International Journal of Cardiology 153 (2011) 36–41
Contents lists available at ScienceDirect
International Journal of Cardiology
j ourna l homepage: www.e lsev ie r.com/ locate / i j ca rd
Development of porcine model of chronic tachycardia-induced cardiomyopathy
Urszula Paslawska a,b, Jacek Gajek j, Liliana Kiczak a,c, Agnieszka Noszczyk-Nowak a,b, Piotr Skrzypczak d,Jacek Bania a,e, Alicja Tomaszek a, Maciej Zacharski a,c, Izabela Sambor c, Piotr Dziegiel f, Dorota Zysko g,Waldemar Banasiak h, Ewa A. Jankowska a,h,i,⁎, Piotr Ponikowski a,h,i
a Regional Specialist Hospital in Wroclaw, Research and Development Centre, Wroclaw, Polandb Department of Internal and Diseases with Clinic for Horses, Dogs and Cats, Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Wroclaw, Polandc Department of Biochemistry, Pharmacology and Toxicology, Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Wroclaw, Polandd Department and Clinic of Surgery, Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Wroclaw, Polande Department of Food Hygiene and Consumer Health Protection, Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Wroclaw, Polandf Department of Histology and Embryology, Wroclaw Medical University, Wroclaw, Polandg Department of Medical Rescue, Wroclaw Medical University, Wroclaw, Polandh Centre for Heart Diseases, Military Hospital, Wroclaw, Polandi Department of Heart Diseases, Wroclaw Medical University, Wroclaw, Polandj Department of Cardiology, Wrocław Medical University, Poland
⁎ Corresponding author. Department of Heart DiseaseCentre of Heart Diseases, Military Hospital, ul. Weigla 5,fax: +48 71 7660250.
E-mail address: [email protected] (
0167-5273/$ – see front matter © 2010 Elsevier Irelanddoi:10.1016/j.ijcard.2010.08.033
a b s t r a c t
a r t i c l e i n f oArticle history:
Received 18 April 2010Received in revised form 23 July 2010Accepted 7 August 2010Available online 29 September 2010Keywords:Tachycardia-induced model of heart failureMyocardial remodelingPigs
Background: There are few experimental models of heart failure (HF) in large animals, despite structural andfunctional similarities to human myocardium. We have developed a porcine model of chronic tachycardia-induced cardiomyopathy.Methods: Homogenous siblings of White Large breed swine (n=6) underwent continuous right ventricular(RV) pacing at 170 bpm; 2 subjects served as controls. In the course of RV pacing, animals developed aclinical picture of HF and were presented for euthanasia at subsequent stages: mild, moderate and end-stageHF. Left ventricle (LV) sections were analyzed histologically and relative ANP, BNP, phospholamban andsarcoplasmic reticulum calcium ATPase 2a transcript levels in LV were quantified by real time RT-PCR.Results: In the course of RV pacing, animals demonstrated reduced exercise capacity (time of running until
being dyspnoeic: 6.6±0.5 vs. 2.4±1.4 min), LV dilatation (LVEDD: 4.9±0.4 vs. 6.7±0.4 cm), impaired LVsystolic function (LVEF: 69±8 vs. 32±7 %), (all baseline vs. before euthanasia, all pb0.001). LV tissues fromanimals with moderate and end-stage HF demonstrated local foci of interstitial fibrosis, congestion,cardiomyocyte hypertrophy and atrophy, which was not detected in controls and mild HF animals. The up-regulation of ANP and BNP and a reduction in a ratio of sarcoplasmic reticulum calcium ATPase 2a andphospholamban in failing myocardium were observed as compared to controls.Conclusions: In pigs, chronic RV pacing at relatively low rate can be used as an experimental model of HF, as itresults in a gradual deterioration of exercise tolerance accompanied by myocardial remodeling confirmed atsubcellular level.© 2010 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
In recent decades, we have witnessed rapid progress in theunderstanding of the complex pathophysiology of heart failure (HF)that subsequently improved modern treatment modalities in patientswith this clinical syndrome [1,2]. Still however numerous pathophys-iological mechanisms remain enigmatic, particularly involved in thedevelopment of HF at the very early stages [3].
s, WroclawMedical University,50-981 Wroclaw, Poland. Tel./
E.A. Jankowska).
Ltd. All rights reserved.
Experimental animalmodels ofHF seemtobea rational alternative forthe comprehensive studies of thewhole spectrumof thenatural historyofHF [4], including the initial sequence of pathophysiological changesfinally leading to over, symptomatic HF. As HF affects unfavourablyalmost all organs and systems in the body, the other advantage of animalmodels of HF is an unrestricted availability for detailed examinations ofmyocardial tissue and virtually all peripheral tissues [4].
Most animal models of HF have been developed and extensivelyvalidated in rodents (mice and rats) [5]. However, they have severallimitations. The most important disadvantages of experimentalmodels of HF developed in small animals are marked differences inanatomy and physiology of the cardiovascular system in comparisonto largemammals, including humans [4]. There is evidence suggestingthat large animal models of HF (in sheep, dogs, and particularly in
Table 1Oligonucleotide primers used in the study.
