Download - IGS sequence variation, group-I introns and the complete nuclear ribosomal DNA of the entomopathogenic fungus Metarhizium: excellent tools for isolate detection and phylogenetic analysis

IGS sequence variation, group-I introns and the completenuclear ribosomal DNA of the entomopathogenic fungusMetarhizium: excellent tools for isolate detection and

phylogenetic analysis

Malena P. Pantou, Annoula Mavridou, and Milton A. Typas*

Department of Genetics and Biotechnology, Faculty of Biology, University of Athens, Panepistemiopolis, Kouponia, Athens 15701, Greece

Received 17 April 2001; accepted 5 September 2002

Abstract

The complete nuclear rDNA gene complex ofMetarhizium anisopliae var. anisopliae isolate ME1 is 8118 bp long and contains the

18S, 5.8S, and 28S rRNA genes as well as the ITS and IGS regions. Variation in the ITS of isolates ofM. anisopliae var. anisopliae

and one each of Metarhizium anisopliae var. acridum, Metarhizium flavoviride var. flavoviride, and Metarhizium flavoviride var.

minus, clustered 39 out of 40 ofM. anisopliae var. anisopliae isolates in one clade. Nucleotide sequence variation in the IGS among

21 of M. anisopliae var. anisopliae isolates showing IGS length variation sorted them into three strongly supported clades, which

were weakly correlated with insect hosts and were not correlated with geographic location. Two group-I introns, Ma-int4 and Ma-

int5, were discovered in the 18S and the 30 end of the 28S, inM. anisopliae var. anisopliae isolates ITALY-12 and IMBST 9601. The

insertion sites and sub-group of these introns correlated with their closest relatives, as judged by phylogenetic analysis of intron

nucleotide sequence.

� 2003 Elsevier Science (USA). All rights reserved.

Keywords: Ribosomal RNA genes; IGS genetic polymorphism; Group-I introns; Metarhizium phylogeny; Species-specific primers

1. Introduction

The genusMetarhizium consists of a diverse group of

asexual entomopathogenic fungi, which have a global

distribution and have been isolated from more than 200

host species (Veen, 1968). Metarhizium anisopliae var.

anisopliae, the most abundant of the three species that

comprise the genus, has been used commercially inmany countries as a biological control agent (Gillespie

and Claydon, 1989; Milner, 1997). Concerns about the

impact of introduced fungal strains in the environment

and non-target hosts accentuate the need for efficient

methods capable of monitoring the establishment and

spread of the released fungus in the field (Bridge et al.,

1993; Leal et al., 1997). As in the case for most asexual

fungi, its classification and typing is usually based on

morphological characteristics (Tulloch, 1976; Rombach

et al., 1987), and/or iso-enzyme profiles (Rakotonirainy

et al., 1994; Riba et al., 1986; St Leger et al., 1992).

However, morphological characters have been shown to

have only limited potential to distinguish between spe-

cies of Metarhizium (Driver et al., 2000) and enzyme

synthesis can vary significantly during growth. The use

of several molecular approaches to detect polymor-phisms in the fungus, e.g., RFLP analysis (Bridge et al.,

1993; Pipe et al., 1995), rDNA sequence data compar-

isons (Curran et al., 1994; Rakotonirainy et al., 1994),

and RAPDs (Bidochka et al., 1994; Cobb and Clarkson,

1993; Fegan et al., 1993; Leal et al., 1994), has certainly

added valuable facets for the possible genetic finger-

printing of the fungus. However, although RAPD-PCR

was shown to be highly discriminatory, it is very sus-ceptible to contamination by non-target DNA and can

be performed reliably only on DNA from axenic cul-

tures. Alternative approaches that combine nested PCR

Fungal Genetics and Biology 38 (2003) 159–174

www.elsevier.com/locate/yfgbi

* Corresponding author. Fax: +30-210-7274318.

E-mail address: [email protected] (M.A. Typas).

1087-1845/03/$ - see front matter � 2003 Elsevier Science (USA). All rights reserved.doi:10.1016/S1087-1845(02)00536-4

mail to: [email protected]

and RFLP analysis of a gene (subtilisin Pr1; Leal et al.,1997) cluster M. anisopliae var. anisopliae isolates in

four main groups. Moreover, mitochondrial DNA

(mtDNA) RFLP analyses helped differentiation almost

at the isolate level (25 isolates placed in 20 groups;

Mavridou and Typas, 1998).

Analysis of the rDNA region of M. anisopliae (Cur-

ran et al., 1994; Driver et al., 2000; Mavridou and Ty-

pas, 1998; Pipe et al., 1995) has demonstrated its overallconserved character in this fungus. Nevertheless, some

variability was detected within the 28S region of the

rRNA gene complex, in which five group-I introns were

detected recently (Mavridou et al., 2000). To evaluate

the usefulness of rDNA for phylogenetic analysis and

genetic fingerprinting of the fungus, the complete rDNA

repeat unit was sequenced and analyzed in this work.

Primers amplifying various regions of the rDNA genecomplex were designed and used to characterize variable

areas of each region, as well as to study polymorphisms

and the phylogenetic relationships of isolates from var-

ious geographic and host origins. Particular emphasis

was placed on the intergenic spacer region (IGS), which

is known to evolve faster and previously has been shown

in other fungi to be the main source of polymorphisms

in the rDNA gene complex (Jackson et al., 1999; Pecchiaet al., 1998; Pramateftaki et al., 2000).

2. Materials and methods

2.1. Isolates, media and growth conditions

Forty M. anisopliae var. anisopliae, one Metarhizium

anisopliae var. acridum, oneMetarhizium flavoviride var.

flavoviride, one Metarhizium flavoviride var. minus, and

two Beauveria bassiana (outgroups) isolates were used

throughout this study. Their hosts and geographical

origin are shown in Table 1. All isolates used were de-

rived from single conidial spores grown on potato dex-

trose agar (PDA) plates. Isolates were maintained on

PDA slopes stored at 4 �C or as conidial suspensions in10% glycerol at )80 �C.

2.2. DNA preparation, primers, and PCR amplification

Methods for fungal mycelium preparation and DNA

extraction have been described previously (Typas et al.,

1992). Plasmid DNA isolation, buffers, restriction, and

electrophoresis techniques were according to standardprotocols (Sambrook et al., 1989).

Total DNA from each isolate was subjected to

polymerase chain reaction in a GTC-2 Genetic Thermal

Cycler (Precision Scientific) programmed as follows:

initial denaturation 3min at 94 �C; 30 cycles of: dena-turation, 1min at 94 �C; annealing 1min (at a temper-ature corresponding to the Tm of the primers used);

extension 2min at 72 �C; and final extension, 5min at72 �C. Each reaction was performed in microfuge tubes0.5ml in a volume of 50 ll, including 5 ll reaction buffer(20mM Tris–HCl, pH 8.3, 1.5mM MgCl2, 50mM KCl,

and 0.1% Triton X-100), 100 lM of each dNTP, 40 pmolof each primer, 2u DisplayTAQ FL (5.0 u �ll�1, DisplaySystems Biotech), 50 ng of template DNA and sterile

ultra pure water. The complete reaction mixtures were

prepared at room temperature and sealed with a drop ofmineral oil before thermal cycling. The reaction prod-

ucts were analyzed on a 0.7% agarose gel in 1� TAEbuffer. A 1 kb DNA ladder (Gibco-BRL) was included

as DNA size marker. PCR products were cloned in

vector pAdvanTage using the AdvanTage PCR Cloning

Kit (Clontech). PCR primers used to amplify the dif-

ferent regions of the rDNA gene complex are shown in

Table 2 and their relative position in the ribosomal re-peat unit is indicated with arrows in Fig. 1.

