Molecular Microbiology (1990) 4(7), 1091-1099

Characterization of a Listeria monocytogenes-speciiicprotein capable of inducing delayed hypersensitivity inListeria-'immune mice

S. Gohmann.^^ M. Leimeister-Wachter,^ E. Schiltz,^W. GoebeP and T. Chakraborty^*' lr)stitut fur Genelik und Mikrobiologie der UniversitatWurzburg, Rontgenring 11. 8700 WOrzburg, FRG.^Institut fur Organische Chemie und Biochemie derAibert'Ludwig Universitat Freiburg, Albertstrasse 21,7800 Freiburg I B.R.. FRG.

Summary

Recovery of the host after infection by the intracellularpathogen Listeria monocytogenes is dependent oncell-mediated immunity. Little is known of the natureof listerial antigens that induce cell-mediatedresponses in the infected host. In this study we reporton the identification and cloning of an Escherichia colirecombinant encoding a listerial antigen, designatedfmaA, capable of elvctting a specific delayed-typehypersensitivity response in Z.rsfer/a-immune mice.Nucieotide sequencing of the Listeria DNA insert inplasmid pLM10 showed that the ImaA gene productconsisted of 170 amino acids with a molecular weightof 17994. The predicted amino acid sequence sug-gests that the protein is localized to the bacterialplasma membrane or cell wall. The imaA gene wasunique to the pathogenic species L. monocytogenesand Listeria ivanovii; it was not present in any otherspecies of the genus Listeria.

Introduction

Listeria monocytogenes is a Gram-positive bacteriumresponsible for perinatal infections, septicaemia, andmeningoencephalitis in humans and many animal species(Cherubinefa/., 1981; Gellin and Broome, 1989; Hansenefal., 1987). Since its description by Murray et al. (1926). ithas become one of the best-characterized micro-organisms in terms of pathogenicity and cell-mediatedimmunity. The pioneering work of Mackaness (1962) and

Received 4 July, 1989; revised 9 March, 1990. fPresent address: Gesells-chafl fijr Biotech no I ogische Forschung mbH, Bereich MikfObiologie,Mascheroder Weg 1,3300 Braunschweig, FRG. 'For corresponcJencB. Tel.(931) 31578; Fax (931) 571954.

subsequent studies established the cellular nature of theimmune response to infection by virulent L. mono-cytogenes (Kongshavn. 1986 and reierences therein).Enhanced phagocytosis and bactericidal activity ofmacrophages induced by antigen-specific T-lymphocyteshave been shown to be important in the abrogation ofinfection caused by virulent Listeria. A strong secondaryresistance to infection by Listeria is also T-cell mediated,suggesting that the immunological memory is specific.The isolation of Listeria antigens involved in the inductionof cell-mediated immunity is therefore a relevant area ofstudy.

A large number of studies have analysed the biologicalactivity and tfie function of subcellular componentsderived from L. monocytogenes in eliciting host responses(reviewed by Ghakraborty and Goebel, 1988). A lowmolecular-weight anionic component, designated MPA, isassociated with the cytoptasmic membrane and has beenshown to induce monocytopoeisis (Shum and Gals-worthy, 1982). Crude fractions of both cell wall proteinsand soluble proteins have been shown to be capable ofeliciting mitogenic activity for B-cells as well as inducingT-cell proliferation in /./ster/a-immune mice (Cohen etal.,1975). In a comprehensive study using cellular proteinsfractionated according to molecular weight on preparativesodium dodecyl sulphate/polyacrylamide gel, Wentworthand Ziegler have identified protein fractions capable ofinducing both antigenic and/or mitogenic responses in/./ster/a-immune and non-immune mice (Wentworth andZiegler. 1987). More recently, Berche etal. (1987) haveshown tfiat T-cell recognition of listeriolysin is inducedduring infection of mice with virulent L. monocytogenes.

In this communication we report the characterization ofa recombinant identified by screening of a pUC18/L.monocytogenes DNA expression library with antiseraraised against soluble antigen of the same strain. Deletionmapping and nucieotide sequencing of the Listeria DNAinsert showed that a 21 kD polypeptide encoded by thisrecombinant was capable of eliciting a delayed-typehypersensitivity response in /./sfer/a-immune mice. Wehave tentatively designated the gene encoding this poly-peptide as imaA (listeria rnonocytogenes antigen A) gene.The gene encoding ImaA was unique to pathogenicListeria; it was not present in any other species of thisgenus.

1092 S. Gdhmann et a\.

Results

A total of 10000 independent Escherichia coli reoombi-nants harbouring Listeria DNA inserts was screened inordered arrays (see the Experimental procedures) using ahyperimmune rabbit antiserum produced against solubleantigen of the same strain. The positive clones wererecovered from the respective microtitre plate, streakedfor single colonies and retested by patching individualcolonies onto nitrocellulose filters screened by the colonyenzynne-!inked immunosorbent assay (ELISA) method(Young and Davis, 1983). Of 62 colonies detected by thismethod, 49 were positive upon retesting.

Analysis of the total protein profiles of cell extracts fromall recombinants by SDS-polyacrylamide gel elec-trophoresis (PAGE) and immunoblotting with anti-solubleantigen antiserum, allowed the detection of unique poly-peptide species in all but one of these recombinants (datanot shown). This was particularly surprising since thisrecombinant, designated pLMIO, repeatedly gave thestrongest reaction upon incubation with anti-soluble anti-gen antiserum in the colony ELISA assay. Because of thisunusual property, we have further characterized thisrecombinant.