Gene Primer Nucleotide sequence (5′-3′) GenBank accession no.
ANP sANP 1/2F CCTGATGGATTTCAAGAATTTGC NM_214260sANP KR TCCTCATTCTGCTCGCTTAG
BNP sBNP 1/2F GATACAGGAGCTGCTGGAC M23596sBNP 2NR GAGGACTTGGAAGATGCTACTGC M25547
SERCA2a SERCA2a F TGTCACTCCACTTCCTAATCC X15073SERCA2a R ACTCCAGTATTGCAGGTTCC X53754
PLN sPLN F CACTCGCTCTGCTATTAGAAG X15075sPLN R AGAGGCATATTAAGATGAGACAG
MMP-9 sMMP-9 5F CCACAGGCCCTCCTTCAG NM_001038004sMMP-9 R TGAACAGCAGCACCTTACC NC_010459
ANP — atrial natriuretic peptide, BNP — B-type natriuretic peptide, SERCA2a —
sarcoendoplasmatic reticulum Ca2+-ATPase 2a, PLN — phospholamban, MMP-9 —
matrix metalloproteinase 9.
37U. Paslawska et al. / International Journal of Cardiology 153 (2011) 36–41
pigs) allow to approximate more closely the pathophysiologicalprocesses occurring in the syndrome of human HF [6,7], and can beused to develop and test novel therapies.
Experimental models of HF established in large mammals are notcommon. Right ventricle (RV) pacing-induced tachycardia applied inpigs is an effective trigger for the development of the progressive leftventricular dilatation and dysfunction and the activation of neurohor-monal systems [8–12]. Previously published porcine tachycardia-induced cardiomyopathy (TIC) was induced by very rapid pacing(200–230 beats per minute) that lasted no longer than 3 months[8,9,13–15]. These models applying rapid pacing for a relatively shorttime reflect the processes occurring during subacute or acute HF. Hence,they do not resemble the pathophysiology of chronic HF syndrome, anddo not allow to investigate this process thatwas our goal in this project.
The aim of this study was to develop an experimental model ofsymptomatic chronic HF in pigs based on relatively slow long-termright ventricle pacing and validate the presence of molecularremodeling within malfunctioning dilated porcine myocardium.
2. Methods
2.1. Protocol of the development of pacing-induced cardiomyopathy
The study was performed in 8 adult pigs of Polish Large White breed (sibling 8-month-old females, weighted from 70 to 74 kg). All animals received human care incompliance with the Guide for the Care and Use of Laboratory Animals as published bythe National Institutes of Health (NIH publication No. 85-23, revised in 1985). Allexperiments were performed in compliance with the Bioethical Committee of theWroclaw University of Environmental and guidelines for the experimentation onanimals.
All procedures andmeasurements were performed during anesthesia administeredaccording to the same protocol, with food restriction for 12 h Life Sciences and waterrestriction for 4 h before. Pigs were anesthetized using amodified protocol described byGoldmann et al. [16]. Briefly, animals were premedicated with an intramuscularinjection 2 mg/kg azaperone (5 ml, Stressnil, Jannsen-Cilag, Neuss, Germany). Afternext 15 min, bolus doses of 10 mg/kg ketamine (5 ml, Ketamin 10%, Sanofi-Ceva,Düsseldorf, Germany) and pentobarbital 8 mg/kg (Morbital, Biowet, Pulawy, Poland)were administered intravenously. Anaesthesia was maintained by an intravenousinfusion of pentobarbital in dose of 9–12 mg/kg/h (Narcoren, Merial, Hallbergmoos,Germany). Pigs were intubated (8.5 Charriere tubes) and shaved for the surgicalprocedure of pacemaker implantation. Monitoring was based on noninvasivemeasurements of arterial blood pressure every 2 min (at femoral artery), heart rateand pulse oximetry (tongue).
One-chamber pacemaker was implanted in each of 6 randomly selected pigs,whereas 2 other animals served as controls. In each animal selected for pacemakerimplantation, a bipolar screw-in pacing lead was inserted into the left internal jugularvein and positioned in the myocardium at the right ventricular apex. Leads wereattached to pacemaker (Verity Adx XL DR 5156, St JudeMedical), and the pacing systemwas placed in a subcutaneous pocket. Every pig was administered antibioticintramuscularly for infection prophylaxis for 10 days. After 2 weeks of recovery,pacemakers were programmed for sequential right ventricular pacing at 170 beats perminute (bpm).
2.2. Schedule of performed assessments
All animals remained under everyday clinical care. The assessment was regularlyperformed at the end of every month and comprised: a) clinical assessments (with anon-invasive measurement of arterial blood pressure and heart rate, body weight,recording of the presence of signs and symptoms of HF), resting ECG, transthoracicechocardiography (for details see below) — before all these procedures the pacemakerwas deactivated for approximately 30 min; b) exercise testing (for details see below)performed with the pacemaker switched on.
