HAL Id: tel-03139834https://tel.archives-ouvertes.fr/tel-03139834
Submitted on 12 Feb 2021
HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.
Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0International License
Interplay between Notch signaling and cytokinesis in theDrosophila sensory organ lineage
Mateusz Trylinski
To cite this version:Mateusz Trylinski. Interplay between Notch signaling and cytokinesis in the Drosophila sensory organlineage. Cellular Biology. Sorbonne Université, 2019. English. �NNT : 2019SORUS470�. �tel-03139834�
Sorbonne Université École doctorale Complexité du Vivant
Laboratoire Génétique du Développement de la Drosophile
Interplay between Notch signaling and cytokinesis in the
Drosophila sensory organ lineage
Par Mateusz Trylinski
Thèse de doctorat de Biologie
Dirigée par François Schweisguth
Présentée et soutenue publiquement le 25 janvier 2019
Devant un jury composé de :
Mme Agnès Audibert
Mr Buzz Baum
Mr Stéphane Vincent
Mme Sarah Bray
Mr Bassem Hassan
Mr François Schweisguth
Professeur Sorbonne Université
Professeur UCL
MCU ENS Lyon
Professeur Université de Cambridge
DR Sorbonne Université
DR1 CNRS
Présidente
Rapporteur
Rapporteur
Examinatrice
Examinateur
Directeur de thèse
Acknowledgements First and foremost, I thank François for mentoring me during all these years and teaching me the
virtues and the subtleties of analytical reasoning in experimental sciences. You taught me to formulate
clearly my hypotheses, to design rigorously experiments testing them and not just confirming the
model I had in mind, to analyze critically my results, to formulate again new hypotheses, and so forth.
To deconstruct each biological question into small pieces and then patiently, step by step, bring them
together into a larger picture.
I would like to warmly thank all the present and past lab members with whom I shared so
much time during these years. First of all: Gantas! These years would never have been so great
without you. Each morning, I knew that some good time was awaiting me while you were in the lab.
Not only I found in you a terrific lab mate, but also a close friend. Khalil, such a good friend as well!
Always willing to share a good discussion about politics and, not least, some pretty good music
(unforgettable Radio Moscow!). All these things helped me to go through this thesis. Lydie, for your
unconditional willingness to help with flies or anything and for your incredible capacity in seeing the
good in all things. Vanessa, for your equally unconditional mood of yours and your communicative
laugh! I will never forget your shouts when something was not working as you expected. Elodie,
you’ve always been really attentive and willing to give tips and advice, to this day. Fred, you taught
me so many tricks with fly genetics, I’m so grateful! My crosses would never have looked the same
without you. Franck, for all the tips in my early PhD days. Maria, for your unfailing cool attitude and
your kindness. Chloe, I’ll miss our discussions on blockbusters! Alexis, you were my first master
student, I hope you enjoyed as much as I did the few months you spent with fly ommatidia. Juan, your
quirky humor that always made me smile. Tin, your beers will be unforgettable and Jang-mi, our new
fly padawan always keen on discussing science.
Stéphane, you were my first fly master. You shared with me your passion with these little
flying objects and introduced me to the beauty of their genetics and their development. At each step of
my studies, you were there to give me advice or simply to discuss science. You helped in finding my
way in the vast domain that is Biology. I’m really grateful for that.
I want also to express my gratitude to my family, who tried to be close despite the distance,
and my friends. I’m particularly grateful to Paul. Our weekly lunches were these magical breaks far far
away from science and experiments.
Last, and certainly not the least, I deeply thank Alison for supporting me during this long
journey and not being jealous with my little flies.
Content
INTRODUCTION ............................................................................................................................ 1 PREFACE ........................................................................................................................................ 3 1. NOTCH SIGNALING: MECHANISM, REGULATION AND DYNAMICS............................ 5
1.1. MECHANISM OF NOTCH RECEPTORS ACTIVATION BY ITS LIGANDS: “TRANS-ACTIVATION” . 6 1.1.1. Interaction between Notch and its ligands ..................................................................... 7 1.1.2. Conformational change of the receptor induced by ligand binding ............................... 15 1.1.3. Gamma-secretase and S3 cleavage .............................................................................. 21 1.1.4. Transcriptional activity of NICD ................................................................................. 22
1.2. REGULATION OF NOTCH RECEPTORS BY THE ENDOSOMAL PATHWAY ............................... 25 1.2.1. Notch endocytosis and regulation of surface levels ...................................................... 26 1.2.2. Recycling of Notch receptors ....................................................................................... 28 1.2.3. Degradation of Notch receptors in lysosomes .............................................................. 30
1.3. LIGAND ENDOCYTOSIS AND TRAFFICKING ........................................................................ 31 1.3.1. Ligand endocytosis and generation of the pulling force ............................................... 31 1.3.2. Ligand endocytosis and ubiquitination......................................................................... 37 1.3.3. Ligand endocytosis and trafficking .............................................................................. 43
1.4. NOTCH SIGNALING DYNAMICS ......................................................................................... 45 1.4.1. Experimental strategies to study Notch signaling dynamics ......................................... 45 1.4.2. Time-scaled genome profiling of the Notch transcriptional response............................ 53 1.4.3. Dynamic encoding of NICD production kinetics .......................................................... 55
1.5. CONCLUDING REMARKS................................................................................................... 57 2. NOTCH SIGNALING DURING DROSOPHILA NEUROGENESIS ..................................... 58
2.1. LATERAL INHIBITION AND SELECTION OF NEURAL PROGENITORS ..................................... 58 2.1.1. Embryogenesis and neuroblast selection...................................................................... 59 2.1.2. Notum patterning and SOP selection ........................................................................... 60 2.1.3. Photoreceptor R8 selection in the eye disc ................................................................... 65
2.2. CENTRAL NERVOUS SYSTEM: NEURAL EXPANSION AND CELL TYPE DIVERSIFICATION ....... 69 2.2.1. Neuroblast self-renewal............................................................................................... 70 2.2.2. Cell type differentiation and diversification ................................................................. 70
2.3. PERIPHERAL NERVOUS SYSTEM: SPECIFICATION OF THE MICROCHAETE LINEAGE ............. 71 2.3.1. The microchaete lineage: an overview ......................................................................... 71 2.3.2. Molecular mechanisms of SOP asymmetric cell division .............................................. 74 2.3.3. Unequal segregation of fate determinants and directional Notch signaling .................. 76 2.3.4. Notch is activated in pIIa, but where?.......................................................................... 80 2.3.5. Notch is activated in pIIa, but when? ........................................................................... 88
3. THE ARP2/3 COMPLEX, A MOLECULAR PIVOT BRIDGING CYTOKINESIS AND NOTCH ACTIVATION?............................................................................................................... 91
3.1. DIVIDING IN AN EPITHELIUM ............................................................................................ 91 3.1.1. Overview of cytokinesis progression ............................................................................ 92 3.1.2. Epithelial cytokinesis as a multicellular process .......................................................... 95 3.1.3. Asymmetric furrow ingression ..................................................................................... 97
3.2. ARP2/3 ROLE DURING CYTOKINESIS ............................................................................... 100 3.2.1. The Arp2/3 complex, a major actin regulator............................................................. 100 3.2.2. Regulation of the Arp2/3 complex by NPFs and inhibitors ......................................... 103 3.2.3. Contact expansion regulated by the Arp2/3 complex: the “zipper” mechanism .......... 109
3.3. ARP2/3 ROLE IN NOTCH-DEPENDENT FATE DECISIONS .................................................... 110 3.3.1. Arp2/3 and WASp requirement in Notch signaling ..................................................... 110 3.3.2. Arp2/3, WASp and Delta recycling: a problematic model .......................................... 114 3.3.3. Alternative hypotheses ............................................................................................... 115
RESULTS ..................................................................................................................................... 120 4. PAPER 1: INTRA-LINEAGE FATE DECISIONS INVOLVE ACTIVATION OF NOTCH RECEPTORS BASAL TO THE MIDBODY IN DROSOPHILA SENSORY ORGAN PRECURSOR CELLS ................................................................................................................. 121 5. PAPER 2: THE ARP2/3 COMPLEX COUPLES CYTOKINESIS TO NOTCH ACTIVATION IN THE DROSOPHILA SENSORY ORGAN LINEAGE ................................ 142
DISCUSSION AND PERSPECTIVES ........................................................................................ 180 6. DISCUSSION ........................................................................................................................... 181
6.1. APICAL VS LATERAL NOTCH SIGNALING ....................................................................... 181 6.1.1. Notch receptors: is localization reflecting function? .................................................. 181 6.1.2. Why an apical pool of Notch receptors in SOPs? ....................................................... 182 6.1.3. The lateral contact: a simple matter of area?............................................................. 183
6.2. INTERPLAY BETWEEN CYTOKINESIS AND NOTCH SIGNALING.......................................... 184 6.2.1. Contact formation and exocytosis .............................................................................. 185 6.2.2. Dual mode of Arp2/3 activation ................................................................................. 185 6.2.3. Is lineage progression hiding a “competence window”? ............................................ 186
7. PERSPECTIVES...................................................................................................................... 188 7.1. A WIDELY-APPLICABLE TECHNIQUE TO IDENTIFY NOTCH ACTIVATION SITE IN VIVO....... 188
7.1.1. Testing the contact area/Notch activity correlation .................................................... 188 7.1.2. Notch signaling site and regulatory mechanisms ....................................................... 189
7.2. ARP2/3-MEDIATED DELTA ENDOCYTOSIS: A MOLECULAR BASIS FOR THE MECHANOTRANSDUCTION MODEL ....................................................................................................
7.2.1. Towards an array of Delta endocytosis mechanisms .................................................. 190 7.2.2. Probing the forces generated by WASp-Arp2/3-dependent Delta endocytosis ............. 191
REFERENCES............................................................................................................................. 193 LIST OF FIGURES ..................................................................................................................... 224 ABSTRACT AND RÉSUMÉ ....................................................................................................... 226
3
Preface Young PhD students often hear that investigators in developmental biology are split into two
categories: those who know and those who do not know yet that they are working on the
Notch pathway. Albeit this anecdote appears presumptuous at first sight, years of research
showed that the Notch pathway is in fact reused over and over during any Metazoan
development and adult life. It appears that Notch signaling has become through evolution the
favorite cellular toolkit to mediate juxtacrine signal transmission in a wide range of cellular
and developmental contexts, including fate specification, fate maintenance, boundary
formation, patterning or morphogenesis. Recent years provided valuable insights into the
molecular mechanism of receptor activation, the role of context-specific regulators and the
function of signaling dynamics in eliciting appropriate outputs. Nonetheless, some
fundamental questions are still barely understood. Where are Notch receptors activated in
relationship with the biological context? How is Notch activity coordinated with the
progression of a developmental process? Addressing these questions would shed a new light
on our understanding of the cellular mechanisms that fine tune or dysregulate Notch signaling
activity in physiological or pathological situations, respectively.
The introduction of this thesis is divided into three chapters: the first chapter gives a
synthetic overview on our current state of knowledge about the core mechanism the Notch
pathway; the second describes the multiple uses of Notch signaling during Drosophila
neurogenesis with a specific emphasis on the thoracic microchaete lineage and the question of
Notch activation site; the last introduces the Arp2/3 complex as a potent molecular pivot
between Notch activation and cytokinesis in lineages.
5
Chapter 1
Notch signaling: mechanism, regulation and dynamics
Notch signaling is an evolutionary conserved juxtacrine pathway relying on a fairly simple
logic where one signaling input translates into downstream signaling output. In biological
terms, a single Notch receptor is activated by one ligand harbored at the cell surface of a
contacting cell and releases its intracellular domain in the cytosol, which translocates to the
nucleus and directs gene expression. Unlike most pathways, signal is not modulated
downstream the receptor and prior nuclear entry by intermediate kinases. Thereby, signal
transduction is conserved in a stoichiometric manner along the pathway and affects
transcription in the signal-receiving cell in a straightforward manner (Housden and Perrimon,
2014).
The Notch pathway is not only conserved among phyla but is used in an incredibly
wide range of processes during animal development and adult life. Depending on the
biological context, Notch can elicit diverse, and sometimes opposite, cellular responses,
including proliferation/cell death, differentiation/self-renewal, tumor formation/tumor
suppression, and so forth (Bray, 2016). Since the characterization of the core mechanism in
the 1990’s, extensive work conducted on all available model organisms revealed that Notch
signaling is subjected to an equally diverse array of regulatory mechanisms. Therefore, Notch
signaling can be viewed as a simplified module adapted by cells to transduce context specific
signals.
This first introductory chapter synthesizes the current state of knowledge on the core
mechanism of Notch activation and emphasizes how each step of this process can be
modulated to generate specificity. Second, it summarizes how the regulation of receptor and
ligand trafficking affects signaling. In particular, the role of ubiquitin-dependent ligand
endocytosis is outlined. Lastly, it focuses on the signaling dynamics of the pathway, both in
terms of transcriptional response and Notch activation kinetics.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
6
1.1. Mechanism of Notch receptors activation by its ligands:
“trans-activation”
The core mechanism of the Notch pathway consists in a four-step process: following ligand-
receptor interaction at a cell-cell contact (1), the receptor undergoes a conformational change
(2) that initiates a sequence of proteolytic cleavages, leading to the release of Notch
Intracellular Domain (NICD) in the cytosol (3). NICD then translocates into the nucleus and
acts as a transcriptional coactivator (4) (Figure 1).
Figure 1. Overview of the sequence leading to Notch activation. See text for
details. Adapted from Bray, 2016.
This section describes the current molecular models for each of these steps and briefly
presents the unanswered questions. The non-canonical Notch pathway and ligand-independent
mechanisms of Notch activation will not be detailed here and have been reviewed in
Andersen et al., 2012 and in Palmer and Deng, 2015.
1.1. Mechanism of Notch transactivation
7
1.1.1. Interaction between Notch and its ligands
The receptor-ligand interface
Notch and its ligands of the Delta/Serrate/Lag family (DSL) are type I transmembrane
proteins that interact through their extracellular domains (ECDs). Notch receptor ECDs are
made of a succession of 29 to 36 EGF repeats followed by a Negatively Regulated Region
(NRR) (Kopan and Ilagan, 2009) (Figure 2A). On the other hand, DSL ligands are
characterized by three main structural motifs: a module at the N terminus of Notch ligands
(MNNL) consisting in C2 domain with lipid binding properties, a DSL domain analogous to
EGF repeats and additional EGF repeats (6 to 16) (Kopan and Ilagan, 2009) (Figure 2B).
Figure 2. Structure and organization of Notch receptors (A) and DSL ligands (B).
Adapted from Gordon et al., 2008.
Early molecular characterization of Notch domains showed that receptor-ligand
engagement (Fehon et al., 1990; Heitzler and Simpson, 1991) is mediated by the interaction
between Notch EGF11-12 (Rebay et al., 1991) and the DSL domain (Shimizu et al., 1999).
Recent technological advances in membrane protein crystallography shed a new light both on
structures of isolated receptor and ligand ECDs and on the structure of the receptor-ligand
complex (reviewed in Kovall et al., 2017). Analysis of crystalized receptor and ligand ECDs
challenged the common view where receptor and ligand structures resemble linear and rigid
threads that extend from the cell surface (Cordle et al., 2008; Hambleton et al., 2004). In the
contrary, they rather alternate rigid segments with flexible pivots and bent regions, suggesting
Chapter 1. Notch signaling: mechanism, regulation and dynamics
8
that ECDs might support different conformation and consequently present different binding
affinities depending on their conformation (Kershaw et al., 2015; Weisshuhn et al., 2016).
Resolution of a Notch1-Dll4 complex confirmed this idea and revealed that receptor
and ligand ECDs interact in an anti-parallel fashion (Luca et al., 2015), a conformation that
supports both trans-activation and cis-inhibition (i.e. when ligand and receptor interact on the
same cell surface, see “Cis interactions”) (Figure 3). In addition, in contrast with former
models, they unveiled that the MNNL directly interacts with EGF12. Authors speculated that
this second interaction site might play a key role in modulating binding affinity in response to
post-translational modifications. Whereas the residues involved in the MNNL-EGF12
interface of the Notch1-Dll4 complex are poorly conserved among other receptors and
ligands, the EGF11-DSL interface shows high sequence homology. Finally, they provided a
structural basis for the role of sugar-based post-translational modifications of the receptor in
modifying receptor-binding affinity (see “Receptor glycosylation” in this subsection).
Figure 3. Structure of the Notch1-Dll4 complex in trans and cis conformations.
Adapted from Luca et al., 2015.
1.1. Mechanism of Notch transactivation
9
Of note, the crystal of the Notch1-Dll4 complex was resolved with mutated ligands
displaying an enhanced binding affinity for the receptor, interactions of endogenous receptor-
ligand complexes being too weak in solution to allow crystallization. Intriguingly, although
these affinity-enhancing mutations were found in the DSL and MNNL regions, they did not
affect residues that directly contacted EGF11-12. Hence, these substitutions might stabilize
the DSL and MNNL modules in a conformation that would strengthen binding interactions.
This might suggest that wild-type ligands are more flexible and would undergo dynamic
conformational changes at the cell surface with differential binding affinities. However,
whether such changes occur in living cells and how that might affect receptor activation and
signaling dynamics remain to be tested.
Ligand specificity
Identification of multiple Notch ligands (Delta and Serrate in Drosophila, Dll1-4 and
Jagged1-2 in mammals, Figure 2B) raised the question whether they can activate Notch in a
similar fashion to trigger the same biological outputs. Early work in Drosophila showed that
Delta and Serrate are interchangeable depending on the context. On one hand, Delta and
Serrate are either replaceable by one another or redundant during early embryonic
neurogenesis and in the peripheral nervous system, respectively (note that compensation
experiments of Delta by Serrate in the embryo were based on Serrate overexpression. It is still
unknown whether Serrate elicits the same response as Delta in Drosophila when expressed at
Delta endogenous levels) (Gu et al., 1995; Zeng et al., 1998). Similar results were obtained in
the chick inner ear and during primary neurogenesis in Xenopus laevis (Adam et al., 1998;
Kiyota et al., 2001). On the other hand, activity of Fringe, a transferase that adds glycans on
Notch ECD (see “Receptor glycosylation” in this subsection), discriminates between Serrate
and Delta in their capacity to activate Notch during dorsal-ventral margin specification in
Drosophila wing and eye discs, suggesting that both ligands are not equivalent depending on
the cellular context (de Celis and Bray, 1997; Fleming et al., 1997; Panin et al., 1997).
Since ECD sequences of Delta and Serrate differ by the number of EGF repeats (9 and
17, respectively) and the presence of a cystein-rich domain in Serrate, one could expect that
these two proteins would interact differently with Notch, which might in turn translate into
different capacities to activate Notch (see below). However, such differential behavior has
also been reported when comparing two close paralogs, Dll1 and Dll4 (Preuße et al., 2015).
Homozygous Dll1Dll4ki mouse embryos, where Dll4 is knocked into the locus of Dll1, failed to
give rise to adult mice and exhibited contrasting phenotypes in Dll1-dependent processes. For
Chapter 1. Notch signaling: mechanism, regulation and dynamics
10
example, while the retinal neuroepithelium was normally formed, somitogenesis was strongly
impaired. This indicates that, despite similar sequences, Dll4 can fully replace Dll1 only in
specific developmental and cellular processes.
What could be the basis of these ligand-specific processes? One part of the answer lies
in the structure of the receptor-ligand complex. Inducing a point mutation in EGF8 of
Drosophila Notch, termed “jigsaw”, was sufficient to impair Notch-Serrate signaling and
decrease Serrate binding affinity for Notch, while neither Delta signaling activity nor its
binding affinity to Notch were affected (Yamamoto et al., 2012). Comparison between the
structures of Dll4-Notch1 and Jagged1-Notch1 complexes revealed that the interacting
surface between Jagged1 and Notch1 was smaller, consistent with Dll4 high affinity for
Notch1 in vitro, and confirmed the role of EGF8 in stabilizing Notch1-Jagged1 interactions
(Luca et al., 2015, 2017). These differences were then correlated with the differential
capacities of the ligands to drive the conformational change of Notch1, a key step leading to
receptor activation (detailed in subsection 1.1.2.). In brief, while Dll4 could activate Notch1
when forces as low as 4 pN were applied, Jagged-1 mediated activation required a tensile
force of 12 pN. These results led the authors to conclude that cells could discriminate between
different ligands through this differential mechanical requirement. Another implication of this
observation was that Notch1-Jagged1 complexes experienced two different states depending
on the force regime: unproductive/low forces and productive/high forces, raising the
hypothesis that unproductive Notch1-Jagged1 complexes might behave as sinks until higher
forces are exerted and, moreover, explain how ligands can “trans-inhibit” receptors in specific
contexts (Benedito et al., 2009).
However, how do these mechanical requirements translate into distinct NICD
productions dynamics and specific physiological outputs in the signal receiving cell remains
unclear and will be discussed in subsection 1.4.3.
Receptor glycosylation
Glycosylation on receptor ECDs plays a critical role in tuning the affinity between the
receptors and its ligands. In parallel, glycosylation, in particular O-fucosylation and O-
glucosylation, can also modulate Notch signaling by regulating receptor trafficking from the
ER to the surface and protein stability. As this will not be discussed in this introduction,
additional details can be found in Harvey and Haltiwanger, 2018.
The landmark discovery that Fringe, a modulator of Notch activity that discriminates
between Delta and Serrate signaling (Panin et al., 1997), is a glycosyltransferase was crucial
1.1. Mechanism of Notch transactivation
11
to appreciate the role of glycosylation in regulating Notch signaling (Brückner et al., 2000;
Moloney et al., 2000a). Since then, several forms of glycosylation have been characterized, as
well as their respective transferases, including O-fucosylation (Ofut1/POFUT1), O-
glucosylation (Rumi/POGLUT1), and O-GlcNacylation (EOGT/EOGT1) (reviewed in
Harvey and Haltiwanger, 2018). O-fucose and O-glucose residues can be further elongated by
GlcNac-transferases (Fringe/Fringe family) and xylosyl-transferases (Shams/GXYLT1-2),
respectively (Figure 4). These modifications are added on serine and threonine residues of
EGF repeats. Loss of function studies showed that O-fucosylation and O-glucosylation are
essential for Notch signaling (Acar et al., 2008; Okajima and Irvine, 2002; Shi and Stanley,
2003), while glycan elongation mediated by Fringe/Fringe family or Shams/GXYLT1-2
rather act as modulators of Notch activity (Harvey and Haltiwanger, 2018; Lee et al., 2013).
Finally, biochemical analyses of transferase activities helped in constituting a consensus
sequence associating each type of modification to an EGF repeat (Figure 4). This unraveled
an incredible number of putative sites, ECD of Drosophila Notch being predicted to carry 22
O-fucose, 18 O-glucose and 18-GlcNac sites (Moloney et al., 2000b; Rampal et al., 2007).
However, despite such complexity, recent progress has been made in understanding how these
modifications, alone or in combination with other glycosylated residues, influence receptor-
ligand interactions.
Figure 4. Types of glycan modifications found in Notch EGF repeats. Adapted
from Harvey and Haltiwanger, 2018.
First, structural studies provided functional evidence for glycosylation in receptor-
ligand binding, confirmed former mutational analyses and identified unknown glycan
modifications in the ligand-interacting surface (Luca et al., 2015). Among the key findings,
Chapter 1. Notch signaling: mechanism, regulation and dynamics
12
they revealed that O-fucose residue from Notch1 EGF12 directly interacted with the MNNL
domains of Dll4 and Jagged-1, thereby providing a structural basis for O-fucose requirement
in Notch signaling. Complementarily, modeling O-fucose elongation at this site by Fringe
transferases showed how glycan elongation can modulate receptor affinity for its ligand.
Thus, this O-fucose residue not only plays a critical role in the receptor-ligand interaction, but
also in its modulation. In addition, O-fucose residue from EGF8 was shown to directly
interact with Jagged-1 MNNL (of note, the residue from EGF8 affected in the jigsaw
mutation is distinct from the O-fucose site), highlighting the importance of EGF8 in the
Notch1-Jagged1 interaction. Nonetheless, despite the structural rationale they provided for
glycosylation function in receptor-ligand binding, these studies focused only on EGF8-12,
letting unsolved the role of modifications lying on the remaining EGF repeats, as well as the
combinatorial effects of these modifications on receptor-ligand interactions.
Second, taking advantage of recent advances in semi-quantitative mass spectrometry
methods, the Haltiwanger group built a comprehensive map of Notch glycan modifications in
Drosophila S2 and mammalian cells in presence or absence of Fringe transferases (Harvey et
al., 2016; Kakuda and Haltiwanger, 2017) (Figure 5). In S2 cells, they first showed that all
receptors do not present the same glycan modifications, implying that different pools of
receptors coexist in cells based on their glycosylation status (Harvey et al., 2016) (Figure 5A-
C). Similar results were obtained with endogenous Notch receptors extracted from embryos.
When characterizing the nature of the glycan modifications, they observed that while O-
fucose sites were modified to high stoichiometries, Fringe-mediated elongation occurred only
in a subset of these sites. Alike, most O-glucose sites were occupied while xylose elongation
was detected only in a subset of them. This suggests that glycan elongation is sequence and
presumably context specific. They later tested in mammalian cells how glycan modifications
mediated by the Fringe family transferases, Manic Fringe (MFNG), Lunatic Fringe (LFNG)
and Radical Fringe (RFNG), influence Notch1 activation by Dll1 or Jagged-1 (Kakuda and
Haltiwanger, 2017). They characterized three classes of glycan modifications: Dll1 and
Jagged-1 activity enhancing, Dll1 activity enhancing and Jagged-1 activity inhibiting (of note,
RFNG could not modify O-fucose sites leading to Jagged-1 inhibition) (Figure 5D).