Characterization of strains harbouring piasmid pLf^iO

Since it proved impossible to identify the Listeria proteinthat was recognized by the hyperimmune antisera toListeria soluble antigen using immunoblots, an analysis ofthe polypeptides encoded by plasmid pLMIO was per-formed. To do this, plasmid pLMIO was transformed intothe maxicell strain CSH26AF6 and polypeptides syn-thesized detected by radioactive labelling with [^^S]-methionine. Plasmid pLMIO was found to encode twounique polypeptides of molecular masses 14 and 21 kD,respectively (Fig. 1 A). Coomassie staining of gels revealedthat both polypeptides were strongly overproduced inthese strains (Fig. 1B). This overproduction was also seenin other E ccli hosts and allowed convenient monitoring ofthe presence of both polypeptides in subsequent studies.When the insert was cloned into pUCI 9 keeping the sameorientation, no expression of either polypeptide was seen.The expression of the genes encoded by the Listeria DNAinsert in pLMIO is therefore dependent on the presence ofthe lac promoter.

To determine which of these polypeptides was reactingwith the anti-soluble antisera, pLMIO was digested withthe restriction endonuclease Sau3A and ligated toSamHI-restricted T7-promoter-based vector pAR3040.Appropriate fusion of the insert to the reading frame of thisvector would allow selective expression of the geneproduct by T7 polymerase present on the chromosome ofstrain BL21(\DE3). After transformation, positively

reacting clones were detected on the basis of theircross-reactivity to anti-soluble antigen antisera in thecolony blot ELISA. Several strongly reacting recombinantswere obtained with the vector pAR3040. Coomassiestaining of the protein gels following electrophoresis ofthese recombinants showed that they all produced the21 kD polypeptide in large quantities. Restriction endo-nuclease mapping and subsequent sequencing showedthat the Listeria DNA insert had been reduced by 114 basepairs in these recombinants. The expression seen with arepresentative recombinant, designated pLM10-1, isshown in Fig. IB. As with pLM10, the expression of the21 kD polypeptide was entirely dependent on transcriptionof the T7 promoter by T7 polymerase (data not shown).

Nucleotide sequence anaiysis of the Listeria DAW insertin plasmid pLf^ 10

Plasmid DNA analysis revealed that the recombinantpLM10 harboured a 1.1 kb L. monocytogenes DNA insert(Fig. 2). Construction of a restriction endonuclease mapfor this insert proved tedious because of the absence ofcutting sites for many conventionally used restrictionendonucleases. The insert was therefore cloned intoplasmids pTZi8 and 19, and a nested set of deletionderivatives was generated using the exonuclease Ill/Siprotocol of Henikoff (1984). These were then subjected toDNA sequence analysis.

Examination of the DNA sequence revealed two longopen reading frames (ORFs) encoding polypeptides of 124and 170 amino acids in length, respectively (Fig. 3). Thesmaller of the two ORFs is probably expressed as a fusionprotein in pLMi 0 where the a-peptide of the p-galactosi-dase gene contributes the first 10 codons. It wouldterminate at position 375 with TAG. The second longerreading frame starts with ATG at position 388 andterminates with TAA at position 900. A stretch of 12nucleotides separated these reading frames and therewere no sequences showing similarity to consensussequences of bacterial promoters. Immediately upstreamof the reading frame, a good consensus ribosome-bindingsequence (5'-TAGGGG-3') is present at position 373 to379 (Stormo et ai, 1982). The ORFs predict two polypep-tides of 14419D and 17994D respectively. A rho-independent terminator with an energy content of 67.62 kJis positioned four nucleotides after the second readingframe (Platt, 1986).

The predicted molecular mass of 18kD for the secondORF is 17% lower than the size of the protein estimated forthe 21 kD protein on the basis of its electrophoreticmobility in SDS-PAGE. To confirm that this reading frameencodes the 21 kD protein, we purified the recombinantprotein, and subjected it to sequential Edman degra-dation. The amino sequence obtained for the first 22

Characterization of a Listeria monocytogenes-spec/ffc protein 1093

kDa

67

45

29

1814

kDa

21

14

Fig. 1. A. Auloradiograph of p^S]-(abelled polypeptides encoded bypLMIO in maxicells. Lane 1, pLMIO; lane 2, pUC18. The positions ofmolecular weight markers are indicated. The 21 kD polypeplide is theproduct of the ImaA gene.B. SDS-PAGE stained gel of proteins from strain BL21 {\DE3) harbouringplasmid pLM10-1 (lane 1), and strain DH5u harbouring pUCIS (lane 2),and pLMI 0 (lane 3), respectively. The positions of the 21 kD (LmaA) and14kD polypeptides are indicated.

amino acids, except the cysteine at position 8, wasIdentical to the amino acid sequence starting from nucleo-tide position 388. The direction and translation of thisreading frame is also corroborated by the detection of twoexonuclease Ill-derived recombinants (6/10 and 6/11)both showing a- complementation of the p-galactosidasegene in strain DH5Q. Nucleotide sequencing shows thefusion junctions to be at amino acids 144 and 26 of thesecond ORF, respectively. The G-FC content of thesequenced region is about 38% and is comparable to thevalue of 36% obtained for the listeriolysin gene (Mengaudet ai, 1988). The deduced amino acid sequence of theImaA gene shows no significant homology to any of theproteins currently in the NBRF database.

Protein sequence features

The translated amino sequence of the second ORF fromnucleotides 297 to 900 revealed it to be a stronglyhydrophobic protein with a transmembrane region locatedat the amino-terminal end of the protein between aminoacids 24 and 40 (Fig. 4). The protein is rich in secondarystructure and was classified as an integral membrane

protein using the method of Klein, Kanehisa and DeLisi(Klein ef a/., 1985)'̂ The two strongly hydrophobic regionswithin the molecule are largely a-helical, and are sepa-rated from each other by a highly charged region ofextended conformation. The polypeptide is acidic and hasan isoelectric point of 4.2, which is in good agreement withthe experimentally determined isoelectric point of therecombinant protein isolated from £ coii harbouringplasmid pLMIO (data not shown).