On the basis of the comprehensive evaluation as described above, in each animalthe clinical severity of HF was categorized as mild, moderate or severe. It wasprospectively designed that during the experiment, animals developing the consecu-tive stages of HF (mild, moderate and severe) would be presented for euthanasia.Control animals were evaluated monthly and presented for euthanasia at week 28.
Tissue sections from left ventricle (LV) free wall were taken, and immediatelyfrozen in liquid nitrogen before the preparation of tissue homogenates and RNAextraction. Separate sections for standard histology were immersed in a 4%paraformaldehyde solution.
2.3. Exercise testing
All pigs were familiarized with exercise consisting of voluntary sprinting andplaying with a ball. Such physical activity was used as a part of clinical evaluation every
week. Exercise capacity was assessed monthly as mentioned before, and wasprospectively defined as the time of active exercise (minutes) up to the momentwhen pigs refused the further running or playing and the concomitant signs ofdyspnoea were seen.
2.4. Transthoracic echocardiography
Transthoracic echocardiography was performed using an imaging ultrasoundsystem (Aloka 4000+ with a 3.5 MHz phased array transducer). Two-dimension directM-mode echocardiography was performed at the right parasternal area in left lateraldecubitus position. Short-but not long-axis views were readily visible in all animals. LVend diastolic diameter (LVEDD, cm) was measured using the leading-edge methodfrom at least 3 consecutive cardiac cycles as recommended by the American Society forEchocardiography [17]. LV ejection fraction (LVEF) was assessed using the Teicholzformula. Tracings were recorded at a sweep speed of 100 mm/s and measurementswere averaged over 3 separate heart beats.
2.5. Standard histology
LV sections from TIC and control animals were fixedwith 4% paraformaldehyde andembedded in a paraffin wax. Paraffin-embedded myocardial tissue was cut into 7-μmtransverse sections, dewaxed in xylene, and subsequently rehydrated in descendingconcentrations of ethanol. Sections were stained with hematoxylin and eosin (H&E), astandard method for histopathological evaluation of myocardium. Myocardial samplesfrom LV were analyzed for the presence of the following features: perivascular andinterstitial fibrosis, giant nuclei, stripes of cardiomiocytes, wavy cardiomyocytes,cardiomyocyte hypertrophy, fatty infiltration, cardiomyocyte atrophy, coronary vesselhypertrophy, and infiltration of polymorphonuclear and mononuclear cells.
2.6. Quantitative real-time reverse transcriptase polymerase chain reactions (RT-PCR)
Total RNA was prepared from 30-mg samples of porcine LV tissue using the RNeasyFibrous Tissue Mini Kit (Qiagen, Wroclaw, Poland) according to the manufacturer'sinstructions. The protocol included an on-column DNAse digestion to remove thegenomic DNA. First-strand cDNA was synthesized using a SuperScript III First-StrandSynthesis System with oligo(dT)20 primer (Invitrogen, Warsaw, Poland).
Based on the genomic and cDNA sequences the primers for porcine atrialnatriuretic peptide (ANP), B-type natriuretic peptide (BNP), sarcoendoplasmaticreticulum Ca2+-ATPase 2a (SERCA2a), phospholamban (PLN) and matrix metallopro-teinase 9 (MMP-9) were designed with Molecular Beacon Software (Bio-Rad, Warsaw,Poland) Table 1. The primers spanned exon junctions to prevent the amplification ofgenomic DNA.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was chosen as areference to normalize the differences in the amount of RNA and in the efficiency ofreverse transcription (primers SGAPDH and ASGAPDH, Table 1).
The relative amounts of porcine ANP, BNP, SERCA2a, PLN andMMP-9 in LV sampleswere determined by quantitative Real-time PCR using the iQ5 Optical System (Bio-Rad,Warsaw, Poland) with the Kapa Mix (KapaBiosystems, Woburn, MA, USA) asappropriate. The reactions were performed under the following conditions: initialdenaturation of 94 °C for 10 min, 35 cycles of 94 °C for 30 s, 58 °C (SERCA2a, PLN), 60 °C(ANP, BNP) or 65 °C (MMP-9) for 30 s, followed by 72 °C for 1 min. All samples wereperformed in triplicates. The specificity of PCR was determined by melt-curve analysisfor each reaction. PCR products for each investigated gene were sequenced with an ABI310 Perkin-Elmer automated sequencer (IBB, Polish Academy of Sciences, Warsaw) toconfirm their identity.
The amplification efficiency was estimated by running serial dilutions of atemplate. Successive dilutions were plotted against the appropriate Ct values togenerate a standard curve. The slope calculated from the standard curve was used todetermine the amplification efficiency (E) according to the formula: E=10−1/slope.Since the amplification efficiencies for the target amplicons and GAPDH were not
38 U. Paslawska et al. / International Journal of Cardiology 153 (2011) 36–41
comparable, the Pfaffl method was used to determine the relative expression [18].Control pigs were chosen as the calibrators.