Therefore, depending on the context, Fringe activity in mammals might result either in
activation or inhibition of Notch1 activity. Intriguingly, some functional sites lied outside the
EGF8-12 binding domain, raising the question of how these modifications affect the
interacting interface.
1.1. Mechanism of Notch transactivation
13
Figure 5. A comprehensive and functional map of glycan modifications on Notch
EGF repeats. (A-C) Glycosylation status of Notch receptors in Drosophila S2
cells. (D) Role of Fringe activity in modulating receptor-ligand affinity. Adapted
from Harvey and Haltiwanger, 2018.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
14
All taken together, these structural and biochemical data suggest that generating
heterogeneity in the receptor glycosylation status is a potent mechanism in fine tuning Notch
activity levels in response to ligand exposure. However, many questions remain unanswered.
For example, how do the O-glucose residues, which do not interact directly with the ligand,
enhance receptor susceptibility to proteolysis (Acar et al., 2008; Luca et al., 2015)? Why only
a subset of sites is subjected to Fringe elongation? Are different glycosylation patterns of
receptors correlating with distinct subcellular localizations? Is glycosylation a reversible
process? It seems that, so far, only the tip of the iceberg has been reached in our
understanding of receptor glycosylation and many exciting discoveries are awaiting
researchers.
Cis interactions
Receptors and ligands of the Notch pathway not only interact in trans, but also in cis (Figure
6). Since this section is dedicated to trans-activation, the role of cis interactions will be here
only briefly described. More details can be found in del Álamo et al., 2011.
Figure 6. Mechanisms of receptor-ligand cis-inhibition. Adapted from del Álamo
et al., 2011.
Genetic studies in Drosophila first hinted that cis-interactions between Notch and its
ligands might have an inhibitory effect. In the wing pouch, Notch receptors could be activated
1.1. Mechanism of Notch transactivation
15
only at the border of domains with high levels of ligands but were inhibited within these
domains (de Celis and Bray, 1997; Micchelli et al., 1997). In addition, ectopic expression of
Delta or Serrate in domains where Notch is normally activated was sufficient to prevent
expression of Notch downstream targets. This phenomenon was subsequently referred to as
“cis-inhibition”.
Despite this initial observation, few biological processes were identified where cis-
inhibition plays a critical role in regulating Notch signaling. Moreover, the mechanism by
which ligands inhibit receptors stays largely unknown. The Elowitz group has provided
experimental and computational evidence that cis-ligands titrate receptors at the cell surface,
hence excluding models based on catalytic processes (Sprinzak et al., 2010). However, since
their experimental strategy was based on a cell culture assay where trans/cis ligands and
receptors were located at the same contact surface, it remains a matter of debate whether their
model can be applied to heterogeneous cell-cell interfaces where receptors could theoretically
interact with cis- or trans-ligands depending on their location in the cell.
Finally, it was recently reported on BioRxiv that Notch receptors could be cis-
activated in isolated cultured cells that express both Notch receptors and its ligands (Elowitz
et al., 2018). This observation was confirmed with several receptor-ligand pairs in different
cell types with either overexpressed or endogenous Notch components. To demonstrate the
biological relevance of cis-activation, authors inhibited Notch cis-activation in isolated neural
stem cells (NSCs) and observed decrease in the survival rate. Given that Notch activity is
required in vivo for NSC maintenance, they concluded that cis-activation might occur in vivo
and regulate physiological processes. Nonetheless, these unexpected observations left many
questions unanswered: how cis-interactions can lead either to inhibition or activation? How
do cis-ligands drive the receptor conformational change? How does the cell integrate trans-
and cis- signals? What are the biological processes subjected to autocrine Notch signaling?
Future work aimed at solving these questions is needed to ascertain that cis-activation is not
an artifact from cell culture and indeed forms another layer of regulation that fine-tunes Notch
activity.
1.1.2. Conformational change of the receptor induced by ligand binding
Structure of the Negatively Regulated Region
The Negatively Regulated Region (NRR) is a highly conserved domain among Notch
homologs. It consists in the succession of three LIN12-Notch repeats (LNRs, defined as A, B,
Chapter 1. Notch signaling: mechanism, regulation and dynamics
16
C) and a homo-dimerization domain (HD) carrying the cleavage site S2 that initiates the
proteolytic cascade (Figure 7). In most Notch receptors, the HD is initially cleaved by a furin-
like protease at an S1 site prior to protein addressing towards the cell surface (Logeat et al.,
1998). This leads to the formation of a heterodimeric dimer linked by non-covalent
interactions between the N- and C-termini of the two halves. Although this cleavage does not
seem required for receptor ability to be activated by its ligands (Kidd and Lieber, 2002), it
appears to regulate surface levels of mammalian Notch1 and Drosophila Notch (Gordon et al.,
2009a; Lake et al., 2009). How such regulation is mediated remains elusive.
Figure 7. Structure and force-dependent unfolding of the NRR. Adapted from
Lovendahl et al., 2018.
The NRR plays a pivotal role in receptor activation by preventing access of the S2 site
to proteases in absence of ligands. Pioneering biochemical studies on the Notch receptor first
showed that disruption of the NRR by deleting the LNR repeats resulted in ligand-
independent constitutive activation of these mutant Notch receptors (Kopan et al., 1996). In
addition, point mutations in the NRR sequence found in human T-cell acute lymphoblastic
leukemia or in developing invertebrates lead as well to enhanced Notch activity (Berry et al.,
1997; Weng et al., 2004).
1.1. Mechanism of Notch transactivation
17
In the same time, several studies proposed that ligand endocytosis might exert a strain
on the receptor which changes the conformation of the NRR and allows receptor proteolysis
(detailed in section 1.3.) (Parks et al., 2000). Alternative models were proposed to explain
how such strain might affect the NRR and uncover the S2 site, including (1) the strain relieves
the NRR from interactions with other proteins (oligomerization model) and (2) the strain
changes the structure of the NRR (conformational change model) (Parks et al., 2000).
Finally, resolution of the NRR structure of human Notch2 revealed how the receptor is
maintained in an auto-inhibited state in absence of ligands: by wrapping around the HD in a
mushroom-like shape, the LIN repeats bury the S2 cleavage site into a small hydrophobic
pocket, hence preventing ectopic proteolysis (Gordon et al., 2007). Consistent with the
“conformational change” model, this structure implies that upon ligand binding, a force is
exerted on the receptor to unfold the NRR. At last, authors proposed that unfolding the NRR
structure through LNR displacement would require substantial energy and would be more
consistent with a mechanical opening than an allosteric change of the whole ECD. These
findings were further extended to Notch1 and Notch3 (Gordon et al., 2009b; Xu et al., 2015)
(Figure 7).
Although the mechanotransduction model fitted with the structural data, back in 2007,
it remained to be experimentally tested whether applying forces on the receptor was indeed
sufficient to trigger its activation (see below) and, more importantly, to determine what might
be in vivo the molecular mechanism generating the pulling force (detailed in section 1.3).
Unfolding the NRR: the pulling force at stake
In recent years, much effort has been made to establish the range of pulling forces required to
trigger the conformational change of the NRR, and to relate this range with physiological
conditions of Notch activation. To this purpose, refined strategies based on force spectroscopy
or molecular tension sensors have been designed. A detailed analysis of each of these
methods can be found in Lovendahl et al., 2018 and a schematic overview in Figure 8. Here
will be summarized the main findings of these studies.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
18
Figure 8. Overview of experimental strategies probing the force range required for
Notch activation. See text for details. Adapted from Lovendahl et al., 2018.
All taken together, these reports first demonstrated that a pulling force is indeed
required to activate the receptor. When bound to soluble ligands, receptors remained inactive,
while applying forces on the receptor led to its activation (Gordon et al., 2015). They also
determined the ligand-receptor rupture force (~19 pN) (Shergill et al., 2012) and the
activation force range of human Notch1 receptor by Dll1, Dll4 or Jagged1, comprised
between 4 and 12 pN (Chowdhury et al., 2016; Gordon et al., 2015; Luca et al., 2017; Seo et
al., 2016; Wang and Ha, 2013). This range is compatible with the work required to drive
1.1. Mechanism of Notch transactivation
19
protein conformational changes (4.1 pN/nm) (Lovendahl et al., 2018) and importantly, with
forces generated by endocytosis (2-10 pN) (Langridge and Struhl, 2017; Meloty-Kapella et
al., 2012). Second, they provided evidence that force-dependent NRR unfolding is
independent of ligand ECDs or receptor EGF repeats. Directly applying forces on the NRR
was sufficient to drive S2 site exposure to proteases and NICD release (Gordon et al., 2015).
Complementarily, a Notch1 receptor carrying an N-terminal SNAP-tag fusion could be
activated by a benzylguanine-conjugated magnetic plasmonic nanoparticle (MPNs) when a
magnetic field was implemented (Seo et al., 2016). This argued that the NRR conformational
change upon pulling does not require allosteric structural changes induced by receptor-ligand
interactions. Third, it appeared that the activation force range was independent of ligand-
oligomerization or local receptor concentration (Seo et al., 2016).
Although this activating force range fits with forces generated by endocytosis, it
remains to be established in vivo what cellular mechanism indeed generate the force. In
addition, as Dll4 and Jagged-1 require different pulling forces to activate Notch1 (resp. 4 pN
and 12 pN), it would be worth knowing upon what force regime all receptor-ligand pairs
become productive, and how such differences might affect Notch dynamics in relationship
with specific cellular contexts. Eventually, even though Seo et al. proposed that receptor
clustering does not affect the pulling force, one cannot exclude that above given thresholds of
clustered receptors or oligomerized ligands, the activation force might be altered.
Lastly, even though accumulating evidence support the here presented
mechanotransduction model where the pulling force is generated by the signal-sending cell,
understanding how plated or membrane-tethered ligand can activate Notch receptors might
challenge this view and uncover other sources generating the pulling force (Narui and Salaita,
2013; Sprinzak et al., 2010). Last but not least, the discordant fact that receptors can be
activated by soluble ligands in worms might reveal additional mechanisms by which receptors
can undergo conformational changes to unbury the S2 cleavage site (Chen and Greenwald,
2004).
S2 cleavage mediated by ADAM proteases
Following receptor conformational change, the S2 site becomes accessible and is
subsequently processed by A Disintegrin Metalloprotease (ADAM) endopeptidases, a large
family of membrane-bound zinc-dependent metalloproteases that hydrolyze extracellular
domains of multiple class-I transmembrane proteins (Brou et al., 2000; Mumm et al., 2000).
This processing leads to receptor shedding and formation of a transient truncated form of the
Chapter 1. Notch signaling: mechanism, regulation and dynamics
20
receptor termed Notch Extracellular Truncation (NEXT), later recognized and processed by
the gamma-secretase complex (Figure 7).
In flies and mammals, the S2 cleavage is mainly achieved by one ADAM protease,
Kuzbanian(Kuz)/ADAM10 (Lieber et al., 2002; van Tetering et al., 2009). Its catalytic
activity is highly regulated in cells to prevent ectopic cleavages of Notch receptors or of its
other targets, including N-Cadherin or the Alzheimer’s precursor protein (APP) (Lammich et
al., 1999; Reiss et al., 2005). First, Kuz/ADAM10 proteases are maintained in a latent state by
a pro-domain that is further removed in the secretory pathway (Groot and Vooijs, 2012).
Second, surface levels are also tightly regulated by the C8 family of tetraspanins, which
mediate their trafficking from the Golgi apparatus towards the cell surface (Dornier et al.,
2012; Haining et al., 2012). Finally, a recent structural study uncovered an additional layer of
regulation (Seegar et al., 2017). By analyzing crystals of ADAM10 ectodomain, Seegar et al.
showed that mature ADAM10s lie at the cell surface in an autoinhibited state where the
disintegrin and the cysteine rich domains mask the catalytic site. Adding a modulatory
antibody that recognizes the cysteine-rich domain was sufficient to unmask the catalytic site
and relieve autoinhibition. This self-regulatory mechanism was proposed to restrict substrate
engagement and avoid ectopic shedding. However, how these allosteric changes are
coordinated with the exposure of the receptor S2 site in vivo remains speculative.
Cellular location of the S2 cleavage site has recently become a matter of debate. While
it was generally accepted that the Kuz/ADAM10 acts at the cell surface, a recent report
challenged this view and proposed a bilateral endocytosis model where heterodimer
dissociation of the receptor is caused by simultaneous ligand and receptor endocytosis,
thereafter followed by ADAM10-mediated shedding in an endocytic compartment
(Chastagner et al., 2017). Nonetheless, how ADAM10 can recognize just one half of the
receptor heterodimer and how endocytosis of ligand and receptor can be coupled is yet to be
determined.
Of note, ADAM17/TACE, another member of the ADAM family that shares high
sequence homology with Kuz/ADAM10, has been also shown to cleave Drosophila Notch
and mouse Notch1 in cell culture assays (Brou et al., 2000; Lieber et al., 2002). Moreover,
dysregulation of its activity in vivo leads in mammals to ectopic Notch activation in a ligand-
independent manner and results in pathological disorders (Bozkulak and Weinmaster, 2009;
Groot and Vooijs, 2012). However, its requirement in physiological Notch activation during
animal development and adulthood is likely redundant with Kuz/ADAM10 activity, as flies
1.1. Mechanism of Notch transactivation
21
and mice deficient for ADAM17/TACE do not exhibit Notch-related phenotypes (Groot and
Vooijs, 2012; Lieber et al., 2002).
1.1.3. Gamma-secretase and S3 cleavage
The core complex
NEXT molecules are then recognized by the gamma-secretase complex and undergo a
regulated intramembrane proteolysis (RIP) at site S3 in the transmembrane domain, thereby
releasing NICD from the plasma membrane into the cytosol (De Strooper et al., 1999;
Schroeter et al., 1998; Struhl and Greenwald, 1999). The gamma-secretase complex is
composed by presenilin, the catalytically active subunit, and three regulatory and essential
components, Nicastrin, Aph-1 and Pen-2.
Complex or complexes?
In mammals, presenilin has two homologues, PSEN1 and PSEN2, and Aph-1 two isoforms,
Aph-1a and Aph1-b, the former existing upon two spliced variants. In theory, six different
gamma-secretase complexes can co-exist in cells and might present different catalytic
properties and substrate affinities. A recent biochemical characterization of these complexes
in cell lines provided support to this hypothesis by showing that each combination cleaves
NEXT molecules with different efficiencies (Yonemura et al., 2016). However, to date, little
is known on the relative abundance of these alternative complexes in vivo or on their potential
role in modulating Notch activity in a context specific manner.
Cellular location of the S3 cleavage site
The location of the S3 cleavage seems also crucial in regulating gamma-secretase activity.
Depending on the cellular context, the S3 cleavage has been shown to occur at the cell surface
or, following NEXT internalization, in acidic endosomes (Siebel and Lendahl, 2017).
Importantly, the cellular environment might determine the position of the S3 cleavage,
leading to the production of NICD molecules with different N-terminal residues and
consequently with distinct half-lives according to the N-end rule (Tagami et al., 2008).
However, relative contribution of short- versus long-lived NICD variants in signaling is not
currently understood.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
22
1.1.4. Transcriptional activity of NICD
Nuclear import
After its release from the membrane, NICD translocates into the nucleus. Intriguingly, while
much effort has been made to describe and understand NICD role in transcription, the
mechanisms mediating NICD transport into the nucleus are largely unknown. Several
importins have been involved in NICD nuclear import in flies and mammalian cell lines
(Huenniger et al., 2010; Sachan et al., 2013), yet knowledge in this area remains scarce.
Interestingly, a recent study uncovered a regulatory role for Brat/TRIM3, a tumor suppressor,
in attenuating nuclear NICD transport mediated by importins alpha and beta (Mukherjee et
al., 2016). Moreover, as brat knockdown in fly neural stem cells leads to Notch-dependent
brain tumors and reduced expression of TRIM3 is found in many human glioblastoma, it
suggests that the nuclear transport machinery can act as a sink for NICD molecules to
modulate signaling levels under physiological conditions.
Formation of the NICD-CSL activating complex
Once in the nucleus, NICD cannot bind to DNA by itself and necessitates interacting with a
CSL (CBF-1, Suppressor of Hairless (Su(H)), Lag-1) DNA binding protein to locate at target
loci (Figure 9). Interactions with CSL proteins are mediated by the N-terminal RAM domain
and the Ankyrin repeats. Once formed, the complex recruits a co-activator, Mastermind
(Mam/MamL1-3), to initiate target gene expression (Bray and Gomez-Lamarca, 2018).
Two models were proposed to explain how the CSL molecules switch from an inactive
to an active form in presence of NICD. It was originally considered that, in absence of NICD,
CSL already resides on DNA and is bound to repressors. Following receptor activation, NICD
molecules compete with repressors and displace them to initiate transcription. However, since
NICD and repressors present similar affinities for CSLs, the molecular mechanism for such
replacement remained a mystery (Bray and Gomez-Lamarca, 2018).
A recent report provided support for an alternative model where preformed repressing
and activating complexes would compete for the same binding sites (Gomez-Lamarca et al.,
2018). Analysis of in vivo CSL dynamics at the E(spl)-C locus in Drosophila, one of the best
characterized CSL binding site, revealed that in absence of NICD, CSL molecules were only
transiently bound to DNA, while in presence of NICD, recruitment of CSL molecules at the
E(spl)-C locus was enhanced and their residency time was increased by the recruitment of
additional factors, including Mam and chromatin remodelers. Whether this competition
1.1. Mechanism of Notch transactivation
23
mechanism is conserved among the different loci subjected to NICD-CSL regulation remains
to be determined.
Figure 9. Overview of mechanisms regulating NICD transcriptional activity. See
text for details. Adapted from Bray, 2016.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
24
Target selectivity
Another intriguing feature of the Notch pathway is the diversity of the cellular behaviors it
can trigger while using a single NICD/CSL/Mam complex to drive transcription. Notch
signaling can indeed activate different set of genes depending on the cellular context, this in
turn leading to context specific responses including differentiation, proliferation or cell death
(Bray, 2016). Moreover, only a restricted subset of optimal CSL binding sites lying in
euchromatic regions is occupied in various cell types in flies or in mammalian cell lines
(Skalska et al., 2015; Wang et al., 2014), hinting that specific mechanisms might be at stake
to recruit NICD at target genes. Taken together, this raises the following question: how is
regulated the selection of target sites by CSL-NICD complexes to elicit cell specific
transcriptional responses?
Exhaustive analyses are lacking but several reports have characterized context specific
mechanisms influencing CSL-NICD selectivity, which could be split among three categories:
the nature of the CSL binding sites, the combination in cis with other transcriptional factors
into cis-regulatory modules (CRMs) and the recruitment of additional factors that either
enhance or inhibit transcription. Each category will be briefly described here and further in-
depth analyses can be found in Bray and Gomez-Lamarca, 2018 and in Kovall et al., 2017.
CSL complexes bind to enhancers with conserved DNA consensus sequences across
the genome. A subset of them, so-called Su(H) paired sites (SPS), is organized in a head-to-
head orientation and are bound by CSL-NICD dimers (Bailey and Posakony, 1995; Hass et
al., 2015; Severson et al., 2017). As these dimers form by cooperative binding, thereby
increasing stability of the complexes, and given that most of the SPS map in highly
responsive enhancers, one might speculate that SPS promote more efficiently transcription
than monomeric CSL binding sites. Yet, the molecular basis for such differential behavior is
not currently understood. On the other hand, few studies reported that degenerated CSL
binding sites could also provide context specific selectivity (Swanson et al., 2010, 2011). In
the developing Drosophila retina, mutating back low-affinity CSL binding sites upstream the
Pax2 gene, normally expressed in the cone cells, towards the consensus sequence led to
ectopic Pax2 expression in additional cell types experiencing Notch activation (i.e.,
photoreceptors and primary pigment cells). Hence, sequence of the CSL binding sites can
influence target gene expression in many flavors.
In addition to CSL binding sites, numerous enhancers also contain other
transcriptional factor binding sites to integrate several upstream signals in CRMs. For
example, architecture of enhancers composed by a combination of E-boxes bound by
1.1. Mechanism of Notch transactivation
25
proneural factors and CSL sites is key to drive target gene expression in a selective manner
during fly neurogenesis (Castro et al., 2005; Cave et al., 2005, 2011). Genome-wide and case
studies also identified another class of transcription factors, the Runx family, whose binding
sites are often found in CRMs containing CSL binding sites (Hass et al., 2015; Terriente-Felix
et al., 2013). However, whether these transcription factors act by creating a permissive
chromatin state for CSL-NICD complexes to drive transcription or by recruiting in synergy
with CSL-NICD complexes the transcriptional machinery is currently not known.
Finally, selectivity in gene expression can also be achieved by local recruitment of
chromatin modifiers. p300, an histone acetylase, has been early shown to be recruited by
Mam and to mediate transcription of target genes (Oswald et al., 2001). More recently,
identification of nuclear partners of the CSL-Notch1ICD complex in human T-all cells
uncovered a large number of chromatin modifiers, including activators and repressors (Yatim
et al., 2012). Nonetheless, why some CSL-NICD complexes would recruit a given chromatin
modifier at specific loci is shrouded in mystery. Of note, while these modifiers can play a key
role in initiating transcription, they also might be involved in modulating the transcriptional
status of a gene, i.e. ON or OFF, once NICD has been degraded.
NICD stability
The core mechanism of Notch signaling ends with the degradation of the NICD fragment.
NICD molecules are supposed to be short-lived due to a PEST sequence localized at the C-
terminus of the protein. Post-translational modifications of PEST residues can additionally
modulate this half-life in a context specific manner, thereby prolonging or abbreviating gene
transcription (Bray and Gomez-Lamarca, 2018; Carrieri and Dale, 2017). To date, our
understanding on the respective role of these modifications in modulating Notch activity in
vivo is scarce.
1.2. Regulation of Notch receptors by the endosomal pathway
Genetic studies in Drosophila and pulse-chase assays in mammalian cell lines revealed that
Notch receptors are constitutively endocytosed and subsequently trafficked among endocytic
compartments till degradation in lysosomes. Impairments in receptor sorting or degradation
Chapter 1. Notch signaling: mechanism, regulation and dynamics
26
lead to ectopic Notch activity, either ligand dependent or independent, and are found in
biological disorders. This highlights the importance for signal-receiving cells to tightly
control the levels of available receptors for activation at the cell surface or at the limiting
membrane of endosomes.
This section follows the endosomal path from endocytosis to degradation and briefly
describes at each step known regulators of receptor trafficking (synthetized in Figure 10). In-
depth details can be found in Schnute et al., 2018.
1.2.1. Notch endocytosis and regulation of surface levels
Starting the journey with E3 ligases
Endocytosis is a general mechanism regulating surface levels of transmembrane proteins. In
particular, ubiquitination of Notch intracellular domains has been proposed to promote
receptor endocytosis in a ligand-independent manner (Le Bras et al., 2011). In Drosophila and
mammalian cell lines, three E3 ligases initiating Notch endocytosis have been identified so
far: Deltex (Dx)/DTX1, Suppressor of Deltex (Su(Dx))/Itch and Nedd4 (Chastagner et al.,
2017; Qiu et al., 2000; Sakata et al., 2004; Sorensen and Conner, 2010; Wilkin et al., 2004;
Yamada et al., 2011). They all have been shown to ubiquitinate NICD in in vitro assays,
although physical binding to NICD has only been established for Dx/DTX1 and Nedd4,
suggesting that Su(dx)/Itch requires an unknown intermediate to interact with NICD.
In vivo studies, on the other hand, point out that these E3 ligases are fine-tuners of
Notch activity rather than essential components of the pathway. First, dx and Su(x) flies
undergo full development and are viable (Fostier et al., 1998; Hori et al., 2004). Moreover, in
those mutant flies, Notch-related phenotypes are mild and mostly observed in adult wings. In
line with these observations, overexpressing mutated forms of Nedd4 in the fly wing produces
only mild phenotypes (Sakata et al., 2004). Second, most of in vivo data relies on the
observation of mislocalized Notch receptors in fly epidermises where either wild-type E3
ligases or their respective dominant-negative forms were overexpressed. Knowing that (1) Dx
and Su(dx) might also regulate the switch between receptor degradation and recycling
downstream in the endosomal path and (2) Nedd4 has many other targets than Notch, it
complicates the establishment of a correlation between the defects in receptor localization and
a specific cellular function of the E3 ligases. Third, an even more puzzling observation is that
the ubiquitin-transferase activity of Dx and Su(dx) does not seem required to promote
receptor endocytosis in cell lines (Shimizu et al., 2014). Instead, Dx and Su(Dx) would act as
1.2. Regulation of Notch receptors by the endosomal pathway
27
adaptors recruiting the endocytic machinery in a clathrin dependent or independent way,
respectively (Schnute et al., 2018). Nonetheless, no data is currently available to support this
hypothesis.
Therefore, although regulating receptor surface levels seems in principle crucial to
avoid any excess in receptor activation, there is presently a paucity of knowledge about the
initiation of receptor endocytosis.