The 21 kD protein is capabie of inducing delayed typehypersensitivity in Listeria-Immune mice

Since soluble antigen is capable of inducing specificdelayed-type hypersensitivity reactions in Listeria-immune mice, we wished to know if the LmaA polypeptide,purified from an E. ccH recombinant harbouring plasmidpLMIO, would be capable of eliciting such a reaction.NMRI mice were immunized with a sublethal dose ofbacteria (8x10^ intravenous), and then challenged on day7 post-infection with four different concentrations of theantigen. Five mice were tested at each concentration.Non-immune mice served as controls. As a further control,both /./sfena-immune and non-immune mice were chal-lenged with an unrelated antigen (ovalbumin) using twodifferent doses. The results, depicted in Table 1, show aspecific reaction at all concentrations of soluble antigen.Footpad swelling was first visible at four hours, andshowed a maximum at 18 hours declining thereafter tobarely detectable levels at 48 hours. Little or no reactionwas obtained with ovalbumin (an unrelated antigen) andnon-immune mice.

Immunological detection of the21kD polypeptide inListeria spp.

We next addressed the question as to whether the 21 kDpolypeptide is expressed in other serotypes of L. mono-cytogenes as well as in other Listeria species. To do this,antiserum to the purified antigen was produced becausethe anti-soluble antigen antiserum does not react with theprotein in immunoblot reactions. Total protein profilesfrom cell extracts of various Listeria strains were analysedby SDS-PAGE. After analysis, proteins were transferred byelectrophoresis to nitrocellulose sheets and the proteindetected using anti-LmaA rabbit antiserum. The dataobtained is depicted in Figure 5. The polypeptide is

Alul Xmnl HaeSl Alul

ATG TAA-

Bell Fig. 2. Partial restriction endonuclease map of theListeria DNA insert in plasmid pLMIO. Thedirection of transcription is from left to right, andthe initiation (ATG) and termination (TAG) codonsare shown.

1094 S. Gohmannetal.

TTCATGAGAGTTTTGGAAGCAGTGAGAACAATGCTCCAGGAAAAAGGCGGACTAGATATT 6 0PheMetArgValLeuGluAlaValArgThrMetLeuGlnGluLysGlyGIyLeuAspHe 20

TCTATTGTAATGCGTGACCAAGTGGAAATGCCTACAACGATGATCGAGATGATTGATCAA 120SerlleValMetArgAspGlnValGluMetProThrThrMetlleGluMetlleAspGln 40

aAGGAAGAAGAAAGCCAAACTGCCTGGAAAGAAAAATACCGTTTTGCAATCCATCATTAT 180GluGluGluGluSerGlnThrAlaTrpLysGluLysTyrArgPheAlalleHisHisTyr 60

ACAAATGAAACGGACTTAGCGGGAGTCGAAAAGATAGATACGCTTATCCAAACAGGATTC 240ThrAsnGluThrAspLeuAlaGlyValGluLysIleAspThrLeuIleGlnThrGlyPhe 80

ACTTTGCCTGAAGGATACAAATTAATCGCTGTTCGACATTACGGAAAACAAAATTTAGTC 300ThrLeuProGluGlyTyrLysLeuIleAlaValArgHisTyrGlyLysGlnAsnLeuVal 100

AAAGAAAATACGTTAATTCACGCAAAAACCAGTTTTGAAGTAAGTATTTGTCGTGAATTA 360LysGluAsnThrLeuIleHisAlaLysThrSerPheGluValSerlleCysArgGluLeu 120

124 RB8 1AAAGTAAAAATTTAGGGGG AAATATTAATGGCATTTQAAGAGAATTTATATTGTGATTAT 420LysValLysIle ElElAlaPheGluGluAsnLeuTyrCysAspTyr 11

ACACCGGGAGCTGCTAAAGCGGTCGCGGGGAAAGATGTAATTTTAGCAGTTTTTAACGCA 480ThrProGlyAlaAlaLysAlaValAlaGlyLysAspVallleLeuAlaValPheAsnAla 31

GCGGGGGACAAACTATTAGCGGTTGCGGGCCAACAAGGTCTAACTGTAAACCGTTCTAAA 540AlaGlyAspLysLeuLeuAlaValAlaGlyGlnGlnGlyLeuThrValAsnArgSerLys 51

GATAGCATTGAAATTACATCTAAAGATACAGTTGGCGGATGGAAATCCAAAATTGGCGGT 600AspSerlleGluIleThrSerLysAspThrValGlyGlyTrpLysSerLysIleGlyGly 71

ATGAAAGAATGGTCAATTGAAAATGACGGATTATATGTCGCTGATGCAGAGTCTCACAAA 660KetLysGluTrpSerlleGluAsnAspGlyLeuTyrValAlaAspAlaGluSerKlsLys 91

GAATTGGCGAAATATTTCGAAAGTGATAGCCCGGTTTGTGTGAAAATCATTAATCAAGCA 720GluLeuAlaLysTyrPheGluSerAspSerProValCysValLysIlelleAsnGlnAla 101

TCTAAAAAAGGTCTTTTCGGTGGTTTGGCAATTGTAGCTGACTATAGTTTTGAAGCACCT 780SerLysLysGlyLeuPheGlyGlyLeuAlalleValAlaAspTyrSerPheGluAlaPro 121

TTTGACG AAGCGATGACTTACTCTGTAAAACTAGACGGAATGGGCGCGCTTGTTGATTTA 840FheAspGluAlaMETThrTyrSerValLysLeuAspGlyMETGlyAlaLeuValAspLeu 141