2.3. DNA sequencing and data analysis

Plasmid DNA from cloned PCR products in vector

pAdvanTage was purified using GeniePrep Kit (Am-

bion) or Qiagen Plasmid Purification Kits. Sequencing

reactions were carried out manually by the dideoxychain termination method of Sanger et al. (1977) using35S-labeled adenine and T7 DNA polymerase (Sequen-

ase Version 2.0 T7 DNA Polymerase Kit, USB), uni-

versal forward and reverse primers and 3lg of templateplasmid DNA. Nucleotide sequence that was initially

obtained was used to design internal primers. These

internal primers were used to amplify further PCR

products and to complete the sequence. PCR productDNA was purified using a JETquick, PCR Purification

Spin Kit (Genomed, Germany) and eluted with sterile

water before using for sequencing reactions in the

amount of 0.5 pmol per reaction. All sequencing reac-

tions were run in 5% polyacrylamide gels, which were

exposed to X-OMAT AR autoradiography films (Ko-

dak) from one to several days.

DNA similarity searches were performed with BasicLocal Alignment Search Tool (BLAST 1.4 10MP;

Altschul et al., 1990), DNA sequence alignments were

made using PCGENE 6.8 (IntelliGenetics, Switzerland),

CLUSTAL 1.5, and CLUSTALX (Thompson et al.,

1994). Deposited sequences were retrieved from Gen-

Bank. Secondary structures of introns were constructed

by comparative sequence analyses with the format pro-

posed by Damberger and Gutell (1994), and intron sub-groups were determined by comparison with sub-group

representatives from the web site at www.rna.icmb.ut-

exas.edu/RNA/GRPI/introns.html. The location and

flanking sequences of each intron were determined by

comparing with the corresponding SSU or LSU se-

quences of Saccharomyces cerevisiae (Georgiev et al.,

1981) or Escherichia coli (J01695). The numbering of

160 M.P. Pantou et al. / Fungal Genetics and Biology 38 (2003) 159–174

http://www.rna.icmb.utexas.edu/RNA/GRPI/introns.html

http://www.rna.icmb.utexas.edu/RNA/GRPI/introns.html

sequence position after which the introns were inserted is

according to the generally accepted terminology, i.e., Sc

for S. cerevisiae and Ec for E. coli sequence positioning.

DNA sequences were preliminarily aligned with

ClustalW with the multiple alignment parameters set

to default and then edited by visual inspection. All

Table 1

Isolates used, their hosts and their geographical origin

Isolate Host Origin

Metarhizium anisopliae var. anisopliae

ATHUM 2920 Coleoptera: Scarabaeidae (Melolontha melolontha) France

ARSEF 438 Orthoptera: Gryllidae (Teleogryllus commodus) Australia

ARSEF 439 Orthoptera: Gryllidae (T. commodus) Australia



ARSEF 703 Lepidoptera: Bombycidae China

ARSEF 727 Orthoptera: Tettigoniidae Brazil

IIBC I 90574 Orthoptera: Acrididae (Acrotylus humbertianus) Pakistan

IIBC I 91676 Orthoptera: Acrididae (Oxya multidentale) Pakistan

IMBST 9601 Coleoptera: Scarabaeidae (Melolontha melolontha) Austria

IMBST 9602 Coleoptera: Scarabaeidae (M. melolontha) Austria

IMBST 9609 Coleoptera: Scarabaeidae (M. melolontha) Austria

IMI 152222 Coleoptera: Curculionidae (Myllocerus discolor) India

IMI 168777ii Orthoptera: Acrididae (Schistocerra gregaria) Ethiopia

IMI 298059 Coleoptera: Scarabaeidae (Scapanes australis) Papua New Guinea

IMI 298061 Coleoptera: Hispidae (Brontispa longissima) Papua New Guinea

IMI 299981 Homoptera: Cercopidae Trinidad

IMI 299984 Homoptera: Cercopidae Trinidad

ITALY-1 Lepidoptera: Pyrallidae Italy



KVL 130 Lepidoptera: Noctuidae Denmark

KVL 275 Lepidoptera: Torticidae (Cydia pomonella) Austria

KVL 96-31 Soil Denmark

KVL 97-1 Soil Denmark

KVL 97125 Soil Denmark

Ma-43 Lepidoptera: Torticidae (Cydia pomonella) Austria

ME1 Coleoptera: Curculionidae USA

NR 48 Orthoptera Thailand

V38 Dermaptera: Forriculidae England

V55 Unknown Unknown

V78 Unknown Unknown

V86 Unknown Unknown

V208 Orthoptera Brazil

V219 Unknown Unknown


V245 Soil Finland

V248 Soil Finland

1046 Coleoptera: Scarabaeidae Japan

1015 Unknown Unknown

Metarhizium anisopliae var. acridum

Ma-48 Patanga succinata Thailand

Metarhizium flavoviride var. flavoviride

ARSEF 1184 Coleoptera: Curculionidae France

Metarhizium flavoviride var. minus

ARSEF 1768 Homoptera: Delpacidae Solomon Islands

Beauveria bassiana



ATHUM 2920: (CBS247.64, MUCL 9646), University of Athens Fungal Collection, Athens Greece; ARSEF: US Department of Agriculture,

Agriculture Research Service Entomopathogenic Fungus Collection, USDA-ARS; IMBST: Institut f€uur Mikrobiologie, Leopold-Franzens Univer-

sit€aat, Innsbruck, Austria; IMI: International Mycological Institute, Egham, UK; ITALY: L. Rovesti, Centro di studio dei Fitopharmaci, Bologna,Italy; KVL: Royal Veterinary and Agricultural University, Frederiksberg, Denmark; Ma: Biologische Bundesanstalt, Darmstadt (Dr. Zimmermann);

V: School of Biological Sciences, Swansea, UK (Dr. Butt); 1046, 1015: K. Charnley, University of Bath, UK.

M.P. Pantou et al. / Fungal Genetics and Biology 38 (2003) 159–174 161

phylogenetic analyses were performed using v4.0b8a of

PAUP* (Phylogenetic Analysis Using Parsimony;

Swofford, 2001). Gaps were encoded as missing data

and were thus excluded from analyses. To increase the

chance of finding the most-parsimonious trees (MP),

100-replicate heuristic searches were performed usingrandom addition of sequences. All MP trees produced

were within a single tree island and all branch lengths

equal to 0 were collapsed to polytomies. Phylogenetic

analyses using neighbor-joining were performed using

the Kimura two-parameter model. Parsimony boot-

strapping was performed with 500 replicates and a

50% majority rule tree was produced. ITS1-5.8S-

ITS2 sequences from all Metarhizium strains(AF516287-321 and AF516324-25), the two Beauveria

strains (AF516322-23) and sequences published by

Driver et al. (2000) were used to monitor genetic

distances (Fig. 5). [Only sequences showing some de-

gree of variability are shown in the tree]. For the

analysis of the 18S region, five sequences of this study,

i.e., one representative from each of the three M.

anisopliae var. anisopliae IGS groups (AF218207, iso-late ME1, group-A; AF487274, isolate KVL 275,

group-B; AF487273, isolate IMBST 9601, group-C),

and the corresponding region of the isolate ITALY-12

(AF487276) and M. anisopliae var. acridum

(AF487275), were aligned with the most similar pub-

lished SSU rDNA sequences: B. bassiana (AF280633),

Beauveria brongniartii (AB027335), Beauveria caledo-

nica (AF339570), Cordyceps militaris (AB070373),Cordyceps ophioglossoides (AB027321), Cordyceps

scarabaeicola (AF339574), Epichloe typhina (U32405),

Table 2

Primers used for the amplification of the rDNA repeat of M. anisopliae var. anisopliae