2.7. Zymography for the assessment of MMP activity
LV samples (30 mg) were homogenized in 200 μl of an ice-cold extraction buffer(50 mM Tris–HCl, 200 mM NaCl, 10 mM CaCl2, 1% Triton X-100, pH 7.6) [19]. Insolublematerial was removed by centrifugation at 9700×g. In order to identify pro- and activeforms of gelatinolytic MMPs the culture medium from DH-82 macrophage-like cell linewas used as a positive control [20]. Culture medium was incubated with 1 mM APMA(p-aminophenyl-mercuric acetate) for 60 min to activate proMMPs [21]. Proteinquantification was performed using the Bradford reagent (Sigma-Aldrich, Poznań,Poland) according to the manufacturer's instructions. Protein samples (70 μg) wereseparated at 4 °C in non-reducing SDS-PAGE (10% acrylamide, 1 mg/ml gelatin) [19,21].Gels were washed 3 times in 2.5% Triton X-100 for 30 min and incubated overnight at37 °C in a collagenase buffer (50 mM Tris–HCl, 200 mM NaCl, 5 mM CaCl2, 0.2% Brij-35,pH 7.6) [22,23]. Then, gels were stained in 0.5% Coomassie brilliant blue (Sigma-Aldrich, Poznań, Poland), 30% methanol, and 10% acetic acid for 30 min and destainedin 30% methanol and 10% acetic acid [24]. Gelatinase activity was identified as clearzones against a blue background. Gels were scanned using GelDoc XR (BioRad), and thevalues of optic densitometry of the bands were provided using Quantity One software(BioRad).
2.8. Brain natriuretic peptide (BNP) measurements
Serum samples were assayed at 1:5 dilution for BNP concentration using peptideEnzyme Immunoassay (EIA) Kit (Bachem, St Helens, UK) according to themanufacturerinstructions. All tests were performed in duplicate.
3. Statistical analyses
All molecular assessments were performed in triplicates. Resultswere expressed as mean±standard deviation, being calculated frommultiple measurements.
Mean values of LVEDD, LVEF and exercise test in RV paced animalswere presented as mean±standard deviation. Significances ofdifferences in these variables at baseline and just before euthanasiawere assessed using a sign test.
4. Results
Six pigs assigned for pacemaker-stimulation developed tachycar-dia-induced cardiomyopathy (TIC). These 6 pigs and 2 control animalscompleted the study protocol.
4.1. Clinical picture
Both animals from a control group demonstrated preservedexercise capacity and did not present any signs or symptoms of HFthroughout the whole study period (Table 2).
RV pacing was accompanied by a continuous reduction in exercisecapacity, however there was no relationship between pacing time and
Table 2Results of exercise test in pigs with tachycardia-induced cardiomyopathy and controls.
Groups No RV pacingtime (weeks)
Results of exercise test (minutes of active exerc
Before PMimplantation
4 week 8 week 12 week
Controls 1 – 6.17 6.00 6.66 7.832 – 6.83 7.83 6.83 6.83
Mild HF 1 21 6.66 6.83 4.66 5.002 14 6.66 5.66 4.83 3.003 14 7.33 5.33 2.83 2.00
Moderate HF 1 21 6.17 5.66 5.66 3.332 18 6.66 6.00 4.00 2.00
Severe HF 1 37 6.00 5.33 5.83 4.50All RV pacedanimals
6.58±0.47
RV — right ventricle, PM — pacemaker, HF — heart failure.Controls were bred for 28 weeks without pacing.
a Final value before euthanasia/prepacing value×100%.b pb0.001 (paced before euthanasia vs. prepacing).
the magnitude of exercise intolerance (Table 2). After the exertion, allanimals with TIC demonstrated a visible redness of snouts and ears,shortness of breath with use of accessory breathing muscle groups.Three animals developed symptoms of mild HF: two after 12 weeksand one after 20 weeks of RV pacing, and were sacrificed at these timepoints. Next 2 pigs were paced for 16 and 20 weeks and subsequentlypresented with moderate HF (as evidenced by signs, symptoms andmore impaired exercise capacity with exercise (time of exercising of1.66 min in both). They were euthanized at these time-points. Oneanimal was paced for 37 weeks in order to reach severe, end-stage. Inthis animal severe dyspnoea, snout and ears cyanosis were observedat rest, and exercise time at the end of the study was only 1 min.
4.2. Echocardiography findings
In control pigs, parameters reflected LV structure and functionremained stable during the whole study.
There were no marked differences in baseline echocardiographyparameters between controls and pigs selected to be paced. Pigs withRV pacing developed a gradual dilatation of LV (as evidenced by anincrease in LVEDD in all animals) and an impairment in LV function(as evidenced by a reduction in LVEF) (Table 3).
4.3. Histopathological findings
Myocardial tissues from LV stained with H&E from control pigsshowed a regular structure of cardiomyocytes without any abnor-malities seen on light microscopy (Fig. 1A). Light microscopydemonstrated a passive congestion (Fig. 1C) in LV samples from allpaced animals. Giant nuclei in some cardiomyocytes (Fig.1E) and aweak infiltration of mononuclear cells were observed in myocardiumtissue from LV from animals with mild HF. In LV samples from pigswith moderate and severe HF, local foci of interstitial fibrosis wereobserved (Fig. 1B). In LV myocardium from an animal with severe HF,cardiomyocyte hypertrophy as well as atrophy were found (Fig. 1E).