ACGATTACTGAGGGCGGCGACCAAATGCCCGGCGAAACACCTGTAGCACCAGCAGAATAA 900

ThrlleThrGluGlyGlyAspGlnHETProGlyGluThrProValAlaProAlaGlu 170

AATAGAAAGCCACTGAAATAAGTGGCTTTCCCTTAGGAGGAAAATAAATGTTTGAAGTGA 960

ATGATACAACTTATATTTTACGATTTAATAAACAAAAAGTTAAAACGGTGGAATTAACAT 1020

CAGGGATTAGTTTAGTTGCAGCTTTGACTGCGAATAAAGGGATTTTGAG 1069

Fig. 3. DNA sequence of the 1069bp ListeriaDNA insert in pLMIO. The predicted amino acidsequence ot the 14 kD polypeptide (positions1-375) and the (jnaA protein (positions 388-900)is shown below the DNA sequenoe. The putativeribosome-binding site is indicated and theputative transcriptional terminator is underlined.

detectable in all L. monocytogenes strains tested in this

study and was absent in strains of the other Listeria

species. Of interest was the finding that the L. mono-

cytogenes strain SLCC 5779 does not express the 21 kD

polypeptide. This strain is of attenuated virulence and has

been shown recently to be defective in invasion of tissue

culture cells (Kuhn and Goebel. 1989).

Detection of the ImaA gene in Listeria spp.

Genomic DNAs of all known Listeria spp. were isolated,

digested with the restriction endonuclease HcoRI, and

transferred to nitrocellulose sheets for hybridization

(Southern. 1975), The entire Listeria DNA insert from

pLMIO was excised using the restriction endonucleases

Kpn\ and BamHI, radioactivety labelled with a[^^Pl-ATP,

and used to probe for homologous sequences. Hybridi-

zation signals were detected only with L. monocytogenes

and L ivanovii strains (Fig. 6). Within the L. mono-

cytogenes strains, two types of hybridization patterns

were observed: all serotype 1/2a strains reacted with a

6,9kb EcoR\ fragment, while the serotype 4b and 3a

strains hybridized with a 7.8 kb EcoRI fragment. The 3.5 kb

EcoRI fragment hybridizing in L. ivanovii was detected

after a three-fold longer film exposure compared to L.

monocytogenes strains, suggesting divergence of the

sequences encoding the gene in this species. Thus the

ImaA gene is only present in pathogenic species of

Listeria.

Discussion

In this study, a recombinant strain, identified by screening

a pUC18//-. monocytogenes expression library with an

Characterization of a Listeria monocytogenes-spec/ffc protein 1095

30 60 90 120Residue number

Fig. 4. Hydropathy plot for the LmaA protein according to the method ofKyte and Doolittle (1982), The average hydropathy of a 15-amino-acidwindow {span length) centred at each amino acid from the amino- tocarboxy-terminus is shown. The bar indicates the position of atransmembrane-spanning domain between amino acid residues 24 and40.

1 2 3 4 5 6 7 8 9 1 0 k D a

21

Fig. 5. Immunological detection of the LmaA poiypeptide in iisteriastrain using rabbit-anti LmaA serum. Lane 1, L monocytogenes serotype1/2a EGD; lane 2, L monocytogenes 1/2a NCTC 7973; lane 3, Lmonocytogenes SLCC 4013 serotype 4b; lane 4, L. monocytogenesSLCC 5489 serotype 4b: lane 5, L. monocytogenes SLCC 5105 serotype3a; lane 6, L monocytogenes SLCC 5779 serotype 1/2a; lane 7, L.ivanovii AJCC 19119; lane 8, L. see'/fifen SLCC 3954 serotype V2b, lane9, L welshimeri SLCC 5334 serotype 6a; lane 10. L innocua NCTC11288 serotype 6a. The position of the LmaA polypeptide is indicated.

antiserum raised against soluble antigen of the samestrain, was found to encode a 21 kD polypeptide capableof eliciting a specific delayed hypersensitivity reaction in/./stena-immune mice. Using rabbit antiserum directedagainst the recombinant protein, we demonstrated thatthis 21 kD polypeptide was expressed only in pathogenicListeria species. DNA hybridization analysis of genomicDNA from different Listeria species showed thatsequences homologous to the ImaA gene were unique tothe species L. monocytogenes. and conserved to a lesserextent in L. Ivanovii. No hybridization to any other speciesof Listeria was detected.

The ambivalence of its reactivity to soluble antigenantiserum in the colony blot ELISA and immunoblotassays prompted us to characterize the recombinantharbouring pLMIO in detail. Of the two polypeptides,

14kD and 21 kD in size, synthesized in maxicell strainsharbouring pLMIO, only strains producing the 21 kDpolypeptide reacted with anti-soluble antigen antiserum inthe colony blot ELISA. This protein constitutes approxi-mately 10% of total cell protein when induced, and theconspicuous absence of a reaction in immunoblots usingthis antiserum suggests that it is only recognizing con-formational epitopes of LmaA. When the protein waspurified from denaturating SDS-PAGE gels, the antiserumobtained against this form of the protein allowed itsdetection in immunoblots.

Nucleotide sequencing showed the product of the ImaAgene to be 170 amino acids long with a molecular mass of17994 Daltons. The protein is extremely acidic, exhibitingan isoelectric point of 4.2. The molecular weight of theprotein in recombinant E. coli and L. monocytogenes at21 kD was higher than the theoretical value expected. Thehydrophobic nature of the protein and the clustering ofproline residues at its C-terminal end may contribute to theaberrant migration in SDS-PAGE, Purified LmaA oftenaggregates at concentrations of greater than 20M.g m l " ^these can be detected as higher molecular-weight formseven in SDS-PAGE gels (data not shown). The amino acidsequence of the LmaA polypeptide reveals a hydrophobicprotein, suggesting that it may be associated with thecytoplasmic membrane. Consistent with the idea that theLmaA protein is an integral membrane protein is thepresence of a domain, at the amino-terminus, which couldfunction as a transmembrane anchor.