Primer Sequence (50–30) Source

18SF GCGAAACTGCGAATGGCT This work

18SR GTAATGATCCCTCCGCTG This work

TW81 GTTTCCGTAGGTGAACCTGC Curran et al. (1994)

AB28 ATATGCTTAAGTTCAGCGGGT Curran et al. (1994)

Ma-ITS2 GGTCCACTGCCGTAAAACCCC This work

Ma-28S GCCGACTTCCCTTATCTAC This work

Vdal4 GCAGCAGGTCTCCAAGGT Pramateftaki et al. (2000)

Vdal2 GCGACGTCGCTATGAACG Pramateftaki et al. (2000)

Vdal3 CGTCGTGAGACAGGTTAG Pramateftaki et al. (2000)

Vdal7 GAGCCATTCGCAGTTTCG Pramateftaki et al. (2000)

Ma-18S1 GTTGATTCTGCCAGTAGTC This work

Ma-5.8S CCAGAACCAAGAGATCCG This work

TW81-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGGTCTCCG

TTGGTGAACCAGC

This work

Ma-28S3 GAATCAGCGGTTCCTCTCG This work

Ma-28S4 CCTTGTTGTTACGATCTGCTGAGGG This work

Ma-18S4 TAATGAGCCATTCGCAGTTTCGCTG This work

Ma-IGS1 CGTCACTTGTATTGGCAC This work

Ma-IGSspF CTACC(C/T)GGGAGCCCAGGCAAG This work

Ma-IGSspR AAGCAGCCTACCCTAAAGC This work

Fig. 1. Schematic presentation of the rDNA gene complex of Metarhizium anisopliae. Arrows at the top mark sequencing reactions. Position and

orientation of primers are indicated by bented arrows. Primers placed over the repeat are designed according to sequences of Verticillium dahliae

ribosomal repeat, whereas primers placed below the repeat are based on Metarhizium anisopliae var. anisopliae sequences. The restriction sites of

endonucleases SacI and SacII are also displayed.


http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AF516287-321



http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AF218207






http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AB027335





http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=U32405

Metarhizium anisopliae (AF280631), M. anisopliae

strain IF05940 (AB027337), M. anisopliae var. frigi-

dum (AF339578), Metarhizium anisopliae var. majus

(AF339579), M. flavoviride var. minus (AF280632),

Tolypocladium inflatum (AB044634), Hypocrea lutea

(AB027338), Nectria cinnabarina (U32412), Neocos-

mospora vasinfecta (U32414), Volutella ciliata

(AJ301967), Verticillium bulbillosum (AF339591), V.

suchlasporium (AF339615), Paecilomyces fumosoroseus

(AB032475), Paecilomyces lilacinus (AF339583),

Myrothecium verrucaria (AJ302003).

The phylogenetic analysis of Metarhizium introns

along with the most similar SSU or LSU introns was

carried out as described above. The accession numbers

of the sequences used are marked on Figs. 8a–b.

2.4. Denaturing gradient gel electrophoresis

Denaturing gradient gel electrophoresis (DGGE) of

PCR products generated by the TW81-GC/Ma-5.8S

primer pair was performed with the use of the DCode

Universal Mutation Detection System (BioRad) ac-

cording to the instructions of the manufacturer. The

GC-rich tail added at TW81 primer was designed ac-

cording to Heuer et al. (1997). Polyacrylamide (10% w/v) gradient gels (1mm thick, 1� Tris–acetate–EDTA[TAE] buffer; 37.5:1 ratio of acrylamide-bis-acrylamide;

30–45% denaturant; 16� 16 cm) were poured with theaid of the gradient maker Model 475 Gradient Delivery

System (BioRad). The 100% denaturating acrylamide

contained 7M urea and 40% formamide. Two hun-

dred ng of amplified DNA were loaded per well and gels

were run for 3.5 h at 160V in 1� TAE buffer at a con-stant temperature of 60 �C before silver-staining.

3. Results

3.1. Cloning and sequencing of the rDNA repeat unit

Previous studies have shown that M. anisopliae var.anisopliae isolate ME1 can be considered as a typical

representative strain of the species (Mavridou and Ty-pas, 1998). Total DNA from this strain was used as

template in a series of PCR reactions with the sets of

primers 18SF/18SR, TW81/AB28S, Ma-ITS2/Ma-28S,

Vdal4/Vdal2, and Vdal3/Vdal7 (Table 2). All PCR

products recovered were cloned and sequenced. To de-

tect the true sequences at the end of each PCR product,

as well as to verify the structural map constructed, in-

ternal primers from the sequences obtained were de-signed and used both as forward and reverse in order to

amplify upstream and downstream of each PCR prod-

uct. The sequencing strategy followed and the positions

of primers are shown in Fig. 1. The total length of the

rDNA repeat unit was 8118 bp (AF218207) and it is

organized in the typical eucaryotic fashion. Following

DNA sequence alignment and comparisons with the

respective regions of other filamentous fungi the exactsize of each gene was estimated namely 1792 bp for the

18S rDNA, 466 bp for the ITS1-5.8S-ITS2 region,

3337 bp for the 28S rDNA and 2523 bp for the IGS re-

gion. Analysis of the region between 28S and 18S (IGS)

showed absence of 5S rRNA-like gene sequences and it

is therefore concluded that this gene is unlinked to the

rRNA major transcription unit.

3.2. Strain polymorphism within the rRNA gene regions,

presence of introns and their secondary structures

DNA from all Metarhizium isolates listed in Table 1

was used as template to screen for PCR product poly-

morphisms. Amplification of the ITS1-5.8S-ITS2 region

of all isolates with primers TW81/AB28 resulted in

identical in size PCR products. Since the ITS1 spacer offilamentous fungi exhibits higher variability than the

conserved 5.8S gene and/or the ITS2 region (Hershko-

vitz and Lewis, 1996; Kuninaga et al., 1997; Zare et al.,

1999), we analyzed this region with DGGE, which can

detect even single bp differences. Primer Ma-5.8S was

paired with the TW81-GC primer, which had been

modified by us to carry a 40 bp GC-rich tail (Heuer

et al., 1997; Table 2). The resulting PCR products con-tained the entire ITS1 spacer region and 13 bp from

Fig. 2. Denaturing gradient gel electrophoresis (DGGE) of the amplified products from different isolates of Metarhizium anisopliae var. anisopliae

using the set of primers TW81-GC/Ma-5.8S.











http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AJ301967





http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AJ302003


either flanking region, i.e., leftwards the 18S and right-wards the 5.8S. As illustrated in Fig. 2 the variation of

amplified fragments was extremely limited and isolates

of Metarhizium can be placed in only four groups. The

first contains almost all (39)M. anisopliae var. anisopliae

isolates (representatives shown in Fig. 2, lanes 1–7), the

second includes the M. anisopliae var. acridium isolate

(Fig. 2, lane 8), the third the two M. flavoviride strains

(Fig. 2, lanes 9–10) and the fourth contains only M.

anisopliae var. anisopliae isolate V242 which appeared to

contain both types of bands (Fig. 2, lane 13). The two

outgroup B. bassiana strains were clearly separated (Fig.

2, lanes 11–12). [Faint bands observed in some lanes,

other than the distinct and sharp main products, are

artifacts of the technique]. It is clear therefore that al-

though the method is sensitive enough to group species

isolates even at the variety level, the odd unexplainedisolate may be out-grouped. Nevertheless, the results

confirm previous reports on the conserved character of

this region in M. anisopliae (Curran et al., 1994; Driver

et al., 2000; Mavridou and Typas, 1998).

