Download - Defined Culture Medium Physiology of Cultured Human ...

Defined Culture MediumPhysiology of Cultured Human Microglia Maintained in a

Philippe Mercier and Terrance M. EganManju Tewari, Maheen Khan, Megha Verma, Jeroen Coppens, Joanna M. Kemp, Richard Bucholz,

http://www.immunohorizons.org/content/5/4/257https://doi.org/10.4049/immunohorizons.2000101doi:

2021, 5 (4) 257-272ImmunoHorizons

This information is current as of July 17, 2022.

MaterialSupplementary

s.2000101.DCSupplementalhttp://www.immunohorizons.org/content/suppl/2021/04/29/immunohorizon

Referenceshttp://www.immunohorizons.org/content/5/4/257.full#ref-list-1

, 17 of which you can access for free at: cites 96 articlesThis article

Email Alertshttp://www.immunohorizons.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

ISSN 2573-7732.All rights reserved.1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is an open access journal published byImmunoHorizons

by guest on July 17, 2022http://w

ww

.imm

unohorizons.org/D

ownloaded from

by guest on July 17, 2022

http://ww

w.im

munohorizons.org/

Dow

nloaded from

https://doi.org/10.4049/immunohorizons.2000101

http://www.immunohorizons.org/content/5/4/257

http://www.immunohorizons.org/content/suppl/2021/04/29/immunohorizons.2000101.DCSupplemental

http://www.immunohorizons.org/content/suppl/2021/04/29/immunohorizons.2000101.DCSupplemental

http://www.immunohorizons.org/content/5/4/257.full#ref-list-1

http://www.immunohorizons.org/alerts

http://www.immunohorizons.org/


Physiology of Cultured Human Microglia Maintained in aDefined Culture Medium

Manju Tewari,*,† Maheen Khan,‡ Megha Verma,* Jeroen Coppens,‡ Joanna M. Kemp,‡ Richard Bucholz,‡

Philippe Mercier,†,‡ and Terrance M. Egan*,†

*Department of Pharmacology and Physiology, Saint Louis University School of Medicine, St. Louis, MO; †The Henry and Amelia Nasrallah Center forNeuroscience, Saint Louis University School of Medicine, St. Louis, MO; and ‡Department of Neurosurgery, Saint Louis University School of Medicine, St. Louis, MO

ABSTRACT

Microglia are the primary immune cell of the CNS, comprising 5--20% of the �60 billion neuroglia in the human brain. In the

developing and adult CNS, they preferentially target active neurons to guide synapse maturation and remodeling. At the same time,

they are the first line of defense against bacterial, fungal, and viral CNS infections. Although an extensive literature details their roles in

rodents, less is known about how they function in humans because of the difficulty in obtaining tissue samples and the

understandable inability to extensively study human microglia in situ. In this study, we use recent advances in the study of brain

microenvironments to establish cultures of primary human microglia in a serum-free medium. Postsurgical samples of human brain were

enzymatically and mechanically dissociated into single cells, and microglia were isolated at high purity by positive selection using CD11b

Ab--coated microbeads. The CD11b1 cells were plated on poly-L-lysine--coated surfaces and bathed in serum-free DMEM/F12

supplemented with three essential components (TGF-b, IL-34, and cholesterol). Under these conditions, microglia assumed a ramified

morphology, showed limited proliferation, actively surveyed their surroundings, and phagocytosed bacterial microparticles. In the presence

of LPS, they assumed a more compact shape and began production of proinflammatory cytokines and reactive oxygen species. LPS on its

own triggered release of TNF-a, whereas release of IL-1b required costimulation by ATP. Thus, humanmicroglia maintained in a defined

medium replicate many of the characteristics expected of native cells in the brain and provide an accessible preparation for investigations

of human microglial physiology, pharmacology, and pathophysiology. ImmunoHorizons, 2021, 5: 257–272.

INTRODUCTION

Microglia are mononuclear phagocytes that comprise�10% of the total cell population of the brain and spinalcord (1). They colonize the brain early in development,eventually forming a grid of cells with rod-shaped somasand motile extensions that continuously survey their

immediate surroundings (2). Microglia are the first to re-spond to prion, bacterial, and viral infections of the CNSby neutralizing invading pathogens (3--5). They play keyroles in neurodevelopment by limiting the number of oli-godendrocytes (6) and neural precursor cells (7), regulat-ing differentiation of astrocytes (8, 9), and pruningsynapses (10). In adults, they contribute to activity-

Received for publication November 30, 2020. Accepted for publication March 8, 2021.

Address correspondence and reprint requests to: Dr. Terrance M. Egan, Department of Pharmacology and Physiology, Saint Louis University School of Medicine,1402 South Grand Boulevard, St. Louis, MO 63104. E-mail address: [email protected]

ORCIDs: 0000-0002-6637-6073 (M.T.); 0000-0001-9713-3122 (J.C.); 0000-0001-6059-5999 (P.M.); 0000-0002-7249-3161 (T.M.E.)

This project was conceived by P.M., M.K., M.T., and T.M.E. Unless otherwise noted, the experimental protocols were designed and performed by M.T. The exceptionswere the Fluo-4 (M.T. and M.V.) and electrophysiology (T.M.E.) experiments. M.T. and T.M.E analyzed the results. Brain samples following resection were supplied byJ.C., J.M.K., R.B., M.K., and P.M. The paper was written by M.T., P.M., and T.M.E.

This work was supported by grants (to T.M.E.) from the National Institutes of Health (R01GM112188) and Saint Louis University.

Abbreviations used in this article: [Ca21]i, intracellular free Ca21; CT, cycle threshold; CTCF, corrected total cell fluorescence; DAMP, danger-associated molecularpattern; ECS, extracellular solution; LDH, lactate dehydrogenase; NAC, N-acetyl cysteine; PAMP, pattern-associated molecular pattern; P2X7R, P2X7 receptor; P2Y12R,P2Y12 receptor; qPCR, quantitative real-time PCR; RFU, relative fluorescence unit; ROS, reactive oxygen species; TIC, TGF-b, IL-34, and cholesterol.

The online version of this article contains supplemental material.

ar>This article is distributed under the terms of the CC BY 4.0 Unported license.

Copyright © 2021 The Authors

https://doi.org/10.4049/immunohorizons.2000101 257

ImmunoHorizons is published by The American Association of Immunologists, Inc.

RESEARCH ARTICLE

Innate Immunity


ww

.imm

unohorizons.org/D

ownloaded from

http://orcid.org/0000-0002-6637-6073

http://orcid.org/0000-0001-9713-3122

http://orcid.org/0000-0001-6059-5999

http://orcid.org/0000-0002-7249-3161

http://orcid.org/0000-0002-6637-6073

http://orcid.org/0000-0001-9713-3122

http://orcid.org/0000-0001-6059-5999

http://orcid.org/0000-0002-7249-3161

https://www.immunohorizons.org/lookup/suppl/doi:10.4049/immunohorizons.2000101/-/DCSupplemental

https://creativecommons.org/licenses/by/4.0/


dependent plasticity by fine-tuning synaptic connectivity(11), and they maintain homeostasis by phagocytosing dy-ing cells (12). At the same time, uncontrolled activation islinked to the aberrant synaptic pruning and production ofproinflammatory molecules that accompanies a number ofchronic diseases, including autism-spectrum disorder,amyotrophic lateral sclerosis, schizophrenia, and Alz-heimer and Parkinson diseases (1, 13).

The foundation of our understanding of microglial phys-iology comes from studies using murine cell lines and ge-netically modified mice (14, 15). Although these studies areunquestionably vital, a growing body of evidence identifiessignificant biochemical, genomic, and pharmacological dif-ferences between the immune response of different species(16--20). In fact, studies of mouse and human microglia re-veal disparities in gene expression, proliferation, heteroge-neity, and cytokine production, calling into question thevalidity of using mouse data to definitively predict humanbehavior (1, 21--23). Thus, the use of human microglia inbenchtop studies is a critical step in bridging the gap be-tween preclinical data and phase 1 clinical trials. Severalmodel systems are currently available. First, immortalizedhuman microglial cell lines (HMO6, HmGlia, CHME-5,HMC3, C13NJ) provide a platform for mechanistic analyses,replicate some of the key properties expected of in situ mi-croglia, and are relatively inexpensive to maintain. Unfortu-nately, they do not completely recapitulate the response ofnative microglia to activation by danger-associated molecu-lar patterns (DAMPs) (24--26), and in some cases, their line-age is questionable (14, 27). Second, stem cell--derivedmicroglia hold significant promise (28--33) but require addi-tional validation (14). Third, primary human microglia canbe purchased from commercial sources (34) or acutely iso-lated from surgical samples and human cadavers (35--40).When placed in culture, these cells have the following dis-tinct advantages: microglia by birth, easily manipulated, andamenable to genomic, mechanistic, and pharmacologicalstudies. However, their usefulness is limited by an unnatu-rally high rate of proliferation, reduced production of theproinflammatory cytokine IL-1b, and a change in phagocyticprofile, all of which are induced by the presence of serumin the culture medium (14, 34, 41).

In this paper, we describe a method to obtain and cultureprimary human microglia from resected brain samples, irre-spective of age and disease state, that results in a viable cohortof microglia capable of replicating the hallmark properties ofnative cells. We used a popular magnetic bead-based separationprotocol to efficiently isolate CD11b1 microglia in numbers suf-ficient for acute RNA sequencing and in vitro cell culture (38).Our culture protocol differs from previously described attemptsin using a medium that lacks serum but includes three essentialastrocyte-derived factors (41). The result is a population oframified human microglia that remain viable for greater than20 days in culture without significant proliferation. These cellsdisplay active surveillance of their immediate surroundings,

phagocytose bacterial microparticles, and produce and releaseproinflammatory cytokines and reactive oxygen species (ROS)in response to exposure to LPS and ATP.

MATERIALS AND METHODS

MaterialsDMEM/F12, HBSS without Ca21 and Mg21, Neurobasal Medi-um, PBS without Ca21 and Mg21, penicillin, streptomycin, glu-tamine, and FBS were purchased from Life Technologies(Waltham, MA). Apotransferrin, ATP, Bradford reagent, BSA,EDTA, LPS from Escherichia coli 055:B5, DMSO, insulin, leu-peptin, N-acetyl cysteine (NAC), Percoll, sodium selenite, andprotease inhibitor mixture were purchased from Millipore-Sigma (St. Louis, MO). TGF-b and IL-34 were purchased fromPeproTech (Rocky Hills, NJ). Cholesterol was purchased fromAvanti Polar Lipids (Alabaster, Alabama). Ammonium--chlori-de--potassium lysing buffer, Fluo-4 AM, pHrodo Red E. Coli Bi-oParticles Conjugate, and YO-PRO-1 were purchased fromThermo Fisher Scientific. Enzymes, columns, and Integrin Sub-unit alpha-M--positive (CD11b1) microbeads for isolation of mi-croglia were purchased from Miltenyi Biotec (Somerville, MA).