4.4. ANP, BNP, PLN, and SERCA2a mRNA expression in the myocardium
LV myocardial levels of BNP and ANP transcripts were shown toincrease along with the development of symptomatic TIC in pigs ascompared to controls (Table 4). Expression of ANP and BNP mRNAwas significantly higher vs. controls already in 2 out 3 animals withmild HF. With HF progression there was further increase in ANP andBNP mRNA reaching level of more than 1000-fold for ANP and 200-fold for BNP in an animal with severe HF (Table 4).
LV myocardial levels of SERCA2a mRNA were shown to decreasealong with the development of mild andmoderate HF in paced pigs as
ising) Exercise capacity expressedin % of baselinea
16 week 20 week 24 week 28 week
7.33 7.00 8.33 7.92 1287.83 6.00 7.00 5.83 854.91 4.83 – – 73– – – – 45– – – – 272.00 1.66 – – 271.66 – – – 254.00 2.00 3.33 1.00 17
2.36±1.38 b
Table 3Changes in left ventricular function during the induction of cardiomyopathy due to tachyarrhythmia in subsequent pigs and control animals.
Groups No RV pacingtime (weeks)
LVEDD LVEF
Baseline (cm) Before euthanasia (cm) % of baseline a Baseline (%) Before euthanasia (%) % of baseline a
Controls 1 – 5.2±0.4 6.33±1.05 121±7 70.2±8.8 64.31±5.4 91.6±72 – 4,6±1,02 4.27±0,93 92.9±20 56.2±4.38 66.4±9 118.7±16
Mild HF 1 21 4.23±0.32 6.7 ±0.5 158.8±11 73.3±4.5 45.87±7.2 62.6±102 14 5.33±1.35 6±0.28 112±5 71.5±5.7 29.6±8.9 41.4±123 14 5.35±0.07 6.75±0.77 128±15 71.7±3.67 32.35±12.94 45±18
Moderate HF 1 21 4.6±0.25 6.95±0.49 151±10 67.6±5 30.65±4.4 45.34±72 18 4.7±0.18 6.8±0.14 144.7±4 76.1±9.3 22.95±5.4 30.15±7
Severe HF 1 37 4.9±0.85 7.18±0.68 146.53±5 50.6±5.2 27.56±2.2 54.45±9All RV pacedAnimals
4.85±0.40 6.73±0.36 b 68.47±8.38 31.50±7.07 b
HF—heart failure, RV—right ventricle, LVEDD—left ventricular end diastolic diameter, LVEF—left ventricular ejection fraction.Controls were bred for 28 weeks without pacing.
a Final value before euthanasia/prepacing value×100%.b pb0.001 (paced before euthanasia vs. prepacing).
39U. Paslawska et al. / International Journal of Cardiology 153 (2011) 36–41
compared to controls (Table 4). No clear pattern of PLN mRNAexpression was observed. However, if a ratio of SERCA2a/PLN mRNAwas calculated, it was significantly lower in paced animals at all stagesof HF vs. control animals (Table 4).
4.5. Serum BNP level
BNP level was determined in sera from 3 individuals (control pig,pigs with moderate and severe HF) at 0 to 28 week of RV pacing. Anincrease of serum BNP was noted in moderate and severe HF pig,whereas serum BNP remained stable up to 28 week in a control pig(Fig. 2).
4.6. LV myocardial MMP-9 mRNA expression and its activity
In order to assess the magnitude of LV remodeling during thedevelopment of TIC, equal amounts of total protein fromLV lysateswereresolved in SDS-PAGE with gelatin. A zymogram reflecting the MMPactivity within LV myocardium from both a control pig and animals in
Fig. 1. Representative left ventricle tissue from a control subject (A) and an animal with tadegeneration (hypertrophy and atrophy): fibrosis foci (B), congestion (C). Atrophy, hypert
subsequent stages of HF demonstrated the presence of 72 kDa and68 kDa bands (corresponding to pro- and active MMP-2, respectively),and the presence of 95 kDa and 82 kDa bands (corresponding to pro-andmature MMP-9, respectively) (Fig. 3A). In order to confirm that theobserved bands specifically reflected the MMP activity, the sampleswere incubated with EDTA, which abolished all MMP activity (data notshown). APMA activation of a culturemedium fromDH82 cells (used asa positive control for MMPs) resulted in a shift in the size of theMMP-9band from 95 kDa (proMMP-9) to 85 kDa (matureMMP-9) (Fig. 3A). Ina pig with mild HF (Fig. 3A, lane 2) the intensity of lytic bandcorresponding to proMMP-9was3%higher than in a control animal, and17% in a pig with severe HF, respectively. Band of active MMP-9 wasobserved inmyocardium lysate from a pigwith severeHF only (Fig. 3A),whereas the lytic band corresponding to proMMP-9 had similarintensity in pigs with severe HF as well as in mild and moderate HF.The finding regarding the MMP activity was consistent with theobservation that mRNA for proMMP-9 in LV myocardium increased atthe early stage of HF and remained high up to the end-staged (severe)HF as compared to controls (Fig. 3B).
chycardia-induced cardiomyopathy (B–E), stained by the H&E method. Cardiomyocyterophy, loss of stripes (D). Giant nuclei (E). Original magnification ×440.