The 18S-ITS1 region of all isolates was amplified

using primers Ma-18S1/Ma-5.8S, and with the exception

of M. anisopliae var. anisopliae isolate ITALY-12 and

the two B. bassiana strains V216, V234, all other isolatesproduced the expected 2.0 kb PCR product. These iso-

lates generated PCR products of approximately 2.3 kb

and when analyzed by restriction endonucleases knownto have single restriction sites in this region they clearly

indicated the presence of an inserted sequence within the

SacI/SacII fragment (Fig. 1; data not shown). The SacI/

SacII fragments were cloned, sequenced and found to

contain group-I introns. M. anisopliae var. anisopliae

isolate ITALY-12 contained a 478 bp intron, named

Ma-int4 (AF487276), whereas both B. bassiana strains

(V216 and V234) contained an identical intron (392 bp,named Bb15; AF363478), which was only 28.6% similar

to Ma-int4. Careful analysis of the site of insertion

showed that the two different introns (Ma-int4 and

Bb15) were inserted after position 1164 of the complete

sequence (corresponding to position 943 of E. coli;

Gutell, 1993; hereafter referred to as Ec). They con-

tained all the characteristic features of group-I introns,

i.e., (a) the P,Q,R,S motifs, (b) stem-loop constructs P1-P9, (c) the last exon base U, immediately upstream of

the 50 intron splice site and the last intron base G, pre-ceding the 30 intron splice site, and (d) similar positionsof insertion with other group-I introns. The predicted

secondary structure of Ma-int4 was constructed (Fig.

3A) and it was found to display an extended P2.1 stem.

When its entire sequence was compared with other

group-I fungal introns inserted after the same positionin the 18S sequence (including Bb15), especially those

recently discovered in entomopathogenic fungi, i.e.,

Fig. 3. Predicted RNA secondary structures of the two Metarhizium anisopliae var. anisopliae introns (a) Ma-int4; (b) Ma-int5.




M. anisopliae (Mavridou et al., 2000), Cordyceps (Nikohand Fukatsu, 2000, 2001) and B. bassiana (AY091576-

83), it exhibited little similarity with most of them.

However, when the comparison was restricted to the

conserved motifs, i.e., the internal guide sequence and

the P, Q, R, S regions, several SSU or LSU introns from

entomopathogenic fungi were found with almost iden-

tical sequences and a few sequences from phytopatho-

genic fungi were also included, e.g., V. longisporum,Fusarium solani var. piperis and F. solani var. phaseoli

(Table 3).

The 28S-50end region of allM. anisopliae isolates was

amplified using primers Ma-ITS2/Ma-28S (Table 2; ex-

pected size 1928 bp), but no apparent size differences

were observed (data not shown). However, when primers

Vdal4/Vdal2 were used (Table 1), which previously had

enabled the discovery of five group-I introns in M. ani-

sopliae (Mavridou et al., 2000), the resulting amplifica-

tion products of some isolates were larger than the

anticipated 1.0 kb products. Thus, apart from isolates 33

and 316 (from Madagascar), and isolate ITALY-11

(Mavridou et al., 2000), an additionalM. anisopliae var.

anisopliae isolate (IMBST 9601), and one of the two B.

bassiana outgroup isolates (V234) gave larger PCR

products, corresponding to approx. 1.4 and 1.9 kb, re-spectively. These products were cloned and sequenced in

order to establish sequence/structure similarities or dif-

ferences with the previously discovered group-I introns

of M. anisopliae inserted in the same region. Isolate

IMBST 9601 contained a sequence of 439 bp (named

Ma-int5, AF363479) and was inserted after position 4490

of the complete sequence (which corresponds to position

Ec1921 or S. cerevisiae 2263; hereafter referred to asSc2263). This intron was inserted at exactly the same

position with intron 33-int1 from the Madagascar isolate

33 (Mavridou et al., 2000) and in exactly the same target

sequence (GACTCTCTTAAGG), being 94% identicalto the latter, but notably lacking the P5d loop present in

33-int1 (Fig. 3B). Its predicted secondary structure was

drawn (Fig. 3B) and comparisons with other elements

placed it in sub-group-IC1. The B. bassiana isolate V234

contained two sub-group-IC introns (our analysis, data

not shown), both of which showed considerably lower

identity (<60%) with previously detected introns of either

M. anisopliae or B. bassiana. The first, named Bb16(426 bp; AF363480), was inserted at exactly the same

position with Ma-int5, using also the same target se-

quence, whereas the second (498 bp; named Bb17;

AF363481) was located at the same position with theM.

anisopliae var. anisopliae 33-int3 intron (5041 of the

complete sequence; Ec2449/Sc2814), and used the

same target sequence, i.e., GGGATAACTGCCT (our

analysis).Finally, amplification with the Ma-28S4/Ma-18S4

primers (expected size 2673 bp according to the ME1

sequence) gave PCR products with apparent length

polymorphisms for the Metarhizium isolates and con-

firmed that the IGS region of the fungus is highly vari-

able (data not shown). Primer walking of the region

proved that the source of variability amongst the M.

anisopliae isolates was located mainly in the region nearthe 30 end of the 28S gene, amplifiable by primers Ma-28S4/Ma-IGS1 (Fig. 1). Consequently, PCR products of

all isolates were amplified, and 20 of these, some of

which exhibited apparent size differences from the cor-

responding ME1 sequence (1032 bp; located between

5606–6637 nt of the complete ME1 sequence,

AF218207), were cloned as representatives of all am-

plicon sizes and sequenced. DNA comparisons of theabove M. anisopliae IGS sequences (AF363459-77 and

AF487272, including the reference sequence from isolate

ME1) allowed their classification into three distinct

Table 3

Alignment of the internal guide sequence, P, Q, R, and S motifs of group-I introns found in the 18S rRNA gene

Fungal species Internal

guide

Sequence

P Q R S Similarity

(%)

Sequence

No.

Metarhizium anisopliae ctgc-ccc aactgacggggaa aatccgcagc gttcagagact ataaagtcc 100 AF487276

Paecilomyces tenuipes ctgctcc- aattgcgggaaa gatccgcagc gttcagagact ataaagtcc 44.6 AB027334

Hypocrea pallida ctgctcc- aactgccgggaa aatccgcagc gttcagagact gtaaagtcc 44.6 AF281672

Isaria japonica ctgctcc- aattgcgggaaa gatccgcagc gttcagagact ataaagtcc 43.3 AB016607

Cordyceps militaris ctgctcc- aattgcgggaaa aatccgcagc gttcagagact atatagtcc 41.0 AB070373

Fusarium solani var.

piperis

ctgctcc- aattgcgggaaa gatccgcagc gtccagagact ataaagtcc 40.3 AF150487

F. solani var.phaseoli ctgctcct aactgcgggaaa gatccgcagc gttcagagact ataaagtcc 39.9 AF150481

Leucostoma cinctum ctgstccc aattgcggggaa aatccgcagc gttcagagact atatagtcc 38.3 AF191167

Beauveria brongniartii ctgctccc aattgcgggaaa aatccgcagc gttcagagact atatagtcc 37.6 AB027335

Verticillium longisporum ctgctcct aattgcgggaaa aatccgcagc gttcagagact ataaagtcc 36.2 AF153421

Cordyceps sp. 97009 ctgctcc- aattgcgggaaa aatccgcagc gttcagagact atatagtcc 34.9 AB027332

Ophiosphaerella narmari ctgcgcca aattgcgggaaa aatccgcagc gttcagagact atatagtcc 32.9 AF102197

Beauveria bassiana ctggtgct aattgcgggaaca aatccgcagc gttcaacgact atatagtc- 32.2 AF293968