Figure 10. Notch trafficking from the cell surface to the lysosomes. The inset
illustrates sequential activities of the ESCRT complex during Notch
internalization in MEs. See text for details. Adapted from Schnute et al., 2018.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
28
Notch endocytosis
The molecular mechanism by which Notch receptors are endocytosed from the cell surface
and incorporated in early endosomes (EEs) is poorly understood. Genetic studies in
Drosophila wing epidermis and S2 cell lines suggest that Notch receptors might take different
routes, depending on the presence or absence of a clathrin coat during endosome formation
(Shimizu et al., 2014; Windler and Bilder, 2010). Windler and Bilder showed in addition that
most clathrin-dependent endocytic events were dependent on the adaptor protein AP-2.
Intriguingly, AP-2 was not required for Notch signaling, indicating that AP-2 might
discriminate between receptors intended for signaling and those for internalization. A more
tantalizing model would be that AP-2 recognizes specifically the poly-ubiquitinated receptors,
thereby promoting endocytosis of “old” (presumably damaged and unfit for signaling)
receptors and indirectly preserving newly-synthetized ones at the cell surface. Whether such
quality control exists in cells for Notch receptors remains to be tested. Likewise, the
functional relevance of different endocytic pathways (clathrin-dependent or independent) for
Notch signaling is not established.
Intriguingly, how the endocytic machinery recognizes NICD of receptors intended for
internalization is still a mystery (Schnute et al., 2018). One current limitation of fly studies
investigating Notch trafficking resides in their experimental approach. First, mutating or
downregulating core components of endocytic pathways might generate unspecific effects
that impact Notch localization in an indirect way. Second, time scales of the endocytic events
are often missed. Defects in Notch signaling and/or mislocalization of Notch receptors are
assessed days following gene knockdowns or clone inductions, while trafficking events occur
within seconds. Whether the reported phenotypes are indeed related to the induced genetic
perturbation, or rather reflect pleiotropic effects affecting cells over a longer time period is
challenging to untangle. Generation of a new set of optogenetic tools allowing temporal and
spatial control of protein behaviors might provide a promising framework to study Notch
endocytosis and trafficking.
1.2.2. Recycling of Notch receptors
Numb, a negative regulator of recycling
Once at the limiting membrane of early endosomes, Notch receptors can either by recycled
towards the cell surface or be addressed towards the lysosomes for degradation. Recycling
can theoretically occur following two main routes routes: (1) cargos are directly addressed
1.2. Regulation of Notch receptors by the endosomal pathway
29
from EEs towards the cell surface in a Rab4-dependent way or (2) cargos are first trafficked
into recycling endosomes (REs) prior Rab11-dependent surface sorting (Schnute et al., 2018).
Numb, a multi-domain protein distributed at the cell surface and in early endosomes,
has been initially shown in Drosophila to be an antagonist of Notch signaling (Spana and Doe,
1996). Its function is in particular well documented in the context of Notch-dependent
lineages undergoing asymmetric cell divisions (ACDs) (detailed in 2.3.3.). A series of reports
showed that Numb is asymmetrically segregated in the signal-sending daughter cell where it
turns off Notch signaling by inhibiting Notch recycling towards the cell surface and by
promoting its addressing towards the lysosomes (Couturier et al., 2012, 2013, 2014; Doe and
Spana, 1995; Rhyu et al., 1994). However, although several hypotheses based on the
characterization of Numb physical partners were proposed, the exact mechanism by which
Numb inhibits Notch recycling is currently unknown.
These findings on the antagonizing role of Numb in Notch signaling were further
confirmed during mouse neurogenesis and in mammalian cell lines (McGill et al., 2009;
Zhong et al., 1996, 2000), suggesting that its molecular function is well conserved among
phyla.
Recycling and fine-tuning Notch activation
Several recent case studies pointed out the role of recycling regulators in fine-tuning Notch
activity levels. In Drosophila, recycling through Rab4-positive compartments of Notch
receptors mediated by the cargo sorting regulator Rme-8 contributes in reaching final Notch
activity levels to properly specify wing veins (Gomez-Lamarca et al., 2015) (Figure 10). In
mouse, loss of COMMD9, a component of the recycling CCC complex, led also to decreased
Notch2 activity, increased intracellular Notch2 levels and caused phenotypes reminiscent of
Notch2-deficient mice (Li et al., 2015). Intriguingly, some proteins of the Bardet-Biedl
syndrome (BBS) complex, which normally associates with Rab11 endosomes to deliver
proteins to cilia, were also found to regulate Notch surface in mammalian cell lines via
regulated recycling (Leitch et al., 2014).
In brief, these studies not only highlight the role of recycling in modulating Notch
activity, but also the diversity of pathways by which this can be achieved. Of note, in the
aforementioned examples, it is not clear whether defects in Notch activity are due to
decreased Notch surface levels or to the lack of post-translational modifications occurring
during recycling and modifying receptor properties in binding its ligands.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
30
1.2.3. Degradation of Notch receptors in lysosomes
ESCRT-mediated intraluminal entry in maturing endosomes
Receptors distributed at surface of EEs undergoing maturation, named maturing endosomes
(MEs), can no longer be recycled and are consequently intended for degradation in lysosomes
(of note, why some receptors will be recycled while other trafficked towards MEs is not
determined). MEs are defined by two characteristics: the acidification of their lumen and the
internalization of intraluminal vesicles (ILVs). This latter process is crucial to prevent any
ectopic Notch activity, as NICDs fragments can no longer be released in the cytosol (Schnute
et al., 2018).
Formation of ILVs containing Notch receptors is dependent on the endosomal sorting
complex required for transport (ESCRT) machinery (Figure 10). Four complexes (ESCRT-0,
I, II and III) compose the machinery and act sequentially to promote ILV internalization.
ESCRT-0 is first recruited to the ILV formation site, and then recruits ESCRT-I and ESCRT-
II to form a super complex hypothesized to generate inward membrane bending. ILV
abscission preceding its release into the lumen is mediated by ESCRT-III. Mutating
components of ESCRT-I, II and III leads to the accumulation of receptors at the ME limiting
membrane and strong ligand-independent Notch activity (Vaccari et al., 2009). Curiously,
impairing ESCRT-0 complex does not affect Notch activity, while receptors do accumulate at
the surface of MEs (Tognon et al., 2014). The molecular basis for this observation is currently
not known and questions whether other factors can recruit ESCRT-I, II and III to Notch
receptors.
Recognition of target cargos for ILV formation by ESCRT0, I and II is favored when
cargo intracellular domains are poly-ubiquitinated. In flies, Dx, Kurtz (Krz), a nonvisual beta
arrestin, and Su(dx) were also proposed to regulate the ubiquitination status of Notch
receptors at the ME limiting membrane (Hori et al., 2011; Shimizu et al., 2014). Whereas Dx
would mono-ubiquitinate Notch, hence preserving receptors for signaling, a Dx-Krz complex
binding to NICD would mediate its poly-ubiquitination, thereby promoting ESCRT complex
recruitment (Hori et al., 2011). In a temperature-sensitive manner, Su(dx) appears also to
promote receptor poly-ubiquitination (Shimizu et al., 2014). Noteworthy, these models are
built from experiments where housekeeping molecular functions are disturbed for several
days prior analysis, hence raising the question whether the observed defects in Notch
localization or signaling are specific or caused by indirect pleiotropic effects.
1.3. Ligand endocytosis and trafficking
31
Ending the journey in the lysosome lumen
Notch receptors are finally delivered into the lumen of lysosomes where they are degraded by
hydrolases in a highly acidic environment (Figure 10). This step consists in the fusion of ILV-
containing MEs to pre-existing lysosomes in a Rab7-dependent manner (Yousefian et al.,
2013).
1.3. Ligand endocytosis and trafficking
For the past two decades, ligand endocytosis has emerged as the prevailing molecular
mechanism driving the conformational change in the receptor ECD and subsequent exposure
of the S2 site to ADAM10 proteases. Studies revealed that ubiquitination of the ligand
intracellular domain acts as a trigger initiating ligand endocytosis and is required for receptor
activation in many contexts. Importantly, recent work provided evidence that ligand
endocytosis generates forces consistent with NRR unfolding. Finally, alternative models
suggest that ubiquitin-dependent ligand endocytosis is not only required for receptor
activation, but also for ligand trafficking through recycling endosomes where post-
translational processing should render them active.
This section aims at summarizing current knowledge on ligand endocytosis and
discussing the significance of the aforementioned models in Notch signalling, as well as the
experimental data supporting them.
1.3.1. Ligand endocytosis and generation of the pulling force
Early evidence for ligand endocytosis requirement in Notch signaling
Published in 1997, the pioneering study linking ligand endocytosis and Notch signaling relied
on the analysis of flies lacking dynamin (shibire in Drosophila) activity (Seugnet et al., 1997).
Dynamin acts at the end of the endocytic process by pinching off endosomes from the
membrane. Thereby, impairing dynamin activity is sufficient to block endocytosis in cells.
Authors based their analysis on the bristle pattern of the Drosophila dorsal thorax and
observed that conditional inactivation of shibire, using a thermo-sensitive allele shits, during
bristle precursor selection resulted in bristle tufts instead of a regularly spaced lattice. This
Chapter 1. Notch signaling: mechanism, regulation and dynamics
32
phenotype was reminiscent of impaired Notch activity during lateral inhibition (see section
2.1.). Epistasis experiments further revealed that shibire was required upstream of the
proteolytic cascade leading to NICD release. Finally, authors analyzed borders between shits
clones and neighboring wild-type tissues to test whether shibire activity was required in the
signal sending or receiving cell. They noticed that 80% of the bordering bristles were located
in the mutant clone, indicating that loss of shibire activity made the mutant cells less sensitive
to the Notch inhibitory signal sent by the neighboring wild-type cells. Hence, this shows that
shibire is mostly required in the signal-receiving cell in this context. Even more puzzling is
the observation of bristles tufts in shits adult flies. As the inactivation period at restrictive
temperature also covered the sensory organ development, if shibire activity would be essential
for Notch signaling, one would expect to recover bald thoraces reminiscent of impaired Notch
activity in fate specification. Therefore, analysis of shi phenotypes in the Drosophila dorsal
thorax does not draw a strong link between ligand endocytosis and Notch activation, even
though the contrary is often found in the literature. More generally, as dynamin activity is also
required for vesicle budding from the Golgi apparatus, an alternative interpretation would be
that diminished levels in Notch activity are instead due to the accumulation of signaling
molecules (receptor, ligand, proteases involved in the proteolytic cascade) in the trans-Golgi
network. Finally, analysis of dynamin loss-of-function experiments is also problematic from
the theoretical viewpoint. As dynamin acts only once endosomes are internalized but still
membrane-tethered, how would pinching off the endosome from the membrane generate the
pulling force? One would rather expect that force transmission occurs during endosome
invagination, and not during endosome release from the cell surface.
Few years later, S2 and S3 cleavages were molecularly characterized and the
proteolytic sequence model leading to Notch activation was demonstrated, but the trigger
initiating the cascade remained hypothetical. In this context, a fly study from the Muskavitch
lab provided in vivo evidence for the role of ligand endocytosis in triggering the proteolytic
cascade (Parks et al., 2000) and confirmed former observations made with S2 cells (Klueg
and Muskavitch, 1999). In binary systems where ligands and receptors are expressed in
distinct contacting cells, Parks et al. observed first, that NICD and NECD localized in the
signal-sending and signal-receiving cells, respectively; and second, the colocalization of
Notch and Delta ECDs in endocytic compartments of the signal-sending cells. This indicated
that Notch receptors dissociated upon activation into two fragments and that NECD was taken
up together with DlECD in the signal-sending cell, referred by the authors as NECD trans-
endocytosis. In flies expressing a combination of Delta alleles whose gene products
1.3. Ligand endocytosis and trafficking
33
accumulate at the cell surface in a temperature sensitive manner, trans-endocytosis was no
longer detected following a heat pulse at restrictive temperature. Finally, authors showed that
ectopic expression of a mutated form of Delta, DeltaC301Y, presumably defective for
endocytosis did not cause ectopic Notch activation in the developing wing, in contrast with
wild-type Delta. To conclude, although highly correlative, these data provided the first
evidence supporting the role of ligand endocytosis in promoting receptor cleavage.
Since then, much effort has been made to determine the molecular machinery
regulating ligand endocytosis (see 1.3.2.) and to establish the force range generated by ligand
endocytosis in vitro and in vivo (see below) (Figure 11). Nonetheless, direct evidence for the
conformational change induced by ligand endocytosis are still lacking. Demonstrating this
process would require the generation of new tools capable of sensing in vivo NRR unfolding.
Given that NRR structures have been resolved, rational design of FRET sensors might
provide a promising experimental strategy.
Figure 11. Ligand endocytosis as a molecular mechanism generating pulling
forces during receptor activation. Adapted from Weinmaster and Fischer, 2011.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
34
Ligand endocytosis as a molecular mechanism generating the pulling force
As the mechanotransduction model gathered supporting evidence, it became needed to
demonstrate that ligand endocytosis does generate pulling forces, and importantly within the
range of those found in artificial experimental setups. To date, only two studies, one in vitro
and one in vivo in Drosophila (Langridge and Struhl, 2017; Meloty-Kapella et al., 2012),
demonstrated that ligand endocytosis can generate forces of approximately 2 pN. Their main
findings as well as their limitations will be discussed here.
In a complex system where Notch1 fragments fixed on beads were stabilized by
optical tweezers, cells expressing Dll1 at their surface were presented in close vicinity to the
beads to allow receptor-ligand binding (Meloty-Kapella et al., 2012). Forces generated by
Dll1 endocytosis were inferred from the bead displacement during a 60 second time window.
Although the average force was of 2.8 pN, hence comparable with the 2-10 pN range found in
artificial pulling systems, 30% of the cells exerted pulling forces below 2 pN and 20% failed
to exert any, while the 50% remaining cells scaled between 3 and 10 pN. Whether this
variability in force generation reflects the technical limitations of the tweezer-based system,
with half of the iterations being unsuccessful, or whether this reveals different flavors of Dll1
endocytosis that would depend on the number of formed receptor-ligand pairs, as this
parameter was not controlled in this study, remains to be determined. Later on, authors used
this system to identify the molecular components required for Dll1 endocytosis in the signal-
sending cells (discussed in 1.3.2.). Nonetheless, the relevance of these results regarding
physiological Notch activation had to be yet demonstrated.
Recently, an elegant study from the Struhl lab provided in vivo evidence that Epsin-
dependent endocytosis of Delta generates pulling forces of ~2pN in the Drosophila wing
imaginal disc (Langridge and Struhl, 2017). Authors designed a genetic framework allowing
ectopic expression of wild-type or chimeric receptor-ligand pairs in complementary clones
throughout the epithelium. Ability of each pair to mediate productive Notch signaling was
determined by the expression of Cut, a characterized Notch downstream target in this tissue,
at the clone border. The main part of their work consisted in discriminating between several
models for Epsin role in Notch signaling, and these findings will be discussed below. Lastly,
they used this assay to establish the pulling capacity of Delta endocytosis by replacing Notch
NRR by different versions of the von Willbrand factor (vWF) A2 domain in the chimeric pair
where Delta ECD (resp. Notch ECD) were substituted by the alpha and beta subunits of the
follicle stimulating hormone (FSH) (FSH receptor, resp.). Of note, the chimeric FSH-
Delta/FSHR-Notch pair was shown earlier in this study to induce Cut expression at the clone
1.3. Ligand endocytosis and trafficking
35
border. The A2 domain is a force sensor requiring force application of ~8pN to uncover a
cleavage site subjected to ADAM-dependent proteolysis. Several A2 variants have been
characterized with either higher (unknown force requirement) or lower (~2pN) force
thresholds, thereby providing a range of force sensors. Cut expression at the clone boarder
was only observed with A2 variants displaying higher sensitivity to proteolysis, thus
indicating that Epsin-mediated endocytosis generates pulling forces of ~2pN.
Nonetheless, even though the title of the study is stating the opposite, authors did not
provide direct in vivo evidence for force dependent activation of Notch. First, substitution of
the NRR by the A2 variants in the wild-type Delta/Notch pair is not reported, interrogating
whether the observations made with the FSH-Delta/FSHR-Notch chimeric system are specific
to this pair. One could hypothesize that force transmission along receptor and ligand ECDs
depends on the molecular nature of the ECDs, as illustrated by the differential force
requirement of Dll4 and Jagged1 in activating Notch1. Hence, comparison with wild-type
Delta/Notch is needed to confirm the 2pN force range. Second, all the results presented in this
study rely on overexpressed ligand/receptor pairs. How this ectopic situation relates to
physiological Notch activation remains to be determined. One way to overcome this
limitation would be to generate chimeric Notch receptors at the endogenous locus using the
CRISPR technology and test their capacity in mediating Notch signaling in a similar clonal
strategy. Additionally, such approach would allow estimating the different force requirements
for Notch activation depending on the biological contexts.
Evidence for alternative activation mechanisms
The growing body of evidence supporting ligand endocytosis as the main molecular
mechanism in the mechanotransduction model has occulted alternative sources for the pulling
force suggested by recent studies.
Besides the specific case of Notch activation by soluble ligands in worms (Chen and
Greenwald, 2004), several studies on mammalian or fly Notch receptors provided convincing
evidence that a pulling force needs to be exerted on the NRR to initiate the proteolytic
cascade. Then, how to explain that plated or membrane-bound ligands ECDs can efficiently
activate receptors harbored at the surface of contacting cells (Narui and Salaita, 2013;
Sprinzak et al., 2010)? One possibility would be that receptor endocytosis can provide the
source of pulling forces, as suggested by the bi-lateral endocytosis model (Chastagner et al.,
2017). Alternatively, a tantalizing idea would be that shear stress forces at the cell surface
might drive NRR unfolding once receptors are bound to fixed ligands. Despite their
Chapter 1. Notch signaling: mechanism, regulation and dynamics
36
differences regarding the molecular mechanism, these two hypotheses imply that signal-
receiving cells can also generate pulling forces. So far, this possibility has not been directly
tested in vivo.
Shear stress forces have also been correlated with Notch activation in the context of
vascular homeostasis. Several studies concomitantly showed with their respective
microfluidic-based strategies that Notch1 receptors expressed at the cell surface of endothelial
cells are activated upon laminar flow induction (Fang et al., 2017; Mack et al., 2017;
Polacheck et al., 2017). Activation scaled with increased flow speed (Mack et al., 2017) and
was dependent on Dll4 and gamma-secretase cleavage (Polacheck et al., 2017). Polachek et
al. proposed the following mechanism where shear stress generated by the laminar flow was
inducing ligand endocytosis in the signal-sending cell, but as the only functional test was
based on dynamin inhibition, it remains debated whether shear stress can directly transmit
forces to the receptor-ligand pair.
Also confusing is the report in flies and fish of Notch receptors being activated in a
ligand-dependent manner at the surface of endosomes (Coumailleau et al., 2009; Kressmann
et al., 2015; Montagne and Gonzalez-Gaitan, 2014). In several studies, the Gonzalez-Gaitan
lab provided genetic and molecular evidence in the context of Notch-dependent asymmetric
cell division (ACD) that a subtype of Rab5 endosomes, marked by the endosomal protein
Sara (Smad Anchor for Receptor Activation), was asymmetrically segregated in the signal-
receiving daughter cell. These endosomes were carrying Notch receptors and ligands at their
surface, and dissociation of NECD and NICD fragments at their limiting membrane was
shown to be dependent on gamma-secretase and on the activity of an E3 ligase promoting
ligand endocytosis (Coumailleau et al., 2009). This led to the conclusion that directionally
trafficking Sara endosomes were part of the molecular machinery that biases Notch signaling
during ACD. It is still unclear whether S2 cleavage does occur at the surface of these
endosomes, and why receptors are only cleaved in the signal-receiving cell, as Sara
endosomes carrying receptors and ligands are detected in the mother cell prior to division and
in the signal-sending cell after ACD; nevertheless, Sara endosomes might support an
alternative mechanism for receptor activation independent of ligand endocytosis. Cis-
activation could provide a mechanistic rationale in this context, but additional work would be
needed to explain how force would be transmitted in a cis configuration and why this
activation mode would take place only in specific contexts.
Finally, contradictory results came from the use of synthetic receptor/ligand pairs
regarding the requirement of ligand endocytosis in Notch signaling. On one hand, Gordon et
1.3. Ligand endocytosis and trafficking
37
al. and Langridge and Struhl showed that chimeric ligands lacking their intracellular tail were
unable to activate their associated receptors in cell culture assays and Drosophila imaginal
discs, respectively (Gordon et al., 2015; Langridge and Struhl, 2017). Additionally, Langridge
and Struhl reported that mutating lysines to arginines in ligand native or chimeric intracellular
tails to prevent ubiquitin-dependent ligand endocytosis inhibited receptor activation. On the
other hand, Morsut et al., in their approach to design synthetic signaling circuits using Notch
transmembrane domains flanked by ectopic ECDs and ICDs as signal transducers, observed
that surface bound ligand did not require endocytosis nor endocytic motifs in their chimeric
intracellular tails to trigger activation of their cognate receptors (Morsut et al., 2016).
Hence, ligand endocytosis might be just one among many other molecular
mechanisms generating the pulling force. Future work will be needed to understand why
ligand endocytosis predominates in most Notch dependent processes, and what advantages it
provides compared to other mechanisms. Finally, reinvestigating ligand endocytosis
requirement by other means than dynamin inhibition would be valuable to ascertain this
predominance compared to alternative mechanisms.
1.3.2. Ligand endocytosis and ubiquitination
Neuralized and Mindbomb, the E3 ligases promoting ligand endocytosis
Mono-ubiquitination of transmembrane protein ICDs is a common cellular mechanism to
initiate endocytosis. Ubiquitination requires sequential activities of three ligases, termed E1,
E2 and E3. While E1 and E2 ligases are used for a broad spectrum of transmembrane
proteins, E3 ligases are often specific to a subset of substrates.
In the context of ligand endocytosis in Notch signaling, the first E3 ligase being
characterized was Neuralized (Neur) (Figure 12A). Early evidence from the 80’s indicated
that fly embryos lacking Neur displayed neurogenic phenotypes similar to embryos deficient
for Notch (Lehmann et al., 1983; Weinmaster and Fischer, 2011). Sequence analysis first
suggested that Neur functioned as a transcription factor through its RING (really interesting
gene) domain, but further biochemical analyses of other proteins containing RING domains
ruled out this hypothesis by demonstrating that these domains encoded an E3 ligase activity.
In 2001, four studies provided genetic and biochemical evidence in Drosophila and Xenopus
that Neur/X-Neur also functions as an E3 ligase, is required in specific developmental
processes regulated by Notch signaling and is mediating Delta/X-Delta ubiquitination and
subsequent internalization through its RING domain (Deblandre et al., 2001; Lai et al., 2001;
Chapter 1. Notch signaling: mechanism, regulation and dynamics
38
Pavlopoulos et al., 2001; Yeh et al., 2001). Further investigations revealed that Neur was also
targeting the second Drosophila ligand, Serrate (Glittenberg et al., 2006).
Nonetheless, it remained unclear at that time whether Neur acted autonomously by
clearing Delta from cell surfaces to relieve Notch receptors from cis-inhibition (Deblandre et
al., 2001; Lai et al., 2001), or non-autonomously in signal-sending cells by promoting ligand
endocytosis in line with the trans-endocytosis model (Pavlopoulos et al., 2001). Subsequent
work in flies provided support to the second hypothesis with Neur acting in the signal-sending
cell (Le Borgne and Schweisguth, 2003; Weinmaster and Fischer, 2011). Concomitantly, two
studies inferred from their experimental data that the balance between ubiquitinated and non-
ubiquitinated ligands in cells expressing Neur might be key to generate a dual state where
cells can still signal to their neighbors while being cis-inhibited (Glittenberg et al., 2006;
Miller et al., 2009). This fine-tuning of Neur activity could be a mechanism particularly
relevant during lateral inhibition to prevent neighboring cells to signal back to the emerging
proneural cell and to lock its fate.
Finally, one peculiarity of Neur is its differential requirement in model organisms,
despite its conservation from worms to humans. While essential in flies, mice lacking the two
Neur homologues, Neurl1 and Neurl2, do not exhibit Notch-related phenotypes during
development, even though biochemical evidence support interaction between Neurl1 and
Neurl2 and Notch ligands (Weinmaster and Fischer, 2011). Whether other E3 ligases act
redundantly, such as Mib1 (see below), to compensate for losses of Neurl1 and Neurl2 is not
known. On the other hand, X-Neur exhibits an expression pattern restricted to neural fields in
early frog embryos, likewise Neur in flies, and can promote Drosophila Delta internalization
when ectopically expressed in fly wing discs, indicating that Neur activity is conserved
between flies and frogs (Deblandre et al., 2001). Unfortunately, the impact of Neur depletion
on Xenopus early development has not been reported. Finally, the role of Neur homologues in
regulating Notch signaling during worm, chicken or zebrafish developments has not been
documented. One possible explanation for this apparent discrepancy might be found in the
process of sub-functionalization. Besides its implication in Notch signaling, Neur has also
been shown to regulate epithelial cell polarity and germ stem cell maintenance in Drosophila
(Liu and Boulianne, 2017; Perez-Mockus et al., 2017a). Therefore, Neur homologues might
have specialized in one Notch-unrelated function in some species along evolution while other
E3 ligases would take over in promoting ligand endocytosis.
1.3. Ligand endocytosis and trafficking
39
Figure 12. Neur and Mib1 functional domains. Ring (RF, RNG) domains mediate
ubiquitin addition on ligand intracellular tails. Adapted from Perez-Mockus et al.,
2017b and D’Amato et al., 2016.