The ImaA gene appears to be part of an operon in L.monocytogenes. An ORF encoding a truncated 14kD

Tabie 1. Induction of delayed hypersensitivity against L. monocytogenesEGD with purified recombinant LmaA antigen.

Antigen

L/sfena-immune mice

LmaA

PBSSoluble antigenOvaibumin

Non-immune mice

LmaA

PBS

Dose (MLg)

15

1050-201050

15

1050-

Footpad swelling(0.1mm ± SD)

4.5 ± 1.25,5 ± 0.86.3 ± 0.68.7 + 0.50.7 ± 0,45.7 ± 0,61.7 ± 0.32,9 ± 1.4

1.2 ±0,51.5 ± 0.71.3 ± 0.41,9 ±0 .20,6 ± 0,6

Delayed hypersensitivity reactions were elicited by footpad challenge withgraded amounts of antigen and read as an increase in footpad thickness24 h later. Positive controls received 20j,Lg of soluble antigen.

1096 S. Gdhmann etal.

kb 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11 12 13 14

7 86 9

3 5-

Fig. 6. Autoradiograph of a Southern blot of chromosomal DNA from different strains digested with the restriction endonuclease EcoRI and hybridized tothe 1.1 kb EcofH-Kpn\ fragment from plasmid pLMIO. The con'espondingethidium-bromide-stained agarose gel of chromosomal DNA from the differentstrains is shown in Fig. 7B.

Lane 1, L monocytogenes EGD serotype 1/2a; lane 2, L monocytogenes SLCC 5764 serotype 1/2a; lane 3, i. monocytogenes NCTC 7973 serotype1/2a; lane 4, L. monocytogenes SLCC 53 serotype 1/2a; lane 5. L monocytogenes SLCC 5489 serotype 4b; lane 6. L monocytogenes SLCC 4013serotype 4b; lane 7. L. monocytogenes SLCC 5105 serotype 3a; lane 8, L innocua NCTC 11288 serotype 8a; lane 9, L. welshimeri SLCC 5334 serotype6a; lane 10, L. seetigeri SLCC 3954 serotype 1/2b; lane 11, L. ivanovitATCC 19119 serotype 5; lane 12, L grayi\ lane 13, L. murrayr, lane 14, E. faecalis.

polypeptide preceded, and was separated by, 12 nucleo-tides from the ImaA gene. Except for a strong ribosome-binding site (RBS), neither termination nor transcriptionalsignals were detected in this intergenic region. Theexpression of both listerial polypeptides in £ coli isdependent on the lac promoter of the pUC plasmid. Thepresence of a strong consensus RBS preceding the ImaAgene suggests that translational coupling plays an impor-tant role in the expression of this gene in both E co//and L.monocytogenes.

In the 3' untranslated region a putative rho-dependentterminator (Platt, 1986) was found 5bp from the termi-nation codon of the ImaA gene.

Rabbit antiserum raised against the denatured form ofthe LmaA polypeptide allowed the detection of its expres-sion in both £ CO//and L. monocytogenes. Nevertheless,detection of the LmaA polypeptide in L. monocytogeneswas only possible when a low dilution of the antisera(1:100) was used and the detection of the resultingimmunoconjugates was amplified using the peroxidase-anti-peroxidase reaction. This suggests that the ImaAgene is poorly expressed under the growth conditionsdescribed here, since the antiserum used was capable ofreacting with as little as lOng of the purified protein (datanot shown). Expression of the LmaA polypeptide was onlydetected in L. monocytogenes strains; neither L. ivanovlinor any strain of the other Listeria species showed anycross-reactive material. DNA hybridization analysis oftotal chromosomal DNA from all known Listeria speciesusing the Listeria DNA insert in pLMIO confirmed that

homologous sequences to the ImaA gene were presentonly in L. monocytogenes and, to a lesser extent, L.ivanovii. The lack of immunological cross-reacting mater-ial in L. ivanovii also suggests that sequences encodingthe ImaA gene have diverged considerably in this species.In a recent study, we used this DNA to probe forhomologous sequences in 284 strains comprising allknown Listeria species and their serotypes (Notermans efai, 1989). Only L. monocytogenes and L. ivanovii strainswere found to react with the probe. The single exceptionwere L. monocytogenes strains of serotype 4a. In a mousemodel for infection, these strains have been shown to haveonly attenuated virulence (Kaufmann, 1984).

One interesting finding was the absence of the polypep-tide in the L. monocytogenes strain SLCC 5779. This strainhas recently been found to be defective for entry intofibroblasts and has an altered pattern of total cell protein(Kuhn and Goebel, 1989). Southern hybridization ofchromosomal DNA shows that the gene is present in thisstrain (fvlartina Kloss and T. Chakraborty, unpublishedresults), so the lack of its expression may be a regulatoryphenomenon.

Purified LmaA was capable of eliciting deiayed-typehypersensitivity (DTH) reactions in /./steria-immune mice.This effect was specific and was induced by proteinisolated from overproducing £ coli recombinants. TheDTH response is a T-cell-mediated reaction and the LmaAprotein may therefore be an immunologically relevantantigen in iisterial infections.