Cell isolation and cultureDiscarded human brain tissue was processed from de-identifiedneurosurgical patients using protocols reviewed and approvedby the Institutional Review Board of the Saint Louis UniversitySchool of Medicine. Samples were transported on ice to a BSL-2 culture hood as soon as possible following resection (typicallyless than 15 min), weighed, then immediately submersed in 50ml of ice-cold divalent-free HBSS for 10 min. The cooled tissuewas transferred to a 10-cm petri dish containing just enoughcold HBSS to cover the tissue, and blood clots and connectivetissue were removed using sterile forceps. The remaining tissuewas chopped into small pieces (�1 mm3) using a sterile single-edge razor blade and transferred to a 50-ml Falcon tube filledwith cold HBSS. The tube was capped and gently inverted sev-eral times to dislodge adhering RBCs. The supernatant was re-moved by suction, and the remaining tissue was enzymaticallydissociated using a papain-based Neural Tissue Dissociation Kit(catalog no. 130-092-628; Miltenyi Biotec) according to themanufacturer�s instructions. In brief, the minced brain tissuewas incubated under slow continuous rotation at 37� in HBSScontaining papain for 15 min followed by a mix of papain andDNase for an additional 10 min. The enzymes were removedby centrifugation in the presence of leupeptin (20 mM), the tis-sue washed with 50 ml of cold HBSS, and single cells were sep-arated by passage through the ends of three to four Pasteurpipettes with fire-polished tips of diminishing diameters. Theresulting cell suspension was passed through a 40-mm cellstrainer, and the flow-through was collected in a 50-ml Falcontube. The flow-through was centrifuged at 300 � g for 10 minat room temperature, the supernatant was removed, and the re-maining pellet was processed for myelin removal using density

258 HUMAN MICROGLIA IN A DEFINED CULTURE MEDIUM ImmunoHorizons



ww

.imm

unohorizons.org/D

ownloaded from


gradient centrifugation. To do this, we resuspended the pelletin a 50-ml conical tube containing 10 ml of room-temperature22% Percoll in PBS, overlaid the cell suspension with 5 ml ofclean PBS, and then centrifuged the mixture at room tempera-ture for 20 min at 950 � g with slow acceleration and no brake.The supernatant including the myelin interface layer was care-fully removed and discarded. The remaining pellet was washedwith 50 ml of HBSS, centrifuged at 300 � g for 10 min, thenresuspended in ammonium--chloride--potassium lysing buffer (5ml) for 5 min at room temperature to lyse RBCs. The lysis wasquenched with 40 ml of HBSS, and the surviving cells werecentrifuged at 300 � g for 10 min to obtain a pellet. Microgliawere isolated by MACS using a Miltenyi Biotec QuadroMACSSeparator, CD11b Ab-conjugated microbeads, and LS columnsas follows: the cell pellet was resuspended in 90 ml of MACSbuffer solution (PBS, 0.5% BSA, and 2 mM EDTA) and 10 ml ofCD11b microbeads per 1 � 107 cells and incubated at 4�C in thedark for 15 min. The cell/microbead suspension was then dilut-ed by addition of 1 ml of cool MACS buffer per 1 � 107 cellsand centrifuged at 300 � g for 10 min. The supernatant wasdiscarded, the pellet was resuspended in 500 ml of cool MACSbuffer per 1 � 107 cells, and the resulting suspension was ap-plied to a prewet LS column positioned in the magnetic field ofthe QuadroMACS Separator. The flow-through, which con-tained cells that did not bind to the CD11b-coated microbeads(i.e., CD11b� cells), was collected, plated, and cultured in 50%DMEM and 50% Neurobasal media supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 1 mM sodium pyruvate,2 mM glutamine, 5 mg/ml insulin, 100 mg/ml transferrin, 100mg/ml BSA, 16 mg/ml putrescine, 60 ng/ml progesterone, 40ng/ml sodium selenite, 5 ng/ml heparin-binding EGF-likegrowth factor, and 5 mg/ml NAC for preliminary analysis as de-scribed later in this paper. The column and the retained cells(i.e., CD11b1 cells) were then washed three times with 3 ml ofcool MACS buffer, removed from the magnetic field, filledwith 5 ml of cool MACS buffer, and plunged to recover themicrobead-bound microglia. These cells were pelleted bycentrifugation and resuspended in 1 ml of a defined medium(TGF-b, IL-34, and cholesterol [TIC medium]) consisting ofDMEM/F12 supplemented with penicillin (100 U/ml),streptomycin (100 mg/ml), glutamine (2 mM), NAC (5 mg/ml), insulin (5 mg/ml), apo-transferrin (100 mg/ml), sodiumselenite (100 ng/ml), human TGF-b2 (2 ng/ml), murine IL-34 (100 ng/ml), and ovine wool cholesterol (1.5 mg/ml) (41).The cells were counted using an automated cell counterand seeded at densities that matched the requirements ofthe experimental protocols. Cells were plated in TIC medi-um at a density of 5 � 104 cells on poly-L-lysine--coated 13-mm glass coverslips (Gold Seal Cover Glass; Thermo FisherScientific, Waltham, MA) for immunocytochemistry, dyeuptake assay, and phagocytosis. For ELISA, cells were plat-ed at 3 � 104 cells per well on poly-L-lysine--coated clear-bottom 96-well plates. In all cases, cells were cultured forup to 20 d in a humidified 5% CO2 incubator with 50% ofthe culture medium replaced every third day.

Cell viability assay using Calcein AM and propidiumWe used Calcein AM and propidium iodide as markers for liveand apoptotic cells, respectively. Immediately following isola-tion, we incubated cells in the dark with 1 mM Calcein AM for30 min at 37�C. The cells were then centrifuged at 750 rpm for5 min to remove residual extracellular dye, washed, recentri-fuged, resuspended in PBS, and left for 10 min to ensure opti-mal retention of the Calcein AM. This was followed by a 5-minincubation with 1.25 mg/ml propidium, after which the cellswere pelleted, washed and centrifuged, resuspended in a PBS,and plated on coverslips for imaging using an Olympus IX70microscope and a 20� objective. Calcein AM was detected us-ing 488-nm excitation and 510-nm emission wavelengths, andpropidium iodide was detected using and 596-nm excitationand 615-nm emission wavelengths. Images (2048 � 2048 pix-els) from 4--5 fields per coverslip were captured and analyzedat �20 magnification using an Orca-Flash4.0 LT digital com-plementary metal oxide semiconductor (CMOS) camera (Ha-mamatsu Photonics, Bridgewater, NJ) and mManager 2.0software (42).

ImmunocytochemistryMicroglia grown on poly-L-lysine--coated glass coverslips werefixed using 4% paraformaldehyde solution for 10 min at roomtemperature. After washing three times with PBS, cells werepermeabilized using 0.3% Triton X-100 for 5 min, washed withPBS, and blocked with 5% normal serum of the secondary Abhost in PBS for 1 h. After blocking, cells were incubated for 4h with primary Ab for Iba1 (1:1000, goat or rabbit), GFAP(1:1000), or Ki-67 (1:500) diluted in blocking solution. For dou-ble-immunostaining, cells were washed three times with PBSand incubated with one of the following primary Abs for either5 h at room temperature or overnight at 4�C: ALDH1L1 (1:500);P2Y12 receptor (P2Y12R, 1:250); or TMEM119 (1:500). Cellswere washed three times with PBS followed by incubationwith an appropriate secondary Ab (see Supplemental Table I)diluted in blocking solution for 1 h in the dark. Negative con-trols were incubated with secondary Abs without primary Abs.Coverslips were mounted on a glass slide using ProLong GoldAntifade Reagent mounting media containing DAPI (Invitro-gen). Images were captured using a FluoView FV1000 confocallaser scanning microscope (Olympus, Center Valley, PA)equipped with blue (405 nm), green (488 nm), and red (568nm) lasers and analyzed offline using mManager/ImageJ.

Gel electrophoresis and Western blotProteins were isolated from cultured cells using RIPA Lysisand Extraction Buffer (Thermo Fisher Scientific) in the pres-ence of a Protease Inhibitor Cocktail (P8340; Millipore-Sigma)followed by quantification using the Bradford method. Protein(25 mg) was electrophoresed on a 4--12% gradient gel (Bio-RadLaboratories, Hercules, CA) and electrophoretically transferredto PVDF membranes. The membranes were blocked with 5%milk in TBST for 1 h at room temperature and incubated

ImmunoHorizons HUMAN MICROGLIA IN A DEFINED CULTURE MEDIUM 259



ww

.imm

unohorizons.org/D

ownloaded from



overnight at 4�C with one of the following primary Abs: anti-ALDH1L1 (1:500), rabbit anti-Iba1 (1:500), or anti-P2Y12R(1:250). After extensive washing with TBST, blots were incubat-ed with the appropriate HRP-conjugated secondary Ab(1:2000) for 1 h. Blots were washed, and the immune com-plexes were revealed using SuperSignal West Pico Chemilumi-nescent Substrate (Thermo Fisher Scientific) and visualizedwith the ChemiDoc XRS System (Bio-Rad Laboratories, Hercu-les, CA). Blots were striped and reprobed with anti--b-actin Ab(1:2000) as a loading control.

Time-lapse microscopyWe imaged cells at 7 d in culture using time-lapse video mi-croscopy to measure cell motility and process extension and re-traction. Cells on poly-L-lysine--coated coverslips bathed in TICmedium were placed in the humidifier chamber (37�C, 5%CO2) of a microscope incubator (Okolab H301-EC-LG-1 � 35;Okolab, Ambridge, PA) positioned on the stage of a Leica TCSSP8 confocal microscope (Leica Microsystems, Buffalo Grove,IL). Ninety-six image stacks (20 images per stack; 512 � 512pixels per image) were captured using a 405-nm diode laser ata rate of one stack every 10 min using confocal differential in-terference imaging detected by a transmitted light photomulti-plier tube with LAS X software (Leica Microsystems). For eachstack, we chose an in-focus image to construct a video (10frames/sec) of movement over time.

Real-time quantitative PCRTotal RNA was isolated using the Invitrogen PureLink RNAMini Kit (Thermo Fisher Scientific) from microglia kept in TICculture for one (day 1) or eight (day 8) days. RNA concentrationand purity were measured using a NanoDrop 2000 Spectropho-tometer (Thermo Fisher Scientific), after which 1 mg of totalRNA was used for cDNA synthesis using the High CapacitycDNA Reverse Transcriptase Kit (Thermo Fisher Scientific).Quantitative real-time PCR (qPCR) was performed using anApplied Biosystems QuantStudio 6 Flex Real-Time PCR Systemand SYBR Select Master Mix (both from Thermo Fisher Scien-tific). Transcript levels were quantified using the 2�DDCT meth-od with Gapdh as an internal control (43). The median value ofthe replicates for each sample were calculated and expressedas the cycle threshold (CT; cycle number at which each PCRreaches a predetermined fluorescence threshold, set within thelinear range of all reactions). DCT was calculated as the CT ofthe endogenous control gene (i.e., Gapdh) minus CT of the tar-get gene in each sample. The relative amount of target gene ex-pression in each sample was then calculated as 2DCT. Foldchange was calculated by dividing the value (2DCT) of the testsample by the value (2DCT) of the control sample. Primer se-quences are listed in Table I.