Table 4Changes in molecular remodeling protein expression during the induction of cardiomyopathy due to tachyarrhythmia in subsequent pigs and control animals.
Groups No RV pacingtime (weeks)
Molecular remodeling expressed by protein expression in LV (relative units with controls as referencevalues=1)
SERCA2a PLN SERCA2a/PLN ANP BNP
Controls 1 – 1 1 1 1 12 – 1 1 1 1 1
Mild HF 1 21 0.6±0.07 0.96±0.15 0.62±0.1 1.75±0.18 11.79±0.472 14 0.53±0.26 0.72±0.27 0.74±0.46 0 0.89±0.273 14 0.66±0.17 2.45±0.67 0.27±0.1 75.78±6.28 19.9±9.41
Moderate HF 1 21 0.19±0.04 0.54±0.09 0.35±0.065 22.8±3.36 32.82±9.382 18 0.74±0.23 1.12±0.09 0.66±0.19 7.66±0.8 37.17±1.25
Severe HF 1 37 0.95±0.18 2.24±0.4 0.42±0.1 1359.39±243.06 223.06±58.28
HF — heart failure, RV — right ventricle, ANP — atrial natriuretic peptide, BNP — B-type natriuretic peptide, SERCA2a — sarcoendoplasmatic reticulum Ca2+-ATPase 2a, PLN —
phospholamban, MMP-9 — matrix metalloproteinase 9.Controls were bred for 28 weeks without pacing.
40 U. Paslawska et al. / International Journal of Cardiology 153 (2011) 36–41
5. Discussion
In this study we have been able to demonstrate that in pigs, RVpacing with rate of 170 bpm resulted in the gradual development ofsymptomatic HF, with an evidence of dilated LV cavity and impairedLVEF. This clinical phenotype of chronic HF was accompanied by thehistological changes and the molecular profile in the diseasedmyocardium, which are typical for HF.
Eight siblings of the White Large breed swine included in thisstudy were divided in two groups, i.e. control (2 individuals) andpaced ones (6 individuals). All the animals were grown up in the sameenvironmental conditions in order to reduce the influence of geneticand environmental factors on the results. The application of relativelylow RV pacing rate of 170 bpm resulted in the development of signsand symptoms consistent with chronic HF (exercise intolerance,ascites, dyspnoea, pulmonary congestion). Reduction of exercisecapacity was observed after 8 weeks of pacing (about a 20% fallcomparing to baseline level — data not shown). We also observed thegradual dilatation of the heart and the deterioration in LV function,which was already seen after 14 weeks of pacing. Such a progressiveincrease in LV dimension and a fall in LVEF seem to confirm that wewere able to follow an evolution of consecutive stages of HF from earlythrough moderate to severe end-stage phase.
The echocardiographic results were concordant with clinicalfindings. To assess the physical fitness of experimental animals, amethod similar to a 6-minute walking test was used in our project.Since it was not possible to assess the distance of individual pigsplaying with the whole group, we measured the time from the onsetof exercise to the moment when pigs refused further running orplaying and concomitant signs of dyspnoea in individual pigs werepresent. To our knowledge, this is the first study linking the results ofsuch a test with the consecutive stages of HF development.
Some previous studies have used the fast pacing approach inyoung piglets, which resulted in the development of acute or subacute
Fig. 2. Serum BNP concentrations in 3 pigs (a control animal, pigs with moderate andsevere HF) at 0, 4, 16, and 28 weeks of RV pacing.
rather than chronic HF [13,14]. TIC induced using ventricular pacing at220–240 bpm was shown to result in a profound low output after3 weeks of pacing [8,9,14,24]. When using the lower pacing rates, thesymptoms of HF usually develop later, and are less pronounced [25],what can be explained by establishment of compensating mechan-isms, similarly to natural course of a disease in humans. Lionetti et al.[26] induced HF in mature mini-pigs (35–40 kg) by LV pacing at180 bpm for 3 weeks, LVEDD increased by about 20%, LVEF decreasedby about 54% compared to control animals. Ramchandra et al. [27]developed an experimental HF model on adult sheep (35–49 kg) withRV pacing at 200–220 bpm for 7–8 weeks. LVEF decreased by 47%, andLVEDD increased by 36% as compared to prepacing values.
