fragmentarystructures are specific to plant UCP genes. A variety of

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

1164 Novel isoform of Arabidopsis uncoupling protein

polyadenylation sites was also found in both genes. Theboxed letters in Fig. 2 indicate the multiple polyadenylationsites found in AtUCP2 cDNAs. In humans, short and longUCP3 proteins are generated from a common UCP3 genedepending on the transcription termination sites (Solanes etal. 1997). However, the variety of polyadenylation sites didnot seem to affect the C-terminal sequence of either of theArabidopsis UCPs.

Phylogenetic relationship of plant UCPs with otherknown UCPs—The phylogenetic tree in Fig. 4 providesanother insight into the plant UCPs. According to theprogram used in this study, all of the three known plantUCPs were classified into a single isolated group, which didnot belong to any of the three subclasses of mammalianUCPs. It was also shown that among the plant UCPs, thepotato UCP, StUCP, is more closely related to AtUCPlthan to AtUCP2. This result may raise the possibility of theexistence of another potato UCP isoform which is equiva-lent to AtUCP2. It is of interest to know whether the UCPgene constitutes a multigene family in potato.

Low temperature does not induce the expression of theAtUCP2 gene—Cold-enhanced accumulation of the tran-scripts for the potato UCP gene has been demonstrated(Laloi et al. 1997). Moreover, in Arabidopsis, 48 h of in-cubation at 4°C increased the transcript level of AtUCPlto a peak amount (Maia et al. 1998). To determine theresponse of the novel UCP gene of Arabidopsis to lowtemperature, we subsequently carried out a Northern blot-

MmUCP3

ABJCP2

Fig. 4 Phylogenetic relationships among plant and mammalianUCPs. A phylogenetic tree was drawn using TREEVIEW (Page1996). The analyzed UCPs include BtUCPl (bovine UCP1,EMBL X14064), SsUCP2 (pig UCP2, GenBank AF036757) andBtUCP3 (bovine UCP3, GenBank AF092048), besides those ap-pearing in Fig. 3. The number at each node shows the reliabilityvalue of the branch, which was calculated from 1000 quartetpuzzling steps. The scale bar represents 0.1 mutations/site.

ting analysis. As an /ifL/C/^-specific probe, we labeledan AtUCP2 cDNA fragment which covered a C-terminalportion of the ORF and the 3' untranslated region (shownby a striped box in Fig. 5a). The specificity of the probe wasconfirmed by a Southern blotting analysis shown in Fig. 5b.As the blot shown by "AtUCP2" in the panel (b) demon-strates, the probe hybridized specifically to the fragmentscorresponding to the AtUCP2 gene (labeled "2"), but notto the fragments derived from the AtUCPl gene (labeled" 1 " in the blot on the left). In the panel (c), a blot waspresented, for comparison, that was hybridized withanother cDNA probe covering the whole AtUCP2 ORF(shown by an open box in Fig. 5a). As the panel (c) shows,this cDNA probe detected intense signals corresponding tothe AtUCP2 gene fragments (labeled "2", note that this

(a) A1UCP2 cDNA probes

XI '

nnn i.o kbAlVCPl cDNA probe

(b) (c)AtUCPl BUD AtUCP2 M AtVCP2 •

EX k b

— 23.1 —

— 9.4 —

— 6.6 -

^m — 4.4 —

— 2.3 —

— 2.0 —

X kb E X

23.1-

Fig. 5 (a) Restriction maps of the AtUCP genes, and the cDNAprobes used in the analysis. Black boxes show the regions cod-ing AtUCP2 (top) or AtUCPl (bottom). Striped boxes show theAtUCP2-specific and the /U£/CP/-specific probes, respectively.The AtUCP2 probe covering the who\e AtUCP2 ORF is shown byan open box. E, EcoRl, X, Xbal. (b) Genomic Southern blottinganalysis. Genomic DNA of Arabidopsis, digested with £coRI orXbal, was separated on an Agarose gel and transferred onto anylon membrane. The /Ut/C/2-specific probe hybridized to anEcoRl fragment (about 8 kb) and a Xbal fragment (about 7 kb)(labeled "2" in the blot in the center), whereas the AtUCPl-spe-cific probe detected an EcoRl fragment (about 5 kb) and two Xbalfragments (about 3.5 kb and 1.8 kb) (labeled " 1" in the blot on theleft), (c) The AtUCP2 cDNA probe covering the whole AtUCP2ORF produced several extra signals (shown by open triangles),other than the signals corresponding to the AtUCP2 gene or theAtUCPl gene (labeled " 1 " or "2").