Phagocytosis of bacterial bioparticlesCells on coverslips bathed in TIC medium were treated with20 mg/ml pHrodo Red E. coli Bioparticle Conjugate (Thermo

Fisher Scientific) for 3 h in the heated CO2 incubator and thenwashed four times with a room-temperature extracellular solu-tion (ECS) to remove unengulfed E. coli. particles. The ECScontained (in mM): 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 10HEPES, and 10 glucose with pH adjusted to 7.4 using NaOH.The coverslips were transferred to the stage of the OlympusIX70 inverted epifluorescence microscope for imaging, inwhich four or five regions of interest per coverslip containing50--100 cells were selected for analysis. Phagocytosis was visu-alized by exciting pHrodo red with 596-nm light and measuringfluorescence at 615 nm. Corrected total cell fluorescence(CTCF) was determined according to the following equation:

CTCFðRFUÞ5whole cell signal�ðarea � background signalÞ;

where RFU is relative fluorescence unit (44). The �whole cellsignal� equals the sum of the pixel values for one cell; �area�equals the number of pixels defining the cells; and �backgroundsignal� is the average signal per pixel for a region near the cellof interest but devoid of cells.

ElectrophysiologyMicroglia were voltage-clamped at a holding potential of �60mV using a standard whole cell broken patch technique. TheECS was (in mM): 150 NaCl, 1.8 CaCl2, 1 MgCl2, 10 glucose,and 10 HEPES at a pH 7.4 with NaOH. The intracellular solu-tion was (in mM): 122 NaCl, 32 NaOH, 10 HEPES, and 10EGTA at pH 7.3. Leak-subtracted current-voltage curves weregenerated by applying two voltage ramps (90 mV, 500 ms), onein the absence of agonist (r1) and one in the presence of agonist(r2). The remainder of r1 minus r2 equaled the leak-subtractedagonist current.

Measurement of changes in intracellular free [Ca21]Human microglia grown on 13-mm collagen-coated glass cover-slips were incubated for 30 min in ECS supplemented with 5mM Fluo-4 AM and 0.02% (w/v) Pluronic F-127 at room tem-perature, washed free of the reagents, and left for 30 min at37�C to allow de-esterification to occur to completion. Singlecoverslips were then transferred to the 14-mm microwell of aMatTek Co (Ashland, MA) glass-bottom culture dish containingECS and positioned on the stage of the Olympus IX70 invertedmicroscope. Intracellular fluorescence was visualized (excita-tion 494 nm, emission 514 nm) using the 20� objective andcaptured using the digital CMOS camera. Agonists were appliedby pipette directly into the bath chamber to give the desiredextracellular drug concentration. Basal fluorescence was ob-tained in normal ECS for 30 s, then microglia were stimulatedwith 5 mM ATP or 300 mM BzATP for 3 min. Images werecaptured at a rate of 1 frame/s using mManager/ImageJ and an-alyzed offline. Each image contained 20--40 cells that were in-dividually analyzed, and each experiment was repeated at least10 times. Data traces show the average fold change in fluores-cence in arbitrary units over baseline after background subtrac-tion for single cells.




ww

.imm

unohorizons.org/D

ownloaded from


ELISAMicroglia seeded in a 96-well plate at a concentration of 3 �104 cells per well were primed with LPS (10 mg/ml) for 3 h inTIC-defined medium. Cells were subsequently stimulated with5 mM ATP for 30 min at 37�C. Supernatant was collected andcentrifuged at 3000 � g for 5 min at 4�C. Cells were lysed withchilled lysis buffer (100 mM Tris [pH 7.4], 150 mM NaCl,1 mM EGTA, 1 mM EDTA, 1% Triton X-100, and protease in-hibitor mixture) and cell lysates were centrifuged at 13,000 � gfor 5 min at 4�C. The pellet was discarded, and supernatantswere collected and kept frozen at �80�C until use for determi-nations of cytosolic and extracellular cytokines. We measuredIL-1b using the Invitrogen IL-1b Human Uncoated ELISA Kit(catalog no. 887261-88; Thermo Fisher Scientific), IL-18 usingthe Human Total IL-18/IL-1F4 Quantikine ELISA Kit (catalogno. DL180; R&D Systems, Minneapolis, MN), and TNF-a usingthe Invitrogen Human TNF-a Uncoated ELISA Kit (catalog no.88-7346-88; Thermo Fisher Scientific). Developed plates wereread on a Biotek Neo Alpha Plate Reader with Gen5 Software(Biotek Instruments, Winooski, VT). The concentration of IL-1b, IL-18, and TNF-a in samples was determined by compari-son with a standard curve generated using different concentra-tions of the target cytokines.

LDH assayCytotoxicity was measured using a CytoTox 96 Non-Radioac-tive Cytotoxicity Assay, a colorimetric assay (Promega, Madi-son, WI). Microglia were seeded in 96-well plates at density of3 � 104 cells per well. Twenty-four hours later, cells were ex-posed to LPS for 3 h at 37�C followed by stimulation with 5mM ATP for an additional 30 min. Untreated cells serving asnegative controls were treated similarly but were not exposedto ATP. Positive controls were incubated in 1% lysis buffer pro-vided with the kit. Supernatants were collected and centrifugedat 5000 � g for 5 min to remove solid debris. Then, 50-ml aliquots of the resulting supernatants were combined with50-ml aliquots of the CytoTox 96 reagent in the wells of a sepa-rate 96-well plate and left to incubate for 30 min at room tem-perature, after which, the reaction was terminated by additionof 50 ml of stop solution. Absorbance was measured at 490 nm

on the Biotek Plate Reader. Percentage cytotoxicity was calcu-lated as described in the manufacturer�s instructions.

ROS formationROS formation was measured using OxiSelect IntracellularROS Assay Kit (Cell Biolabs, San Diego, CA). Human microgliaon coverslips were incubated in a 1:20 solution of 2�,70-dichloro-fluorescin diacetate in DMEM for 45 min at 37�C followed bythree washes with PBS to remove unbounded dye. These cellswere then incubated with or without LPS in TIC media for 1h in a heated CO2 incubator before imaging using 488/510 exci-tation/emission wavelengths on the stage of the epifluorescencemicroscope. In experiments using NAC, cells were incubated inthe presence of the antioxidant (40 mM) for 30 min and thenwashed to remove the drug before introducing LPS or ATP.

StatisticsData were analyzed using Prism 8 software (GraphPad, San Di-ego, CA), and results are shown as mean 6 SEM. One-way AN-OVA or Student t test was used for statistical analysis withsignificant difference at p < 0.05. The level of significance is in-dicated in the figures as follows: *p < 0.05, ***p < 0.001, and****p < 0.0001.

RESULTS

Previous studies of primary human microglia used culture me-dia containing FBS to maintain cells in vitro (14, 34, 36, 37, 45).We isolated microglia from tissue resected during surgery forcancer (n 5 51), cavernous malformation (n 5 1), epilepsy (n 55), infarct (n 5 2), and trauma (n 5 3) from seven differentbrain regions (frontal, parietal, occipital, and temporal lobes;and caudate, cerebellum, and thalamus). The patient populationconsisted of 29 males and 32 females of ages ranging from2--74 y old. Our protocol differs from past attempts by others inthat we cultured the microglia in a serum-free TIC medium de-fined by three key components: TGF-b, IL-34, and cholesterol(41). Tissue processing for cell isolation began within 15--30min of resection, and single cells were plated no more than 3h later. Our dissociation protocol is fully described in the Mate-rials and Methods. Briefly, samples of brain parenchyma

TABLE I. Primer Sequences for qPCR

Gene Symbol Forward Sequence (50-30) Reverse Sequence (50-30)

IL-1b CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG

CCL2 AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGG

MRC1 AGCCAACACCAGCTCCTCAAGA CAAAACGCTCGCGCATTGTCCA

TYROBP TGGTGCTGACAGTGCTCATTGC CTGATAAGGCGACTCGGTCTCA

TMEM2 GGAATAGGACTGACCTTTGCCAG TTCTGACCACCCTGAAAGCCGT

P2RY12 TGCCAAACTGGGAACAGGACCA TGGTGGTCTTCTGGTAGCGATC

TMEM119 AGCACGGACTCTCTCTTCCAG GTGCCCCCAGGACCAGTTC

ADGRG1 CTCTCCTAAGAGGTTCTCTCCA CTACAACAGGCCAGCAATCTA

GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA

CSF1R GCTGCCTTACAACGAGAAGTGG CATCCTCCTTGCCCAGACCAAA

P2RX7 QIAGEN RT2 qPCR Primary Assay for Human P2RX7 (catalog no. PPZ03286A-200)




ww

.imm

unohorizons.org/D

ownloaded from


(0.2--12.0 g; median 5 400 mg) were chopped into �1 mm3

chunks that were incubated for 25 min at 37� in a divalent-freemedium containing papain and DNase. Single cells were thendispersed by repeated passage through the openings of threefire-polished Pasteur pipettes with diminishing tip diameters,and the remaining fragments of undigested tissue were trappedby a 40-mm cell strainer. The flow-through was processed bydensity gradient centrifugation to remove myelin, RBCs werelysed, and microglia were isolated by positive magnetic selec-tion using nanosized superparamagnetic microbeads conjugatedto a CD11b Ab (38). The purified CD11b1 cells were pelleted,resuspended in TIC medium, and grown on either 96-wellplates, 35-mm tissue culture dishes, or 13-mm glass coverslipscoated with poly-L-lysine for genomic, immunocytochemical,and functional studies. We did not extensively investigate theidentity of cells in the flow-through fraction of the magnetic se-lection protocol (i.e., the CD11b� cells); nevertheless, immuno-cytochemistry performed at 7 d in culture suggests a highpercentage of viable GFAP1 astrocytes (Supplemental Fig. 1).

Yield and viability of CD11b1 cellsWe counted cells before and after magnetic bead selection todetermine yields. Total cell count before selection varied withdonor and disease, but from a sample of 31 surgeries (27 tumorand 4 epilepsy), they averaged 38,007 6 12,493 cells/mg of tis-sue. Of these, 15.2 6 1.8% were retained by the MACS column,with average yields of 4,325 6 884 CD11b1 cells per/mg of tis-sue, thus identifying a population of myeloid cells in the sus-pension. In keeping with published reports of high densities ofimmune cells in glioblastoma multiforme (46), samples takenfrom tumor cores contained a greater percentage (p < 0.05) ofCD11b1 cells (15.4 6 2.1%; n 5 13) by comparison with otherdonor samples (10.8 6 2.2%; n 5 4).

To quantify viability, we loaded freshly isolated CD11b1

cells with calcein and then incubated them in a bath solutioncontaining propidium iodide (Fig. 1A). We expected live cells toretain calcein and exclude propidium, which was the case for92.8 6 1.1% of the CD11b1 cells studied immediately followingisolation (n 5 15; Fig. 1B).

Cultured CD11b1 cells are ramified, extend and retractprocesses, and express microglia-specific markersCD11b1 cells were spherical when initially isolated (for exam-ple, see Fig. 1A) and flattened in the first few hours of platingas they adhered to the poly-L-lysine-coated surfaces. They be-gan to extend processes over the course of 2 to 3 d in culture,achieved a ramified morphology by 7 d, and continued to thrivefor greater than 21 d postplating (Fig. 1C, 1D). We did not at-tempt to maintain cells for longer than that, and all of the histo-logical, biochemical, qPCR, and functional studies reported inthis work were performed on cells grown in vitro for 7--14 d,except where noted.