The second E3 ligase, Mindbomb (Mib) (Figure 12B), was first discovered in a
genetic mutagenesis screen conducted in zebrafish. mib embryos displayed neurogenic
phenotypes, but the relationship with Notch signaling was not established at that time (Schier
et al., 1996). In 2003, Itoh et al. analyzed mib locus by positional cloning and revealed that
the gene product contains three RING domains, acts as an E3 ligase and promotes Delta
endocytosis through ICD ubiquitination (Itoh et al., 2003). Following that pioneering
molecular and functional characterization, two homologues of Mib, Mib1 and Mib2, were
found in flies, mice and humans and shown to ubiquitinate ligands of the Serrate family (Koo
et al., 2005a, 2005b; Lai et al., 2005a; Le Borgne et al., 2005; Pitsouli and Delidakis, 2005).
In both vertebrates and flies, mutational analyses pointed out that Mib1 is the main E3
ligase involved in Notch signaling, as mib2 animals either did not display pleiotropic Notch-
Chapter 1. Notch signaling: mechanism, regulation and dynamics
40
related phenotype and presented defects in a restricted number of cellular processes (Koo et
al., 2007; Mikami et al., 2015; Nguyen et al., 2007). Specifically, in mice, Neur homologues
and Mib2 cannot compensate for loss of Mib1 in processes regulated by Notch signaling
during development, hence suggesting that Mib1 is the main E3 ligase required for ligand
endocytosis in this model organism (Koo et al., 2007). In contrast, mib1 fly embryos did not
exhibit neurogenic phenotypes and animals developed till late pupal stages (Lai et al., 2005a;
Le Borgne et al., 2005). Developmental defects were observed in Notch-dependent
developmental events that were independent of Neur, including wing margin formation, leg
segmentation and eye specification. Drosophila Mib1 and Neur, unlike in mammals, have
been proposed to be interchangeable in certain contexts, i.e. during wing margin formation
(Lai et al., 2005a; Le Borgne et al., 2005; Pitsouli and Delidakis, 2005; Wang and Struhl,
2005) or fate specification in the sensory organ lineage (Lai et al., 2005a). Nonetheless, while
the functional conservation is demonstrated, several observations and technical limitations
balance this statement. First, all these experiments were based on the overexpression of Mib1
transgenes in neur mutant backgrounds using the UAS/Gal4 system. Whether such approach
reproduces physiological Notch activity levels is questionable. Second, despite the
overexpression drawback, clustered sensory organs were still observed in rescue assays
conducted in the notum, reflecting defective signaling transmission between emerging SOPs
during lateral inhibition (Lai et al., 2005a). Hence, Mib1 and Neur do not seem
interchangeable in this process. Third, Mib1 expression driven by neurPGal4 (Gal4 insertion
at the neur locus generating a null allele), a driver presumably more representative of
endogenous Neur expression levels, could not rescue the cuticular neurogenic phenotype of
neur embryos. This was not due to insufficient expression levels, as UAS-Neur constructs
could compensate the loss of Neur with the same driver (Le Borgne et al., 2005). This
observation provides a second example related to neurogenesis where Mib1 does not
recapitulate Neur function. Fourth, fate restoration has not been quantified in the sensory
organ lineage, letting uncertain the penetrance of Mib1 rescue in this context (Lai et al.,
2005a). All taken together, this series of remarks question whether Mib1 can indeed
compensate Neur activity when expressed at Neur endogenous levels and to what extent these
two E3 ligases are interchangeable in flies.
More generally, the requirement of Neur or Mib1 in specific contexts during fly
development might rather underlie that Neur and Mib1 mediate ligand endocytosis in a
different manner with different capacities in activating Notch receptors. In support of this
hypothesis, Neur and Mib families do not share any structural similarities (Weinmaster and
1.3. Ligand endocytosis and trafficking
41
Fischer, 2011) nor recognize the same epitopes on ligand ICDs (Daskalaki et al., 2011). This
might result in the recruitment of distinct endocytic adaptors depending on the ICD
ubiquitination pattern, which would in turn modulate either the ligand endocytosis rate or the
generated pulling force. Alternatively, a recent structural study uncovered a bipartite
mechanism by which Mib1 binds to Jagged1 ICD (Guo et al., 2016), raising the possibility
that Neur and Mib1 interact with Delta or Serrate ligand families with different affinities.
Similarly, this would translate into differential ubiquitination kinetics and distinct endocytosis
rates. Lastly, specificity might also arise from interacting partners, as Mib1 has been shown to
directly bind with components of the endocytic machinery (Okano et al., 2016).
Finally, whether E3 ligases constitutively ubiquitinate ligand ICDs or in response to a
stimulus is largely unknown. To address this question, Hansson et al. compared the cellular
distributions of Jagged1 and a mutated form of Jagged1 that cannot bind to receptors, named
Jagged1(Ndr), in presence of absence of neighboring cells expressing Notch1 (Hansson et al.,
2010). Intriguingly, when signal-sending cells were isolated, both Jagged1(WT) and
Jagged1(Ndr) were detected at the cell surface while when the same cells were put in contact
with Notch1-expressing cells, only Jagged1(WT) was efficiently endocytosed in a Mib1-
dependent manner and signal was transduced to the signal-receiving cell. This led the authors
to conclude that ligand-receptor interaction induced ligand endocytosis. How binding to the
receptor stimulates Mib1 activity on the ligand intracellular tail and whether such signal
transduction occurs in vivo remains to be established.
From a wider perspective, such transduction mechanism leading to ligand
ubiquitination might be a potent mechanism to segregate bound from unbound ligands. This
would explain why among the total pool of endocytosed Delta molecules in the Drosophila
wing disc, Epsin-mediated endocytosis leading to Notch activation (see section below) affects
only a small fraction of them in the fly imaginal wing disc (Wang and Struhl, 2004). Such
model would also imply that several types of ligand endocytosis coexist in cells with different
abilities to generate pulling forces.
The endocytic machinery
Following ubiquitination of cargo ICDs, additional adaptor proteins bind to these ubiquitin
motives and thereafter promote cargo endocytosis in a clathrin dependent or independent way.
To date, the unique adaptor protein shown to be required in signal-sending cells to mediate
Notch signaling is Epsin (Chen et al., 2009; Overstreet et al., 2003, 2004; Tian et al., 2004;
Wang and Struhl, 2004). In flies, loss of Lqf (Liquid Facets, Drosophila Epsin) impaired
Chapter 1. Notch signaling: mechanism, regulation and dynamics
42
photoreceptor selection during eye patterning, lateral inhibition in the notum, wing margin
formation, wing vein specification and cardioblast selection during embryogenesis (Overstreet
et al., 2004; Tian et al., 2004; Wang and Struhl, 2004). Of note, in lqf clones, bristle tufts
could be observed, indicating that fate specification in the sensory organ lineage was not
disturbed (Wang and Struhl, 2004). This implies that other adaptors might replace Epsin in
specific contexts. Similar requirements for Epsin in signal-sending cells have also been
reported in worms and mice (Chen et al., 2009; Tian et al., 2004). Finally, the two studies
described in “Ligand endocytosis as a mechanism generating the pulling force” showed that
the force generated by ligand endocytosis was dependent on Epsin activity (Langridge and
Struhl, 2017; Meloty-Kapella et al., 2012).
Generally, there is a paucity of knowledge regarding Epsin downstream effectors in
the context of Notch signaling. Whether ligand-receptor ECD complexes are internalized
within clathrin coated or uncoated vesicles is not known. Actin polymerization is required,
but nucleating enzymes are not characterized (Meloty-Kapella et al., 2012). The role of BAR
proteins in membrane bending during endosome invagination has not been tested yet. One
explanation to this situation is that impairing proteins with household activities might
generate pleiotropic phenotypes, thereby complicating the dissociation of direct from indirect
effects.
Is ubiquitination always required?
A recent study in Drosophila challenged the here presented paradigm where Epsin-mediated
endocytosis of ligands depends on the ubiquitination of their ICDs by Neur or Mib1 (Berndt
et al., 2017). Authors provided genetic evidence that Delta can activate Notch in two other
modes independent of ubiquitination but either dependent on or independent of Neur. The
first mode was inferred from the expression in a ligand-dependent manner of a Notch activity
reporter in the notal part of the wing disc in absence of Mib1 and Neur. The second derived
from the analysis of Dl Ser clones encompassing sensory organ precursors and expressing Dl
constructs with mutated lysines or lacking Neur interacting domains. Lateral inhibition
defects observed in absence of ligands could only be rescued by the former construct. In
addition, the ubiquitin binding domain of Epsin was also shown to be dispensable in this
process. Therefore, Neur appeared to act in this context as an endocytic adaptor independently
of its E3 ligase activity.
Invoking evolutionary considerations, authors proposed that the first alternative mode
(ubiquitination and Neur independent) corresponds to the ancestral mechanism of Notch
1.3. Ligand endocytosis and trafficking
43
activation (Gazave et al., 2009). Nonetheless, as Mib1 is present in the most ancient analyzed
phylum, this hypothesis remains debated. The second alternative mode (ubiquitination
independent and Neur dependent) might provide the rationale to the partial rescue of Neur by
Mib1 in Drosophila, as Neur would recruit specific endocytic effectors. Further investigations
are needed to estimate the relevance of these activation modes in other developmental
contexts or species and to decipher the molecular mechanisms underlying them.
1.3.3. Ligand endocytosis and trafficking
The recycling model
An alternative model, based on ligand recycling, was proposed for Epsin- and Neur/Mib1-
dependent (referred as Epsin-dependent hereafter) ligand endocytosis (Wang and Struhl,
2004) (Figure 13). Despite the fact that this model is nowadays ruled out by many studies and
by internal inconstancies, it is still presented in some articles as a preeminent mechanism for
Notch activation (Daeden and Gonzalez-Gaitan, 2018). Therefore, this model will be briefly
described here (a more in-depth analysis can be found in Weinmaster and Fischer, 2011) and
selected contradictory evidence presented in the next subsection.
Figure 13. Delta recycling model. See text for details. Adapted from Wang and
Struhl, 2004.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
44
The main assumption of this model states that newly-synthetized ligands must enter
into a recycling loop prior to being able to activate receptors (Wang and Struhl, 2004).
Concretely, newly-addressed Delta molecules at the cell surface will first be endocytosed in
an Epsin-dependent manner and targeted towards a Rab11 recycling endosome (Emery et al.,
2005; Jafar-Nejad et al., 2005; Rajan et al., 2009; Wang and Struhl, 2004). Within this
compartment, Delta will be processed to become “active” and subsequently readdressed to the
cell surface to mediate Notch signaling. A milder version of this model eludes the processing
step, but instead assumes that recycling is needed to target Delta to the dedicated activation
site of Notch receptors at the cell-cell contact (Benhra et al., 2010).
Contradictory evidence
The central inconstancy of this model relies on the nature of the “active” form of the ligand.
So far, besides the original paper (Wang and Struhl, 2004), no study has provided any
experimental evidence for such Delta processing, including the subsequent reports supporting
this model (Emery et al., 2005; Jafar-Nejad et al., 2005; Rajan et al., 2009). Other criticisms
will be formulated in a dedicated subsection in the section 2.3, as these reports used the SOP
asymmetric cell division as a model.
The strongest set of in vivo evidence against the recycling-processing model came
from the Langridge and Struhl paper (Langridge and Struhl, 2017). In their clonal approach
presented above, they first showed that either wild-type or synthetic receptor/ligand pairs
depended on Epsin to mediate signaling. As it is unlikely that all the chimeric ligands would
require any additional processing within a recycling compartment to bind their counterparts, it
suggests that Epsin-mediated is only required at the activation step. In line with this
conclusion, authors reported that wild-type ligands and receptors can still be bound in absence
of Epsin, henceforth negating the requirement for additional ligand processing.
Corroborating data were also published by Shergill et al. (Shergill et al., 2012). In their
tweezer-based setup used to measure Dll1-Notch1 interaction strength, they did not observe
any difference between control conditions and Dll1 expressing cells with impaired Rab11 or
Epsin activities. Instead, recycling assays revealed that Rab11, but not Epsin, regulated Dll1
surface levels. Therefore, this suggests that impaired recycling might impact Notch signaling
by decreasing ligand surface levels rather than by modulation ligand-receptor binding affinity
through an uncharacterized process.
1.4. Notch signaling dynamics
45
1.4. Notch signaling dynamics
Signaling pathways determine cell identities in both space and time. To date, the Notch
pathway has mostly been investigated regarding its spatial requirement during animal
development or adulthood, its core mechanism has been dissected in great detail but very little
is known on how the transcriptional output is deployed in time in response to Notch
activation. This problem can be subdivided in two parts and approached accordingly: either
by studying the dynamics of the transcriptional response or by analyzing the integration of the
Notch signalling activity into the gene expression profile.
Recent studies provided valuable insights into these two sides of Notch signaling
dynamics. Their findings will be briefly outlined in this section and several perspectives will
be discussed. A subsection will also be dedicated to the available or potential experimental
methods to study Notch signaling dynamics. Cross-talk with other pathways will not be
discussed here and has been recently reviewed in Ho et al., 2018.
1.4.1. Experimental strategies to study Notch signaling dynamics
Reporting expression of downstream targets
Gene specific reporters
Gene specific reporters are either fusion proteins or gene promoters driving fluorescent
protein expression. In most model animals, these reporters were based on genes from the HES
family and used to understand where Notch signaling is active as well as to map context-
specific gene responses (Imayoshi et al., 2013; Zacharioudaki and Bray, 2014). For example,
in Drosophila, Hes genes from the E(spl) (Enhancer of Split) complex are expressed in a
tissue specific manner (Zacharioudaki and Bray, 2014). Similarly, in mice, the requirement of
their homologues depends on context (Fischer and Gessler, 2007). Moreover, when combined
with live-imaging and mathematical modeling, these gene specific reporters proved to be
extremely powerful in understanding in vivo Notch signaling dynamics at the tissue scale
(Aulehla et al., 2008; Corson et al., 2017).
However, one obvious limitation of this method is the restricted number of genes that
genes that can be studied. Indeed, if one aims at understanding how cell identities are
acquired in time in response to Notch signaling, gene specific reporters will offer only a
Chapter 1. Notch signaling: mechanism, regulation and dynamics
46
partial view and will leave the following questions unanswered: are cells acquiring fates
shortly following Notch signaling, or does it require time-dependent downstream relays?
What are the feedback loops that either lock fates or maintain unstable states? Are they
coherent or incoherent? Are they context specific? One can always increase the number of
gene-specific reporters, assume that the studied set of genes recapitulates the whole process
and eventually infer regulatory transcriptional loops based on reporter expression patterns, but
the risk always remains that another key gene is missing.
Genome-wide methods
Dynamic genome-wide approaches might provide a powerful strategy to understand the
temporal expression pattern of Notch targets and their regulatory interactions. Recent
improvements in RNAseq protocols facilitate their application not only in cell culture assays
but also in tissues (Kolodziejczyk et al., 2015). To probe the dynamics of Notch target gene
response, if the onset of Notch activation is known or can be induced, one could perform
RNA extractions at fixed time points to assess the temporal pattern of gene expression. This
approach was recently applied to Drosophila muscle progenitors and their findings will be
discussed hereafter (Housden et al., 2013) (Figure 14). Conversely, if cells are not
coordinated, one can separate them in groups based on the expression of a Notch fluorescent
reporter through FACS sorting prior extraction.
Figure 14. Temporal profiling of Notch target gene expression (A) Principle. (B-
C) NICD decay following initial stimulus. Adapted from Housden et al., 2013.
1.4. Notch signaling dynamics
47
Although appealing in theory, application of time-scaled RNAseq on tissues might
reveal to be difficult when cell numbers are low and/or tissue dissections are time consuming.
In addition, RNAseq protocols imply cell isolation, therefore tissue dissociation by proteases.
Whether this process affects cell transcriptomes and generates artifacts is currently poorly
understood. An alternative and not less powerful technique is the targeted DamID (TaDa)
genome-profiling technique (Marshall et al., 2016; Southall et al., 2013) (Figure 15). DamID
relies on the fusion of the bacterial enzyme Dam (DNA adenine methyl-transferase) to a DNA
binding protein of interest. For example, a Dam-Pol II fusion would be useful to imprint all
transcribed genes in the genome. Targeted expression in a specific cell type is achieved with a
conditional expression system, such as UAS/Gal4 in Drosophila. Following DNA extraction,
methylated fragments are enriched and subsequent sequencing will therefore identify DNA
sequences from the cell types expressing the Dam-fusion. Importantly, contrary to RNAseq
protocols, this technique does not require cell isolation, fixation or nucleus purification
(Marshall et al., 2016).
Figure 15. Principle and application of the TaDa technique. Adapted from
Marshall et al., 2016.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
48
In the context of Notch signaling, DamID has been used further engineered to
characterize SPS binding sites at a genomic scale (Hass et al., 2015). The enzyme was split
into two inactive halves fused to a pair of proteins of interest (Notch1ICD with RBP,
MAML1 or p300). A similar approach can be used to assess where Notch transactivating
complexes localize in the genome at several time points following the onset of signaling, but
this will not provide information on gene expression. A more exciting strategy would be to
combine the rationale of Notch activation mechanism with split DamID, where Pol II would
be fused to one half of Dam while a synthetic Notch receptor whose ICD is replaced by a
complementary portion of the Dam protein to control Dam activity in a Notch-dependent
manner. Similarly, the whole Dam-Pol II fusion could replace NICD, but this would not allow
control of its expression levels. Since Dam-Pol II is toxic at high expression levels, such
constructs might be unfit in high Notch activity contexts. Furthermore, cell specificity will be
lost if the Notch-Dam-Pol II synthetic receptor is expressed at Notch endogenous levels. An
alternative approach to the split system would consist in the introduction of an orthogonal
activating system. On the TaDa side, the enzymatic activity of a Dam-Pol II fusion would be
inhibited by an additional peptide hindering Dam catalytic site. On the Notch side, a chimeric
Notch receptor would be generated in what NICD is replaced by the enzyme recognizing the
linker between the inhibiting peptide and Dam. Then, following signaling onset, the enzyme
would be released in the cytosol, activating the inhibited Dam-Pol II fusion. This would
prevent titration effects that might occur in the split system due to unwanted reconstitution of
the Dam-Pol II fusion at the ICD of unproductive Notch synthetic receptors.
To conclude, by using any of these methods, temporal evolution of the methylation
profile would inform on the gene expression pattern in response to Notch activation. By doing
so, TaDa would not only be cell type specific, but also Notch-dependent. In fact, this strategy
could be used in a broader range of cellular contexts using synthetic ligand/receptor pair to
drive Dam activity in a contact-dependent manner.
Assessing Notch activity dynamics in vivo
Gal4 chimeric receptors
Notch receptors where the intracellular domain is replaced by a Gal4 transcription factor have
been intensively used in cell culture assays to describe the kinetics of Notch activation and to
understand their influence on target gene expression (LeBon et al., 2014; Nandagopal et al.,
2018; Sprinzak et al., 2010) (Figure 16). NotchGal4-expressing cells are mixed with cells
1.4. Notch signaling dynamics
49
expressing ligands under the control of an inducible promoter to control the timing of
activation. Alternatively, signal-receiving cells can be plated on fixed ligands and signaling
starts when the gamma-secretase inhibitor DAPT is removed from the medium. Once
receptors are activated, the cleaved Gal4 moiety translocates to the nucleus and drives
expression of a UAS-driven fluorescent reporter. Integration over is used as readout of the
NICD production dynamics. Lastly, by being orthogonal to Notch endogenous targets, this
method circumvents promoter-specific regulations and downstream feedback. Of note, this
strategy does not take into account the translocation time of endogenous NICD, which can be
modulated in certain contexts (Mukherjee et al., 2016).
Figure 16. Notch-Gal4 chimeric receptors as a tool to follow Notch signaling
dynamics. Adapted from Nandagopal et al., 2018.
The impact of different NICD production dynamics on target gene expression can also
be directly tested using this system. Artificial activities are generated by applying controlled
pulses of DAPT in the medium of cells that express truncated Gal4 receptors lacking their
extracellular domains (NotchΔECD-Gal4) (Nandagopal et al., 2018). By doing so, Gal4
moieties can be released from the membrane in a time-controlled manner (see below for
experimental applications).
Interestingly, while chimeric Notch-Gal4 constructs have been generated for more
than two decades in Drosophila (Lecourtois and Schweisguth, 1998; Struhl and Adachi,
1998), they only have been used for qualitative assessment of the effectiveness of S2 or S3
cleavages. As Notch expression levels are low in tissues and the detection in vivo of the
endogenous protein is difficult (see below), reintroduction of these tools in experimental
Chapter 1. Notch signaling: mechanism, regulation and dynamics
50
strategies might be valuable in quantifying NICD production dynamics in a living organism
over longer time periods and/or with a higher temporal resolution.
Synthetic reporters
Another versatile approach by which to analyze the kinetics of Notch endogenous signaling in
vivo relies on Notch-responsive synthetic fluorescent reporters. Upstream regions of these
reporters consist in multiple Su(H) binding sites combined with additional enhancers and a
ubiquitous promoter, so that expression of a fluorescent marker is induced upon NICD entry
in the nucleus (Zacharioudaki and Bray, 2014). This strategy has been efficiently applied in
flies and mice and, by contrast to Notch-Gal4 receptors, integrates NICD degradation rate, as
the reporter activity depends on endogenous NICD. Therefore, this method provides a good
readout of NICD activity in the nucleus, even if it cannot be used to discriminate between a
reduction in signaling and an increase of NICD degradation rate.
These reporters have been extensively used in Drosophila to determine the different
cell types undergoing Notch activation. The most commonly utilized, Notch Responsive
Element (NRE), is made of two SPS sites flanked by binding sites of a broadly expressed
transcription, Grainy Head (Grh), and a minimal hsp70 promoter (Furriols and Bray, 2001)
(Figure 17). Several variants with different fluorescent proteins have been generated (eGFP,
mCherry or a destabilized Venus-PEST) (Zacharioudaki and Bray, 2014). So far, due to weak
fluorescence, the NRE reporter activity has been mostly detected using antibodies targeting
the reporter protein. Recently, a study provided evidence that a destabilized super-folder GFP
(sfGFP) NRE variant can be used to quantify in vivo Notch activation in epidermal cells of
the fly notum over several hours (Hunter et al., 2016).
Figure 17. Expression patterns of NRE-GFP and Cut, a Notch target gene. Note
the broader pattern of the synthetic reporter. Adapted from Zacharioudaki and
Bray, 2014.
1.4. Notch signaling dynamics
51
Nonetheless, the weak fluorescence could be overcome by simple means. For
example, increasing the number of NRE reporters per animal can enhance the signal-to-noise
ratio. However, this might also affect endogenous signaling. Indeed, reporters can act as sinks
for NICD molecules and compete with endogenous target genes. Another way to increase the
signal-to-noise ratio would be to fuse several fluorescent proteins separated by T2A
sequences downstream the promoter, instead of just one. This strategy has proved to be
successful in refining live imaging of E-Cadherin and Myosin II in the fly notum (Pinheiro et
al., 2017).
Lastly, the choice of the fluorescent reporter also requires much attention. As
fluorescent proteins display different maturation times, detection of the reporter expression
kinetics might be biased by this factor in fast developmental processes (Couturier et al., 2014;
Khmelinskii et al., 2012). Therefore, fast maturating fluorescent proteins should be favored to
avoid long delays between RNA synthesis and fluorescent detection.
Direct measurement
Recent work from our lab provided strong evidence that Notch activation rate can be directly
measured in flies expressing GFP-tagged receptors (Couturier et al., 2012). The strategy
consisted of inserting a GFP in the Notch intracellular domain to monitor both full-length
Notch and cleaved NICD fragments. The construction, named NiGFP, was introduced in flies
within a bacterial artificial chromosome (BAC) and was shown to rescue a Notch null
mutation. In NiGFP transgenic flies, following SOP division, GFP fluorescence could be
detected in vivo in the nucleus of the signal-receiving daughter cell, but not the signal-sending
one (Figure 18). Additionally, the onset of signaling and NICD accumulation rates in the
nucleus of the signal-receiving cell could be determined. Nevertheless, GFP fluorescence was
low in vivo and might limit more refined analyses of Notch dynamics. Tagging Notch
intracellular tails with several GFP proteins could address this shortcoming, but protein
functionality might be altered. More generally, further applications of this approach will
depend the generation of fast-maturating and bright fluorescent tags.
Eventually, it is worth noting that the main difference between this approach and the
aforementioned relies on the direct integration of NICD degradation rate in the quantification
of Notch signaling dynamics. Whereas Gal4 chimeric receptors solely reflect the NICD
production rate at the cell surface, and synthetic reporters measure NICD nuclear activity,
quantification of GFP fluorescence in the nucleus directly integrates both NICD production
and degradation rates. To estimate these processes, two complementary approaches based on
Chapter 1. Notch signaling: mechanism, regulation and dynamics
52
light manipulation could be used. First, measuring nuclear GFP fluorescence after FRAP
application on the nucleus (or FLIM outside the nucleus) would allow the estimation of NICD
entry/exit rates in/from the nucleus. Second, in flies expressing Notch receptors tagged with a
green-to-red photoconvertible fluorescent protein, the nuclear NICD pool could be
discriminated from surface or cytosolic Notch molecules, thereby allowing dual imaging of
NICD production (green fluorescence accumulating in the nucleus) and NICD degradation
(decay of the nuclear red fluorescence). Nonetheless, although simple in design, these setups
might be challenging to implement in vivo due to weak fluorescent signals and may need to
be combined with combination either chimeric Gal4 or synthetic reporters to quantify Notch
signaling dynamics.