Beauveria bassiana ctgctccc aattgcgggaaa aatccgcagc gttcagagact atatagtcc 28.6 AF363478


http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AY091576-83

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=AY091576-83







groups (named group-A, -B, and -C, respectively), withisolates of each group displaying almost identical mu-

tation types and sites compared with isolate ME1. In

addition to these differences, two highly divergent nu-

cleotide regions with distinctive structural motifs were

detected (Fig. 4a). The first, common to all isolates, was

restricted between nucleotides 5777 and 6109 and har-

bored most insertions/deletions responsible for the

length polymorphism observed amongst the PCRproducts. Moreover, it contained two sequence stretches

of 12 and 8 bp (referred to as boxes A and B, respec-tively hereafter), in single or multiple copies, which

shared a common orientation for each group; the dis-

tance between these stretches being always 9bp or 11 bp,

which suggests a close structural relation (Fig. 4b). Box

B sequence was highly conserved and remained invari-

able amongst the different isolates or multiple repeats of

the same isolate, whereas the Box A sequence often

varied in 1 or 2 bp. The distribution, orientation andnumber of these motifs supported further the classifi-

Fig. 4. (a) Schematic presentation of the relative position of the two variable regions. (b) Schematic presentation of the 5777–6109nt region of the

complete sequence. Deletions are marked as dotted lines and arrows at the top of boxes A and B designate their orientation. Boxes, distances between

them and insertions/deletions width are designed under scale. (c) Schematic presentation of the second variable region in the Ma-28S4/Ma-IGS1

amplified product. A 20 bp GT-rich insertion is present in all group-B strains.


cation of isolates in three groups (Fig. 4b) and helpedthe differentiation of isolate IMBST 9602 from the rest

of the group-A strains, as well as the detachment of

isolate KVL 96-31 from the rest of group-B strains. The

second divergent region was placed immediately after

position 6592 of the complete sequence (AF218207), and

corresponded to an invariable 20 bp GT-rich insertion

present only in the group-B strains (Fig. 4c). Group-C

isolates had replaced this motif by a 4-bp insertion,at exactly the same position. In general, group-C isolates

were more divergent than group-A and -B isolates, but

rather uniform when compared with each other. As

anticipated, the entire IGS region showed only moderate

similarity with other submitted sequences, but interest-

ingly enough the highest identity scores (65%) were e-

corded for Epichloe typhina (AF049677), Neotyphodium

Fig. 5. ITS phylogenetic analysis. Parsimony analysis of the ITS1-5.8S-ITS2 region identified in excess of 40,000 MP trees at length 350 (CI: 0.83, RI:

0.93 and RC: 0.77). Numbers below and above branches represent bootstrap percentages of 500 replicates. CI, consistency index; RI, retention index;

RC, rescaled consistency index.




lolii (AF049678) and Nectria galligena (NGA243082), atthe 50 upstream region of the trascript unit (7671–8118 nt), where regulatory sequences are located.

3.3. Phylogenetic analyses

As shown from DGGE analysis of the ITS1 region,

with the exception ofM. anisopliae var. anisopliae strain

V242, all other isolates (39) of the species gave identicalprofiles, failing to provide adequate discriminatory in-

formation. To evaluate whether the ITS1-5.8S-ITS2 re-

gion could provide further information for sub-grouping

isolates of M. anisopliae var. anisopliae, the region was

amplified for all isolates, including the two B. bassiana,

sequenced and compared. The sequences of the 43

Metarhizium (AF516287-321 and AF516324-25) and the

two outgroup B. bassiana isolates listed in Table 1(AF516322-23), together with all corresponding Meta-

rhizium sequences published by Driver et al. (2000) were

used to detect their genetic distances. The most parsi-

monious phylogenetic tree was drawn (Fig. 5) using only

sequences that displayed some degree of variability(identical ITS1-5.8S-ITS2 regions with previously re-

ported sequences are excluded from the tree for clarity).

All 40 M. anisopliae var. anisopliae isolates studied

here—including isolate V242—were always placed under

the same cluster (clade 9 of Driver et al., 2000) with M.

anisopliae var. anisopliae isolate ITALY-12 showing

some degree of variability. Similarly, and in accordance

with Driver�s classification, our M. anisopliae var. acri-dum isolate branches in clade 7, the M. flavoviride var.

flavoviride isolate in clade 6, and the M. flavoviride var.

minus isolate in clade 5.

To clarify discrepancies in clustering of Metarhizium

isolates, attention was focused on the 18S region. The

SSU region of representative M. anisopliae var. anisop-

liae strains from IGS groups-A, -B, and -C along with

the SSU region of the strains Ma-48 (M. anisopliae var.acridum) and the divergent according to ITS analyses

isolate ITALY-12 (IGS group-A) were amplified with

the Ma-18S1/Ma-5.8S set of primers, cloned and se-

quenced. With no differential weighting of transversions

Fig. 6. SSU rDNA phylogenetic analysis. Parsimony analysis of 888 nucleotides of the SSU rDNA identified 36 MP trees requiring 111 steps.

Bootstrap percentages over 50% from 500 replicates are shown above each supported branch. CI, consistency index; RI, retention index; RC, rescaled

consistency index.



http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=NGA243082




against transitions parsimony analysis was performedon the most similar sequences and one of the most

parsimonious trees is shown in Fig. 6. Additionally, to

check for possible sensitivity to transversion: transition

weighting the original alignment was analyzed by par-

simony with weighting 2:1, and to test for possible

sensitivity to tree-estimation procedure, neighbor-join-

ing trees were constructed using the Kimura two-pa-

rameter model. The tree topology was largely invariantto these manipulations. The data support the mono-

phyly of M. anisopliae as all the M. anisopliae var. ani-

sopliae isolates form a robust cluster, with strain

ITALY-12 slightly differentiated. Although M. anisop-

liae var. acridum isolate (Ma-48) displayed a higher de-

gree of variability, it still branched with high support

value with the rest of the group. Metarhizium anisopliae

var. majus isolate was placed in the heart of M. ani-

sopliae var. anisopliae isolates and branched with theisolate IMBST 9601 (group-C, according to our IGS

classification) displaying limited differentiation. In

agreement with Rath et al. (1995) M. anisopliae var.

frigidum strain clustered with M. flavoviride.

The correlation between ITS1-5.8S-ITS2/18S se-

quences and the non-coding IGS sequences was exam-

ined by analyzing the latter separately. The phylogenetic

tree based on IGS sequences (Fig. 7) strongly supportstopology differences, as it clearly illustrates that the 21

M. anisopliae var. anisopliae isolates (taken at random

and representing the three groups detected by the pres-

ence of motifs) can be differentiated as they cluster in

three clades, each representing group-A, -B, and -C re-

spectively (Fig. 7). Surprisingly enough, isolate ITALY-

12 which seemed to be the most divergent (Driver et al.,

2000) according to ITS1-5.8S-ITS2 and 18S sequences,

Fig. 7. IGS phylogenetic analysis. One of 477 MP trees (583 steps) found by heuristic analysis and rooted with midpoint method is shown. Numbers

below and above branches represent bootstrap percentages of 500 replicates. CI, consistency index; RI, retention index; RC, rescaled consistency

index.


had an almost identical IGS sequence with isolate KVL

97-1 and was grouped with the majority ofM. anisopliae

var. anisopliae isolates (i.e., group-A, Fig. 7). The di-

versity of the IGS region was further exploited in order

to design the species-specific primers Ma-IGSspF/Ma-

IGSspR (Table 2). These primers amplified a 380 bp

region which corresponds to the 6102–6481 nt of the

complete rDNA repeat when using as template, DNA

from the M. anisopliae var. anisopliae strains but failed

to produce products using DNA template from M.

anisopliae var. acridum andM. flavoviride strains, as well

as isolates of the closely related taxa B. brongniartii, B.

bassiana, Tolypocladium cylindrosporum, P. fumosoro-

seus, and P. lilacinus. As expected, more distant taxa of

entomopathogenic fungi, i.e., Basidiobolus ranarum,

Zoophthora radicans, Nomurea sp., and Aschersonia sp.

also failed to give PCR product with the above primers.