Mature CD11b1 cells showed one of two morphologies.Most cells (89.9 6 2.4%; n 5 27) had rod-shaped somas and

mobile radial extensions at 14 d in culture, typical of microgliain situ in the absence of disease. We counted processes for 46of these cells from four different cultures and found that theaverage cell had 5.3 6 0.3 primary extensions that often splitinto two or more smaller branches (Fig. 1D, 1E). A much small-er fraction had larger and flatter somas with shorter and fatterextensions typical of activated cells (15, 47, 48). These cellswere typically seen in older cultures ($14 d in culture) or

FIGURE 1. Viable ramified microglia in TIC-culture.

(A) CD11b1 cells were incubated in Calcein AM and propidium iodide

(PI) immediately following purification by magnetic selection. When vi-

sualized by fluorescence microscopy, viable cells retain calcein (green)

and exclude PI (red). (B) Quantification of data like those shown in (A).

Each data point indicates the percentage of live (calcein1/PI�) and

dead (calcein�/PI1) cells in 1 of 15 fields of view. Box designates the 25

and 75% quartiles. The dotted lines are the median values. (C and D)

Photomicrographs of two samples of CD11b1 cells maintained on

poly-L-lysine--coated glass coverslips in TIC medium for 21 days shown

at 10 (C) and 40� (D) original magnifications. (E) Confocal image of mi-

croglia obtained close to the plane of the coverslip showing the sec-

ondary branches. The ramified morphology suggests a microglia

lineage. ****p < 0.0001.




ww

.imm

unohorizons.org/D

ownloaded from



when plating densities were high enough to force multiple cell-to-cell contacts. Nevertheless, these less common cells ex-pressed microglia-specific markers and, like their more com-monly seen rod-shaped counterparts, continuously surveyedthe environment (see below).

We used time-lapse microscopy to determine whether ourcultured cells showed the characteristic sequence of processextension and retraction that defines active surveillance in situ(49). We recorded movement over the course of 12 h (n 5 4)and found that cells tended to sit in place and at a distancefrom their neighbors, which reflects the typical tiling behaviorseen for microglia in the brain (2). Further, we saw a continu-ous pattern of branch extension and retraction as cells ap-peared to sample their immediate environment, includingcontacts with neighboring cells (Supplemental Video 1). Specifi-cally, we found that branches momentarily inspected theirneighbor�s membrane, retracted, then extended in the same ordifferent direction. Importantly, all of CD11b1 cells showed ac-tive surveillance regardless of their morphology, suggesting acommon lineage.

Next, we stained CD11b1 cells with Abs for cell-specific sig-nature proteins and visualized the results using confocal micros-copy. Immunocytochemistry confirmed that all CD11b1 cellswere positive for the microglial proteins Iba1, TMEM119 (50),and P2Y12R (51) (Fig. 2A, 2B) and negative for astrocyte(ALDH1L1), neuronal (NeuN), and oligodendrocyte (MBP)markers (Supplemental Fig. 2A--D) with purity close to 100%.We confirmed these results using Western blot analysis to mea-sure protein levels (Supplemental Fig. 2E) and found that gelsloaded with whole brain extracts showed bands for Iba1,P2Y12R, and ALDH1L1, as expected for a mix of cell types. Incontrast, the purified CD11b1 fraction expressed only the pro-teins unique to microglia (P2Y12R and Iba1), again demonstrat-ing that this fraction contains a pure population of myeloid cells.

Positive staining for P2Y12R was particularly important.Most of our tissue samples came from tumor resections thatmay contain large numbers of CD11b1 nonparenchymal macro-phages and CNS-resident microglia (46, 52). However, neitherperipheral blood monocytes nor nonparenchymal macrophagesexpress P2Y12R (51, 53, 54) or TMEM119 (50). Therefore, thefact that cells in the CD11b1 fraction are P2Y12R1/TMEM1191

and AL1DH1�/NeuN�/MBP� suggests a microglial lineage.

Microglia do not proliferate in TIC mediumMicroglia populate the CNS during early embryogenesis, inwhich they form a stable population of long-lived cells (55). Inhumans, the average lifespan is reported to be 4.2 y, with �2%of the population proliferating at any one time (56). In contrast,microglia cultured in the presence of serum show enhancedproliferation (34, 41). We used an Ab against the Ki-67, a pro-tein present in dividing cells (57), to determine the growth frac-tion of the total cell population of microglia grown in TICmedium lacking FBS. We stained microglia maintained for 7 din TIC medium with or without 10% FBS with DAPI and Iba1to count cells, costained them with Ki-67 to assess proliferation,then viewed the cells using fluorescence microscopy (Fig. 3A,3B). Cultures lacking serum showed a smaller percentage of Ki-671 cells (Fig. 3C). Remarkably, the percentage of proliferatingcells grown in TIC medium without FBS (1.37 6 0.3%, mea-sured from 20 fields of view from four different cultures) was aclose match to the percentage of proliferating microglia inintact adult human brain (1.38%; see Ref. 58). Thus, unlike pri-mary microglia that continuously and rapidly divide in serum-containing media (34, 41), microglia in TIC medium mimic

FIGURE 2. CD11b1 cells show positive staining for two specific mi-

croglial markers.

CD11b1 cells purified by positive selection were costained with a nu-

clear stain (DAPI) to count cells, a positive marker of cells of myeloid

origin (Iba1), and one of two positive markers for microglia [P2Y12R (A)

or TMEM119 (B)]. In both cases, composite images [rightmost panels of

(A) and (B)] show near complete overlap of staining for Iba1 and the mi-

croglial markers.

FIGURE 3. Microglia do not proliferate in TIC medium.

Cultures incubated in the absence of FBS (A) show fewer cells and less

Ki-67 staining than those incubated in the presence of 10% FBS (B). (C)

Percentage of Ki-671 cells in the absence (�FBS) and presence (1FBS)

of serum. The percentage was calculated by dividing the number of

cells showing positive staining for Ki-67 by the number of cells stained

by DAPI. ****p < 0.0001.




ww

.imm

unohorizons.org/D

ownloaded from





conditions in healthy human adult brains, in which they showlimited rates of proliferation (59).

Gene expression suggests that microglia assume anoninflammatory state in TIC cultureWe used qPCR to measure gene expression in TIC-culturedmicroglia for two reasons. First, all of our brain samples camefrom patients suffering from trauma, epilepsy, or cancer, dis-ease states in which in situ microglia often adopt an amoeboidmorphology typical of activated microglia and show high levelsof expression of proinflammatory markers (48, 60--62). Wewondered whether culturing human microglia in TIC mediumwould maintain these cells in a state of classical activation. Sec-ond, tissue culture removes microglia from the native environ-ment provided by the brain parenchyma and, in doing so,denies them access to essential molecular signals that help de-termine their phenotype; the result is a loss of homeostatic, de-velopmental, and disease-associated genes (31, 41, 63).Therefore, we measured the level of gene transcripts of select-ed markers of homeostasis, inflammation, and phagocytosis onthe first and eighth days in culture (Fig. 4). In keeping withpublished results of studies on mice (41), we saw downregula-tion of three (Adgrg1, P2ry12, and Csfr1) of the four homeostaticgenes that we probed. The exception was Tmem119, a gene thatencodes a protein of unknown function in microglia (50). Wealso saw downregulation of genes associated with classical(Ccl2 and IL-1b) and alternative (Arg1) activation and upregula-tion of genes associated with phagocytosis and tissue repair(Tyrobp, Trem2, Mrc1). Taken together, these data suggest thatmicroglia revert to a noninflammatory/phagocytic phenotypewhen maintained in TIC medium for 8 d. This reversion pre-sumably occurs because the TIC medium lacks the DAMPS/pathogen-associated molecular patterns (PAMPs) responsiblefor the proinflammatory state in intact diseased brain. Rather,

the formulation seems to more closely mimic conditions in ahealthy brain.

Isolated microglia phagocytose fluorescence beadsOur gene expression analysis suggests that microglia adopt aphagocytic phenotype after 8 d in culture. To confirm this hy-pothesis, we measured the phagocytic capability using pHrodoRed E. coli Bioparticle Conjugates, which strongly fluoresce inthe acidic environment of the phagolysosome. We used time-lapse confocal microscopy to monitor uptake over the course of5 h and saw significant accumulation of red bioparticles by thesurveilling microglia (5A, Fig. 5B; Supplemental Video 2). To

FIGURE 4. Gene expression of human microglia in TIC-cultures.

Tissue sample from a glioblastoma patient. The graph shows the log2-

fold change in transcripts for 10 genes from cells maintained 8 d in cul-

ture by comparison with cells maintained 1 d in culture.

FIGURE 5. TIC-culturedmicrogliaphagocytosis intheabsenceofserum.

(A) Confocal images captured 10 (left panel) and 310 (right panel) min

after addition of pHrodo bioparticles (20 mg/ml) to TIC-cultured micro-

glia. Images were extracted from Supplemental Video 2. (B) Microglia

show extensive phagocytosis of pHrodo-conjugated E. coli biopar-

ticles, seen as red fluorescence in the absence of serum (left panel). In

a separate experiment, addition of ATP (5 mM) results in less phagocy-

tosis (right panel). (C) Phagocytosis is quantified as the CTFC in RFUs

(see Materials and Methods for details) for cells incubated in the ab-

sence of serum (control) and the presence of 5 mM ATP, 20 mM of a

P2X7R antagonist (A804598), or both (ATP 1 A804598). ****p <

0.0001.




ww

.imm

unohorizons.org/D

ownloaded from




quantify uptake, we incubated cells in the presence of 20 mg/mlof the E. coli bioparticles for 3 h and then vigorously washedthem to remove unengulfed fragments. When visualized on thestage of an epifluorescence microscope, we saw significantphagocytosis in 84.8 6 2.8% of cells in 22 separate fields ofview. This finding is a stark contrast to the results of Bohlenet al. (41), who saw no phagocytosis in mouse microglia in theabsence of serum. Instead, they saw robust engulfment onlyupon addition of FBS, which is thought to promote phagocyto-sis either by opsonizing debris (64) or providing essential regu-latory factors (41). To determine the effect of serum onphagocytosis by human microglia, we incubated donor-matchedmicroglia maintained 7 d in vitro for an additional 24 h in TICmedium with or without 10% FBS. We then added pHrodo bio-particles to the incubation media and measured the CTCF from151 cells (80 and 71 cells in the absence or presence of FBS, re-spectively) 5 h later. We found that cells incubated in FBS hada 3.2-fold greater CTCF by comparison with cells measured inthe absence of serum, thus confirming the hypothesis that se-rum facilitates phagocytosis.