Figure 18. Dynamics of Notch signaling using a NiGFP transgene. (a-b) Detection
of NiGFP in a fixed pIIa nucleus. (c) Detection of NiGFP in a pIIa nucleus in
vivo. (d-e) Signaling dynamics based on GFP fluorescence quantification in pIIa
and pIIb nuclei. Adapted from Couturier et al., 2012.
1.4. Notch signaling dynamics
53
1.4.2. Time-scaled genome profiling of the Notch transcriptional response
To date, only one study investigated the temporal pattern of the transcriptional output in
response to Notch activation (Housden et al., 2013). Genome-wide approaches have been
applied to identify Notch target genes, but these strategies could only provide a snapshot of a
single transcriptional state, but not the logic of the underlying regulatory network (Chen et al.,
2018; Krejci et al., 2009; Palomero et al., 2006; Weng et al., 2006).
Figure 19. Types of gene expression profiles in response to an NICD stimulus.
See text for details. Adapted from Housden et al., 2013.
Chapter 1. Notch signaling: mechanism, regulation and dynamics
54
To obtain the expression dynamics of Notch target genes, Housden et al. performed
expression microarrays on Drosophila DmD8 cells at fixed time points following an initial 5-
minute pulse of NICD expression (of note, NICD was not detected after 30 minutes,
indicating that NICD was active in the nucleus between 5 and 20-25 minutes). They identified
154 differentially expressed genes that respond to the NICD pulse and analyzed a subset of
them that showed the strongest up or down regulations. These 57 selected genes were
distributed among 3 types of expression profile: early up-regulated (5- to 15-minute
response), late up-regulated (>30-minute response) and down-regulated genes (Figure 19).
The first group was mainly composed by genes from the E(spl) complex, while
developmental genes constituted the second group and negative transcriptional regulators the
third one. At first glance, one might think that E(spl) genes act as activating relays driving the
expression of downstream targets that change the cell behavior and/or fate and whose
expression might not necessarily depend on NICD. However, as E(spl) genes encode
transcriptional repressors, the authors hypothesized that they alleviate repression of late up-
regulated genes by repressing another repressor. Indeed, expression of some late up-regulated
genes depended on the E(spl)-dependent repression of Hairy, a transcriptional repressor
belonging to the group of down-regulated genes. As this feed-forward repression affected
only a subset of genes, this implies that additional layers of regulation are at play.
Nonetheless, this supports some interesting model whereby Notch-responsive genes are
maintained in a repressive state to buffer ectopic expression when Notch activity levels are
low or transient. Taking into consideration the fact that E(spl) genes display a context-specific
expression pattern, one might think that E(spl) not only function as relays, but also as points
of a railway track that orient information flow.
The authors also tested the influence of two other parameters, signal duration and
signaling dynamics, on the dynamics of the transcriptional response. A comparison between a
5-minute and a 30-minute pulse of NICD did not reveal significant changes in expression
profiles of most genes, suggesting that, in this context, extending the presence of NICD in the
nucleus does not affect the expression pattern of target genes. Said differently, the
transcriptional network downstream of Notch activation works autonomously once triggered.
Similarly, pulsed or continuous Notch activation did not differentially affect the dynamics of
gene expression, although mRNA levels were higher at some loci. Nonetheless, the authors
did not verify whether additional genes were expressed when changing these parameters (see
next section).
1.4. Notch signaling dynamics
55
Beyond the experimental considerations specific to this study, the key information
here, in light of this section, is that expression of Notch targets requires time, transcriptional
relays and feed-forward interactions. Therefore, once a cell receives Notch signaling, the
acquisition of a new fate with a new set of cellular behaviors is not instantaneous and might
present context specific temporal requirements. This is somewhat obvious, i.e. cells do not
switch fates within seconds or few minutes, but this has never been demonstrated at the
genomic scale in the context of Notch signaling. Finally, as animal development is a time
constrained phenomenon, it would be interesting to determine how the response at the
transcriptional level to Notch signaling is coordinated with the progression of developmental
processes and to reveal the molecular mechanisms enabling fast or slow responses depending
on the temporal constraint of the process.
1.4.3. Dynamic encoding of NICD production kinetics
Why Notch ligands cannot always compensate for each other depending on the cellular
context and whether kinetics of NICD release from the cell surface influence the nature of the
transcriptional output seem at first sight as two separate questions. Yet, a recent study
connected these two questions and elegantly showed that Dll1 and Dll4 activate Notch1 with
different dynamics, which in turn translate into the expression of different Notch target genes
(Nandagopal et al., 2018) (Figure 20).
To reach that conclusion, Nandagopal et al. first observed in a cell culture assay that
Dll1 and Dll4 activate Notch1 with different kinetics, either pulsatile or sustained (NICD
production kinetics were probed using Notch-Gal4 chimeric receptors described above).
Moreover, Dll1 and Dll4 drive expression of different Notch direct target genes: Hes1
expression was induced by both ligands, while Hey1 and HeyL showed strong up-regulation
only with Dll4 (i.e., sustained activation regime). The authors then investigated the
relationship between the kinetics of NICD production and the nature of the transcriptional
output using a NotchΔECD-Gal4 expressing cell line. As stated above, activation dynamics
can be artificially generated with this construct by the timely removal of DAPT. First,
analysis of Hes1, Hey1 and HeyL expression profiles following DAPT removal revealed that
Hes1 responded early and transiently, between 0 and 2 hours after removal, while Hey1 and
HeyL expression was detected 3 hours after removal and was maintained afterwards. This
suggested the idea that pulsed activation of Notch can only trigger Hes1 expression, an early
up-regulated gene, but not Hey1/L, two late responding genes requiring a more sustained
Chapter 1. Notch signaling: mechanism, regulation and dynamics
56
activation regime. This hypothesis was corroborated when different durations of NICD pulses
were applied: Hes1 was expressed in a transient manner under any condition (5-, 15-, 30-
minute and continuous pulse) while Hey1 expression required a continuous pulse. Finally, the
authors provided evidence that this differential behavior of Dll1 and Dll4 was also pertinent in
vivo in the context of embryonic myogenesis, where both ligands direct opposite fates, and
was dependent on ligand intracellular tails, but not ECDs, raising the possibility that ligand
specificity arises from different modes of endocytosis.
Figure 20. Dynamic encoding of Notch activity elicits different biological outputs.
See text for details. Adapted from Nandagopal et al., 2018.
From the dynamic viewpoint, this study provides intriguing insights into the way
dynamics of NICD production are decoded by the genome. Identical cells can display
different gene expression patterns that specify distinct fates just simply because the dynamics
of NICD production differ. As the Notch pathway elicits a wide range of responses depending
on the cellular context, it would be interesting to estimate how much the dynamic encoding of
Notch activity described in this study contributes to this heterogeneity.
1.5. Concluding Remarks
57
1.5. Concluding remarks
To conclude, the logic of the Notch pathway where upstream (the ligand) and downstream
signals (NICD) are relayed in a stoichiometric manner appears to be modulated in many
different ways to trigger the expected cellular response at the right time and at the right
location. In a sense, synthetic circuits based on chimeric receptor-ligand pairs only reproduce,
in a crude way, the strategies employed by cells throughout development and evolution to
adapt this signaling module to a given biological context. Moreover, our perception of the
Notch pathway is limited by the extensive work conducted in model organisms, whose
findings are often extended to the whole animal kingdom. Evo-Devo approaches might
therefore provide exciting insights on how the Notch signaling module has been adapted not
only between cell types, but also between species and phyla.
Although only a small part of this knowledge will be useful in the following chapters,
the main aim of this chapter was nonetheless to give to the reader an integrated view of our
current knowledge of the pathway and a general context related to Notch signaling in which
my thesis is integrated.
58
Chapter 2
Notch signaling during Drosophila neurogenesis
The involvement of Notch in Drosophila embryonic neurogenesis was first discovered in the
1930’s in pioneering work of Poulson on embryos carrying deficiencies on the X
chromosome (Poulson, 1937). Among the different deficiencies he analyzed, one spanned the
whole Notch locus. He observed that endodermal and mesodermal tissue layers were lacking
in Notch deficient embryos. At the same time, the ectoderm being proliferated producing cells
belonging to the nervous system at the expense of the epidermis. Forty years later,
combination of mutational analysis with electronic microscopy confirmed this original
observation and revealed that the “neurogenic” phenotype is caused by an imbalance in fate
acquisition between neuroblasts and epidermal cells within proneural fields (Hartenstein and
Wodarz, 2013; Lehmann et al., 1981, 1983). Notch and other “neurogenic” genes (Delta,
Mastermind, E(spl)-C) were later proposed to single out neuroblasts in the embryonic
neurectoderm through a process termed “lateral inhibition” (Cabrera, 1990).
Since then, regulation of lateral inhibition by the Notch pathway appeared to occur in
multiple neurogenic processes throughout fly development. In parallel, molecular
characterization of neural lineages revealed that Notch signaling is also involved in fate
specification in the central and peripheral nervous systems. This chapter aims to give to the
reader an overview of these different processes. In a first section, it synthesizes the different
neural contexts where Notch signaling regulates lateral inhibition. Second, it briefly
summarizes the current knowledge on the role of Notch in larval neurogenesis. A last and
consequent section will be dedicated to the sensory organ lineage, the model I worked on
during my PhD.
2.1. Lateral inhibition and selection of neural progenitors
Since the original discovery of Notch role in selecting neuroblasts among a proneural groups,
several additional selection processes of neural progenitor selection were found to be
dependent on Notch. General principles of lateral inhibition will be discussed in the first
2.1. Lateral inhibition and selection of neural progenitors
59
subsection dedicated to embryonic neurogenesis, while the two following subsections will
serve as variations of this common theme.
2.1.1. Embryogenesis and neuroblast selection
Figure 21. Selection of neural progenitors during embryogenesis: from
prepatterning genes to neuroblast. (a) Prepatterning genes expression pattern. (b-
c) Proneural clusters. (d) Neuroblast delamination after selection. (e) Notch-
mediated lateral inhibition. (f) From the proneural cluster to the NB lineage.
Adapted from Hartenstein and Wodarz, 2013.
Chapter 2. Notch signaling during Drosophila neurogenesis
60
Formation of a proneural field
Lateral inhibition occurs within a group of equivalent cells that can either adopt a neural or an
epidermal fate (Figure 21). During embryogenesis, these groups of cells, or “proneural
clusters”, are found in the ventral neurectoderm and their location in different embryonic
segments is dependent on prepatterning genes (Hartenstein and Wodarz, 2013; Skeath and
Carroll, 1992; Skeath et al., 1992) (Figure 21a). These prepatterning genes regulate the
expression of a set of proneural genes, acheate (ac), scute (sc) and lethal of scute (l’sc), that
belong to the Achaete-Scute complex (AS-C). These three proneural genes encode bHLH
transcription factors that specify the equivalency group (Figure 21b-c). Intriguingly, these
proneural genes are not always expressed altogether among all the proneural clusters (Skeath
et al., 1992). Whether this is responsible for the different types of neurons produced later by
the selected neuroblasts is not known.
Neuroblast selection
Once proneural clusters are formed, proneural genes enhance expression of Delta and bi-
directional Notch signaling starts between cells (Figure 21e). In this context, Notch receptors
exert an inhibitory effect on proneural factors and bias fate specification towards the
epidermal identity. NICD drives the expression of E(spl)-C genes whose gene products bind
to the promoter region of AS-C genes and inhibit their transcription. As signaling endures,
cells from the proneural clusters enter a bi-modal state where they express simultaneously the
proneural genes and their inhibitor. Eventually, one cell among the cluster “wins” the
competition by expressing more Delta and/or receiving less Notch signal from the neighbors.
As the selected neuroblast is the only remaining cell expressing proneural genes, it
upregulates Delta expression and sends a permanent inhibitory signal to lock in respective
fates (Campos-Ortega, 1994; Hartenstein and Wodarz, 2013). Finally, lateral inhibition ends
in this context with neuroblast delamination and its first division (Figure 21d,f).
Lateral inhibition has also been extensively studied in the context of sensory organ
precursor (SOP) selection and recent advances will be discussed in the next subsection.
2.1.2. Notum patterning and SOP selection
SOP selection, a classical lateral inhibition model
The understanding of Notch involvement in lateral inhibition arose with concomitant
discoveries in neuroblast or SOP selection (Hartenstein and Wodarz, 2013). SOPs produce a
2.1. Lateral inhibition and selection of neural progenitors
61
wide variety of sensory organs through stereotyped lineages during fly development (Lai and
Orgogozo, 2004) (Figure 22). Like neuroblasts, SOPs emerge from proneural groups
characterized by proneural genes, either belonging to the AS-C complex or not (Jarman et al.,
1995; Simpson, 1990). Selection of SOPs then occurs via a competition mechanism mediated
by Notch signaling (Heitzler and Simpson, 1991; Simpson, 1990).
Figure 22. Diversity of sensory organs and lineages in Drosophila. Adapted from
Lai and Orgogozo, 2004.
Chapter 2. Notch signaling during Drosophila neurogenesis
62
Lateral inhibition has been mostly studied in the context of the microchaete lineage in
the fly notum, or dorsal thorax. SOPs giving rise to these structures are first selected among
proneural clusters expressing achaete and scute (Simpson, 1990). A recent report provided
experimental and computational insights into the selection process of microchaete SOPs
(Corson et al., 2017). Authors demonstrated that proneural cells experience a succession of
intermediary states where they both emit and receive the signal (Figure 23). This cell-intrinsic
bistability in turn leads to a gradual refinement of proneural clusters, organized as anterior-
posterior stripes in the notum, into single SOPs selected at the center of the stripe. These
results contrast with former models proposed for lateral inhibition where precursors are
selected in a sharp manner once a threshold of signal-sending activity has been crossed (Barad
et al., 2010; Lubensky et al., 2011). Finally, the model implied a positive feedback loop
between proneural activity and signal-sending activity (i.e. Delta expression) in the proneural
group and cis-inhibition of Notch as mechanisms permitting bistability and amplifying subtle
heterogeneities in cell states, although their biological significance has not experimentally
been tested in this study. More information on modeling lateral inhibition can be found in
Binshtok and Sprinzak, 2018.
Figure 23. Neural precursor selection occurs through gradual refinement of the
cluster. (A-B) Model recapitulating precursor selection. (C-D) In vivo cluster
refinement. Sc (Scute) is the proneural gene. Adapted from Corson et al., 2017.
2.1. Lateral inhibition and selection of neural progenitors
63
Dynamic patterning of SOP selection in the notum
Proneural clusters where SOPs give rise to macrochaete or microchaete are determined in the
notum either by prepatterning factors (Gómez-Skarmeta et al., 2003; Simpson, 2007) or by
Notch-mediated self-organization (Corson et al., 2017), respectively.
In the former case, the situation is much like neuroblast selection during embryonic
neurogenesis. In the latter case, however, extrinsic cues do not provide the informational
position. As mentioned above, proneural clusters organize within narrow stripes along the
body axis. At the end of the patterning process, each hemi-notum displays five rows of
regularly spaced SOPs. Strikingly, at the beginning of the process, no stripe can be observed.
Careful examination of proneural activity and Notch signaling components revealed how the
five rows emerge (Corson et al., 2017) (Figure 24). First, a prepattern of Delta expression
with Notch activity at its sides sets the position for Ac and Sc expression in the presumptive
rows 1, 3 and 5. As SOPs are selected within these rows, Notch activity starts receding
between rows 1-3 and 3-5. Gaps generated by this decrease provide the positional information
for Ac and Sc expression in presumptive rows 2 and 4. Thus, dynamic Notch signaling
provides in this context a negative template for the sequential emergence of SOP rows in a
self-organized manner.
Figure 24. Patterning of the bristle rows in the notum combines prepatterning and
self-organization. Adapted from Corson et al., 2017.
Chapter 2. Notch signaling during Drosophila neurogenesis
64
To conclude, emergence of the bristle pattern in the fly notum provides an interesting
example where Notch signaling is used sequentially to provide the positional information for
proneural activity in the prospective rows and to single out SOPs once proneural stripes are
defined. Nonetheless, it still remains unclear why Ac and Sc start being expressed in between
rows of Notch activity.
Long-range signaling: what mechanism? what role?
In the notum, proneural domains exceed several cell diameters. This questions how cells that
are not in the immediate vicinity of the selected SOP are inhibited. A simple model would
assume that proneural cells at the boarder of the proneural domain would be inhibited first,
and so forth as one of the cells at the center of the domain will be selected. Such gradual
refinement is coherent with current models of lateral inhibition (Corson et al., 2017;
Lubensky et al., 2011).
Figure 25. Combination between short-range (A) and long-range (B) signaling is a
potent mechanism explaining lateral inhibition in large proneural clusters.
Adapted from Perez-Mockus and Schweisguth, 2017.
2.1. Lateral inhibition and selection of neural progenitors
65
Alternatively, lateral inhibition might combine short-range and long-range Notch
signaling (Figure 25). This hypothesis has emerged fifteen years ago when thin actin-based
protrusions, or filopodia, containing Delta molecules have been observed on the basal side of
SOPs (de Joussineau et al., 2003; Renaud and Simpson, 2001). However, whether these
structures could contact distant cells and activate Notch was speculative at that time. A series
of reports from the Kornberg lab (Huang and Kornberg, 2015; Roy et al., 2011, 2014)
provided evidence that filopodia can indeed mediate Hedgehog or Notch signaling in other
developmental contexts. Concomitantly, a combination of in vitro experimentation with
modeling revealed that signaling in filopodia is presumably dependent on ligand diffusion
coefficient to compensate for small contact surfaces (Khait et al., 2016). Therefore, high
ligand turnover and/or diffusion length in filopodia might yield high levels of Notch activity.
All these reports considered, it became clear that filopodia might be a potent source of
ligands for Notch receptors. Recent studies provided support to a model where filopodia are
involved after SOP selection in refining the bristle pattern during notum morphogenesis
(Cohen et al., 2010) and in maintaining fates of distant epidermal cells prior to SOP division
(Hunter et al., 2016). Whether filopodia are required for the selection process of SOPs within
the proneural cluster is yet not known.
Another mechanism regulating Notch long-range signaling is based on the secreted
glycoprotein Scabrous (Sca). Sca was first discovered in the context of R8 selection in the eye
disc (see subsection below, Baker et al., 1990). In the notum, loss of Sca leads to
supernumerary SOPs with reduced spacing compared to wild-type cells (Renaud and
Simpson, 2001). This suggested that Sca promotes long range signaling, either in a Notch-
dependent or independent way. Discovery that Sca complexes with Notch favored the first
model (Powell et al., 2001). To date, the molecular function of Sca in Notch signaling is still
debated, as it has been proposed to act as a positive (Giagtzoglou et al., 2013; Li et al., 2003)
or negative (Lee et al., 2000; Powell et al., 2001) regulator.
2.1.3. Photoreceptor R8 selection in the eye disc
Morphogenetic furrow progression
The Drosophila eye compound is a sensory organ composed by 800 subunits, called
ommatidia, that are organized in a crystal lattice (Ready et al., 1976). Each ommatidium is a
complex multicellular structure made of eight photoreceptor neurons, four cone cells that
secrete the apical lens and additional pigment cells (Kumar, 2012). The crystal pattern of the
Chapter 2. Notch signaling during Drosophila neurogenesis
66
adult retina originates from the selection in a regularly-spaced pattern of R8 photoreceptors
during imaginal eye disc development. These are the first cells selected among each
ommatidium, the remaining cells being recruited and specified afterwards.
Selection of R8 photoreceptors is tightly linked to the progression of a morphogenetic
furrow that crosses orthogonally the whole epithelium from the posterior to the anterior
margin (Ready et al., 1976; Wolff and Ready, 1991). R8 cells emerge right behind the furrow
as it progresses anteriorly (Figure 26).
Figure 26. Morphogenetic furrow progression (red) and formation of ommatidial
rows (green) in the eye disc. Adapted from Spratford and Kumar, 2014.
Besides the classical features defining a furrow, i.e. apical constriction and tissue
invagination, this morphogenetic furrow is also characterized by the expression of a bHLH
proneural gene, atonal (ato), within an anterior stripe (Jarman et al., 1994). In absence of ato,
the morphogenetic furrow keeps progressing but R8 specification is lost (Jarman et al., 1995).
This led to the conclusion that Ato is the proneural gene in this context. Analysis of Ato
expression revealed that R8 selection occurred in a two-step restrictive process where first
Ato expression pattern is refined from the anterior stripe into intermediary groups (1) prior to
R8 selection (2) (Jarman et al., 1994, 1995).
Following this discovery and knowing that Notch signaling was required for
photoreceptor specification (Cagan and Ready, 1989), the analogy with neuroblast or SOP
selection through lateral inhibition became clear.
2.1. Lateral inhibition and selection of neural progenitors
67
Notch signaling, patterning and selection of the R8 photoreceptor
The transition from the intermediary proneural group to the single R8 photoreceptor through
ato down-regulation looks much like classical Notch-mediated lateral inhibition (Figure 27).
In addition, patterning of photoreceptors into a crystalline lattice highly resembles a template-
based mechanism where the former row of specified R8 cells provides the positional
information for the next row by emitting a circular inhibitory field (Lubensky et al., 2011).
Then, two functions can be hypothesized for Notch signaling in this context: it is required for
R8 selection (“local lateral inhibition”) (1) and it constitutes the inhibitory signal that
positions the next row (“long-range inhibition”) (2).
Figure 27. R8 selection and patterning in the eye disc. See text for details.
Adapted from Frankfort and Mardon, 2002.
Chapter 2. Notch signaling during Drosophila neurogenesis
68
Using a Notch thermosensitive allele to probe in a timely manner the requirement of
Notch activity during the selection process, Baker and others demonstrated that Notch
signaling was indeed required for the selection of the R8 cell among the intermediary group
(Baker and Yu, 1997; Baker et al., 1996) (stage 2/3 in Figure 27). Mechanistically, Notch
activity appeared to inhibit Ato autoregulation in intermediary groups, presumably through
the expression of E(spl) genes. This led to the extinction of Ato expression in the intermediary
group except in the future R8 cell. To date, whether R8 selection occurs in a similar fashion
as SOPs in the notum (Corson et al., 2017) or by a preselection mechanism (Lubensky et al.,
2011) remains unclear. Further mutational analyses revealed that Delta is the key ligand in
this context (Baker and Yu, 1997). Intriguingly, although redundant with Delta, Ser
expression was detected in the morphogenetic furrow and in selected R8 cells. What non-
essential function Ser could mediate in this process remains a mystery.
The role of Notch signaling in exerting the long-range inhibition that serves as a
template for the next row of R8 photoreceptors is less clear. While first ruled out (Baker et al.,
1996), such role was assessed in later developmental studies (Baker et al., 1996; Sun et al.,
1998) or inferred in computational analyses describing the crystalline pattern formation
(Lubensky et al., 2011). In support of this “long-range inhibition”, signals emitted by Delta
expressing cells posterior to the morphogenetic furrow were shown to extend over several cell
diameters (Baker and Yu, 1997). The cellular basis (filopodia, cell packing) of this long range
signaling has yet to be determined. Similarly to the notum, Scabrous has been proposed as the
molecular effector of the inhibitory field (Baker et al., 1990; Lubensky et al., 2011), but its
molecular function has still not been defined.
More careful analysis of Notch phenotypes revealed an unexpected third function for
Notch signaling prior to R8 selection. While it was established that Ato expression in the
stripe anterior to the morphogenetic furrow was dependent on Hedgehog (Hh) and
Decapentaplegic (Dpp) signaling (stage 1, Figure 27), it appeared that Notch was required to
stimulate Ato expression levels at higher levels (Baker and Yu, 1997). Importantly, this
enhancement seemed to be required for the transition from the stripe to the intermediary
group and correlated with the shift of ato regulation by upstream regulators (Hh, Dpp)
towards autoregulation. This Notch-dependent upregulation was hypothesized to enhance
expression of Ato target genes at sufficient levels to trigger subsequent processes.
Nonetheless, whether such gating mechanism is taking place remains to be tested. More
confounding at that time was the fact that Notch signaling could either stimulate or inhibit
Ato expression depending on the step during the selection process. One explanation resides in
2.1. Lateral inhibition and selection of neural progenitors
69
the signal transduction mechanism: while Ato inhibition during R8 selection required E(spl)-
C expression in a Su(H)-dependent manner, enhancement of Ato expression in the stripe by
Notch apparently did not require Su(H) (Ligoxygakis et al., 1998). Further reexamination of
the Su(H) phenotype supported the idea that Notch activation is required to alleviate Su(H)-
mediated repression (Bray and Furriols, 2001; Li and Baker, 2001). A second explanation lies
in the mode of Ato regulation. Isolation and characterization of ato enhancers uncovered that
Ato expression within the stripe or in intermediary groups is mediated by two distinct
regulatory regions (Sun et al., 1998) (Figure 27). One appealing, but, hypothesis is that the 3’
enhancer responsible for Ato expression within the stripe integrates Hh and Dpp positioning
signals and a Notch-mediated Su(H) “derepression” to elevate Ato expression levels in order
to trigger the switch in Ato regulation towards the second 5’ enhancer specific to the
intermediary groups that depends on Ato auto-regulation and is sensitive to E(spl) inhibition.
As a result, intermediary groups form only at equal distance from R8 cells of the former row,
while Ato expression becomes sensitive to the long-range Notch-mediated inhibitory signal
(Figure 27).