Antonissen and colleagues (Antonissen et ai, 1986)

Characterization of a Listeria monocytogenes-spec/ftc prote/n 1097

have reported the isolation of a 20.4 kD protein from thecell-envelope fraction of a L. monocytogenes serotype 4bstrain that is capable of inducing delayed hypersensitivityreactions in /./sfer/a-immune mice. Taking the size and thelocation of the 20.4 kD protein in the bacterial cell envelopeinto consideration, it is likely that this protein is the LmaAprotein described here. Recently, Ziegler and colleagues(Ziegler et ai, 1987) fractionated solubilized total cellprotein of a L. monocytogenes strain on preparativeSDS-PAGE and used individual fractions to study differen-tial requirements for the processing and presentation ofthese antigens by macrophages. A fraction containing a21 kD polypeptide was found in these studies to becapable of specifically inducing T-lymphocyte prolifer-ation without prior processing by the presenting macro-phages. In this respect, we have found that the purifiedLmaA antigen is capable of inducing T-cell proliferation inL/ster/a-immune mice (M. Leimeister-Wachter and T.Chakraborty, unpublished results). It would therefore be ofgreat interest to establish if the LmaA polypeptide can bepresented without prior processing by the presentingmacrophage.

We have reported the cloning of a listerial antigen that isspecific to pathogenic Listeria. The protein exhibitedstrong secondary structure and was highly acidic: thesetwo features may contribute to the immunological pecula-rities associated with this protein. Purified recombinantprotein was also found to elicit delayed type hypersensiti-vity in L/s(eria-immune mice. The ImaA gene appears to bepart of an operon, and the molecular cloning of this operonand its regulatory region will enable us to study theexpression of this polypeptide during infection. Little isknown of the nature of listerial antigens that are targets ofthe cell-mediated responses in the infected host. Therelative ease of isolation of this protein will permit ananalysis of regions that may interact with cells of the hostimmune response. The availability of the cloned geneshould also allow the construction of mutants and engi-neered strains for the evaluation of its role in thepathogenesis of listerial infection.

Experimental procedures

Bacterial strains

The L. monocytogenes serotype 1/2a strain EGD was obtainedfrom Dr S. H. E. Kaufmann. The E. coli strains DH5a {endA^,hsdmi. supEAA, thi-^, recA^, gyrA9e. relA^, CSH26AF6 (ara,thi, Mtac-pro). MrecA-srI), F6, rpsL, BL21 (lambda DE3) hsdS,gal, TB me) were used in the construction of the gene library andmaxicell analysis, respectively. The plasmid cloning vectorspUCI 8 (Yanisch-Perron etai, 1985) and pAR3040 (Rosenberg efai, 1987) have been previously described. The plasmids pTZ18and pTZ19, used in DNA sequencing, were purchased fromPharmacia.

Media and buffers

Listeria spp. were cultured in brain heart infusion broth (Difco) at37''C and all E. co/f recombinants were grown at 37°C in L-broth.Where required, medium was supplemented with ampicillin atlOOfig ml '. Restriction endonucleases were purchased fromBoehringer-Mannheim, and used as suggested by the manufac-turer. Swine anti-rabbit and rabbit peroxidase-anti-peroxidaseantibodies were purchased from DAKO Laboratories.

Preparation of soluble antigen

The soluble antigen used in this study was prepared essentially asdescribed by Kaufmann (1984). Briefly, bacteria were grown at37''C in tryptic soy broth that had been filtered to remove materialof >10kD molecular mass. After 30h of growth in this medium,bacterial lysis occurred and the culture was completely iysed 6hlater. After a brief spin to remove intact bacteria, the supernatantwas concentrated by ultrafiltration. dialysed extensively againstphosphate-buffered saline to a final protein concentration of20mg ml ^ and stored in frozen aliquots at -70°C. Solubleantigen thus prepared contains both cellular and extracellularlisterial antigens.

Antiserum to soluble antigen was produced by subcutaneousinjection of antigen with Freund's incomplete adjuvant, followedby booster injections 14,28 and 60d later in incomplete Freund'sadjuvants. Rabbit were bled lOd following the last injection andthe defibrinated serum stored at -70°C until used.

Electrophoretic analysis of plasmid-encodedpolypeptides

Analysis of plasmid-encoded translational products in a maxicellsystem has been described previously (Stoker et ai, 1984).Labelling of polypeptides was carried out in methionine assaymedium (Difco Laboratories) containing 50^lCi of p^S]-methio-nine (970 Ci mmol '; Amersham Buchler). Samples wereanalysed in a 12.5% actylamide gel, dried and used to expose FijiRX X-ray film.

Screening of the pUCW-L. monocytogenes DNAexpression library

Chromosomal DNA from L monocytogenes strain EGD cleavedwith the restriction endonuclease Alu\ was fractionated and DNAfragments of between 4 and 10 kb pooled and ligated withSmal-cleaved pUC18 vector. The resulting ligation mixture wastransformed into E. coti strain DH5a. Standard protocols wereused in the preparation of plasmid DNA, cleavage, ligation, andtransformation of competent bacteria (Maniatis etai, 1982).

L/s(en'a-antigen-producing clones were selected by screeningordered arrays of bacterial colonies using an in situ enzyme-lin-ked immunoassay (Young and Davis, 1983). Recombinants werescreened with rabbit antiserum raised against a soluble antigenfraction of L. monocytogenes EGD, preabsorbed with £ coliDH5a lysate. Positive clones were identified using a secondlinking antibody capable of binding to both the primary antibodyand the subsequently added peroxidase-anti-peroxidase (PAP)complex. Blots were developed with 4-chloro-1 -naphthol (0.4 mgml"'') and 0.015% hydrogen peroxide.