Next, we incubated the cells in ATP (5 mM), a purinergicagonist that prevents phagocytosis in a range of immune cellsby binding to P2X7 receptors (P2X7Rs) (65), for 4 h. In the ab-sence of agonist, P2X7Rs act as scavenger receptors for innatephagocytosis, the result of an interaction of its intracellular Cterminus and actin--nonmuscle myosin, a component of the cellcytoskeleton. Addition of ATP causes a conformational changethat dissociates myosin from the receptor (66), leading to lossof innate phagocytosis (67). We found that addition of ATP(5 mM) decreased both the percentage of human microglia dis-playing evidence of phagocytosis (18.4 6 4.4%; n 5 20) and theCTCF (Fig. 5C), a measure of the amount of engulfment percell. To determine whether the decrease in CTCF resultedfrom activation of P2X7Rs, we preincubated cells in A804598, apotent and selective P2X7R antagonist (68). On its own,A804598 caused a 50% reduction in phagocytosis (Fig. 5C).However, it did not block the ability of ATP to further reducephagocytosis. Like many P2X7R antagonists, A804598 binds toa novel binding pocket that is different from that which bindsATP (69). Our finding that a selective P2X7R antagonist inde-pendently reduces engulfment lends support to the hypothesisthat P2X7Rs are capable of modulating phagocytosis in primaryhuman microglia (34). It also suggests that occupation of the al-losteric antagonist binding site is capable of initiating a signifi-cant but muted effect on the cell cytoskeleton and phagocytosisby comparison with what happens when the orthosteric site isoccupied by ATP. More importantly, our data support the hy-pothesis that ATP is a DAMP that switches microglia from aprophagocytic to a proinflammatory phenotype (70, 71).

Cultured microglia are capable of adopting aproinflammatory phenotypeThe ability of ATP to block phagocytosis shows that TIC-cul-tured human microglia are capable of responding to external

signals with a change in phenotype. To further explore this hy-pothesis, we sought to determine whether microglia in TIC me-dium change morphology, gene expression, and synthesis andrelease of proinflammatory cytokines when challenged with aPAMP. Homeostatic microglia in situ are typically ramifiedwith characteristic small soma and distal mobile arborizations,accurately describing the dominate cell morphology seen formost of the cells cultured in the TIC medium in the absence ofpathogen (for examples, see Fig. 1B--D). Microglia in the brainretract their processes and adopt a reactive phenotype capableof releasing proinflammatory cytokines when challenged with aPAMP (72). To determine whether PAMPs activate TIC-cul-tured human microglia, we incubated cells in LPS (10 mg/ml inTIC medium) and then imaged cells 24 h later. As expected,cultured microglia showed a ramified morphology character-ized by a small cell soma and extensive distal arborizations inthe absence of LPS (Fig. 6A). In contrast, TIC-cultured micro-glia incubated in LPS adopted a more compact, amoeboid struc-ture after 24 h, with fewer and shorter arborizations and largercell somas (Fig. 6B), which is generally taken as a sign of acti-vation. We counted the number of amoeboid cells in culturesmaintained in the absence or presence of LPS and found a sig-nificantly higher percentage of these amoeboid-shaped cells inthe presence of LPS than in its absence (Fig. 6C).

This change in morphology suggests that the cells have theability to convert to an activated state. If so, then they should becapable of synthesizing and releasing proinflammatory cytokinesin response to introduction of a DAMP such as ATP (73). Tothis end, we sought to directly confirm the hypothesis that TIC-cultured human microglia express functional ATP receptors us-ing electrophysiology and measurement of intracellular freeCa21 ([Ca21]i). We applied ATP (5 mM) to a voltage-clampedmicroglia (holding voltage 5 �60 mV) and recorded a cation-nonselective inward current in the presence of the agonist (Fig.6D). Next, we measured the expected change in the concentra-tion of [Ca21]i that typically accompanies activation of puriner-gic receptors in mouse (74--77) and human (34) microglia. Wefound that both ATP (5 mM) and the higher affinity agonist,BzATP (300 mM), caused immediate and substantial changes in[Ca21]i that remained elevated for the length of the drug appli-cation (Fig. 6E). We then preincubated the cells for 5 min in theP2X7R antagonist A804598 (20 mM) and found that it complete-ly blocked the ability of ATP and BzATP to increase [Ca21]i, ef-fectively ruling out the contribution of other types of purinergicreceptors in mediating the response (Fig. 6E). We did not at-tempt to further characterize the ATP response, as this is thesubject of another study. More importantly, the ability of TIC-cultured human microglia to respond to a DAMP with an in-ward current and a change in [Ca21]i demonstrates that thesecells express functional P2X7Rs that are gated by ATP.

Next, we incubated microglia for 6 h in either ECS or ECSplus LPS to see if the presence of this PAMP results in upregu-lation of inflammatory genes. We isolated total RNA and gener-ated cDNA by reverse transcription and then performed qPCRfor genes encoding homeostatic, proinflammatory, and anti-




ww

.imm

unohorizons.org/D

ownloaded from


inflammatory proteins. We found that LPS treatment resultedin upregulation of the proinflammatory genes Il-1b, P2rx7, andCcl2 and a slight downregulation of the anti-inflammatory gene,Mrc-1 (Fig. 6F). We saw only small effects on the transcriptnumber of the homeostatic genes, P2ry12 and Tmem119. Fur-thermore, in keeping with our results that show upregulationof P2rx7, we measured a large increase in the magnitude of theagonist/P2X7R--evoked change in [Ca21]i in cells exposed toLPS by comparison with LPS-naive cells (Fig. 6G). Taken

together, the morphological, genomic, and functional resultsdemonstrate the ability of TIC-cultured microglia to transitionto a proinflammatory state in the presence of LPS, a hallmarkproperty of in situ microglia in human brain.

To determine whether the upregulation of proinflammatorygenes is physiologically significant, we measured the productionand release of IL-1b in TIC-cultured microglia exposed to aPAMP (i.e., LPS) and subsequently challenged by exposure to aDAMP (i.e., ATP). We incubated the cells in 10 mg/ml LPS for

FIGURE 6. LPS induces a proinflammatory phenotype in TIC-cultured human microglia.

Microglia were cultured for 7 d in TIC medium before introduction of LPS (10 mg/ml) for 24 h. (A) Naive microglia show a ramified morphology with

rod-shaped cell bodies and radial extensions. (B) Cells incubated for 24 h in LPS show larger somas and fewer extensions than control cells, sug-

gesting that LPS has induced a proinflammatory phenotype. (C) The graph plots the number of amoeboid cells divided by the number of total cells

� 100%. LPS increased the percentage of cells adopting an amoeboid shape. (D) ATP (5 mM) evokes inward current in a voltage-clamped microglia

held at -60mV. This resulting current reverses near 0 mV demonstrating its cation-nonselective nature (inset). (E) ATP (5 mM; n 5 53 cells) and

BzATP (300 mM; n 5 28) increased [Ca21]i, seen as a change in background-subtracted intracellular Fluo-4 fluorescence measured in AU. The in-

crease in [Ca21]i was blocked by the P2X7R antagonist A804598 (20 mM; n 5 31). The cyan bar indicates the period of agonist application. (F) qPCR

data from cells treated with LPS for 6 h. LPS caused upregulation of proinflammatory transcripts. (G) Incubation in LPS for 6 h facilitated the change

in [Ca21]i caused by ATP (5 mM, n 5 39) and BzATP (300 mM, n 5 139). ***p < 0.001, ****p < 0.0001.




ww

.imm

unohorizons.org/D

ownloaded from


4 h and measured a significant increase in intracellular IL-1bproduction using an ELISA that recognizes both the immatureand mature forms of the cytokine (Fig. 7A). However, we sawno change in the concentration of IL-1b in the solution bathingthe cell (Fig. 7B), suggesting that LPS stimulates production ofIL-1b but does not trigger its release. These results are clearlydifferent from data obtained from primary human microgliacultured in serum, which failed to show LPS-stimulated IL-1bproduction (34).

Next, we stimulated LPS-challenged microglia with ATP (5mM), which evokes cytokine maturation and release frommouse microglia (78). We bathed LPS-stimulated TIC-culturedmicroglia for 30 min in 5 mM ATP and then measured the con-centration of IL-1b in the cytoplasmic and extracellular frac-tions using the ELISA. We found a significant increase in theconcentration of extracellular IL-1b in cells exposed to boththe PAMP and the DAMP (Fig. 7B), signaling release. In keep-ing with published results from mouse microglia (78), intracel-lular IL-1b (Fig. 7A) was unchanged following application ofATP and LPS by comparison with LPS alone, suggesting that

the LPS-stimulated production of IL-1b outpaces ATP-evokedrelease.

We also looked at the ability of TIC-cultured microglia toproduce and release other proinflammatory cytokines, includingTNF-a and IL-18. In agreement with published results ofmouse microglia (79), we found the LPS alone stimulated re-lease of TNF-a (Fig. 7C). In contrast, LPS and ATP failed tostimulate IL-18 release (Fig. 7D). Importantly, neither LPS norATP caused release of lactate dehydrogenase (LDH), showingthat the release of IL-1b and TNF-a by DAMPs/PAMPs didnot result from cell lysis (Fig. 7E).

Taken together, the ability of a PAMP and DAMP to con-vert cultured microglia from phagocytic to proinflammatoryphenotypes demonstrates the ability of these cells to adapt tochanges in their environment and suggests that microglia cul-tured in TIC are appropriate for studying neuroinflammation.

Intracellular ROS generation upon LPS treatmentFinally, microglia are implicated as a causative factor in a num-ber of neurodegenerative disorders, in part because they are asource of ROS that underlie neuroinflammation and oxidativestress (80, 81). To determine whether TIC-cultured human mi-croglia produce ROS in response to introduction of a PAMP,FIGURE 7. LPS stimulates production of proinflammatory cytokines.

(A) LPS (10 mg/ml, 4 h) but not ATP (5 mM, 0.5 h) results in production

of intracellular IL-1b. (B) ATP (5 mM) evokes IL-1b release after LPS

stimulation. (C) LPS stimulates TNF-a release in the absence of a

DAMP. (D) Neither LPS nor ATP evoke release of IL-18. (E) The fact that

neither LPS nor ATP cause significant LDH release demonstrates cell vi-

ability. The y-axis shows percentage LDH release by comparison with

that caused by the positive control. *p < 0.05, ****p < 0.0001, #p <

0.01, significant difference from control.

FIGURE 8. LPS and ATP stimulate ROS production.

TIC-cultured human microglia show a baseline production of ROS (A)

that is enhanced by a 1-h incubation in LPS (B). (C) ROS production was

measured as CTCF in RFUs for control cells (control) and those incubat-

ed alone or in combination with LPS, NAC, and ATP (n 5 43--60 for each

drug paradigm). LPS (10 mg/ml) and ATP (5 mM) were applied for 1 h to

stimulate ROS production; in both cases, the stimulation is prevented by

preincubation with NAC (40 mM) for 30 min. Relevant significant differ-

ences between groups are designated with letters as follows: �a� indi-

cates a significant difference from control. �b� indicates significant

difference from LPS. �c� indicates a significant difference from ATP.




ww

.imm

unohorizons.org/D

ownloaded from


we incubated cells for 1 h with LPS and then visualized intra-cellular ROS formation using a 20,70-dichlorofluorescin diacetatefluorescence assay. We found that LPS increased intracellularfluorescence (Fig. 8A, 8B) and that this effect was blocked bypreincubation with the potent antioxidant free-radical scaven-ger, NAC (40 mM; Fig. 8C). Fluorescence also increased afterexposure to ATP (5 mM) in the absence but not the presenceof NAC (Fig. 8C).