To conclude, just like in the notum, Notch signaling is reused several times during the
R8 selection process to trigger the transition from the stripe to the intermediary groups (1), to
select R8 by inhibiting immediate neighbors (2) and to presumably set the position of the next
intermediary groups emerging from the stripe (3). Hence, Notch-mediated patterning and
lateral inhibition seem to be coordinated. How this emerged during evolution still remains
poorly understood (see discussion in Gazave et al., 2017).
2.2. Central nervous system: neural pool expansion and cell type
diversification
Following neural precursor selection during embryonic neurogenesis, Notch signaling is
reused several times to maintain and specify cell fates along neural lineages when quiescent
embryonic neuroblasts of the central nervous system (CNS) reactivate at larval stages.
Depending on the step when Notch is required, fate specifications can either lead to stem cell
renewal or to diversification of differentiated cell types. These two cases will be described in
the following two subsections.
Chapter 2. Notch signaling during Drosophila neurogenesis
70
2.2.1. Neuroblast self-renewal
In the larval brain, neural stem cells are subdivided in two categories: type I and type II
neuroblasts (NBs). They differ by the nature of the lineages they initiate. Type I NBs divide
asymmetrically to self-renew and produce differentiated glial mother cell (GMC). The GMC
then divides to produce either neurons or glial cells (Brand et al., 1993; Jarman et al., 1993).
On the other hand, type II NBs also divide asymmetrically to self-renew but instead of a
GMC, produce an intermediate neural progenitor (INP) (Bowman et al., 2008). These INPs
undergo in turn a succession of self-renewing ACDs generating GMCs that terminally divide
to generate two neurons or glial cells. Although in fewer number than type I NBs, type II NBs
makes a significant contribution to larval neurogenesis due to this transit-amplification. In
both lineages, despite these differences, daughter NBs receive Notch signaling from the
newly-born GMC (Zacharioudaki et al., 2012).
The requirement of Notch signaling is different in the two subtypes. While absolutely
required to maintain identity of type II NBs (Bowman et al., 2008), Notch activity appears to
play only a minor role in type I NB self-renewal (Almeida and Bray, 2005; Homem et al.,
2015; Wang et al., 2006). This discrepancy might be due to the expression of Asense (Ase), a
bHLH transcription factor, in type I but not type II NBs (Bowman et al., 2008). One
hypothesis would be that Ase buffers Notch activity in type I NBs by antagonizing E(spl)
genes (Southall and Brand, 2009) and regulates other mechanisms that maintain type I NB
identity after division (Zacharioudaki et al., 2012); nonetheless the basis for the differential
integration of Notch signaling between NB lineages is not known. In addition to self-renewal,
Notch signaling regulates also growth of the daughter NB following division of the mother
type II NB (San-Juán and Baonza, 2011; Song and Lu, 2011).
2.2.2. Cell type differentiation and diversification
NB lineages are characterized by one (type I) or a succession (type II) of asymmetric cell
division(s) that is followed by the terminal division of a GMC giving rise to two neurons or
two glial cells. Often considered as a symmetric division (Homem et al., 2015), the terminal
division of the GMC can generate daughter cells with distinct fates. Analysis of neural
lineages revealed that Notch is also activated differentially between daughter cells of a GMC.
In the ventral CNS, directional Notch signaling between the terminal daughter neurons is
2.2. CNS: neural pool expansion and cell type diversification
71
crucial to generate the diversity of secondary neurons (Truman et al., 2010). Similar results
were obtained with medulla NBs, whose lineages are identical to type I ones ((Li et al., 2013).
A recent report provided evidence that such role for Notch in diversifying cell fates among a
common cellular type is also conserved in gliogenesis (Ren et al., 2018).
Hence, Notch signaling appears to regulate cell fate decisions in NB lineages from the
top, i.e. the stem cell in type II lineages, to the bottom, i.e. the neuronal or glial identities.
Such preponderance, although intriguing at first sight, might be simply due to the fact that
Notch signaling, being a juxtacrine pathway, is the perfect signaling toolkit to specify fates in
an intra-lineage fashion. Thus, NB lineages can undergo their developmental program
autonomously without being dependent on external cues to dictate fate decisions.
2.3. Peripheral nervous system: specification of the microchaete
lineage
As in the CNS, Notch signaling regulates cell fate decisions in various developmental
contexts in the peripheral nervous system (PNS), including ommatidium formation,
diversification of peripheral neurons or fate specification in sensory organ lineages. This
section will focus specifically on the role of Notch in one the sensory organ lineages: the
microchaete lineage of the notum. Phenomenology of the lineage will be presented, as well as
a brief synthesis on the ACD of sensory organ precursor cell (SOP). The two last subsections
will each emphasize an aspect of SOP division that is debated or poorly understood and that
will correspond each to a Chapter of the Results section.
2.3.1. The microchaete lineage: an overview
Phenomenology of the lineage
Following their selection by lateral inhibition during early metamorphosis, SOPs undergo a
stereotyped series of ACDs that finally give rise to a four-cell mechanosensory organ called
microchaete (Fichelson and Gho, 2003; Gho et al., 1999; Hartenstein and Posakony, 1989;
Roegiers et al., 2001a) (Figure 28). SOPs first divide asymmetrically along the body anterior-
posterior axis to generate a posterior pIIa cell and an anterior pIIb cell. Two hours later, the
pIIb undergoes its own ACD in a neuroblast-like manner along the apical-basal axis. It
Chapter 2. Notch signaling during Drosophila neurogenesis
72
produces an apical pIIIb cell that remains at the level of other epidermal cells and a basal glial
cell that undergoes apoptosis (Fichelson and Gho, 2003). The pIIa cell divides as the SOP
along the body axis approximately one hour after pIIb ACD and gives rise to the socket cell
and the shaft, i.e. the two external cells of the mechanosensory organ. pIIIb then divides
asymmetrically along the apical-basal axis two hours after being produced and generates the
neuron and the sheath cell, i.e. the internal cells of the mechanosensory organ. Hence, two
types of ACDs occur in the microchaete lineage: following the anterior-posterior axis (SOP,
pIIa) and along the apical-basal axis (pIIb and pIIIb). Of note, the microchaete lineage, named
hereafter the SO (sensory organ) lineage, is just one variant among many different sensory
organ lineages found in flies (Lai and Orgogozo, 2004) (Figure 22).
Figure 28. The thoracic microchaete lineage. (a) Dorsal thorax, or notum. (b)
External and (c) internal cells of the mechanosensory bristle. (d) Lineage
overview. Red (resp. blue) outlines Notch activation (resp. inhibition). Adapted
from Schweisguth, 2015.
Once the four cells composing the future organ are made, they undergo coordinated
morphogenetic processes to form a functional mechanosensory organ.
2.3. PNS: specification of the microchaete lineage
73
Early evidence for Notch requirement
In 1990, while the Notch field was exploding, Hartenstein and Posakony provided pioneering
evidence supporting the requirement of Notch activity in fate specification in the SO lineage
(Hartenstein and Posakony, 1990). They made use of the thermosensitive allele Nts of Notch
to estimate the temporal requirement of Notch activity in the SO lineage. While early
inactivation of Notch during pupal development impaired lateral inhibition, thereby leading to
an excess of bristles on the adult notum, bald cuticles were recovered when the temperature
shift was performed after SOP selection. Although this experiment clearly demonstrated the
requirement of Notch in specifying the SO fates, notions of intralineage signaling and ACD
were not considered. In fact, by analogy with the lateral inhibition model, it was hypothesized
that the neuron was inhibiting the three remaining cells.
Figure 29. Unequal segregation of Numb during SOP ACD in pIIb. Adapted from
Schweisguth, 2015.
This changed with the discovery of the unequal segregation of Numb in one daughter
cell following SOP and NB ACD (Rhyu et al., 1994) (Figure 29). Then, it became clear that
fates in the SO lineage are internally regulated by ACDs. Of note, Numb was already
identified as a fate determinant in SO lineages, but its role in biasing fates towards the neural-
like one was unclear (Uemura et al., 1989). A last brick was missing: the link with a signaling
pathway. The connection with Notch was made few years later when Numb was shown to
directly bind Notch and to antagonize its activity. Additionally, live-imaging of Partner of
Numb (Pon, Lu et al., 1998), a Numb adaptor protein in SOPs, revealed that pIIb, pIIIb, the
socket and the neuron were the cells inheriting Numb (Gho et al., 1999). This led to a new era
when the regulators that orchestrate directional Notch signaling in the SO lineage started
being characterized.
Chapter 2. Notch signaling during Drosophila neurogenesis
74
2.3.2. Molecular mechanisms of SOP asymmetric cell division
Polarization of the SOP in response to PCP
ACD is step-wise process where an initial symmetry breaking event triggers the subsequent
orientation of the spindle along the division plane and the unequal segregation of cellular
materials that include cell fate determinants, organelles or cytosolic content (Knoblich, 2008;
Schweisguth, 2015). SOPs lying in the notum, a monolayered epithelium, display an apical-
basal polarity with distinct domains. Their symmetry breaking mechanism relies on the
polarization of polarity proteins prior to ACD, a strategy found again and again in metazoans
(Cowan and Hyman, 2004; Knoblich, 2008) (Figure 30).
Figure 30. Polarization of polarity proteins prior to SOP division ensures unequal
segregation of Numb and Neur and orientation of the mitotic spindle. Adapted
from Schweisguth, 2015.
The polarity proteins Par3 (Bazooka (Baz) in flies), Par6 and the atypical protein
kinase C (aPKC) were shown to accumulate at the posterior pole of interphasic SOPs in
response to the Fz/Dsh (Frizzled/Dishevelled) PCP signaling (Bellaïche et al., 2001; Bellaıche
et al., 2001; Besson et al., 2015; Roegiers et al., 2001b) (Figure 30). Of note, PCP signaling is
2.3. PNS: specification of the microchaete lineage
75
only responsible for the anterior-posterior orientation of the ACD and impairing its
components does not prevent ACDs for occurring. How the asymmetric mode of division is
rescued at mitosis in PCP mutants is still a mystery. Recently, Meru, a RASSF9/10 homolog
that polarizes posteriorly prior to ACD, was proposed to bridge the Fz/Dsh pathway with Par3
recruitment at the posterior pole (Banerjee et al., 2017). Similar to PCP components, Meru is
dispensable for ACD.
In interphase, Par6-aPKC is maintained in an inactive state in a complex with Lgl
(Lethal (2) giant larvae) (Wirtz-Peitz et al., 2008). Upon mitosis entry, the mitotic kinase
AuroraA phosphorylates Par6 and mediates dissociation from Lgl. Released Par6-aPKC
dimers then associate with Par3 and form the active Par3-Par6-aPKC complex which excludes
Numb from the posterior cortex by the coordinated Par3-dependent recruitment of Numb
(Wirtz-Peitz et al., 2008) and its aPKC-mediated phosphorylation (Smith et al., 2007; Wirtz-
Peitz et al., 2008) (Figure 31). Thus, Numb anterior polarization is controlled both spatially
and temporally. Nonetheless, it remains unclear how Par6 and aPKC are recruited posteriorly.
Indeed, they are sequestered by Lgl, which is uniformly distributed at the cortex, and cannot
interact with polarized Par3 prior AuroraA activation.
Figure 31. Phosphorylation-based exclusion of Numb from the posterior pole
prior to SOP division. See text for details. Adapted from Schweisguth, 2015.
In parallel, an anterior complex was also shown to form prior ACD in response to
Pk/Stbm (Prickle/Strabismus) PCP signaling and to be required for Numb anterior recruitment
(Bellaïche et al., 2004; Bellaıche et al., 2001; Schaefer et al., 2000). This complex is made of
the polarity protein Dlg (Disc-large), Pins (Partner of Inscuteable) and Gai. In synergy with
Chapter 2. Notch signaling during Drosophila neurogenesis
76
Meru and Fz/Dsh signaling, Pins excludes Par3 from the anterior cortex and thereby enhances
symmetry breaking (Figure 30).
Intriguingly, although two mechanisms were found to direct Numb anterior
localization, i.e. the posterior phosphorylation-based exclusion and the anterior positive
recruitment, it is still unclear why Numb and Pon form a cortical crescent at mitosis entry and
do not accumulate at endosomal cell surfaces or at apical membranes. An entry point to this
matter might reside in the regulation of Pon distribution by the mitotic Polo kinase (Plk) in
NBs (Wang et al., 2007; Zhu et al., 2016). Plk-mediated phosphorylation is indeed required
for anterior localization of Pon. Therefore, Pon might be the key effector recruiting Numb
anteriorly. More recently, Pon and Numb were shown to form liquid condensates at the basal
cortex of NBs and liquid droplets in Hela cells through atypical interactions between Numb
PTB domain and Pon N-terminus (Shan et al., 2018). Authors speculated that physical
characteristics of this condensate, coupled with the membrane anchoring of the Numb-Pon
complex (Knoblich et al., 1997; Lu et al., 1999), explain why Numb and Pon distribution is
crescent-shaped.
Spindle orientation
The polarizing cues driving Numb anterior localization are reutilized during ACD to align the
spindle with the anterior-posterior division axis. While randomly distributed upon mitosis
entry, centrosomes are recruited to the anterior and posterior poles at mitotic entry (Bellaïche
et al., 2001; Schweisguth, 2015). One centrosome is recruited anteriorly by polarized Pins and
Gai in a Mud-dynein-dependent manner whereas Fz/Dsh attract the second centrosome via
Mud (Bowman et al., 2006; Johnston et al., 2013; Ségalen et al., 2010) (Figure 30).
In this way, unequal segregation of Numb is coupled to spindle orientation along an
anterior-posterior division axis.
2.3.3. Unequal segregation of fate determinants and directional Notch
signaling
Numb, the negative regulator
Numb is an evolutionary conserved protein involved in a plethora of cellular processes that
include ubiquitin-mediated protein degradation, vesicle trafficking, and cell adhesion (Gulino
et al., 2010). Drosophila Numb acts as an endosomal adaptor through its phospho-tyrosine
2.3. PNS: specification of the microchaete lineage
77
binding (PTB) domain (Guo et al., 1996; Hutterer and Knoblich, 2005) and as an endosomal
sorting protein through its two C-terminal Eps15 homology regions, termed DPF and NPF
(Gulino et al., 2010; Hutterer and Knoblich, 2005).
Figure 32. Time-lapse images illustrating the relocalization of Numb from the
anterior crescent (B-E’’) to subapical endosomes in pIIb (F-G’). Adapted from
Couturier et al., 2013.
During ACDs in the SO lineage, Numb is asymmetrically inherited by the signal-
sending cell (Guo et al., 1996). At cytokinesis, Numb relocalizes from the anterior crescent to
subapical sorting endosomes (Couturier et al., 2013) where it is thought to inhibit Notch
recycling (Cotton et al., 2013; Couturier et al., 2013) and promote its addressing towards
lysosomes (Couturier et al., 2014) (Figure 32). The current view on Notch inhibition by
Numb involves a third protein, Sanpodo (Spdo). Spdo is a four-pass transmembrane protein
expressed specifically in multiple lineages where fate acquisition is Notch-dependent (Dye et
al., 1998; O’Connor-Giles and Skeath, 2003; Park et al., 1998; Skeath and Doe, 1998). It
physically interacts with Notch (O’Connor-Giles and Skeath, 2003) and is required in the
signal-receiving cell for Notch activation through the recruitment the g-secretase complex
(Upadhyay et al., 2013). Spdo also physically binds to Numb and thereby negatively regulates
Notch in the signal-sending cell (O’Connor-Giles and Skeath, 2003). A combination of live-
Chapter 2. Notch signaling during Drosophila neurogenesis
78
imaging and mutational analyses provided support to a “recycling inhibition” model
(Schweisguth, 2015) whereby Numb prevents Notch recycling towards the cell surface via
Spdo (Cotton et al., 2013; Couturier et al., 2013) (Figure 33). The molecular details of this
model have yet to be determined.
Figure 33. Current model for Numb function in pIIb. See text for details. Adapted
from Couturier et al., 2013.
Neuralized, the positive regulator
Neur is an E3 ligase promoting endocytosis of Notch ligands (see section 1.3.2. for details). In
the SO lineage, it is both required to single out SOPs during lateral inhibition and to promote
Delta/Notch signaling during lineage progression (Yeh et al., 2000) (of note, Delta is the key
ligand in this context (Zeng et al., 1998)).
Figure 34. Unequal segregation of Neur in pIIb during SOP ACD. Adapted from
Le Borgne and Schweisguth, 2003.
2.3. PNS: specification of the microchaete lineage
79
Just like Numb, Neur is segregated unequally in pIIb during SOP ACD (Le Borgne
and Schweisguth, 2003) (Figure 34). This bias in Neur distribution is considered to increase
the signal-sending activity of pIIb, thereby reinforcing intralineage fate specification.
Regulation of Neur asymmetric anterior localization shares similarities with Numb and Pon as
Neur anterior crescent was shown to be dependent on PCP and the components of the
anteriorly polarized complex (Le Borgne and Schweisguth, 2003). However, a mechanism
based on posterior phosphorylation-dependent exclusion does not seem to apply to Neur.
Finally, the molecular machinery leading to Neur anterior accumulation is not known.
Is unequal segregation of Numb and Neur relevant, after all?
Unequal segregation of fate determinants is a powerful mechanism to bias fate decisions in an
intralineage fashion, yet in the context of the SOP ACD, the relevance of Numb and Neur
unequal inheritance has not been directly tested.
Regarding Numb, it remains unclear to what extent increased Numb concentration
and/or differentially regulated Numb activity contribute to the inhibition of Notch recycling
specifically in pIIb. The fact that Numb redistributes at cytokinesis in subapical sorting
endosomes in pIIb, but not in pIIa, raises the question whether an additional regulator is
present in pIIb to drive this cell-specific relocalization. This question could be directly
addressed by analyzing fate specification, Notch activity and Numb distribution in pIIa-pIIb
pairs expressing Numb mutants unable to bind to Par3 (Wirtz-Peitz et al., 2008) or aPKC
(Smith et al., 2007).
On the other hand, several lines of evidence suggest that Neur asymmetric inheritance
in pIIb is not crucial. First, loss of Numb leads to robust bidirectional Notch signaling along
the lineage. As the formation of Neur anterior crescent is independent of Numb (Le Borgne
and Schweisguth, 2003), this means that pIIa can efficiently signal to pIIb in absence of
Numb despite a reduced Neur concentration. Second, Neur knockout can be compensated by
uniformly expressing Mib1 in SOPs to restore fate specification (Lai et al., 2005b). Therefore,
uniform E3 ligase activity does not induce cell fate transformations. Taken together, these
data rather indicate that unequal segregation of Neur provides a non-essential mechanism
increasing the robustness of binary fate decisions. Challenging the system by decreasing
Notch or Delta expression levels might uncover such role.
Chapter 2. Notch signaling during Drosophila neurogenesis
80
2.3.4. Notch is activated in pIIa, but where?
Contact area and Notch signaling
As Notch signaling is a juxtacrine pathway, it was long assumed that signaling activity could
be affected by the contact area. Recently, two in vitro studies provided experimental evidence
supporting this idea (Khait et al., 2016; Shaya et al., 2017) (Figure 35). In the latter report, to
address this question, investigators designed an elegant micropattern-based device allowing
the precise control of the contact area between a signal-sending and a signal-receiving cell.
Using trans-endocytosis levels as a readout for Notch activity, they observed that Notch
activation levels scale with contact area. From a biological standpoint, these results emphasize
the possibility that the location of Notch activation site at the interface of contacting cells
might have a quantitative effect on signaling. Therefore, elucidating this location might not
only explain how cells elicit strong Notch activity but also shed a new light on known Notch
regulators regarding the organization of the activation site.
Figure 35. Correlation between contact area and Notch signaling activity. Adapted
from Shaya et al., 2017.
In the SO lineage, although investigators were mostly making use of this model to
perform genetic screens to characterize novel Notch regulators (Acar et al., 2008; Giagtzoglou
et al., 2013; Go and Artavanis-Tsakonas, 1998; Jafar-Nejad et al., 2005; Le Bras et al., 2012;
Mummery-Widmer et al., 2009; Rajan et al., 2009), several models were proposed over the
years for Notch activation site during SOP ACD. In fact, these models were mostly built to
interpret the phenotypes observed when newly-characterized regulators were mutated rather
2.3. PNS: specification of the microchaete lineage
81
than to directly address where Notch is activated. The supporting evidence will be presented
and discussed below as well as the implications resulting from the hypothesized signaling
subcellular site. Developing novel experimental strategies to directly tackle the location of
Notch activation site along the pIIa-pIIb interface comprises Chapter 4 from the “Results”
section.
Adherens junction, apical microvilli and Delta recycling
Detection of Notch and its ligands at the level of the adherens junction (AJ) adhesive belt and
the above-located apical region in epithelia led investigators to assume that Notch receptors
are activated at this location (Banda et al., 2015; Mizuhara et al., 2005; Sasaki et al., 2007).
This idea is further reinforced by the reported physical interaction between Notch and E-Cad
(Sasaki et al., 2007).
As mentioned earlier, SOPs lying in the notum display an apical-basal polarity.
Likewise, the pIIa-pIIb interface is polarized and characterized by an apical region marked by
Crumbs and Par6, subapical AJs and a basolateral domain (Benhra et al., 2011; Founounou et
al., 2013). It is noteworthy that furrowing is asymmetric during SOP ACDs, leading to an
apically positioned midbody at cytokinesis (subsection 3.1.3, Founounou et al., 2013).
Therefore, the pIIa-pIIb interface is characterized by a small apical domain located above the
midbody and a large basolateral area below the midbody.
On the receptor side, experimental data supporting Notch activation at the level of AJs
and/or the most-apical region mostly relies on the detection of endogenous Notch both in
fixed tissues (Benhra et al., 2011; Cotton et al., 2013) and in vivo (Couturier et al., 2012)
(Figure 36). Nonetheless, no functional assays were designed to test whether these receptors
contribute to signaling, thereby assuming that localization mirrors function.
Figure 36. Notch localizes at the AJ level at cytokinesis in fixed tissues (A) and in
vivo (B). Adapted from Benhra et al., 2010 and Couturier et al., 2012.
Chapter 2. Notch signaling during Drosophila neurogenesis
82
The array of evidence appears to be denser on the ligand side. Several studies
suggested that Delta trafficking, in light of the recycling model (subsection 1.3.3, Wang and
Struhl, 2004) towards the apical domain was reflecting the signaling site (Benhra et al., 2010;
Emery et al., 2005; Jafar-Nejad et al., 2005; Rajan et al., 2009). The seminal observation
reporting that Delta-containing Rab11 recycling endosomes were forming specifically in pIIb
at cytokinesis raised the possibility that Delta undergoes a recycling cycle prior to being
readdressed to the signaling site (Emery et al., 2005) (Figure 37A). However, careful analysis
of this paper rather suggests that this recycling event plays a minor role in tuning Notch
activity. First, authors indicated several times that in Rab11GFP expressing flies, formation of
large Rab11-positive compartments was detected only in a small subset of pIIa-pIIb pairs,
which were subsequently selected for the analysis of Delta trafficking. Thus, the importance
of this mechanism in SO lineages is uncertain. Second, whether inhibiting Delta recycling by
the expression a dominant-negative Rab11 protein affects cell fate acquisition is not reported.
Third, symmetrizing the formation of large Rab11 compartments in pIIa and pIIb by genetic
means only mildly perturb cell fate specification. Alternatively, even though these Rab11
endosomes still form in pIIb in absence of Neur, one might consider that they appeared
through evolution to handle the bulk of Neur-mediated Delta endocytosis in pIIb.
Despite these limitations, the Delta trafficking model is rapidly gaining acceptance. In
the same issue of Developmental Cell, the component of the exocyst Sec15 was reported to
mediate Notch signaling in the SO lineage (Jafar-Nejad et al., 2005). In sec15 cells,
trafficking of Notch, Delta and Spdo was defective and proteins accumulated at the basal side
of pIIa and pIIb. Nonetheless, the authors chose to only emphasize the role of Sec15 in Delta
trafficking towards the apical side of the pIIa-pIIb interface to match with the Rab11-
dependent recycling model (Figure 37B). Some data of this study instead argue that signaling
defects might be due to impaired exocyst-mediated budding from the Golgi apparatus
(Yeaman et al., 2001). Indeed, Spdo was shown to accumulate in LVA-positive
compartments. In such a scenario, signaling would be abolished due to sequestered Spdo
instead of mistrafficked Delta. Finally, as exocytosis is broadly impaired in sec15 cells, one
might hypothesize that pIIa-pIIb contact formation during furrow ingression is defective due
to insufficient membrane material deposition.
2.3. PNS: specification of the microchaete lineage
83
Figure 37. Evolution of the Delta recycling model in the SO lineage. See text for
details. Adapted from Emery et al., 2005, Jafar-Nejad et al., 2005 and Rajan et al.,
2009.
Chapter 2. Notch signaling during Drosophila neurogenesis
84
This model was further supported by a proposed connection between the Arp2/3
complex, WASp and Delta trafficking (Rajan et al., 2009). The authors found that Arp3, an
essential subunit of the Arp2/3 complex (section 3.2), is required for Notch activation in the
SO lineage. Together with WASp, an activator of Arp2/3 that also regulates Notch signaling
in this context (Ben-Yaacov et al., 2001), they appeared to regulate the formation of an actin
rich structure (ARS) at the pIIa-pIIb interface and microvilli covering the apical surfaces of
pIIa and pIIb (Figure 38). In parallel, they also mediated Delta recycling towards the apical
side of the ARS and/or microvilli (Figure 37C). Alternative hypotheses, including Delta
endocytosis or contact formation/expansion during cytokinesis, were not thoroughly tested in
this study. Collectively, these data extended the original recycling model where henceforth
Delta-containing vesicles are addressed towards the apical domain (AJs and/or microvilli) of
the pIIa-pIIb interface in a WASp-Arp2/3-Sec15-dependent manner. Whether the ARS is
necessary for signaling is not tested in this study. This model will be discussed more in-depth
in the last Chapter of this Introduction describing the relationship between the Arp2/3
complex and Notch signaling (subsection 3.3.2).