1098 S. Gdhmann eta\.

Poiyacrylamide gel electrophoresis and immunobiots

Crude lysates of Listeria strains and E. coli recombinantsexpressing plasmid-encoded polypeptides were made by har-vesting cells from overnight cultures and resuspending them in10mM Tris (pH 7.5)-1 OmM EDTA containing 100 M.g lysozyme perml. After 10 min at room temperature. SDS was added to a finalconcentration of 1%. A protease inhibitor (Trasylol; BoehringerMannheim) was added to the crude lysate at a final concentrationof 0.1%. Samples (25-|il) were taken up in double-strengthsample buffer, and boiled for 3 min before loading onto polyacry-lamide gels. Analysis of all samples was performed by PAGE in12.5% polyacrylamide gels in the presence of SDS. For immuno-blot reactions, proteins were transferred to nitrocellulose paperand reacted with rabbit anti-soluble antigen antiserum. This wasfollowed by a second linking antibody capable of binding both theprimary antibody and the subsequently added PAP complex.Blots were developed with 4-chloro-1 -naphthol (0.4 mg ml ') and0.015% hydrogen peroxide.

DAM sequencing

The insert from plasmid pLMIO was cloned into the vectorspTZ18 and pTZ19 into the unique SamHI and Kpnl cloning sites.A unidirectional deletion library was made from each clone usingthe protocol devised by Henikoff (1984) so as to obtain thesequence of both strands of the insert DNA over its entire length.The restriction endonuclease sites Kpn\ and Bcl\ were used tolinearize the plasmid before being subjected to unidirectionalexonuclease III digestion. Sequence data were analysed bycomputer using the UWGCG (Oevereux etai, 1984} and PC-GENEsoftware programs. The hydropathy plot of the predicted proteinsequence was constructed using the method of Kyte and Doolittle(1982).

Purification of the LmaA protein and determination of itsamino acid sequence

E. coli recombinants harbouring the ImaA gene were grown toODeoo = 1 in LB medium containing ampicillin, following whichIPTG was added to a final concentration of 0.5 mM. After a furtherthree hours of grov f̂th, cells were harvested by centrifugation andresuspended in a one-tenth volume of phosphate-buffered saline(PBS) and Iysed by three freeze-thaw cycles in liquid nitrogenfollowed by ultrasonication for 15s. Samples were taken up in thesame volume of double-strength sample buffer and boiled for 5min before loading onto a preparative 12.5% polyacrylamide gel.After electrophoresis, ttie gels were stained with 3.5 M sodiumacetate and the protein band corresponding to the LmaApolypeptide excised. The protein was isolated by electroelutionusing a Schleicher and Schuell BIOTRAP'̂ '̂ chamber, concentratedby precipitation in cold acetone, and resuspended in PBS buffer.The partial amino-terminal sequence of the gel-purified proteinwas determined by automated sequential Edman degradation,carried out using an Applied Biosystems gas-phase sequenator.

Antisera to the purified antigen was produced by subcutaneousinjection with Freund's complete adjuvant, followed by boosterinjections 2,4 and 6 weeks later in incomplete Freund's adjuvant.Rabbits were bled lOd following the last injection and defibri-nated serum stored at - 70^0 until used. The antiserum was used

at a dilution of 1:2000 wtien detecting Listeria antigens in £. colirecombinants and at a 1:100 dilution for the same antigen inListeria species.

Southern hybridization

Bacterial ctiromosomal DNA was isolated after lysis of bacteria(Johnson, 1981). The DNA {5|xg) was digested with variousrestriction endonucleases. The digested DNA was elec-trophoresed on 0.7% agarose gels for approximately 16h (30V),after which the DNA was transferred to nitrocellulose sheets asdescribed by Southern (1975). Hybridization was carried outunder conditions of high stringency as described previously(Notermansefa/., 1989).

DNA probes were labelled with a-p^P]-ATP by the randompriming method (Feinberg and Vogelstein, 1983). A specificactivity of 1-4 x io° c.p.m. jig ' was routinely obtained.

Footpad reactivity to the LmaA antigen

Delayed hypersensitivity responses were determined followingthe injection of purified antigen into Lisferia-immune and non-immune mice (Kaufmann, 1984). Mice were immunized intrave-nously with 8 x 1 0 ^ bacteria of L. monocytogenes strain EGD. At7d post-infection, mice were injected subcutaneously withincreasing amounts of purified antigen into one hind footpad andan equal volume of PBS in the other footpad. Footpad swellingwas determined with a dial gauge caliper (Kroplin) at varioustimes after antigen injection over the following 48h.

Acknowledgements

We thank K. Wernars and S. Notermans (Rijks Instituut voorVolksgezondheid en Milieuhygeine, The Netherlands) for adviceon many aspects of this work, H. Hof for providing the animalsused in this study, Brigitte Gopfert for expert technical assis-tance, and V. Husslein for editorial assistance with the manu-script. T.C. is indebted to T. Jarchau and M. Kloss for manydiscussions. This work was supported by the Deutsche Fors-chungs Gemeinschaft through SFB 165 Project B4.

References

Antonissen, A.C.J.M., Lemmens, P.J.M.R., van den Bosch, J.F.,and van Boven, C.P.A. (1986) Purification of a delayed hyper-sensitivity-inducing protein from Listeria monocytogenes.t^EMS Microbiot Lett 34: 9^-95.

Berche, P., Gaillard, J.-L., Geoffroy, C , and Alouf, J.E. (1987) Tcell recognition of listeriolysin O is induced during infection withListeria monocytogenes. J tmmunot 139: 3813-3821.

Chakraborty, T., and Goebei. W. (1988) Recent developments inthe study of virulence of Listeria monocytogenes. Curr TopMicrobiot tmmunobiot 138: 41-58.