The progression of pathological changes within failing porcinemyocardium was assessed post-mortem based on the histologicalexamination of LV sections. In left ventricular myocardium from RVpacing pigs we have demonstrated the presence of passive conges-tion, giant nuclei in some cardiomyocytes, fibrosis foci, hypertrophy ofremaining cardiomyocytes as well as degeneratedmyofibrils. All thesefeatures are consistent with ultrastructural changes seen in failingmyocardium [28,29]. The echocardiographical and histologicalchanges found in failing porcine myocardium were accompanied byan activation of the natriuretic peptide system and myocardial
Fig. 3. A. Zymogram representing an activity of matrix metalloproteinases in porcineleft ventricle tissues. Lines 1–4 represent a gelatinolytic activity of lysates from 4 pigs (acontrol, pigs with mild, moderate and severe heart failure, respectively). Lines 5 and 6represents the activity of the culture medium fromDH82macrophage-like cell line, andthe activity of the medium subjected to 60-minute treatment with APMA, respectively.B. Relative proMMP-9 transcript levels in left ventricle from a control, pigs with mild,moderate and severe HF, respectively. mRNA levels were quantified using real-time RT-PCR and normalized against the product of GAPDH (details described in the Methodssection).
41U. Paslawska et al. / International Journal of Cardiology 153 (2011) 36–41
remodeling, both confirmed at molecular level. Namely, we haveconfirmed the up-regulation of ANP and BNP, a reduction in a ratio ofsarcoplasmic reticulum calcium ATPase 2a and phospholamban aswell as an increase in MMP-9 expression in failing myocardium ascompared to control animals. Such molecular changes are establishedfeatures of diseased myocardium [10,30–35].
6. Conclusions
We have demonstrated that the long-term application of 170 bpmRV pacing in pigs induces the development of myocardial dysfunctionrevealed by both echocardiography and molecular methods, accom-panied by an occurrence of clinical features of the syndrome ofchronic HF. The applied pacing rate, lower than in the other reportedprotocols, was well tolerated by animals and during rather the longertime induced the unfavourable changes within myocardium. There-fore, we have provided the experimental porcinemodel of tachycardiainduced cardiomyopathy that reflects the development of chronic HFrather than previously reported models resembling acute or subacuteHF. Importantly, the myocardial susceptibility to applied pacing mayvary between individuals, hence, careful clinical and echocardio-graphic monitoring is needed during the performing of RV pacing. Ourmodel of chronic HF provides an opportunity to study the subsequentstages during the natural history of non-ischaemic chronic HF.
Acknowledgments
The authors of this manuscript have certified that they complywith the Principles of Ethical Publishing in the International Journal ofCardiology [36].
The research project was supported by European RegionalDevelopment Fund and the Polish Government (OperationalProgram - Innovative Economy) under the grant “WROVASC —
Integrated Cardiovascular Centre 2007–2013”.
References
[1] Jessup M, Brozena S. Heart failure. N Engl J Med 2003;348:2007–18.[2] Mann DL, Deswal A, Bozkurt B, Torre-Amione G. New therapeutics for chronic
heart failure. Ann Rev Med 2002;53:59–74.[3] Jankowska EA, Ponikowski P, Piepoli MF, Banasiak W, Anker SD, Poole-Wilson PA.
Autonomic imbalance and immune activation in chronic heart failure —
pathophysiological links. Cardiovasc Res 2006;70:434–45.[4] Dixon JA, Spinale FG. Large animal models of heart failure a critical link in the
translation of basic science to clinical practice. Circ Heart Fail 2009;2:262–71.[5] Patten RD, Hall-Porter MR. Small animal models of heart failure development of
novel therapies, past and present. Circ Heart Fail 2009;2:138–44.[6] Xanthos T, Bassiakou E, Koudouna E, et al. Baseline hemodynamics in anesthetized
landrace-large white swine: reference values for research in cardiac arrest andcardiopulmonary resuscitation models. J Am Assoc Lab Anim Sci 2007;46:21–5.
[7] Ohtsuka S, Ishikawa K, Suzuki S, et al. A porcine model of ischemic heart failureproduced by chronic placement of a tube in a coronary artery. Pacing ClinElectrophysiol 2007;30:925–8.
[8] Spinale FG, Zellner JL, Tomita M, Crawford FA, Zile MR. Relation betweenventricular and myocyte remodeling with the development and regression ofsupraventricular tachycardia-induced cardiomyopathy. Circ Res 1991;69:1058–67.
[9] Spinale FG, Fulbright BM, Mukherjee R, et al. Relation between ventricular andmyocyte function with tachycardia-induced cardiomyopathy. Circ Res 1992;71:174–87.
[10] Spinale FG, Coker ML, Thomas CV, Walker JD, Mukherjee R, Hebbar L. Time-dependent changes in matrix metalloproteinase activity and expression during
the progression of congestive heart failure relation to ventricular and myocytefunction. Circ Res 1998;82:482–95.
[11] Komamura K, Shannon RP, Paslpoularides A, et al. Alterations in left ventriculardiastolic function in conscious dogs with pacing induced heart failure. J Clin Invest1992;89:1825–38.
[12] Zellner JL, Spinale FG, Eble DK, Hewett KW, Crawford Jr FA. Alterations in myocyteshape and basement membrane attachment with tachycardia-induced heartfailure. Circ Res 1991;69:590–600.