Figure 38. An actin rich structure (top panels) containing microvilli (bottom
panels) forms at the pIIa-pIIb interface. Adapted from Rajan et al., 2009.
2.3. PNS: specification of the microchaete lineage
85
The Delta recycling loop was at last closed when Neur-mediated endocytosis was
proposed to provide Rab11 endosomes in Delta molecules (Benhra et al., 2010). In this study,
Neur activity was found to trigger the endocytosis of Delta proteins that essentially localized
laterally. Later on, investigators made use of MDCK cells to test the capacity of Neur to drive
basal-to-apical transcytosis. It is noteworthy that MDCK cells are a model cell line derived
from canine kidney and display elevated endogenous transcytosis activity. Moreover, MDCK
cells used in this study were in interphase, while Delta trafficking occurs in pIIb in the
specific context of cytokinesis (Emery et al., 2005). Lastly, Neur or Delta homologs are not
expressed in this cell line. Therefore, one should be careful while transposing experimental
results between biological systems. Neur2 was found to trigger Dll1 basal-to-apical
transcytosis in MDCK cells and this finding was extrapolated to pIIb.
Taken together, these studies imply that Notch is activated either at the level of
subapical AJs or apical microvilli, thus in a reduced contact area. Importantly, they also
assume that Delta needs to be recycled prior to activating Notch. Recent work oppositely
contradicts such requirement (subsection 1.3.3).
The lateral contact
A much weaker, but not less important, body of evidence suggests on the contrary that Notch
receptors are activated by Delta on the lateral side of the pIIa-pIIb interface. Consistently,
Neur-mediated endocytosis of Delta occurs at this location (Benhra et al., 2010).
Whereas Notch is mainly detected apically in wild-type pIIa-pIIb pairs, receptors
appeared to accumulate laterally in mutant backgrounds impairing Notch trafficking
(Couturier et al., 2012). In numb cells, Notch lateral localization might reflect the
readdressing of receptors in pIIb towards the interface to drive ectopic signaling in pIIb
(Figure 39). In spdo cells, this ectopic lateral distribution might account for the accumulation
of unprocessed receptors, thereby correlating with abolished Notch signaling in spdo SO
lineages (Figure 39). However, alternative explanations can account for these phenotypes. In
both numb and spdo backgrounds, lateral detection of Notch might simply reflect an excess of
Notch molecules caused by impaired Numb-mediated degradation or Spdo-dependent
endocytosis of Notch prior to SOP ACD. More generally, this versatility in interpreting
protein distributions in multiple genetic backgrounds highlights the difficulty to draw strong
and unambiguous conclusions from this type of data. Thus, Notch activation site should be
determined without relying on genetic correlations.
Chapter 2. Notch signaling during Drosophila neurogenesis
86
Figure 39. Notch is detected laterally in vivo in numb and spdo backgrounds. See
text for interpretation. Adapted from Couturier et al., 2012.
Finally, as the lateral domain of the pIIa-pIIb interface is a large contacting surface,
this location might be particularly adapted to elicit high levels of Notch activity in pIIa, if
required.
Directionally trafficking Sara endosomes
An unexpected location for Notch activation emerged from the discovery and characterization
of directionally trafficking Sara (Smad anchor for receptor activation) endosomes during SOP
ACD (Coumailleau et al., 2009). Sara endosomes, which belong to the family of Rab5 early
endosomes, were found to incorporate Notch and Delta molecules prior to ACD, localize at
the central spindle during anaphase and be directed at late telophase in pIIa. Once inherited, it
is speculated that Notch receptors are activated at the endosomal surface in a Neur- and Delta-
dependent manner (Figure 40).
2.3. PNS: specification of the microchaete lineage
87
Figure 40. Directionally trafficking Sara endosomes carrying Notch and Delta
molecules are inherited by pIIa. Adapted from Coumailleau et al., 2009.
Although the molecular mechanism biasing Sara endosome inheritance in pIIa has
been resolved with great details during SOP ACD (Derivery et al., 2015; Loubéry et al.,
2017), some aspects of the model remain elusive and question its significance in fate
specification throughout the SO lineage. First, the mechanism by which Notch can be
activated at the endosomal surface by ligand endocytosis needs to be elucidated. Notch
cleavage was observed at the surface of enlarged endosomes expressing the dominant-
negative Rab5Q88L to help visualize NECD and NICD moieties (Coumailleau et al., 2009).
Whether Notch is efficiently processed at the surface of endogenous Sara endosomes is not
reported to date. Ligand-dependent cis-activation (Elowitz et al., 2018) might solve this
matter, yet it remains to be experimentally addressed. Second, in contrast with other
biological contexts (Kressmann et al., 2015; Montagne and Gonzalez-Gaitan, 2014), loss of
Sara does not affect fate decisions in the SO lineage (Coumailleau et al., 2009). Depleting
zygotically Sara enhances neur knock-down phenotype in the notum (Loubéry et al., 2017),
albeit the reason for this synergy in unclear. Indeed, impairing Sara endosomes could increase
the total pool of available Neur, since Notch signaling at the Sara endosomal surface is Neur
dependent, and thereby rescue the neur phenotype. Lastly, authors observed that the Sara-
positive Rab5Q88L compartment was randomly segregated in pIIa and pIIb and subsequently
made use of it to assess whether ectopic localization in pIIb drives a pIIb-to-pIIa fate change
(Coumailleau et al., 2009). This was indeed the case in 66% of pIIb cells, yet this phenotype
might be due to impaired Numb activity at the surface of Rab5 sorting endosomes (Couturier
et al., 2013). More importantly, when the Sara-Rab5Q88L enlarged endosome was found in
pIIb, the pIIa fate was normally specified. This indicates that Sara endosomes do not
contribute significantly to Notch signaling in pIIa.
Chapter 2. Notch signaling during Drosophila neurogenesis
88
Collectively, these remarks suggest that Sara endosomes are dispensable for fate
specification in the SO lineage but might play a significant role in other biological contexts
(Kressmann et al., 2015; Montagne and Gonzalez-Gaitan, 2014). Consequently, this implies
that the bulk of NICD in signal-receiving cells originate from the pIIa-pIIb interface.
2.3.5. Notch is activated in pIIa, but when?
Lineage progression and theoretical temporal requirement for Notch activation
As outlined above (subsection 1.4.2), Notch transcriptional response is orchestrated in time
and requires time-demanding relays mediated by E(spl) genes (Housden et al., 2013). Using
Drosophila muscle progenitors as an experimental model, authors showed that activated
Notch targets are divided into two categories: early- and late-responding genes. They also
uncovered that the expression of some late targets relied on a negative feedforward loop.
Considering that late-responding gene expression peaks approximately one hour after the
NICD stimulus, one can now appreciate that specifying fates is a time-demanding process and
might be highly time-constrained with regards to Drosophila developmental time.
The SO lineage clearly illustrates such constraint. As mentioned earlier (subsection
2.3.1), the division rate following first SOP division ranges from 2 to 3 hours. In particular,
after being produced, pIIb divides two hour later. As it is the single signaling source for pIIa,
this means that the pIIa fate must be specified within this time window. From the signaling
standpoint, this requirement questions whether Notch receptors need to be activated in pIIa
prior to a time limit to enable correct target gene expressions and fate acquisition.
Evidence for Notch activation at cytokinesis
Making use of the Nts allele, Remaud et al. determined the temporal requirement of Notch
activation in pIIa by switching flies from the restrictive to the permissive temperature at fixed
time points following SOP division (Remaud et al., 2008). First defects in fate specification
(approx. 10%) were observed when flies were shifted between 15 and 30 minutes after SOP
division. Adding an additional 15-minute delay to this shift (i.e., 30-45-minute total delay)
increased the proportion of abnormal lineages to approximately 35%. This percentage kept
increasing as Notch activation was set further from SOP division, till recovering only mutant
lineages with a 90-minute delay (Figure 41). This clearly demonstrates that Notch receptors
need to be activated at cytokinesis to ensure pIIa fate specification in a reproducible manner.
Authors later attempted to link this result with a competence window related to cell cycle
2.3. PNS: specification of the microchaete lineage
89
progression. Evidence supporting this hypothesis were based on the observation that pIIb cells
were more responsive to ectopic Notch signaling during S phase than G2 phase. However,
how an ectopic NICD input relates to endogenous signaling experienced by pIIa is not clear.
Second, as the S-G2 transition occurs ~75 minutes after SOP division, this hypothesis does
not account for fate defects observed with early shifts in the Nts experiment. A more
parsimonious interpretation would assume that delayed Notch activation prevents the
expression in pIIa of the whole set of genes required for fate specification.
Figure 41. Notch activation at cytokinesis is required to specify the pIIa fate. See
text for details. pI corresponds to SOP. Adapted from Remaud et al., 2008.
Live-imaging of GFP-tagged Notch firmly demonstrated that Notch receptors are
indeed activated at cytokinesis in pIIa (Couturier et al., 2012). The GFP being inserted on
Notch intracellular tail, investigators could monitor in vivo both the full-length receptor and
the cleaved NICD fragment following receptor activation (Figure 42). At cytokinesis, GFP
fluorescence was shown to accumulate in pIIa nucleus once furrowing was completed.
Figure 42. Notch is activated at cytokinesis. Adapted from Couturier et al., 2012.
Chapter 2. Notch signaling during Drosophila neurogenesis
90
Therefore, as soon as a contact surface is established between the SOP daughter cells,
signaling starts. When linked to the requirement of Notch activation at cytokinesis (Remaud
et al., 2008), this observation suggests that the interplay between SOP cytokinesis and Notch
activation is a key mechanism to ensure fate specification prior to the next round of ACDs.
How the two are related will be discussed in the next introductory chapter and experimentally
tested in the Chapter 5 of the Results section.
91
Chapter 3
The Arp2/3 complex, a molecular pivot bridging cytokinesis and Notch activation?
The requirement of Notch activation at SOP cytokinesis to ensure pIIa fate specification
questions the interplay between the mechanism driving cytokinesis and the core mechanism
mediating Notch processing. Given that Arp3 is required for Notch signaling in the SO
lineage and that the Arp2/3 complex regulates contact expansion during cytokinesis,
investigating the role of Arp3 in the context of SOP cytokinesis might reveal the nature of this
interplay.
This chapter is divided into three sections. The first one succinctly describes the
molecular mechanisms at stake during cytokinesis occurring in an epithelium. The second
section introduces the Arp2/3 complex, its molecular activity and its role in cytokinesis. The
last section discusses the nature of Arp2/3 requirement in the SO lineage.
3.1. Dividing in an epithelium
Cytokinesis can be defined as the last step of cell division where different cellular materials
(chromosomes, organelles, cytoplasmic content) are segregated into the two daughter cells. Its
molecular mechanisms have been intensively studied in isolated cell systems, including the
budding yeast or mammalian cell lines. However, dividing in an epithelium presents
additional challenges for a cell: not only it has to generate forces to split itself into two
daughter cells but also to preserve the barrier function of the epithelium by generating new
adhesive contacts and, not the least, to endure the pressure exerted by the neighboring cells
while dividing. On top of that, SOPs need to generate a contact surface that sustain Notch
signaling between pIIa and pIIb.
This section briefly describes the different steps occurring during cytokinesis and later
focuses on the specificities found in epidermal cell or SOP cytokineses of the fly notum.
These latter subsections are linked with SOP ACD to present how cytokinesis can influence
Chapter 3. Arp2/3, Notch activation and cytokinesis
92
Notch signaling in the pIIa-pIIb fate decision. A more detailed and integrated view of
cytokinesis can be found in Glotzer, 2017.
3.1.1. Overview of cytokinesis progression
Anaphase onset and cytokinetic ring positioning
Cytokinesis starts upon metaphase-to-anaphase transition when cyclin B is degraded and
Cdk1 inactivated after activation of the anaphase promoting complex/cyclosome (APC/C)
(Glotzer, 2017). This switch in kinase activity at anaphase onset enables the activation of
several cytokinetic regulators, including the centralspindlin complex (Figure 43). This
complex then relocalizes at the spindle midzone and promotes cortical recruitment and
activation of the RhoGEF (guanine exchanging factore) Ect2/Pbl (Pebble) at the division
plane (Lekomtsev et al., 2012). Ect2/Pbl in turn recruits and activates the GTPase RhoA to
trigger the assembly of the cytokinetic ring (Basant and Glotzer, 2018).
Of note, although the requirement of the cytokinetic ring is valid in many cell types,
alternative mechanisms through polarized cell migration enable cytokinesis independently of
the formation of an actomyosin ring (Dix et al., 2018; Neujahr et al., 1997).
Figure 43. Cytokinetic ring positioning at anaphase onset. Adapted from Basant
and Glotzer, 2018.
3.1. Dividing in an epithelium
93
Cytokinetic ring assembly and contraction
Once activated, RhoA orchestrates the recruitment of the key components forming the
cytokinetic ring, including the MyoII kinase ROCK, formins mediating filamentous actin
polymerization and the mulitfunctional scaffold protein anilin (Piekny and Maddox, 2010;
Thieleke-Matos et al., 2017). RhoA activity leads to the formation of bipolar MyoII
minifilaments and the additional recruitment of tropomyosin, a-actinin and septins (Glotzer,
2017). Anchoring of the actomyosin ring to the membrane is mediated by RacGaps, FERM
(4.1 protein – ezrin – radixin – moesin)-domain containing proteins, anilins and F-BAR
proteins, depending on the context (Figure 44).
Figure 44. Overview of the molecular mechanisms at stake during anaphase
elongation. (a-b) Metaphase-anaphase transition and anaphase elongation. (c)
Anchoring of the cytokinetic ring to the plasma membrane. (d) Polar relaxation.
See text for details. Adapted from Ramkumar and Baum, 2016.
Contractility that drives ring closure is mediated by RhoA-activated Rho- and citron-
kinases whose activity regulate the MyoII-dependent sliding of actins filaments. This induces
membrane furrowing at the division plane. Progression of ring closure till the formation of the
Chapter 3. Arp2/3, Notch activation and cytokinesis
94
midbody depends on the cycling between active and inactive forms of RhoA (Basant and
Glotzer, 2018).
Several cellular mechanisms that also shape cellular architecture accompany ring
constriction. Anaphase cell elongation is dependent on forces generated during mitotic spindle
elongation (Scholey et al., 2016), albeit the specific molecular mechanisms at stake in an
epithelium are not known. Polar relaxation through kinetochore-localized PP1-Sds22
signaling facilitates anaphase elongation and couples chromosome segregation to anaphase
progression (Rodrigues et al., 2015) (Figure 44). At the cytokinetic furrow, coordination of
constriction progression with vesicle exocytosis to deliver membrane material at newly-
forming membranes is key for cytokinesis completion (Frémont and Echard, 2018; Neto et al.,
2011; Schechtman, 1937). In the remainder cortex, Rac1-dependent Arp2/3 activity is thought
to counteract forces exerted by the contractile ring (Loria et al., 2012).
Midbody formation and abscission
As the cytokinetic ring closes, a narrow intracellular bridge filled with antiparallel
microtubule filaments is left between the two daughter cells. Following cytokinetic ring
maturation, a circular structure termed the midbody forms within the bridge and is actively
remodeled through exocytosis (Frémont and Echard, 2018). In parallel, microtubule filaments
are depolymerized. Finally, the ESCRT-III complex is recruited by the midbody to drive
membrane scission and resolve the daughter cells’ membranes (Frémont and Echard, 2018;
Glotzer, 2017) (Figure 45).
Figure 45. Midbody formation and abscission. Adapted from Glotzer, 2017.
3.1. Dividing in an epithelium
95
3.1.2. Epithelial cytokinesis as a multicellular process
Non-autonomous MyoII activity in neighboring cells
Neighboring cells in the first place can be considered as a negative constraint from the view
point of the dividing cell. Firstly, during anaphase elongation, the dividing cell must at the
same time push on the neighbors located at the poles and resist to the pressure they exert in
return on the cell body. Second, neighboring cells can directly induce a tension via adherens
junctions (AJs) on the constricting cytokinetic ring (Founounou et al., 2013).
Figure 46. MyoII (red) activity in neighbors helps in juxtaposing the dividing cell
membranes during cytokinetic ring constriction. Adapted from Herszterg et al.,
2013.
Recent work in the fly notum challenged this view and provided evidence that MyoII
activity in immediate neighbors to the newly-forming AJ cohesive contact is necessary to set
proper contact geometry (Founounou et al., 2013; Herszterg et al., 2013) (Figure 46).
Constriction of the cytokinetic ring exerts a pulling force on the neighboring cells and drives
local recruitment and activation of MyoII in Rho-kinase dependent manner at the level of the
AJ belt. This localized activity facilitates the apposition of the invaginating membrane and
controls the length of the future AJ interface (Herszterg et al., 2013). These findings were
recently augmented by a study resolving the molecular mechanisms that trigger this local
MyoII activity (Pinheiro et al., 2017). Pulling forces exerted by the ring elongate the AJs
Chapter 3. Arp2/3, Notch activation and cytokinesis
96
where the dividing membrane ingress, thereby diluting locally AJ concentration. This
promotes on the side of the neighboring cell self-organized actomyosin flows that ultimately
lead to the recruitment of MyoII at the basis of the invagination. Thereby, cytokinesis
progression is coordinated with AJ remodeling and formation.
This mechanism resolved in the notum is exclusively based on dividing epidermal
cells. Therefore, whether neighboring cells contribute to set the geometry of the AJ interface
between pIIa and pIIb is not known. Assuming that signaling occurs at this level (Benhra et
al., 2010, 2011; Rajan et al., 2009), one could hypothesize that such contribution would be
crucial to promote the formation of elongated AJs, thereby increasing the contact surface to
sustain high Notch signaling levels (Shaya et al., 2017). A similar hypothesis could be
formulated regarding the lateral side of the pIIa-pIIb interface, although this model is based
on the analysis of the apical side of epidermal cells where AJs are mostly detected and
organized within a belt. Whether MyoII activity in neighbors is also required to properly set
the geometry of the lateral contact, which differs by polarity protein composition and AJ
organization from the apical adhesive belt, between daughter epidermal cells or pIIa and pIIb
is not known.
Autonomous contact expansion
In vivo analysis of epidermal cell cytokinesis in the notum also uncovered a cell-autonomous
mechanism that promotes contact expansion during cytokinetic ring constriction (Herszterg et
al., 2013). Activities of the small GTPase Rac1 and the Arp2/3 complex in the dividing cell
are required for AJ elongation, and in some cases for the formation of the adhesive contact, by
promoting a wave of actin polymerization above and below the apically positioned midbody
(see next subsection). This actin bulge has been proposed to draw newly-formed membranes
closer to allow AJ formation and consequently to push away the intervening membranes of
the neighboring cells (Herszterg et al., 2013, 2014) (Figure 47). Therefore, Rac1 and Arp2/3
activities also regulate the contact geometry between daughter cells and could influence
Notch signaling levels in pIIa in a quantitative manner (Shaya et al., 2017). As Arp3 is
required for Notch activation in pIIa (Rajan et al., 2009), this hypothesis will be discussed
with greater details in the last section of this chapter.
3.1. Dividing in an epithelium
97
Figure 47. Cell-autonomous Rac-dependent Arp2/3 activity ensures neighbor
membrane withdrawal and contact expansion. Adapted from Herszterg et al.,
2014.
3.1.3. Asymmetric furrow ingression
Apical midbody positioning
Epidermal cell and SOP cytokineses in the notum are characterized by an apical positioning
of the midbody due to asymmetric furrow ingression (Founounou et al., 2013; Herszterg et al.,
2013). The basal initiation of furrowing does not seem to respond to extrinsic cues in this
context and appears to rely only on the initial basal bias in MyoII distribution along the
cytokinetic ring (Founounou et al., 2013). After ring closure, the midbody is shifted apically
and localizes just below the AJ belt (Figure 48).
Figure 48. Asymmetric furrowing in the notum is caused by asymmetric MyoII
distribution. Adapted from Herszterg et al., 2013 and Herszterg et al., 2014.
Chapter 3. Arp2/3, Notch activation and cytokinesis
98
Recent work on abscission during epidermal cell cytokinesis in the notum provided
evidence that neighboring cells stay attached to the midbody following telophase and thereby
generate a physical discontinuity in the contact surface separating the daughter cells (Daniel
et al., 2018; Wang et al., 2018) (Figure 49). Thus, asymmetric furrowing generates two
contact surfaces, above and below the midbody, that are physically separated. Moreover,
these two contact surfaces are composed by different polarity proteins, including Crumbs, E-
Cad above and basolateral markers below the midbody.
Figure 49. Two physically separated contact surfaces above and below the
midbody at cytokinesis. Adapted from Daniel et al., 2018.
Relevance in Notch signaling
Asymmetric furrowing observed during SOP cytokinesis can influence Notch signaling in
several manners. First, by generating two contact surfaces with different areas, it might dictate
where Notch activation site will be located. Indeed, as the lateral contact (i.e. below the
midbody) appears to be much larger than the apical one (i.e. above the midbody), one could
assume that signaling predominantly occurs where the contact area is the largest, that is to say
laterally (Shaya et al., 2017). Therefore, mechanisms setting the geometry of the lateral
contact might be particularly relevant regarding Notch activity levels in this context.
Second, the two contact surfaces present also different properties in terms of protein
composition and cortical cytoskeleton organization. The apical contact surface is
characterized by apical polarity proteins, such as Crumbs, and AJs coupled to an actomyosin
3.1. Dividing in an epithelium
99
belt while the lateral one displays basolateral markers, including Dlg and NrxIV (NeurexinIV)
(Benhra et al., 2011; Founounou et al., 2013) (Figure 50). In theory, activation of Notch
receptors might depend on these different membrane contexts. Experimentally, E-Cad and
Crumbs have been shown to directly regulate Notch activity in Drosophila imaginal wing
discs (Nemetschke and Knust, 2016; Sasaki et al., 2007) Thus, specific and local functional
requirements might favor one contact surface against the other.
Figure 50. The pIIa-pIIb interface is polarized along the apical-basal axis.
Adapted from Le Bras et al., 2011.
Third, asymmetric furrowing might also fulfill the requirement of Notch activation
following telophase. As the lateral contact is the first to be generated, Notch receptors located
laterally could be activated there in the first place.
Beyond which hypothesis is valid among the three proposed here, this subsection also
emphasizes the importance of knowing where Notch is activated. It would help in orientating
further investigations to understand how local environments can influence Notch activity and
how basic cellular processes, such as cytokinesis, are coordinated with cell fate decisions that
are dependent on Notch signaling.
Chapter 3. Arp2/3, Notch activation and cytokinesis
100
3.2. Arp2/3 role during cytokinesis
Work in flies and cultured cells revealed that the branched actin network initiated by the
activity of the Arp2/3 complex is recurrently used to expand the contact area between two
contacting cells, and more specifically during cytokinesis. As the subunit Arp3 is required for
Notch activity in the SO lineage, it becomes tempting to speculate that Arp2/3 links Notch
signaling to cytokinesis by generating large contact surfaces between daughter cells.
However, Arp2/3 regulates many other cellular processes that might also affect Notch
signaling.
This section aims at introducing the Arp2/3 complex, its molecular function and the
molecular mechanisms leading to its activation. Lastly, its role in contact expansion will be
outlined and connected with the small GTPase Rac1.
3.2.1. The Arp2/3 complex, a major actin regulator
Molecular function
The Arp2/3 complex is an actin nucleator conserved in almost all eukaryotic cells (Rotty et
al., 2013). It is composed of seven subunits: the two actin-related proteins Arp2 and Arp3 and
the five additional structural components ARPC1-5. The Arp2/3 complex nucleates actin
filaments in a unique fashion by branching daughter actin filaments to mother filaments with
a characteristic angle of 70° (Pollard, 2007) (Figure 51). By doing so, it generates a branched
actin network that regulates a plethora of cellular processes (see below).
Figure 51. Structure of the Apr2/3 complex under its active or inactive form. See
text for details. Adapted from Goley and Welch, 2006.
3.2. Arp2/3 role during cytokinesis
101
Extensive work on the structure of the Arp2/3 complex and the actin branch it forms
uncovered the sequence by which the daughter filament is initiated and branched to the
mother filament (Gournier et al., 2001; Pizarro-Cerdá et al., 2017; Pollard, 2007; Robinson et
al., 2001; Rouiller et al., 2008; Volkmann et al., 2001). Upon activation by a nucleating
promoting factor (NPF, see subsection below), the Arp2/3 complex undergoes a substantial
conformational change. This allows the interaction of the subunits ARPC2 and ARPC4 to the
mother filament together with the initiation of the daughter filament whose first subunits of
the pointed end are made of the subunits Arp2 and Arp3 (Figure 51). The daughter filament
further extends from the branch through barbed-end polymerization until abortion by capping
proteins (Michelot et al., 2013). The role of the other subunits during this process is not firmly
established. ARPC3 is proposed to bridge Arp3 to the mother filament, although its loss has
only minor consequences on the complex activity (Pizarro-Cerdá et al., 2017). The N-
terminus of ARPC5 is hypothesized to tether Arp2 to the rest of the complex (Pollard, 2007).