Cherubin, C.E., Marr, J.S., Sierra, M.F., and Becker, S. (1981)Listeria and gram-negative bacillary meningitis in New YorkCity. 1972-1979: frequent causes of meningitis in adults. Am JMedT\: 199-209.

Cohen, J.J., Rodriguez, G.E., Kind. P.D., and Campbell, P.A.(1975) Listeria cell wall fraction: a B cell mitogen. J Immunol114:1132-1137.

Characterization of a Listeria monocytogenes-spec/ffc prate/n 1099

Devereux, P., Haeberii, P., and Smithies, O. (1984) A comprehen-sive set of sequence analysis programs for the VAX. NucI AcidsRes 12: 387-395.

Feinberg, A.P., and Vogetstein, B. (1983) A technique forradiolabeling DNA restriction endonuclease fragments to highspecificity. Analyt Biochem 132: 6-13.

Gellin, B.G., and Broome, C.V. (1989) Listeriosis. J Am MedAss261: 1313-1320.

Hansen, P.B., Jensen, T.H., Lykkegaard, S., and Kristensen, H.S.(1987) Listeria monocytogenes meningitis in adults: sixteenconsecutive cases 1973-1982. Scand J Inf Dis 19: 55-60.

Henikoff, S. (1984) Unidirectional digestion with exonuclease IIIcreates targefed breakpoints for DNA sequencing. Gene 28:351-359.

Johnson, J.L. (1981) Genetic characterization. In Manual ofMethods for General Bacteriology. Gerhardt, P. (ad.). AmericanSociety of Microbiology, Washington, D.C.: American Societyfor Microbiology, pp, 450-472.

Kaufmann, S.H.E. (1984) Acquired resistance to facultativeintracellular bacteria: relationship between persistence, cross-reactivity at the T-cell level, and capacity to stimulate cellularimmunity of different Listeria strains. Infect Immun 45: 234-241.

Klein, P., Kanehisa, M., and DeLisi, C. (1985) The detection andclassification of membrane-spanning proteins. BBA 815:468-476.

Kongshavn, P.A.L. (1986) Genetic control of resistance to Listeriainfection. Curr Top Microbiol Immunobiol 124: 67-86.

Kuhn, M., and Goebel, W. (1989) Identification of an extracellularprotein of Listeria monocytogenes possibly involved inintracellular uptake by mammalian cells. Infect Immun 57:55-61.

Kyte, J., and Doolittle, R.F. (1982) A simple method for displayingthe hydropathic character of a protein. JMo/6/o/157:105-132.

Mackaness, G.B. (1962) Cellular resistance to infections. J ExpMed 116: 381-406.

Maniatts, T., Fritsch, E.F., and Sambrook, J. (1982) MolecularCloning. A Laboratory Manual. Cold Spring Harbor, Nevi/ York:Cold Spring Harbor Laboratory Press.

Mengaud, J., Vicente, M.F., Chenevert, J., Pereira, J,M., Geof-froy, C , Gicquel-Sanzey. B., Baquero, F., Perez-Diaz, J.C., andCossart, P. (1988) Expression in Escherichia coti and sequenceanalysis of tfie listeriolysin O determinant of Listeria mono-cytogenes. Infect Immun 56: 766-772.

Murray, E.G.D., Webb, R.A.. and Swann, M.B.R. (1926) A diseaseof rabbits characterized by large mononuclear leukocytosis,caused by a hitherto undescribed bacillus Bacterium mono-cytogenes. J Pathol Bacteriol 29: 407-439.

Notermans, S., Chakraborty, T,, Leimeister-Wachter, M.,Dufrenne, J., Heuvelman, K.J., Maas, H., Jansen, W., Wernars,K., and Guinee, P. (1989) A specific gene probe for thedetection of Bio- and Serotyped Listeria strains. AppI EnvironMicrobiol 55: 902-906.

Platt, T. (1986) Transcription termination and the regulation ofgene expression. Annu Rev Biochem 55: 339-372.

Rosenberg, A.M., Lade, B.N., Chui, D.-S., Lin, S.-W., Dunn, J.J.,and Studier, F.W. (1987) Vectors for selective expression ofcloned DNAs by T7 RNA poiymerase. Gene 56: 125-135.

Shum, D.T., and Galsworthy, S.B. (1982) Stimulation of monocyteproduction by an endogenous mediator induced by acomponent from Listeria monocytogenes. Immunology 46:343-351.

Southern, E.M. (1975) Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J Mol S/o/98:503-517.

Stoker, N.G., Pratt, J.M., and Holland, I.B. (1984) Expression andidentification of cloned gene products in Escherichia coli. InTranscription and Translation - A Practical Approach. Hames.B.D., and Higgins, S.J. (eds). Oxford: IRL Press, pp. 122-147.

Stormo, D.G., Schneider, T.D., Gold, L., and Ehrenfuecht, A.(1982) Perceptron alogarithm to distinguish translational initi-ation sites in Escherichia coli. NucI Acids Res 12: 2997-3011.

Wentworth, P.A., and Ziegler, H.K. (1987) The antigenic andmitogenic response of murine T and B lymphocytes to solubleproteins of Listeria monocytogenes. J Immunol 138: 2671-2678.

Vanisch-Perron, C, Vieira, J., and Messing, J. (1985) ImprovedMl 3 phage cloning vectors and host strains: nucteotidesequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.

Young, R.A., and Davis, R.W. (1983) Yeast RNA poiymerase IIgenes: isolation with antibody probes. Science 222: 77S-782.

Ziegler, H.K., Orlin, C.A., and Cluff. C.W. (1987) Differentialrequirements for the processing and presentation of solubleand particulate bacteria! antigens by macrophages. Eur JImmunol M: 1287-1296.