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

Novel isoform of Arabidopsis uncoupling protein 1165

probe also covers a 6 kb Xba\ fragment), as well as otherweak signals. While the signals labeled " 1 " seemed to cor-respond to the AtUCPl gene judging from their sizes, therest of them with open triangles may suggest the existenceof other members of the UCP gene family of the plants.However, the possibility can not be excluded that thesesignals are derived from genes for other UCP-relatedproteins. Because of the similarity to other mitochondrialtranslocators, UCPs have been classified as members of themitochondrial carrier family (Klingenberg 1990).

Using the AtUCP2-specific probe, we tested the re-sponse of the gene to low temperature. In this experiment,Arabidopsis seedlings were cold-treated in weak light. Asthe blot in Fig. 6a shows, the transcript level remained atlow levels during the treatment, suggesting that the coldtreatment does not induce the gene directly. We also exa-mined the amount of AtUCPl transcripts in the cold-treated seedlings for comparison, since Maia et al. (1998)reported that 48 h of incubation at 4°C increased thetranscript level of AtUCPl to a peak amount. The tran-script level, however, even decreased after 48 h of coldtreatment in our experiment, although it recovered slightlyafter 72 h of the treatment. The recovered level, however,was lower than that noted in the control plants (kept at24°C for 72 h). Since the detailed conditions for the plantgrowth and the cold treatment used by Maia et al. (1998)were not described, the cause of this discrepancy is unclear

(a) Weak light v

4°C R.T.

Dark

4°C

u 24

*..—48

• • • —

72 72h

•0

-

24 48h

AtUCP2

AtUCPl

25S rRNA

Fig. 6 Response of the AtUCP2 gene to low temperature, (a)Arabidopsis seedlings (grown on vermiculite for four weeks) wereincubated at 4°C for 0, 24, 48 and 72 h in weak light. Total RNAwas extracted from the seedlings and also from the control plantskept at room temperature (24°C) for 72 h in light. Twenty p% ofthe RNA were loaded on each lane. Hybridization was carriedout, using the AtUCP2-specific probe or, for comparison, the/4ft/CiJ/-specific probe. In the cold-treated plants, no significantincrease was observed in the level of the AtUCP2 transcripts, andalso in the transcript level of AtUCPl, which had been shown tobe cold inducible by Maia et al. (1998). (b) A different group ofseedlings (14-day-old seedlings grown on MS medium) was sub-jected to cold treatment in darkness for 0, 24 and 48 h. Fifteen jugof the RNA were loaded on each lane. Whereas the amount of theAtUCP2 transcripts remained at low levels during the treatment,the level of the A tUCPl transcripts increased significantly after 48h of the treatment, in good agreement with the report by Maia etal. (1998).

at present. We assume, though, that differences in the ageof seedlings, plant growth conditions, the procedure forcold treatment etc., could be responsible for the differentresponses of the AtUCPl gene to low temperature. Evi-dence supporting our hypothesis came from the followingexperiment. In the subsequent experiment, we grew Arabi-dopsis seedlings on MS medium for two weeks, and incu-bated them at 4°C in darkness rather than in weak light asin the previous experiment. In these seedlings, the amountof the AtUCPl transcripts increased after 48 h of the coldtreatment (Fig. 6b), in good agreement with the report byMaia et al. (1998). From these observations, it is suggestedthat factors other than temperature can affect the transcriptlevel of the AtUCPl gene in the cold-treated plants. Unlikethe AtUCPl gene, no significant increase in the amount ofthe AtUCP2 transcripts was observed also in darkness(Fig. 6b). Thus, this novel UCP gene did not seem to becold-inducible.

In summary, we demonstrated in this study the exis-tence of a novel UCP gene of Arabidopsis, showing for thefirst time the occurrence of a multigene family for plantUCPs. Unlike the AtUCPl gene, no significant enhance-ment by low temperature was observed for the expressionof the AtUCP2 gene in our experiments. This observationmay suggest that these two UCP genes are differentiallyregulated under cold environments. We hope that ourstudy will facilitate further studies on UCPs of higherplants.

This work was supported partly by grants-in aid from theMinistry of Education, Science and Culture of Japan and bygrants from the Program for Basic Research Activities for In-novative Biosciences (PROBRAIN). The authors thank D. Saishoof our laboratory for preparing the RNA samples.