Together, these results demonstrate that acutely activatedhuman microglia cultured in TIC medium are capable of pro-duction and release of proinflammatory cytokines and ROS, asexpected for critical components of the innate immuneresponse.

DISCUSSION

Efforts to understand microglia function in mechanistic detailhave been hindered by the lack of an in vitro model that reca-pitulates the essential properties of mature microglia in the in-tact CNS. Murine models are vitally informative but do notfully mimic the human phenotype (21, 22, 82), whereas humanstudies typically use culture media containing calf serum, anunnatural component of the brain milieu that adversely affectsfunction (14, 34, 36, 37). We investigated the use of freshly iso-lated primary human microglia cultured in a defined mediumcontaining three essential factors: TGF-b, IL-34, and cholester-ol (41). TGF-b and CSF-1 are secreted by astrocytes (83) andpromote microglia maturation and survival (84, 85). However,CSF-1 shows poor species cross-reactivity, and therefore, fol-lowing the lead of Bohlen et al. (41), we used IL-34 in place ofCSF-1 because it activates the CSF-1 receptor and promotessurvival in a range of species. Cholesterol is included in the for-mulation to compensate for the relatively low level of cholester-ol biosynthetic genes in mature microglia by comparison withastrocytes and oligodendrocytes (41, 83). When cultured in thismedium, human microglia adopted a ramified morphology withradial extensions that continuously monitored their surround-ings. Most importantly, they recapitulated two essential butpreviously problematic microglial properties; unlike their mu-rine counterparts (41), they actively phagocytosed componentsof bacterial cell walls in the absence of serum, and unlike hu-man cells cultured in serum (34, 86), they responded to thepresence of proinflammatory signals by processing and releas-ing cytokines and ROS.

We used a commercial immunomagnetic protocol to isolatea relatively pure population of CD11b1 myeloid cells (38). De-spite reports that white matter contains significantly more mi-croglia than gray matter (87), we consistently failed to obtaingood yields from human white matter using the methods out-lined in this study. One possible explanation, noted by the man-ufacturer, is that the high myelin content of white mattermight have interfered with the ability of the CD11b Ab--coatedmicrobeads to bind their Ag. We do not believe that this is thecase because we saw no visual evidence of myelin remaining in

our cell pellet after gradient centrifugation, a step that precedesintroduction of the Ab-coated microbeads. Regardless, in casesof samples containing both gray and white matter (typical ofsamples obtained from lobotomies and trauma), we typicallydiscarded white matter before beginning enzymatic dissocia-tion. In light of the limited availability of fresh brain samples,we continue to refine our isolation technique with the hope ofincluding white matter in future studies. On a similar note, weobtained tissue samples from head trauma patients on two sep-arate occasions and were able to isolate viable microglia. How-ever, these cells typically died for unknown reasons afterapproximately five to seven days in culture and they are not in-cluded in the data set of functional assays reported in thisstudy. Finally, although regional variations in microglia densityare reported in the brain (88), we did not attempt to quantifythese differences because the limited number of surgical sam-ples included in the present report precluded reliable use ofstatistics to identify region-dependent differences in cellnumbers.

Our average yield of 4.1 � 106 viable CD11b1 cells per prep-aration was higher than previously published reports (37, 38).This may stem from the fact that we used fresh brain samplesthat were processed within 30 min of resection, thus increasingviability, or simply because we started with a larger amount oftissue (average weight equaled 1.4 6 0.3 g; n 5 52). Surprising-ly, we found no evidence of contamination of the CD11b1 frac-tion by nonparenchymal monocytes/macrophages, despite thefact that glioblastoma tumor cores and their surrounding tis-sues, which constituted the largest set of brain samples used inthis study, are expected to contain a great number of these cells(46, 89--91). We used microglia-specific markers and immuno-cytochemistry to identify lineage after seven days in cultureand saw an almost complete overlap in staining for Iba1, amarker of myeloid cells, and P2Y12R and TMEM119, two spe-cific markers of microglia in brain. We do not know why ourcultures lacked tumor-associated macrophages (i.e., Iba11/P2Y12R�/TMEM119� cells), although two hypotheses come tomind. First, the TIC medium may not be conducive to long-term viability of macrophages because it lacks critical growthfactors typically supplied by serum when these cells are grownin culture (92). Second, the infiltrating monocyte/macrophagesmay adopt a microglial phenotype in situ in response to the re-lease of GM-CSF and IL-34 from the astrocytic tumors (93)that includes the ability to express microglia-specific markers.However, experiments using transgenic mice and an optic ner-ve--crush model to study infiltrating monocytes in the CNS ar-gue against the later hypothesis, as only the resident microgliawere found to express TMEM119 (94). Similar results werealso found using mouse models of glioblastoma (95).

Although most of the cultured cells adopted a ramified mor-phology with rod or spindle shaped somas and thin radial ex-tensions, we also saw a smaller percentage (�15%) of flattercells with wider extensions. Like the longer, thinner cells, theflatter cells showed positive staining for microglial markers andprocess extension and retraction typical of active surveillance,




ww

.imm

unohorizons.org/D

ownloaded from


suggesting a common lineage. A mixed morphology might beexpected. In situ, microglia adopt a diverse range of phenotypesthat vary with age, location, sex, and the absence or presenceof disease (31). Furthermore, both induced pluripotent stemcell--derived human microglia (29) and the HMC3 cell line (96)are capable of adopting a range of shapes much like the prima-ry cell cultures described in this study.

The use of TIC-cultured primary human microglia presentstwo distinct advantages over human microglia cultured in se-rum. First, similar to in situ microglia in a healthy brain, theyshow limited proliferation. FBS typically causes a dramatic in-crease in proliferation of cultured microglia (34, 41) and in-creases expression of genes related to DNA replication (41),although this is not always the case (97). Using TIC medium,we saw a rate of proliferation that closely matched that of mi-croglia in an intact brain. In future studies, it will be interestingto look more closely at the transcriptomes of microglia culturedin the presence and absence of FBS to further probe the effectof serum on microglial function. Second, the results of our geneexpression analysis suggest that TIC-cultured microglia adoptan anti-inflammatory M0-like phenotype by eight days in cul-ture. We performed qPCR experiments at two time points. Wechose day 1 to avoid the immediate but transitory changes ingene expression that result from the cell isolation protocols(41), and we chose day 8 to represent the period of time inwhich we performed our functional analyses. By comparisonwith day 1, we found downregulation of genes involved in ho-meostasis, including the microglia-specific marker P2Y12R. Thefact that microglia downregulate homeostatic genes is not sur-prising, as others reported similar results (41, 54, 63). Thus,whereas the use of TIC medium is a clear step forward, addi-tional refinement is required. That said, immunocytochemistryand Western blot analysis show that TIC-cultured microgliastill express significant amounts of P2Y12R, thus demonstratingthat the ability to make this homeostatic protein is not lost inculture. We also measured downregulation of inflammatorygenes and upregulation of genes associated with phagocytosis.These results are in accordance with our findings that TIC-cul-tured microglia show a ramified morphology, actively surveytheir surroundings, and show a low rate of proliferation, all ofwhich support the conclusion that the cells have adopted ananti-inflammatory M0-like phenotype typical of a healthy brain.Furthermore, the ability of DAMPs and PAMPs to induce achange in morphology, a decrease in phagocytosis, and in-creased synthesis and release of proinflammatory cytokinesdemonstrates the ability of these microglia to respond to exter-nal signals. Plasticity is a hallmark property of microglia in theintact brain (98) and an attribute that is well-represented inour cultured cells.

In closing, we find that culturing primary human microgliain a serum-free defined medium avoids many of the problemscaused by inclusion of FBS, thus providing a platform for thestudy of the downstream signaling pathways that underlie sur-veillance, phagocytosis, and activation by DAMPs and PAMPs.Although additional refinement of the culture medium is

required, the present formulation provides a valuable resourcefor the study of microglia physiology and pharmacology. In ad-dition, the protocol allows simultaneous isolation of multipletypes of glia from a single donor sample. Because human tissueis a precious and valuable commodity, the simultaneous isola-tion of multiple cell time is highly beneficial.

DISCLOSURES

The authors have no financial conflicts of interest.

ACKNOWLEDGMENTS

We thank the nurses and residents who facilitated procurement of hu-man brain tissue samples, Stephanie Michalski for reviewing the manu-script prior to submission, and Grant Kolar and Caroline Murphy forhelp with time-lapse microscopy.

REFERENCES

1. Wolf, S. A., H. W. Boddeke, and H. Kettenmann. 2017. Microglia inPhysiology and Disease. Annu. Rev. Physiol. 79: 619--643.

2. Nimmerjahn, A., F. Kirchhoff, and F. Helmchen. 2005. Resting mi-croglial cells are highly dynamic surveillants of brain parenchymain vivo. Science 308: 1314--1318.

3. Fu, R., Q. Shen, P. Xu, J. J. Luo, and Y. Tang. 2014. Phagocytosis ofmicroglia in the central nervous system diseases. Mol. Neurobiol. 49:1422--1434.

4. Hanisch, U. K., and H. Kettenmann. 2007. Microglia: active sensorand versatile effector cells in the normal and pathologic brain. Nat.Neurosci. 10: 1387--1394.

5. Carroll, J. A., and B. Chesebro. 2019. Neuroinflammation, microglia,and cell-association during prion disease.Viruses 11: 65.

6. Li, Q., Z. Cheng, L. Zhou, S. Darmanis, N. F. Neff, J. Okamoto, G.Gulati, M. L. Bennett, L. O. Sun, L. E. Clarke, et al. 2019. Develop-mental heterogeneity of microglia and brain myeloid cells revealedby deep single-cell RNA sequencing. Neuron. 101: 207--223.e10.

7. Cunningham, C. L., V. Martínez-Cerde~no, and S. C. Noctor. 2013.Microglia regulate the number of neural precursor cells in the de-veloping cerebral cortex. J. Neurosci. 33: 4216--4233.

8. Antony, J. M., A. Paquin, S. L. Nutt, D. R. Kaplan, and F. D. Miller.2011. Endogenous microglia regulate development of embryoniccortical precursor cells. J. Neurosci. Res. 89: 286--298.

9. Menassa, D. A., and D. Gomez-Nicola. 2018. Microglial dynamicsduring human brain development. Front. Immunol. 9: 1014.

10. Paolicelli, R. C., G. Bolasco, F. Pagani, L. Maggi, M. Scianni, P. Pan-zanelli, M. Giustetto, T. A. Ferreira, E. Guiducci, L. Dumas, et al.2011. Synaptic pruning by microglia is necessary for normal braindevelopment. Science 333: 1456--1458.

11. Schafer, D. P., and B. Stevens. 2015. Microglia function in centralnervous system development and plasticity. Cold Spring Harb. Per-spect. Biol. 7: a020545.

12. Hammond, T. R., D. Robinton, and B. Stevens. 2018. Microglia andthe brain: complementary partners in development and disease.Annu. Rev. Cell Dev. Biol. 34: 523--544.