[13] Chow E, Woodard JC, Farrar DJ. Rapid ventricular pacing in pigs: an experimentalmodel of congestive heart failure. Am J Physiol 1990;258:1603–5.
[14] Hendrick DA, Smith AC, Kratz JM, Crawford FA, Spinale FG. The pig as a model oftachycardia and dilated cardiomyopathy. Lab Anim Sci 1990;40:495–501.
[15] Lacroix D, Gluais P, Marquie C, D'Hoinne C, Adamantidis M, Bastide M.Repolarization abnormalities and their arrhythmogenic consequences in porcinetachycardia-induced cardiomyopathy. Cardiovasc Res 2002;54:42–50.
[16] Goldmann C, Ghofrani A, Hafemann B, et al. Combination anesthesia withketamine and pentobarbital: a long-term porcine model. Res Exp Med 1999;199:35–50.
[17] Quiñones MA, Douglas PS, Foster E, et al. ACC/AHA Clinical Competence Statementon Echocardiography. J Am Coll Cardiol 2003;41:687–708.
[18] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) forgroup-wise comparison and statistical analysis of relative results in real-time PCR.Nucleic Acids Res 2002;30:E36.
[19] Mook ORF, Van Overbeek C, Ackema EG, Van Maldegem F, Frederiks WM. In situlocalization of gelatinolytic activity in the extracellular matrix of metastases ofcolon cancer in rat liver using quenched fluorogenic DQ-gelatin. J HistochemCytochem 2003;51:821–9.
[20] Puff C, Krudewig C, Imbschweiler I, Baumgartner W, Alldinger S. Influence ofpersistent canine distemper virus infection on expression of RECK, matrixmetalloproteinases and their inhibitors in a canine macrophage/monocytictumour cell line (DH82). Vet J 2009;182:100–7.
[21] Shapiro SD, Fliszar CJ, Broekelmann TJ, Mecham RP, Senior RM, Welgus HG.Activation of the 92-kDa gelatinase by stromelysin and 4-aminophenylmercuricacetate. J Biol Chem 1995;270:6351–6.
[22] Yamashita C, Hayashi T, Mori T, et al. Angiotensin II receptor blocker reducesoxidative stress and attenuates hypoxia-induced left ventricular remodeling inapolipoprotein E-knockout mice. Hypertens Res 2007;30:1219–30.
[23] Leber TM, Balkwill FR. Zymography: a single-step staining method for quantita-tion of proteolitic activity on substrate gels. Anal Biochem 1997;249:24–8.
[24] Bauer A, McDonald AD, Donahue JK. Pathophysiological findings in a model ofpersistent atrial fibrillation and severe congestive heart failure. Cardiovasc Res2004;61:764–70.
[25] Power JM, Tonkin AM. Large animal models of heart failure. Aust N Z J Med1999;29:395–402.
[26] Lionetti V, Guiducci L, Simioniuc A, et al. Recchia FAMismatch between uniformincrease in cardiac glucose uptake and regional contractile dysfunction in pacing-induced heart failure. Am J Physiol Heart Circ Physiol 2007;293:H2747–56.
[27] Ramchandra R, Hood SG, Denton Derek A, et al. Basis for the preferential activationof cardiac sympathetic nerve activity in heart failure. PNAS 2009;106:924–8.
[28] Cohn JN, Ferrari R, Sharpe N. Cardiac remodeling: concepts and clinicalimplications. J Am Coll Cardiol 2000;35:569–82.
[29] Gerdes AM, Capasso JM. Structural remodeling and mechanical dysfunction ofcardiac myocytes in heart failure. J Mol Cell Cardiol 1995;27:849–56.
[30] GrahamHK, Trafford AW. Spatial disruption and enhanced degradation of collagenwith the transition from compensated ventricular hypertrophy to symptomaticcongestive heart failure. Am J Physiol 2007;292:H1364–72.
[31] Chen CL, Huang SKS, Lin JL, et al. Upregulation of matrix metalloproteinase-9 andtissue inhibitors of metalloproteinases in rapid atrial pacing-induced atrialfibrillation. J Mol Cell Cardiol 2008;45:742–53.
[32] McMullen JR, Jennings GL. Differences between pathological and physiologicalcardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clin ExpPharmacol Physiol 2007;34:255–62.
[33] Rocchiccioli JP, McMurray JJV, Dominiczak AF. Biomarkers in Heart Failure: AClinical Review. Heart Fail Rev 2010;15:251–73.
[34] Hasenfuss G, Reinecke H, Studer R, et al. Relation between myocardial functionand expression of sarcoplasmic reticulum Ca(2+)-ATPase in failing and nonfailinghuman myocardium. Circ Res 1994;75:434–42.
[35] Vanderheyden M, Mullens W, Delrue L, et al. Myocardial gene expression in heartfailure patients treated with cardiac resynchronization therapy responders versusnonresponders. J Am Coll Cardiol 2008;51:129–36.
[36] Coats AJ. Ethical authorship and publishing. Int J Cardiol 2009;131:149–50.