References

Boss, O., Samec, S., Dulloo, A., Seydoux, J., Muzzini P. and Giacobino,J.-P. (1997b) Tissue-dependent upregulation of rat uncoupling protein-2 expression in response to fasting or cold. FEBS Lett. 412: 111-114.

Boss, O., Samec, S., Paoloni-Giacobino, A., Rossier, C , Dulloo, A.,Seydoux, J., Muzzin, P. and Giacobino, J-P. (1997a) Uncoupling pro-tein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Lett. 408: 39-42.

Bouillaud, F., Arechaga, I., Petit, P.X., Raimbault, S., Levi-Meyrueis,C , Casteilla, L., Laurent, M., Rial, E. and Ricquier, D. (1994) A se-quence related to a DNA recognition element is essential for the inhibi-tion by nucleotides of proton transport through the mitochondrial un-coupling protein. EMBO J. 13: 1990-1997.

Brown, J.W.S., Smith, P. and Simpson, C.G. (1996) Arabidopsis con-sensus intron sequences. Plant Mol. Biol. 32: 531-535.

Cassard, A.-M., Bouillaud, F., Mattei, M.-G., Hentz, E., Raimbault, S.,Thomas, M. and Ricquier, D. (1990) Human uncoupling protein gene:structure, comparison with rat gene, and assignment to the long arm ofchromosome 4. J. Cell. Biochem. 43: 255-264.

Ito, Y., Saisho, D., Nakazono, M., Tsutsumi, N. and Hirai, A. (1997)Transcript levels of tandem-arranged alternative oxidase genes in rice areincreased by low temperature. Gene 203: 121-129.

Klingenberg, M. (1990) Mechanism and evolution of the uncoupling pro-tein of brown adipose tissue. Trends Biol. Sci. 15: 108-112.

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from

1166 Novel isoform of Arabidopsis uncoupling protein

Kozak, L.P., Britton, J.H., Kozak, U.C. and Wells, J.M. (1988) Themitochondrial uncoupling protein gene. Correlation of exon structure totransmembrane domains. / . Biol. Chem. 263: 12274-12277.

Laloi, M., Klein, M., Riesmeier, J.W., Miiller-Rober, B., Fleury, C ,Bouillaud, F. and Ricquier, D. (1997) A plant cold-induced uncouplingprotein. Nature 389: 135-136.

Liu, X., Bell, A.W., Freeman, K.B. and Shore, G.C. (1988) Topogenesisof mitochondrial inner membrane uncoupling protein. Rerouting trans-membrane segments to the soluble matrix compartment. J. Cell. Biol.107: 503-509.

Lutcke, H.A., Chow, K.C., Mickel, F.S., Moss, K.A., Kern, H.F. andScheele, G.A. (1987) Selection of AUG initiation codons differs in plantsand animals. EMBO J. 6: 43-48.

Maia, I.G., Benedetti, C.E., Leite, A., Turcinelli, S.R., Vercesi, A.E. andArruda, P. (1998) AtPUMP: an Arabidopsis gene encoding a plant un-coupling mitochondrial protein. FEBS Lett. 429: 403-406.

Murashige, T. and Skoog, K. (1962) A revised medium for plant growthand bioassays with tobacco culture. Physiol. Plant. 15: 473-497.

Nicholls, D.G. and Locke, R.M. (1984) Thermogenic mechanisms inbrown fat. Physiol. Rev. 64: 1-64.

Page, R.D.M. (1996) TREE-VIEW: an application to display phylogenetictrees on personal computers. Comput. Appl. Biosci. 12: 357-358.

Ricquier, D., Casteilla, L. and Bouillaud, F. (1991) Molecular studies ofthe uncoupling protein. FASEB J. 5: 2237-2242.

Seymour, R.S. (1997) Plants that worm themselves. Sci. Amer. 276: 104-109.

Solanes, G., Vidal-Puig, A., Grujic, D., Flier, J.S. and Lowell, B.B.(1997) The human uncoupling prtoein-3 gene. Genomic structure, chro-mosomal localization, and genetic basis for short and long form tran-scripts. J. Biol. Chem. 272: 25433-25436.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W:improving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties and weightmatrix choice. Nucl. Acid Res. 22: 4673-4680.

Vercesi, A.E., Martins, I.S., Silva, M.A.P., Leite, H.M.F., Cuccovia,I.M. and Chaimovich, H. (1995) PUMPing plants. Nature 375: 24.

(Received April 28, 1999; Accepted September 6, 1999)

by guest on October 14, 2011

pcp.oxfordjournals.orgD

ownloaded from