13. Salter, M. W., and B. Stevens. 2017. Microglia emerge as centralplayers in brain disease. Nat. Med. 23: 1018--1027.

14. Timmerman, R., S. M. Burm, and J. J. Bajramovic. 2018. An over-view of in vitro methods to study microglia. Front. Cell. Neurosci.12: 242.




ww

.imm

unohorizons.org/D

ownloaded from


15. Sierra, A., R. C. Paolicelli, and H. Kettenmann. 2019. Cien a~nos demicroglía: milestones in a century of microglial research. TrendsNeurosci. 42: 778--792.

16. Masopust, D., C. P. Sivula, and S. C. Jameson. 2017. Of mice, dirtymice, and men: using mice to understand human immunology. J. Im-munol. 199: 383--388.

17. Mestas, J., and C. C. Hughes. 2004. Of mice and not men: differ-ences between mouse and human immunology. J. Immunol. 172:2731--2738.

18. Sellers, R. S. 2017. Translating mouse models. Toxicol. Pathol. 45:134--145.

19. Tao, L., and T. A. Reese. 2017. Making mouse models that reflect hu-man immune responses. Trends Immunol. 38: 181--193.

20. Seok, J., H. S. Warren, A. G. Cuenca, M. N. Mindrinos, H. V. Baker,W. Xu, D. R. Richards, G. P. McDonald-Smith, H. Gao, L. Hennessy,et al. Inflammation and Host Response to Injury, Large Scale Col-laborative Research Program. 2013. Genomic responses in mousemodels poorly mimic human inflammatory diseases. Proc. Natl.Acad. Sci. USA 110: 3507--3512.

21. Geirsdottir, L., E. David, H. Keren-Shaul, A. Weiner, S. C. Bohlen, J.Neuber, A. Balic, A. Giladi, F. Sheban, C. A. Dutertre, et al. 2019.Cross-species single-cell analysis reveals divergence of the primatemicroglia program. [Published erratum appears in 2020 Cell 18:746.] Cell 179: 1609--1622.

22. Smith, A. M., and M. Dragunow. 2014. The human side of microglia.Trends Neurosci. 37: 125--135.

23. Wagar, L. E., R. M. DiFazio, and M. M. Davis. 2018. Advanced modelsystems and tools for basic and translational human immunology.Genome Med. 10: 73.

24. Nagai, A., E. Nakagawa, K. Hatori, H. B. Choi, J. G. McLarnon,M. A. Lee, and S. U. Kim. 2001. Generation and characterization ofimmortalized human microglial cell lines: expression of cytokinesand chemokines. Neurobiol. Dis. 8: 1057--1068.

25. Das, A., S. H. Kim, S. Arifuzzaman, T. Yoon, J. C. Chai, Y. S. Lee,K. S. Park, K. H. Jung, and Y. G. Chai. 2016. Transcriptome sequenc-ing reveals that LPS-triggered transcriptional responses in estab-lished microglia BV2 cell lines are poorly representative of primarymicroglia. J. Neuroinflammation 13: 182.

26. Horvath, R. J., N. Nutile-McMenemy, M. S. Alkaitis, and J. A. Deleo.2008. Differential migration, LPS-induced cytokine, chemokine, andNO expression in immortalized BV-2 and HAPI cell lines and pri-mary microglial cultures. J. Neurochem. 107: 557--569.

27. Garcia-Mesa, Y., T. R. Jay, M. A. Checkley, B. Luttge, C. Dobro-wolski, S. Valadkhan, G. E. Landreth, J. Karn, and D. Alvarez-Carbonell. 2017. Immortalization of primary microglia: a newplatform to study HIV regulation in the central nervous system. J.Neurovirol. 23: 47--66.

28. Muffat, J., Y. Li, B. Yuan, M. Mitalipova, A. Omer, S. Corcoran, G.Bakiasi, L. H. Tsai, P. Aubourg, R. M. Ransohoff, and R. Jaenisch.2016. Efficient derivation of microglia-like cells from human plurip-otent stem cells. Nat. Med. 22: 1358--1367.

29. Abud, E. M., R. N. Ramirez, E. S. Martinez, L. M. Healy, C. H. H.Nguyen, S. A. Newman, A. V. Yeromin, V. M. Scarfone, S. E. Marsh,C. Fimbres, et al. 2017. iPSC-Derived human microglia-like cells tostudy neurological diseases. Neuron. 94: 278--293.e9.

30. Xu, R., X. Li, A. J. Boreland, A. Posyton, K. Kwan, R. P. Hart, and P.Jiang. 2020. Human iPSC-derived mature microglia retain theiridentity and functionally integrate in the chimeric mouse brain.Nat. Commun. 11: 1577.

31. Dubbelaar, M. L., L. Kracht, B. J. L. Eggen, and E. W. G. M. Bod-deke. 2018. The kaleidoscope of microglial phenotypes. Front.Immunol. 9: 1753.

32. Speicher, A. M., H. Wiendl, S. G. Meuth, and M. Pawlowski. 2019.Generating microglia from human pluripotent stem cells: novel

in vitro models for the study of neurodegeneration. Mol. Neurodege-ner. 14: 46.

33. Hinze, A., and A. Stolzing. 2011. Differentiation of mouse bone mar-row derived stem cells toward microglia-like cells. BMC Cell Biol.12: 35.

34. Janks, L., C. V. R. Sharma, and T. M. Egan. 2018. A central role forP2X7 receptors in human microglia. J. Neuroinflammation 15: 325.

35. Mizee, M. R., S. S. Miedema, M. van der Poel, K. G. Adelia, K. G.Schuurman, M. E. van Strien, J. Melief, J. Smolders, D. A. Hen-drickx, K. M. Heutinck, et al. 2017. Isolation of primary microgliafrom the human post-mortem brain: effects of ante- and post-mor-tem variables. Acta Neuropathol. Commun. 5: 16.

36. Smith, A. M., H. M. Gibbons, C. Lill, R. L. Faull, and M. Dragunow.2013. Isolation and culture of adult human microglia within mixedglial cultures for functional experimentation and high-content anal-ysis. Methods Mol. Biol. 1041: 41--51.

37. Rustenhoven, J., T. I. Park, P. Schweder, J. Scotter, J. Correia, A. M.Smith, H. M. Gibbons, R. L. Oldfield, P. S. Bergin, E. W. Mee, et al.2016. Isolation of highly enriched primary human microglia forfunctional studies. Sci. Rep. 6: 19371.

38. Bordt, E. A., C. L. Block, T. Petrozziello, G. Sadri-Vakili, C. J. Smith,A. G. Edlow, and S. D. Bilbo. 2020. Isolation of microglia frommouse or human tissue. STAR Protoc. 1: 100035.

39. Olah, M., D. Raj, N. Brouwer, A. H. De Haas, B. J. Eggen, W. F. DenDunnen, K. P. Biber, and H. W. Boddeke. 2012. An optimized proto-col for the acute isolation of human microglia from autopsy brainsamples. Glia. 60: 96--111.

40. Hassan, N. F., D. E. Campbell, S. Rifat, and S. D. Douglas. 1991. Iso-lation and characterization of human fetal brain-derived microgliain in vitro culture. Neuroscience 41: 149--158.

41. Bohlen, C. J., F. C. Bennett, A. F. Tucker, H. Y. Collins, S. B. Muli-nyawe, and B. A. Barres. 2017. Diverse requirements for microglialsurvival, specification, and function revealed by defined-mediumcultures. Neuron 94: 759--773.e8.

42. Edelstein, A., N. Amodaj, K. Hoover, R. Vale, and N. Stuurman.2010. Computer control of microscopes using mManager. Curr. Pro-toc. Mol. Biol. Chapter 14: Unit14.20.

43. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene ex-pression data using real-time quantitative PCR and the 2(-delta del-ta C(T)) method. Methods 25: 402--408.

44. Janks, L., R. S. Sprague, and T. M. Egan. 2019. ATP-gated P2X7 re-ceptors require chloride channels to promote inflammation in hu-man macrophages. J. Immunol. 202: 883--898.

45. Melief, J., M. A. Sneeboer, M. Litjens, P. R. Ormel, S. J. Palmen, I.Huitinga, R. S. Kahn, E. M. Hol, and L. D. de Witte. 2016. Character-izing primary human microglia: A comparative study with myeloidsubsets and culture models. Glia. 64: 1857--1868.

46. Rossi, M. L., J. T. Hughes, M. M. Esiri, H. B. Coakham, and D. B.Brownell. 1987. Immunohistological study of mononuclear cell infil-trate in malignant gliomas. Acta Neuropathol. 74: 269--277.

47. Del Rio-Hortega, P. 1932. Microglia. In Cytology and Cellular Pa-thology of the Nervous System. W. Penfield, ed. Hoeber, NewYork. 482--534.

48. Morin-Brureau, M., G. Milior, J. Royer, F. Chali, C. Le Duigou, E.Savary, C. Blugeon, L. Jourdren, D. Akbar, S. Dupont, et al. 2018.Microglial phenotypes in the human epileptic temporal lobe. Brain141: 3343--3360.

49. Li, Q., and B. A. Barres. 2018. Microglia and macrophages in brainhomeostasis and disease. Nat. Rev. Immunol. 18: 225--242.

50. Satoh, J., Y. Kino, N. Asahina, M. Takitani, J. Miyoshi, T. Ishida,and Y. Saito. 2016. TMEM119 marks a subset of microglia in the hu-man brain. Neuropathology 36: 39--49.

51. Mildner, A., H. Huang, J. Radke, W. Stenzel, and J. Priller. 2017.P2Y12 receptor is expressed on human microglia under physiological




ww

.imm

unohorizons.org/D

ownloaded from


conditions throughout development and is sensitive to neuroinflam-matory diseases. Glia. 65: 375--387.

52. Gutmann, D. H., and H. Kettenmann. 2019. Microglia/brain macrophagesas central drivers of brain tumor pathobiology. Neuron. 104: 442--449.

53. Layhadi, J. A., J. Turner, D. Crossman, and S. J. Fountain. 2018.ATP evokes Ca21 responses and CXCL5 secretion via P2X4 receptoractivation in human monocyte-derived macrophages. J. Immunol.200: 1159--1168.

54. Butovsky, O., M. P. Jedrychowski, C. S. Moore, R. Cialic, A. J. Lans-er, G. Gabriely, T. Koeglsperger, B. Dake, P. M. Wu, C. E. Doykan,et al. 2014. Identification of a unique TGF-b-dependent molecularand functional signature in microglia.[Published erratum appears in2014 Nat. Neurosci. 17: 1286.] Nat. Neurosci. 17: 131--143.

55. Ginhoux, F., M. Greter, M. Leboeuf, S. Nandi, P. See, S. Gokhan,M. F. Mehler, S. J. Conway, L. G. Ng, E. R. Stanley, et al. 2010. Fatemapping analysis reveals that adult microglia derive from primitivemacrophages. Science 330: 841--845.

56. R�eu, P., A. Khosravi, S. Bernard, J. E. Mold, M. Salehpour, K. Alkass, S.Perl, J. Tisdale, G. Possnert, H. Druid, and J. Fris�en. 2017. The lifespanand turnover of microglia in the human brain. Cell Rep. 20: 779--784.

57. Endl, E., and J. Gerdes. 2000. The Ki-67 protein: fascinating formsand an unknown function. Exp. Cell Res. 257: 231--237.