Finally, group-I introns of entomopathogenic fungi

inserted after the eight conserved sites of the SSU (Ec516,

Ec943, Ec989, and Ec1921) and LSU (Ec1921/Sc2263,

Ec2066/Sc2407, Ec2449/Sc2814, and Ec2563/Sc2928)were used to construct the most parsimonious phyloge-

Fig. 8. Group-I intron phylogenetic analysis. Relationships are inferred from parsimony analysis of introns inserted at indicated preferred sites of the

nuclear (a) SSU and (b) LSU rDNA. Bootstrap percentages over 50% from 500 replicates are shown below each supported branch. The accession

numbers of the sequences used are shown. CI, consistency index; RI, retention index; RC, rescaled consistency index.


netic trees shown in Figs. 8a–b. The topology of both

trees supported by clustering of introns according to the

site of insertion rather than the organism they were de-

tected. Additionally, introns inserted after the same sites

were found to belong to the same subgroup considering

their predicted secondary structures (our analysis).

4. Discussion

The nuclear rDNA gene complex of M. anisopliae

was 8118 bp long, organized in a single transcript con-

taining the 18S, 5.8S, and 28S rRNA genes, with the 5S

genes unlinked to the major transcription unit and

possibly distributed throughout the genome as is the

case in several other filamentous fungi (Lockington

et al., 1982; Selker et al., 1981). Its size is relatively

smaller than the corresponding repeat units for most of

the known fungal sequences, but larger than the smallest

recorded rDNA repeat unit from V. dahliae (Pramatef-

taki et al., 2000). The primers used to amplify regions of

the repeat unit proved that the ITS1-5.8S-ITS2, the 18Sand most of the 28S regions were, in general, very

conserved within the 43 isolates of Metarhizium, exhib-

iting also a high degree of similarity to several other

mitosporic fungi. However, in contrast with many of

these fungi (e.g., Hershkovitz and Lewis, 1996; Kuni-

naga et al., 1997; Zare et al., 1999), even the usually

most variable ITS1 spacer region was highly conserved

in M. anisopliae, providing limited information on iso-

Fig. 8. (continued)


late sequence differentiation under the most discrimi-native technique (DGGE), which placed the 40 isolates

of M. anisopliae var. anisopliae in two major groups,

leaving only one isolate (V242) as a member of the

second group. Phylogenetic analysis of the ITS1-5.8S-

ITS2 sequences of all the 43 Metarhizium strains ex-

amined in this work fully supported these findings,

showing a robust clustering of all M. anisopliae var.

anisopliae in one clade (clade 9, according to Driveret al., 2000; including isolate V242), the only exception

being isolate ITALY-12 which displayed some degree of

variability. Although DGGE analysis failed to differ-

entiate the two M. flavoviride varieties, ITS1-5.8S-ITS2

analysis placed the M. flavoviride var. flavoviride isolate

in clade 6 and the M. flavoviride var. minus isolate in

clade 5, whereas the M. anisopliae var. acridum isolate

branched in clade 7 (classification according to Driveret al., 2000). Similarly, the data from 18S sequence

analyses supported the monophyly ofM. anisopliae with

allM. anisopliae var. anisopliae isolates forming a robust

cluster, —only strain ITALY-12 differentiated slightly—,

and isolate Ma-48 ofM. anisopliae var. acridum, in spite

of its sequence variability, still branching with high

support value with the rest of the group. Undoubtedly,

these results confirm previous suggestions about theconserved character of the above regions in M. anisop-

liae var. anisopliae (Curran et al., 1994; Driver et al.,

2000; Mavridou and Typas, 1998; Pipe et al., 1995).

Polymorphisms within the rDNA gene region have

been attributed to small insertions/deletions, multiple

duplications, or, mainly, to the presence of group-I in-

trons. In eucaryotic nuclear genomes, the group-I in-

trons are found exclusively in the rDNA genes, andmost of them are located in the 18S gene of many or-

ganisms (Gutell et al., 1994), including several entomo-

pathogenic fungi (Cordyceps sp., Nikoh and Fukatsu,

2001; B. bassiana, Wang et al., databanks;M. anisopliae,

Mavridou et al., 2000). The 28S gene has been found to

harbor group-I introns at its 30-end in various fungi,including M. anisopliae, (Neuv�eeglise and Brygoo, 1994;Roesel and Kunze, 1996; Tan and Wong, 1996; Mavri-dou et al., 2000). The introns lie in specific sites of an

approx. 1000 bp long fragment of the 28S gene (4089–

5080 of the complete sequence, AF218207). Sequence

analysis of 18S and 28S PCR products larger than the

expected size revealed the presence of two new group-I

introns inM. anisopliae var. anisopliae, as well as in both

B. bassiana isolates. Notably, the 18S intron Ma-int4 of

M. anisopliae var. anisopliae isolate ITALY-12 was in-serted at exactly the same position as was the B. bassiana

Bb15 intron (Ec943). Similarly, the 28S intron Ma-int5

was inserted after the same position of the sequence, and

used the same target sequence as the B. bassiana Bb16

intron (Ec1921). These positions appear to be insertion

sites preferred by several other fungal group-I introns

from entomopathogenic fungi (Okada et al., 1998; Ni-

koh and Fukatsu, 2000, 2001; Suga et al., 2000). Athorough analysis of these sites of insertion of group-I

introns in the 18S and 28S, made by extracting the se-

quences of entomopathogenic fungi from the approx.

700 different group-I sequences in the Texas databank,

showed that these positions are highly conserved in both

genes. These positions are Ec516, Ec943, Ec989, Ec1199

for the former and Ec1921, Ec2066, Ec2449, Ec2563 for

the latter. As illustrated in Fig. 8a–b, this conservation istrue not only for the position of insertion but it also

seems to be directly associated with the type of intron

sub-group, with subgroup-IC1 inserted preferably in the

18S at position Ec943 and in the 28S at positions

Ec1921, Ec2449 and with sub-group IE inserted after

18S positions Ec516, Ec989, and Ec1199 and after 28S

positions Ec2066 and Ec2563. These data are fully

supported by most-parsimonious phylogenetic trees andrelated bootstrap values. Thus, the structural charac-

teristics of the M. anisopliae group-I introns described

here (Fig. 3) or previously (Mavridou et al., 2000) and

their conserved insertion positions (Figs. 8a–b), strongly

support the hypothesis that introns at the same insertion

sites are monophyletic, whereas introns at different po-

sitions, in the same organism, correspond to separate

insertional events (Bhattacharya et al., 1996; Gargaset al., 1995; Grube et al., 1999; Mavridou et al., 2000).

The high levels of polymorphism observed in the

beginning of the IGS region led to the easy detection of

PCR products with obviously different sizes in 20 M.

anisopliae isolates, which were further classified in three

principal groups according to the type of mutations and/

or motifs they contained. Insertions/deletions in the IGS

sequences of these isolates were located at clearly dis-tinct regions, and followed a pattern similar to isolates

within the same group (Fig. 7). The characteristic A and

B boxes observed in-between the 5777 and 6109 nt of the

complete rRNA gene complex sequence, and the char-

acteristic 20 bp GT-rich DNA stretch found at position

6592 nt render convenient tools for the identification of

the fungus. Furthermore, they confirm the classification

of isolates into three main groups. Group-C isolates,although uniform within members of the group, were

the more distantly related when compared with group-A

and -B isolates. Thus, analysis of IGS regions in con-

junction with ITSs allow simultaneously a more accu-

rate clustering as well as discrimination of strains than

the ITSs alone. In one case, i.e., strain ITALY-12, IGS

region even helped to clarify the somehow ambiguous

grouping of the strain based on ITS and 18S regionsalone. In addition, only a weak correlation between the

groupings and the hosts could be recorded, whereas no

association of group-clusters with geographical loca-

tions was revealed.

The direct and inverted repeats characterizing box A

and box B motifs in the IGS region ofM. anisopliae are

notable for the species. The only similar formation that



has been previously reported was that of the phytopath-ogenic fungus V. dahliae, in which a 39 bp repeat was

observed in multiple perfect and/or imperfect copies

(Pramateftaki et al., 2000). The close structural relation of

such repeats, in combination with their position near the

end of 28S gene, can be related to a possibly functional

role in the transcriptional termination of the 35S rRNAor

in the maturation of the 35S precursor molecule, as this

region has been reported to contain several regulatingsequences and signals (Dutta and Verma, 1990).

The characteristic group-C 20 bp sequence inserted

after position 6592 of the complete rDNA sequence,

corresponds to a microsatellite GT-rich region. How-

ever, its presence in the IGS region, previously sug-

gested to promote unequal crossing over in order to

maintain homogeneity between rDNA repeats (Dover,

1982), combined with the recent findings of Gendrel etal. (2000) which support an inhibiting role of

ðCA=GTÞn microsatellites in the strand exchange dur-ing meiotic homologous recombination in S. cerevisiae

merits further investigation. It may therefore be con-

cluded that the highly conserved regions in the fast

evolving and highly divergent IGS region can be used

in conjunction with the characteristic motifs of the

fungus, for the designing of species- or group-specificprimers for the detection of M. anisopliae isolates in

nature.

It is generally accepted that single gene comparisons

do not always faithfully represent the history of the

entire genome of an organism and may mislead to the

wrong conclusions about the relationship of a fungus

with other members of the same species or even genus.

In fungi, although ITS and 18S sequences are extremelyabundant in the databanks, and are customarily used for

phylogenetic analyses, information on the complete

rRNA gene complex is rather limited. It comes therefore

as no surprise that the most similar sequences to the

entire M. anisopliae rDNA repeat were those of the few

fungal sequences available in the databanks, i.e., Verti-

cillium dahliae (AF104926; 76.9% identity in 5,733 bp

overlap), Magnaporthe grisea (AB026819; with 89.5%identity in 3784 bp overlap) and Filobasidiella neofor-

mans (AF356652; with 84.7% identity in 2645 bp over-

lap). Obviously, the lack of adequate numbers of

sequences covering the entire rDNA repeat—or even the

LSU region—in the databanks does not allow safe

conclusions over the phylogenetic relations of M. ani-

sopliae, particularly when analysis of SSU or LSU se-

quences clearly place the fungus in the Clavicipitales.Neverthelss, as shown by our analysis of all regions of

the ribosomal repeat and especially the IGS polymor-

phic region, the knowledge of the entire repeat sequence

provides far more information for phylogenetic analyses

and helps to resolve isolate deviations that could have

led to misclassification. Furthermore, it allows for the

designing of strictly species-specific and isolate-specific

primers which can be used for tracking a released bio-control agent in the environment.

Acknowledgments

This work has been supported by EU Grants FAIR-

98-4105 and QLRT-2000-013991.

References

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990.

Basic local alignment search tool. J. Mol. Biol. 215, 403–410.

Bhattacharya, D., Friedl, T., Damberger, S., 1996. Nuclear-encoded

rDNA group-I introns: origin and phylogenetic relationships of

insertion-site lineages in the green algae. Mol. Biol. Evol. 13, 978–

989.

Bidochka, M.J., McDonald, M.A., St Leger, R.J., Roberts, D.W.,

1994. Differentiation of species and strains of entomopathogenic

fungi by random amplification of polymorphic DNA (RAPD).

Curr. Genet. 25, 107–113.

Bridge, P.D., Williams, M.A.J., Prior, C., Paterson, R.R.M., 1993.

Morphological, biochemical and molecular characteristics of

Metarhizium anisopliae and M. flavoviride. J. Gen. Microbiol.

139, 1163–1169.

Cobb, B.D., Clarkson, J.M., 1993. Detection of molecular variation in

the insect pathogenic fungus Metarhizium using RAPD-PCR.

FEMS Microbiol. Lett. 112, 319–324.

Curran, J., Driver, F., Ballard, J.W.O., Milner, R.J., 1994. Phylogeny

ofMetarhizium: analysis of ribosomal DNA sequence data. Mycol.

Res. 98, 547–552.

Damberger, S.H., Gutell, R.R., 1994. A comparative database of

group-I intron structures. Nucleic Acids Res. 22, 3508–3510.

Dover, G., 1982. Molecular drive: a cohesive mode of species

evolution. Nature 299, 111–117.

Driver, F., Milner, R.J., Trueman, J.W.H., 2000. A taxonomic revision

of Metarhizium based on phylogenetic analysis of rDNA sequence

data. Mycol. Res. 104, 134–150.

Dutta, S.K., Verma, M., 1990. Primary structure of the non-

transcribed spacer region and flanking sequences of the ribosomal

DNA of Neurospora crassa and comparison with other organisms.

Biochem. Biophys. Res. Commun. 170, 187–193.

Fegan, M., Manners, J.M., Maclean, D.J., Irwin, J.A.G., Samuels,

K.D.Z., Holdom, D.G., Li, D.P., 1993. Random amplified

polymorphic DNAmarkers reveal a high degree of genetic diversity

in the entomopathogenic fungus Metarhizium anisopliae var.

anisopliae. J. Gen. Microbiol. 139, 2075–2081.

Gargas, A., DePriest, P., Taylor, J.W., 1995. Positions of multiple

insertions in SSU rDNA of lichen-forming fungi. Mol. Biol. Evol.

12, 208–218.

Gendrel, C.-G., Boulet, A., Dutreix, M., 2000. ðCA=GTÞn microsat-ellites affect homologous recombination during yeast meiosis.

Genes Dev. 14, 1261–1268.

Georgiev, O.I., Nikolaev, N., Hadjiolov, A.A., Skryabin, K.G.,

Zakharyev, V.M., Bayev, A.A., 1981. The structure of the yeast

ribosomal RNA genes. 4. Complete sequence of the 25 S rRNA gene

from Saccharomyces cerevisae. Nucleic Acids Res. 21, 6953–6958.

Gillespie, A.T., Claydon, N., 1989. The use of entomopathogenic fungi

for pest control and the role of toxins in pathogenesis. Pest. Sci. 27,

203–215.

Grube, M., Gutmann, B., Arup, U., de los Rios, A., Mattsson, J.,

Wedin, M., 1999. An exceptional group-I intron-like insertion in

the SSU rDNA of lichen mycobionts. Curr. Genet. 35, 536–541.





Gutell, R.R., 1993. Collection of small subunit (16S- and 16S-like)

ribosomal RNA structures. Nucleic Acids Res. 21, 3051–3054.

Gutell, R.R., Larsen, N., Woese, C.R., 1994. Lessons from an evolving

rRNA: 16S and 23S rRNA structures from a comparative

perspective. Microbiol. Rev. 58, 10–26.