58. Askew, K., K. Li, A. Olmos-Alonso, F. Garcia-Moreno, Y. Liang, P.Richardson, T. Tipton, M. A. Chapman, K. Riecken, S. Beccari, et al.2017. Coupled proliferation and apoptosis maintain the rapid turn-over of microglia in the adult brain. Cell Rep. 18: 391--405.

59. Kierdorf, K., and M. Prinz. 2017. Microglia in steady state. J. Clin.Invest. 127: 3201--3209.

60. Avignone, E., L. Ulmann, F. Levavasseur, F. Rassendren, and E.Audinat. 2008. Status epilepticus induces a particular microglial ac-tivation state characterized by enhanced purinergic signaling. J.Neurosci. 28: 9133--9144.

61. Maas, S. L. N., E. R. Abels, L. L. Van De Haar, X. Zhang, L. Morsett,S. Sil, J. Guedes, P. Sen, S. Prabhakar, S. E. Hickman, et al. 2020.Glioblastoma hijacks microglial gene expression to support tumorgrowth. J. Neuroinflammation 17: 120.

62. Donat, C. K., G. Scott, S. M. Gentleman, and M. Sastre. 2017. MicroglialActivation in Traumatic Brain Injury. Front. Aging Neurosci. 9: 208.

63. Gosselin, D., D. Skola, N. G. Coufal, I. R. Holtman, J. C. M. Schla-chetzki, E. Sajti, B. N. Jaeger, C. O�Connor, C. Fitzpatrick, M. P. Pa-sillas, et al. 2017. An environment-dependent transcriptionalnetwork specifies human microglia identity. Science 356: eal3222.

64. Johnston, R. B., Jr., M. R. Klemperer, C. A. Alper, and F. S. Rosen.1969. The enhancement of bacterial phagocytosis by serum. Therole of complement components and two cofactors. J. Exp. Med.129: 1275--1290.

65. Gu, B. J., and J. S. Wiley. 2018. P2X7 as a scavenger receptor for in-nate phagocytosis in the brain. Br. J. Pharmacol. 175: 4195--4208.

66. Gu, B. J., C. Rathsam, L. Stokes, A. B. McGeachie, and J. S. Wiley.2009. Extracellular ATP dissociates nonmuscle myosin from P2X(7)complex: this dissociation regulates P2X(7) pore formation. Am. J.Physiol. Cell Physiol. 297: C430--C439.

67. Gu, B. J., B. M. Saunders, C. Jursik, and J. S. Wiley. 2010. TheP2X7-nonmuscle myosin membrane complex regulates phagocyto-sis of nonopsonized particles and bacteria by a pathway attenuatedby extracellular ATP. Blood 115: 1621--1631.

68. Donnelly-Roberts, D. L., M. T. Namovic, B. Surber, S. X. Vaidyana-than, A. Perez-Medrano, Y. Wang, W. A. Carroll, and M. F. Jarvis.2009. [3H]A-804598 ([3H]2-cyano-1-[(1S)-1-phenylethyl]-3-quino-lin-5-ylguanidine) is a novel, potent, and selective antagonist radio-ligand for P2X7 receptors. Neuropharmacology 56: 223--229.

69. Karasawa, A., and T. Kawate. 2016. Structural basis for subtype-spe-cific inhibition of the P2X7 receptor. eLife 5: e22153.

70. Di Virgilio, F., A. C. Sarti, and R. Coutinho-Silva. 2020. Purinergicsignaling, DAMPs, and inflammation. Am. J. Physiol. Cell Physiol.318: C832--C835.

71. Andrejew, R., �A. Oliveira-Giacomelli, D. E. Ribeiro, T. Glaser, V. F.Arnaud-Sampaio, C. Lameu, and H. Ulrich. 2020. The P2X7 Recep-tor: Central Hub of Brain Diseases. Front. Mol. Neurosci. 13: 124.

72. Kettenmann, H., U. K. Hanisch, M. Noda, and A. Verkhratsky. 2011.Physiology of microglia. Physiol. Rev. 91: 461--553.

73. Roh, J. S., and D. H. Sohn. 2018. Damage-associated molecular pat-terns in inflammatory diseases. Immune Netw. 18: e27.

74. Light, A. R., Y. Wu, R. W. Hughen, and P. B. Guthrie. 2006. Puriner-gic receptors activating rapid intracellular Ca increases in microglia.Neuron. Glia. Biol. 2: 125--138.

75. Hidetoshi, T.-S., T. Makoto, and K. Inoue. 2012. P2Y receptors inmicroglia and neuroinflammation. Wiley Interdiscip. Rev. Membr.Transp. Signal. 1: 493--501.

76. Toulme, E., A. Garcia, D. Samways, T. M. Egan, M. J. Carson, andB. S. Khakh. 2010. P2X4 receptors in activated C8-B4 cells of cere-bellar microglial origin. J. Gen. Physiol. 135: 333--353.

77. F€arber, K., and H. Kettenmann. 2006. Functional role of calcium sig-nals for microglial function. Glia. 54: 656--665.

78. Sanz, J. M., and F. Di Virgilio. 2000. Kinetics and mechanism ofATP-dependent IL-1 beta release from microglial cells. J. Immunol.164: 4893--4898.

79. Edlow, A. G., R. M. Glass, C. J. Smith, P. K. Tran, K. James, and S.Bilbo. 2019. Placental macrophages: a window into fetal microglialfunction in maternal obesity. Int. J. Dev. Neurosci. 77: 60--68.

80. Simpson, D. S. A., and P. L. Oliver. 2020. ROS generation in micro-glia: understanding oxidative stress and inflammation in neurode-generative disease. Antioxidants 9: 743.

81. Hickman, S., S. Izzy, P. Sen, L. Morsett, and J. El Khoury. 2018. Mi-croglia in neurodegeneration. Nat. Neurosci. 21: 1359--1369.

82. Galatro, T. F., I. R. Holtman, A. M. Lerario, I. D. Vainchtein, N.Brouwer, P. R. Sola, M. M. Veras, T. F. Pereira, R. E. P. Leite, T. M€oller,et al. 2017. Transcriptomic analysis of purified human cortical micro-glia reveals age-associated changes. Nat. Neurosci. 20: 1162--1171.

83. Zhang, Y., K. Chen, S. A. Sloan, M. L. Bennett, A. R. Scholze, S.O�Keeffe, H. P. Phatnani, P. Guarnieri, C. Caneda, N. Ruderisch,et al. 2014. An RNA-sequencing transcriptome and splicing databaseof glia, neurons, and vascular cells of the cerebral cortex. J. Neurosci.34: 11929--11947.

84. Elmore, M. R., A. R. Najafi, M. A. Koike, N. N. Dagher, E. E. Span-genberg, R. A. Rice, M. Kitazawa, B. Matusow, H. Nguyen, B. L.West, and K. N. Green. 2014. Colony-stimulating factor 1 receptorsignaling is necessary for microglia viability, unmasking a microgliaprogenitor cell in the adult brain. Neuron. 82: 380--397.

85. Salimi, K., K. V. Moser, J. Marksteiner, M. Reindl, and C. Humpel.2003. GDNF and TGF-beta1 promote cell survival in serum-free cul-tures of primary rat microglia. Cell Tissue Res. 312: 135--139.

86. Guo, L., A. Rezvanian, L. Kukreja, R. Hoveydai, E. H. Bigio,M. M. Mesulam, J. El Khoury, and C. Geula. 2016. Postmortemadult human microglia proliferate in culture to high passage andmaintain their response to amyloid-b. J. Alzheimers Dis. 54:1157--1167.

87. Mittelbronn, M., K. Dietz, H. J. Schluesener, and R. Meyermann.2001. Local distribution of microglia in the normal adult humancentral nervous system differs by up to one order of magnitude.Acta Neuropathol. 101: 249--255.

88. B€ottcher, C., S. Schlickeiser, M. A. M. Sneeboer, D. Kunkel, A. Knop,E. Paza, P. Fidzinski, L. Kraus, G. J. L. Snijders, R. S. Kahn, et al.NBB-Psy. 2019. Human microglia regional heterogeneity and phe-notypes determined by multiplexed single-cell mass cytometry. Nat.Neurosci. 22: 78--90.




ww

.imm

unohorizons.org/D

ownloaded from


89. Roesch, S., C. Rapp, S. Dettling, and C. Herold-Mende. 2018. Whenimmune cells turn bad-tumor-associated microglia/macrophages inglioma. Int. J. Mol. Sci. 19: 436.

90. Chen, Z., and D. Hambardzumyan. 2018. Immune microenviron-ment in glioblastoma subtypes. Front. Immunol. 9: 1004.

91. Parney, I. F., J. S. Waldron, and A. T. Parsa. 2009. Flow cytometryand in vitro analysis of human glioma-associated macrophages. Lab-oratory investigation. J. Neurosurg. 110: 572--582.

92. Davies, J. Q., and S. Gordon. 2005. Isolation and culture of humanmacrophages. Methods Mol. Biol. 290: 105--116.

93. Ohgidani, M., T. A. Kato, D. Setoyama, N. Sagata, R. Hashimoto, K.Shigenobu, T. Yoshida, K. Hayakawa, N. Shimokawa, D. Miura,et al. 2014. Direct induction of ramified microglia-like cells from hu-man monocytes: dynamic microglial dysfunction in Nasu-Hakoladisease. Sci. Rep. 4: 4957.

94. Bennett, M. L., F. C. Bennett, S. A. Liddelow, B. Ajami, J. L. Zama-nian, N. B. Fernhoff, S. B. Mulinyawe, C. J. Bohlen, A. Adil, A. Tuck-er, et al. 2016. New tools for studying microglia in the mouse andhuman CNS. Proc. Natl. Acad. Sci. USA 113: E1738--E1746.

95. Haage, V., M. Semtner, R. O. Vidal, D. P. Hernandez, W. W. Pong,Z. Chen, D. Hambardzumyan, V. Magrini, A. Ly, J. Walker, et al.2019. Comprehensive gene expression meta-analysis identifiessignature genes that distinguish microglia from peripheral mono-cytes/macrophages in health and glioma.[Published erratum ap-pears in 2020 Acta Neuropathol. Commun. 8:1.] Acta Neuropathol.Commun. 7: 20.

96. Dello Russo, C., N. Cappoli, I. Coletta, D. Mezzogori, F. Paciello, G.Pozzoli, P. Navarra, and A. Battaglia. 2018. The human microglialHMC3 cell line: where do we stand? A systematic literature review.J. Neuroinflammation 15: 259.

97. Williams, K., A. Bar-Or, E. Ulvestad, A. Olivier, J. P. Antel, andV. W. Yong. 1992. Biology of adult human microglia in culture: com-parisons with peripheral blood monocytes and astrocytes. J. Neuro-pathol. Exp. Neurol. 51: 538--549.

98. Hickman, S. E., N. D. Kingery, T. K. Ohsumi, M. L. Borowsky, L. C.Wang, T. K. Means, and J. El Khoury. 2013. The microglial sen-some revealed by direct RNA sequencing. Nat. Neurosci. 16: 1896--1905.




ww

.imm

unohorizons.org/D

ownloaded from