Hershkovitz, M.A., Lewis, L.A., 1996. Deep-level diagnostic value of

the rDNA-ITS region. Mol. Biol. Evol. 13, 1276–1295.

Heuer, H., Krsek, M., Baker, P., Smalla, K., Wellington, E.M.H.,

1997. Analysis of actinomycete communities by specific amplifica-

tion of genes encoding 16S rRNA and gel-electrophoretic separa-

tion in denaturing gradients. Appl. Environ. Microbiol. 63,

3233–3242.

Jackson, C.J., Barton, R.C., Evans, E.G.V., 1999. Species identifica-

tion and strain differentiation of dermatophyte fungi by analysis of

ribosomal-DNA intergenic spacer regions. J. Clin. Microbiol. 37,

931–936.

Kuninaga, S., Natsuaki, T., Takeuchi, T., Yokosawa, R., 1997.

Sequence variation of the rDNA ITS regions within and between

anastomosis groups in Rhizoctonia solani. Curr. Genet. 32, 237–

243.

Leal, S.C.M., Bertioli, D.J., Butt, T.M., Peberdy, J.F., 1994. Charac-

terization of isolates of the entomopathogenic fungi Metarhizium

anisopliae by RAPD-PCR. Mycol. Res. 98, 1077–1081.

Leal, S.C.M., Bertioli, D.J., Butt, T.M., Carder, J.H., Burrows, P.,

Peberdy, J.F., 1997. Amplification and restriction endonuclease

digestion of the Pr1 gene for the detection and characterization of

Metarhizium strains. Mycol. Res. 101, 257–265.

Lockington, R.A., Taylor, G.G., Winther, M., Scazzochio, C., Davies,

R.W., 1982. A physical map of the ribosomal DNA repeat unit of

Aspergillus nidulans. Gene 20, 135–137.

Mavridou, A., Typas, M.A., 1998. Intraspecific polymorfism in

Metarhizium anisopliae var. anisopliae revealed by analysis of

rRNA gene complex and mtDNA RFLPs. Mycol. Res. 102, 1233–

1241.

Mavridou, A., Cannone, J., Typas, M.A., 2000. Identification of

group-I introns at three different positions within the 28S rDNA

gene of the entomopathogenic fungus Metarhizium anisopliae var.

anisopliae. Fungal Genet. Biol. 31, 79–90.

Milner, R.J., 1997. Prospects for biopesticides for aphid control.

Entomophaga 42, 227–239.

Neuv�eeglise, C., Brygoo, Y., 1994. Identification of group-I introns in

the 28s rDNA of the entomopathogenic fungus Beauveria bron-

gniartii. Curr. Genet. 27, 38–45.

Nikoh, N., Fukatsu, T., 2000. Interkingdom host jumping under-

ground: phylogenetic analysis of entomoparasitic fungi of the

genus Cordyceps. Mol. Biol. Evol. 17, 629–638.

Nikoh, N., Fukatsu, T., 2001. Evolutionary dynamics of multiple

group-I introns in nuclear ribosomal RNA genes of endoparasitic

fungi of the genus Cordyceps. Mol. Biol. Evol. 18, 1631–1642.

Okada, G., Seifert, K.A., Takematsu, A., Yamaoka, Y., Miyazaki, S.,

Tubaki, K., 1998. A molecular phylogenetic reappraisal of the

Gaphium complex based on the 18S rDNA sequences. Can. J. Bot.

76, 1495–1506.

Pecchia, S., Mercatelli, E., Vannacci, G., 1998. PCR amplification and

characterization of the intergenic spacer region of the ribosomal

DNA in Pyrenophora graminea. FEMS Microbiol. Lett. 166, 21–

27.

Pipe, N.D., Chandler, D., Bainbridge, B.W., Heale, J.B., 1995.

Restriction fragment length polymorphisms in the ribosomal

RNA gene complex of isolates of the entomopathogenic fungus

Metarhizium anisopliae. Mycol. Res. 99, 485–491.

Pramateftaki, P., Antoniou, P., Typas, M.A., 2000. The complete

rDNA sequence of the nuclear ribosomal RNA gene complex of

Verticillium dahliae: intraspecific heterogeneity within the inter-

genic spacer region. Fungal Genet. Biol. 29, 134–143.

Rakotonirainy, M.S., Cariou, M.L., Riba, G., 1994. Phylogenetic

relationships within the genus Metarhizium based on 28S rRNA

sequences and isoenzyme comparisons. Mycol. Res. 98, 225–230.

Rath, A.C., Carr, C.J., Graham, B.R., 1995. Characterization of

Metarhizium anisopliae strains by carbohydrate utilization

(API50CH). J. Invertebr. Pathol. 65, 152–161.

Riba, G., Soares, G.G., Samson, R.A., Onillon, J., Caudal, A., 1986.

Isoenzyme analysis of isolates of the entomogenous fungi Toly-

pocladium cylindrosporum and Tolypocladium extinguens (Deutero-

mycotina: Hyphomycetes). J. Invertebr. Pathol. 48, 362–367.

Roesel, H., Kunze, G., 1996. Identification of a group-I intron within

the 25S rDNA from the yeast Arxula adeninivorans. Yeast 12,

1201–1208.

Rombach, M.C., Humber, R.A., Evans, H.C., 1987. Metarhizium

album a fungal pathogen of leaf- and planthoppers of rice. Trans.

Br. Mycol. Soc. 37, 37–45.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A

Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory,

Cold Spring Harbor, NY.

Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with

chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–

5467.

Selker, E.U., Yanofsky, C., Driftmier, K., Metzenberg, R.L., Alzner-

DeWeerd, B., Rajbhandary, U.L., 1981. Dispersed 5S RNA genes

in N. crassa: structure, expression and evolution. Cell 24, 819–828.

St Leger, R.J., Allee, L.L., May, B., Staples, R.C., Roberts, D.W.,

1992. World-wide distribution of genetic variation among isolates

of Beauveria spp. Mycol. Res. 96, 1007–1015.

Suga, H., Oyabu, K., Ito, M., Kageyama, K., Hyakumachi, M., 2000.

Detection of intron-like sequence in small subunit rDNA 30 region

of Fusarium solani. Mycol. Res. 104, 782–787.

Swofford, D.L., 2001. PAUP (Phylogenetic Analysis Using Parsi-

mony)* v.4.0b8a. Sinauer, Sunderland, MA.

Tan, M.K., Wong, P.T.W., 1996. Group-I introns in the 26S rRNA

gene of Gaeumannomyces graminis as possible indicators of host

specificity of G. graminis varieties. Mycol. Res. 100, 337–342.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW:

improving the sensitivity of progressive multiple sequence align-

ment through sequence weighting, position-specific gap penalties

and weight matrix choise. Nucleic Acids Res. 22, 4673–4680.

Typas, M.A., Griffen, A.M., Bainbridge, B.W., Heale, J.B., 1992.

Restriction fragment length polymorphism in mitochondrial DNA

and ribosomal RNA gene complexes as an aid to the character-

ization of species and sub-species populations in the genus

Verticillium. FEMS Microbiol. Lett. 95, 157–162.

Tulloch, M., 1976. The genusMetarhizium. Trans. Br. Mycol. Soc. 66,

407–411.

Veen, K.H., 1968. Recherches sur la maladie, due �aa Metarhizium

anisopliae chez le criquet p�eelerin. Mededelingen Landbouwhoge-

school Wageningen, Nederland 68, pp. 407–411.

Zare, R., Kouvelis, V.N., Typas, M.A., Bridge, P.D., 1999. Presence of

a 20 bp insertion/deletion in the ITS1 region of Verticillium lecanii.

Lett. Appl. Microbiol. 28, 258–262.