The exact role of ARPC1 remains unclear (Pizarro-Cerdá et al., 2017).
ATP binding to and hydrolysis by Arp2 and Arp3 appear also to play a key role in
Arp2/3 activation. Nucleotide binding to Arp2 and Arp3 drives a small conformational
change that correlates with increased affinity for NPFs (Espinoza-Sanchez et al., 2018;
Pollard, 2007). The role of hydrolysis is less clear. Although it is necessary for daughter
filament elongation, it is currently not known whether it is related to actin nucleation or
dissociation of branches (Pollard, 2007).
Finally, recent studies revised the widely accepted view of a single canonical seven-
subunit Arp2/3 complex and provided support for a diverse array of functionally distinct
complexes (Pizarro-Cerdá et al., 2017). First, Arp2/3 complexes can present “exotic”
compositions in focal adhesions of chicken smooth muscles with Arp2, Arp3 and ARPC1
associated to a-actinin and vinculin, or to ARPC3 and vinculin (Chorev et al., 2014). Second,
several subunits of the complex present different isoforms in many species, raising the
possibility of isoform-specific complexes (Pizarro-Cerdá et al., 2017). Not only such
complexes were found but were also shown to elicit different cellular functions (Kühbacher et
al., 2015) and to present different efficiencies in actin nucleation (Abella et al., 2016). Hence,
context specific composition of the Arp2/3 complex might present a potent mechanism
regulating Arp2/3 activity and the associated cellular output (Figure 52).
Chapter 3. Arp2/3, Notch activation and cytokinesis
102
Figure 52. Diversity of Arp2/3 complexes found in cells. Adapted from Pizarro-
Cerdá et al., 2017.
Cellular function
As most cytoskeleton regulators, the Arp2/3 complex is implicated in a wide range of cellular
processes that can be found from the nucleus to the cell surface. A short and non-exhaustive
list is given here to apprehend how often the branched actin network is reutilized in cells
(Figure 53).
Figure 53. Overview of cellular processes regulated by the Arp2/3 complex. Its
nuclear function is not represented. Adapted from Rotty et al., 2013.
3.2. Arp2/3 role during cytokinesis
103
In nuclei, Arp2/3 plays a critical role in repairing DNA double-strand breaks (Caridi et
al., 2018; Schrank et al., 2018). It is required in hetero- and euchromatic regions for the
migration of double-strand breaks to repair sites located at the nuclear periphery for
homology-directed repair. In the cytosol, Arp2/3 regulates the endosomal pathway at several
steps, including endocytosis, segregation of surface subdomains, formation and fission of
vesicles budding from recycling endosomes and endosomal motility (Simonetti and Cullen,
2019). At the cell surface, it can either maintain cell shapes by stabilizing adherens junctions
or deform them by inducing the formation of lamellipodia, filopodia or podosomes, thereby
conferring motility to the cells (Rotty et al., 2013; Swaney and Li, 2016).
Therefore, the Arp2/3 complex can elicit functions spanning from the molecular to the
cellular scale. Such pleiotropy implicates context specific regulators that help coordinating all
these different processes within a single cell. These specific regulators are described in the
next subsection.
3.2.2. Regulation of the Arp2/3 complex by NPFs and inhibitors
Mechanisms of activation
The idea that the Arp2/3 complex requires additional activators to mediate actin nucleation
arose from the observation that purified Arp2/3 complexes present a weak nucleating activity
on their own (Welch et al., 1998). On the contrary, when the surface protein ActA of Lysteria
monocytogenes was added to the medium (a protein required for the Arp2/3-dependent
motility of L. monocytogenes in infected cells), the nucleating activity was strongly enhanced
(Welch et al., 1998). Since this seminal discovery, numerous endogenous activators termed
nucleating promoting factors (NPFs) were characterized and can be split into two categories
(Figure 54).
Figure 54. Summary of Arp2/3 interactors. Adapted from Rotty et al., 2013.
Chapter 3. Arp2/3, Notch activation and cytokinesis
104
Type I NPFs are defined by a WCA domain (WASp-homology 2 domain/ Verpolin-
homology domain, Cofilin-homology domain/Central domain, Acidic domain). The CA motif
binds to Arp2/3 while the W motif to monomeric actin (Figure 55). This category is
constituted by WASp (Wiskott Aldrich Syndrome protein), N-WASp (neural WASp),
SCAR/WAVE (suppressor of cyclic AMP repressor/WASp-family verpolin-homologous
protein), WASH (WASp and SCAR homologue), WHAMM (WASp homologue associated
actin, membranes and microtubules) and JMY (junction-mediating and regulatory protein).
Type II NPFs lack the WCA domain but possess acidic regions at their N-terminus binding to
Arp2/3 and binding domains to F-actin (Figure 55). They include cortactin and the
hematopoietic cortactin-like HS1 (Rotty et al., 2013). They are weak activators, and act by
stabilizing branches. Nonetheless, they can enhance Arp2/3 activity in synergy with a type I
NPF (Helgeson and Nolen, 2013).
Figure 55. Domain structure of NPFs. See text for details. Adapted from
Campellone and Welch, 2010.
Activation of Arp2/3 by type I NPFs involves the interaction of the CA region with
various subunits of the complex, thereby driving the conformational change required for
nucleation (Campellone and Welch, 2010; Espinoza-Sanchez et al., 2018). The WH2 transfers
G-actin to the barbed ends of Arp2 and Arp3 to initiate daughter filament elongation.
Following the first polymerization round, type I NPFs presumably detach from the primed
Arp2/3 complex and drives additional elongation cycles (Campellone and Welch, 2010).
Functional specificity and activation of NPFs
Although all type I NFPs share a C-terminal WCA domain, they all differ regarding their N-
termini. This sequence specificity confers to each NPF a proper regulatory mode which
translates into the regulation of specific processes. These different modes will be succinctly
presented for each type NPF and are summarized in Figure 56. Noteworthy, NPFs also have
cellular functions unrelated to Arp2/3 activation. Details can be found in Tyler et al., 2016.
3.2. Arp2/3 role during cytokinesis
105
Figure 56. Activation modes of type I NPFs. See text for detailed description.
Adapted from Campellone and Welch, 2010.
WASp and N-WASp
WASp and N-WASp N-termini are defined by a GTPase binding domain (GBD) that
maintains the NPF in an auto-inhibited state by intramolecular interaction with the WCA
region and a proline-rich domain (PRD) adjacent to the WCA region implicated in
intermolecular interactions (Campellone and Welch, 2010). Of note, WASp is specific to the
hematopoietic lineage in mammals while N-WASp is found in most cell types, whereas there
is only one WASp homolog in flies. The rest of the paragraph will focus on N-WASp
activation, which presumably resembles the one of Drosophila WASp.
Alleviation of N-WASp auto-inhibition was mainly found to be dependent on the
membrane-tethered small GTPase Cdc42 (Kim et al., 2000). More specifically, Cdc42-GTP
appeared to bind with either active or inactive N-WASp with higher affinity than Cdc42-GDP
(Leung and Rosen, 2005). Additionally, binding of a GBD subdomain to membrane PI(4,5)P2
enhances N-WASp-mediated activation of Arp2/3 (Tomasevic et al., 2007). Alternatively, N-
WASp can be stimulated by the SH3-containg proteins Nck1 and Nck2 (non-catalytic kinases
Chapter 3. Arp2/3, Notch activation and cytokinesis
106
1-2) (Tomasevic et al., 2007), the F-BAR protein Cip4/Toca-1 (Fricke et al., 2009; Ho et al.,
2004; Takano et al., 2008) and an interactor of the kinase Abl, Abi1 (Innocenti et al., 2005).
Finally, tyrosine kinases can also stabilize active N-WASp through phosphorylation of the
GBD (Torres and Rosen, 2006) (Figure 56).
A last layer of N-WASp regulation is found with the prolin-rich protein WIP (WASp
interacting protein). WIP binds to N-WASp as well as to G- and F-actin. Intriguingly, while it
stabilizes the auto-inhibited state of N-WASp in vitro, it enhances N-WASp activity in vivo to
promote actin polymerization (Campellone and Welch, 2010). Recent studies revealed that
WIP rather acts as a scaffold protein required for the recruitment of context specific effectors,
including type I myosin and Nck (Donnelly et al., 2013; Lewellyn et al., 2015; Sun et al.,
2017).
Integration of these various inputs by N-WASp drives numerous Arp2/3 mediated
processes occurring throughout the cell, including membrane ruffling, formation of
lamellipodia and filopodia, membrane invagination during endocytosis, endosomal motility
(Campellone and Welch, 2010), DNA-double strand repair (Caridi et al., 2018; Schrank et al.,
2018). In flies, WASp function was studied with less details but was notably found to regulate
myoblast fusion (Massarwa et al., 2007; Schäfer et al., 2007), Notch activation in neural
lineages (Ben-Yaacov et al., 2001), exocytosis in larval salivary glands (Tran et al., 2015) and
E-Cad endocytosis in the fly notum (Georgiou et al., 2008; Leibfried et al., 2008).
WAVE
In contrast to WASp proteins, WAVEs (3 homologs in mammals, SCAR in flies) do not
possess a GBD and are constitutively active when isolated in vitro. Their regulation arises
from additional proteins interacting with its Scar-homology domain (SHD), including Brk1,
Abi1, Nap1 (Nck-associated protein 1) and Sra1 (specifically Rac-associated-1) (Campellone
and Welch, 2010). When these WAVE regulatory complexes (WRCs) are reconstituted in
vitro, WAVEs no longer display any activity (Ismail et al., 2009). The recent resolution of the
WRC structure provided a structural basis for WAVE inhibition within the complex (Chen et
al., 2010). It revealed that interactions of the WCA domain and a “meander region” of WAVE
with Sra1 buries the actin- and Arp2/3-binding sites into a hydrophobic pocket.
Similarly to WASp proteins, WAVEs can also be activated by a small membrane-
tethered GTPase, Rac1 (Eden et al., 2002), acidic phospholipids (Oikawa et al., 2004) and
phosphorylation (Sossey-Alaoui et al., 2007), presumably altogether in a cooperative manner
(Lebensohn and Kirschner, 2009) (Figure 56). The structural studies mentioned in the former
3.2. Arp2/3 role during cytokinesis
107
paragraph also uncovered how Rac1-binding and phosphorylation release the WCA region of
WAVE from the hydrophobic pocket. Rac1 competes with the WAVE meander region to
interact with Sra1 and, once bound, is thought to induce a conformational change in the
meander region and alleviate by an allosteric switch the sequestration of the WCA domain.
Likewise, phosphorylation is hypothesized to disturb the interaction between Sra1 and the
meander region as conserved tyrosines are found in the associated contacting surface. More
recently, a second activating binding site of Rac1 on Sra1 was found opposite to the
interacting surface with the meander and appeared to be required for WRC activation (Chen et
al., 2017). Nonetheless, the mechanism by which the two binding sites cooperate to drive the
allosteric change is not elucidated. Author speculated that this dual requirement for Rac1
binding might underlie a regulatory mechanism sensing Rac1 concentration at the membrane.
WAVEs are predominantly involved in processes affecting cell shapes. WAVE-
dependent Arp2/3 activation stimulates formation of lamellipodia and protrusions at the
leading edge of migratory cells (Alekhina et al., 2017). In flies, WAVE is also critical to
mediate lamellipodium formation (Gautier et al., 2011), organize protrusions (Evans et al.,
2013; Georgiou and Baum, 2010), drive myoblast fusion (Richardson et al., 2007) and
regulate cell shape during morphogenesis (Del Signore et al., 2018; Zallen et al., 2002).
WASH
In many aspects, WASH resembles WAVE regarding its structure and its regulation. WASH
proteins neither possess a GBD and are maintained inhibited within a large complex
composed by FAM21, SWIP (strumpellin and WASH interacting protein), strumpelin and
CCDC53 (coiled-coil domain containing protein 53) (Derivery et al., 2009; Gomez and
Billadeau, 2009). Both WRC and WAVE complexes display similar morphological
characteristics, including size and shape, although protein composition differ and amino-acid
sequences are not related (Jia et al., 2010). It was proposed that WASH and WRC complexes
are ancient regulators of the Arp2/3 complex that diverged along evolution and specialized in
a subset of cellular processes (Rotty et al., 2013).
WASH complexes are activated by different mechanisms. While RhoA has been
shown to promote WASH activation in flies (Liu et al., 2009) (Figure 56), this was not the
case in mammals (Jia et al., 2010). Instead, activation of the WASH complex was found to be
dependent on WASH polyubiquitination mediated by the E3 ligase MAGE-L2-TRIM27 (Hao
et al., 2013).
Chapter 3. Arp2/3, Notch activation and cytokinesis
108
WASH complexes are involved in a restricted and specific array of cellular processes.
They promote Arp2/3-mediated actin polymerization at the vicinity of endosomes to drive
endosomal motility, vesicular fission and maintenance of the maturing endosome shape
(Alekhina et al., 2017). Surprisingly, WASH is dispensable for fly development and adult life
(Nagel et al., 2017), raising the question of its redundancy with other NPFs in this model
organism.
WHAMM and JMY
WHAMM and JMY are type I NPFs specifically found in mammals. WHAMM, like WAVE,
is active when purified in vitro. To date, the proteins composing its anticipated inhibitory
complex have not been identified (Figure 56). WHAMM proteins carry a coiled-coil (CC)
domain that interacts with microtubules protofilaments (Shen et al., 2012). Intriguingly, this
binding hides its WCA region and prevents activation of Arp2/3 (Liu et al., 2017). Thereby,
WHAMM might play a pivotal role between the microtubule and the actin cytoskeleton in
specific cellular processes (Campellone et al., 2008). JMY sequence harbors in addition of its
WCA region two WH2 domains. This additional WH2 tandem can promote polymerization of
unbranched actin filaments (Coutts et al., 2009; Zuchero et al., 2009). Moreover, binding of
G-actin to the WH2 tandem masks a bipartite nuclear localization signal (NLS) which, when
uncovered, relocalizes JMY to the nucleus to regulate p53-dependent gene expression
(Zuchero et al., 2012). Mechanisms regulating JMY activity are to date not established.
WHAMM and JMY elicit unique functions among the NPFs. WHAMM is found in
the Golgi network and in the ER where it regulates structure maintenance and vesicular
transport (Campellone et al., 2008). Together with JMY, they both play a central role in
autophagosome biogenesis (Coutts and La Thangue, 2015; Kast et al., 2015).
Mechanisms of inhibition
In contrast with NPF-mediated activation, the Arp2/3 complex can also be directly inhibited
(Figure 54). Several negative inhibitors were identified over the past years and all present
specific mechanisms. Cofilin and its homolog GMF act by debranching the Arp2/3 complex
from the mother filament (Blanchoin et al., 2000; Gandhi et al., 2010). Coronins stabilize the
open and inactive state of the Arp2/3 complex (Cai et al., 2005, 2008; Sokolova et al., 2017).
Gadkin sequesters Arp2/3 complexes at endosomal surfaces (Maritzen et al., 2012). PICK1
inhibits Arp2/3-mediated actin polymerization via an unknown mechanism (Rocca et al.,
3.2. Arp2/3 role during cytokinesis
109
2008). Arpin, similar to coronins, stabilizes the inactive conformation of Arp2/3 (Dang et al.,
2013; Sokolova et al., 2017).
Recent structural analysis of the Arp2/3-inhibitor interaction showed that Arpin,
Cororin and GMF all bind to Arp2/3 at distinct sites, suggesting that the Arp2/3 activity might
be regulated in a context specific manner by combinations of inhibitory ligands (Sokolova et
al., 2017).
3.2.3. Contact expansion regulated by the Arp2/3 complex: the “zipper”
mechanism
The branched actin network polymerized by Arp2/3 complexes can be viewed as the slider of
a zipper that draws contacting membranes close enough to enable junction formation (i.e. the
zipper’s teeth) and contact stabilization (Cavey and Lecuit, 2009) (Figure 57).
Figure 57. Arp2/3-mediated contact expansion as a zipper-like mechanism.
Adapted from Herszterg et al., 2014.
In several studies, branched actin filaments were found in lamellipodium-like
structures at the edges of spreading cells on substrates or at locations where contact was
expanding between contacting cells (Ehrlich et al., 2002; Helwani et al., 2004; Kovacs et al.,
2002; Yamada and Nelson, 2007). Cell-cell contacts were further stabilized by formation of
homophilic E-Cad junctions. In addition, the small GTPase Rac1 was detected at the leading
edges of expanding contacts and regularly correlated with Arp2/3 activity (Ehrlich et al.,
2002; Engl et al., 2014; Yamada and Nelson, 2007). As contact expands, Arp2/3 and Rac1
activities are further inhibited and restricted to the edges by E-Cad-recruited a-catenin
(Benjamin et al., 2010; Hansen et al., 2013) and E-Cad-stimulated RhoGAPs (Kitt and
Nelson, 2011), respectively.
Chapter 3. Arp2/3, Notch activation and cytokinesis
110
In flies, contact expansion is also regulated by Rac1 and/or Arp2/3 during epidermal
cell cytokinesis (Herszterg et al., 2013), retina morphogenesis (Del Signore et al., 2018) and
cellularization during embryogenesis (Stevenson et al., 2002; Zhang et al., 2018). Thus, the
Rac1-Arp2/3 pathway appears to promote contact expansion in many different contexts by
providing pushing forces at the expanding edges.
Although SCAR/WAVE requirement has been tested in only one of these studies (Del
Signore et al., 2018), one could assume based on SCAR/WAVE is the intermediate that
integrates Rac1 activity to promote Arp2/3-dependent actin polymerization.
3.3. Arp2/3 role in Notch-dependent fate decisions
Arp2/3 and WASp were found to be required for Notch signaling in a subset of cellular
processes during fly development, and in particular in the SO lineage. A model based on the
regulation of Delta trafficking by Arp2/3 and WASp has emerged, although several
observations contradict this view and indicate that their function in Notch signaling should be
reinvestigated.
This section presents the original experimental data linking Arp2/3 and WASp to
Notch signaling, discusses the currently accepted model and proposes alternative models.
Thereby, this section also serves as an analytical introduction to the Chapter 5 of the Results
section.
3.3.1. Arp2/3 and WASp requirement in Notch signaling
Arp3 and WASp in the SO lineage
WASp requirement in fate specification during SO lineage progression was initially found in
the seminal paper characterizing the WASp fly homolog (Ben-Yaacov et al., 2001). Authors
first reported that mutant flies where zygotic WASp function was lost developed until the
pharate stage but did not hatch from the pupal case. Careful observation of these WASp
pharates uncovered a deficit in microchaete and macrochaete numbers in many epidermises,
including the head, the abdomen, the notum and the eye (Figure 58). Further analysis of the
SO lineages revealed that lateral inhibition was not affected in WASp flies, whereas cell fate
changes reminiscent of impaired Notch signaling were found following SOP and pIIIb ACDs.
3.3. Arp2/3 role in Notch-dependent processes
111
Although the molecular function of WASp was not determined in this study, authors provided
evidence that WASp was not required for correct Numb and Pon segregation in pIIb.
Additionally, they showed that WASp is epistatic to Numb, reinforcing the idea that WASp
plays a central role in Notch activation in this context. Noteworthy, another epistasis
experiment highlighted an intriguing relationship between WASp and the Notch antagonist
Hairless (H). Removal of one copy of H in a WASp-deficient background was sufficient to
promote fate restoration in a large number of interommatidial SO lineages (Figure 59). One
interpretation might be that loss of WASp does not abolish Notch signaling in the SO lineage
but rather diminishes signaling activity to levels where active NICD-Su(H) complexes are too
few to outcompete H-Su(H) repressor complexes in the signaling receiving cell nucleus. A
following mutational analysis confirmed that WASp activity in the SO lineage required its
CA domain, thereby setting the bridge with the Arp2/3 complex (Tal et al., 2002). Notably,
this study provided the initial evidence that the Arp2/3 complex is required for cell fate
acquisition in the SO lineage by reporting bristle losses in arpc1 mutant heads.
Figure 58. WASp is required for correct bristle development in multiple
epidermises (A-B, head; C-D, abdomen; E-F, thorax; G-H, eye). Adapted from
Ben-Yaacov et al., 2001.
Chapter 3. Arp2/3, Notch activation and cytokinesis
112
Figure 59. Decreasing Hairless activity is sufficient to rescue the WASp
phenotype. (D) Control eye. (E) WASp eye. (F) WASp Hairless+/- eye. Note the
rescue of the bristle phenotype. Adapted from Ben-Yaacov et al., 2001.
Arp3 was isolated in a genetic screen designed to identify novel regulators of the
Notch pathway (Rajan et al., 2009). This screen made use of the SO lineage of the fly notum
as a functional readout for impaired Notch signaling. Authors found three lethal alleles
causing bristle loss that were found in a restricted cytological region later associated to the
arp3 locus. Like WASp, bristle losses were correlated with cell fate changes after SOP and
pIIIb ACDs. Further functional characterization indicated that Arp3 is required upstream of
the Notch proteolytic cascade and does not affect Numb or Neur segregation. Nonetheless,
authors did not generate arp3 mitotic clones in the SO lineage to ascertain whether Arp3 was
required in signal-receiving or in signal-sending cells. To demonstrate this point, they used
alternative epithelial tissues that include the ovarian follicle cells and the imaginal wing disc.
Finally, they excluded that Arp2/3 and WASp were required for Delta endocytosis and
proposed a model where Arp2/3 and WASp regulate Delta recycling towards the apical side
of the ARS based on Delta trafficking assays and phalloidin immunostainings performed in
control and mutant backgrounds (see also 2.3.4. and Figure 37). Limitations of this model will
be discussed in the next subsection.
Arp2/3 and WASp only required in lineages?
An intriguing observation is that WASp and Arp2/3 appear to be required for Notch activation
only in lineages. The original WASp paper in flies did not report any Notch-dependent
cytokinesis-independent phenotype in pharates, including wing margin formation, vein
morphogenesis, segment formation in legs or lateral inhibition, but instead uncovered a role
for WASp in different lineages during embryogenesis (Ben-Yaacov et al., 2001). They first
found a similar requirement in fate specification in embryonic SO lineages as in the notum.
3.3. Arp2/3 role in Notch-dependent processes
113
They also observed that a Notch-dependent fate decision in the RP2 neuroblast lineage was
impaired in embryos lacking maternal and zygotic WASp (Figure 60). Lastly, they reported
that loss of WASp, by contrast, mimicked a Notch gain-of-function phenotype in a
mesodermal lineage thought to produce from a single progenitor the future pericardial cell
(PC) and the DA1 muscle founder cell (Park et al., 1998). The authors noted a decrease in
DA1 founders and in DA1 daughter cells. Reexamination of mesodermal lineages revised this
relationship between the PC and the DA1 founder and showed that DA1 muscle founders are
arising from another progenitor, while the PCs in fact are generated by a PC founder which
shares a common progenitor with the DO2 founder muscle cell (Han and Bodmer, 2003).
Therefore, loss of WASp should be reinvestigated in light of this in mesodermal lineages
giving rise to PCs. Finally, considering that WASp also regulates myoblast fusion in embryos
(Massarwa et al., 2007; Schäfer et al., 2007), one might speculate that the reduced number of
DA1 nuclei in WASp embryos accounts for defective muscle formation. Consistently with this
hypothesis, analysis of WASp muscles generated by DA1 or DO2 founders revealed a
decreased number in nuclei per syncytium and the abortion of fusion after a single round of
founder cell fusion with the fusion-competent myoblast (Massarwa et al., 2007; Schäfer et al.,
2007). Taken together, although WASp role is unclear in mesodermal lineages, these data
suggest a conserved role for WASp in mediating Notch signaling in neural lineages. In
mammals, N-WASp might also play a central role in neurogenesis in both neuronal cells and
neural stem cells (Jain et al., 2014; Liebau et al., 2011), although the connection with fate
specification during lineage progression has not been tested.
Figure 60. The neuronal fate is favored in absence of WASp in the RP2 lineage.
Adapted from Ben-Yaacov et al., 2001.
Chapter 3. Arp2/3, Notch activation and cytokinesis
114
Similar to WASp, components of the Arp2/3 complex seem to affect Notch signaling
only in the SO lineage. Loss of Arp2 does not impair Notch-dependent expression of the
Notch target genes Wingless and Senseless in the wing margin (Legent et al., 2012) (Figure
61). Although the overall wing shape is strongly disturbed, veins appear to form normally in
arpc1 wings (Gohl et al., 2010) (Figure 61). Role of the Arp2/3 complex in type II NBs is not
documented. During mammalian neurogenesis, as the Arp2/3 complex might be involved in
mediating Notch signaling in asymmetrically dividing radial glial cells (Chou and Wang,
2016; Dong et al., 2012).
Figure 61. Impairing Arp2/3 function does not impair Notch signaling during vein
morphogenesis (A-B) or wing margin formation (F-F’’’). sop2Q25st corresponds
to a arpc1 background in B. arp2 clones are marked by the GFP in F’’’. Adapted
from Legent et al., 2012 and Gohl et al., 2010.
As one key feature of lineages is cytokinesis and knowing that Notch receptors are
activated at cytokinesis during SOP ACD (Couturier et al., 2012), one might speculate that
Arp2/3 and WASp molecular functions are to link SOP cytokinesis with Notch activation in
the signal-receiving cell (Chapter 5).
3.3.2. Arp2/3, WASp and Delta recycling: a problematic model
The model currently accepted for Arp2/3 and WASp roles in activating Notch assumes a
mechanism independent of cytokinesis (Rajan et al., 2009). Authors proposed that Arp2/3 and
WASp drives the formation of an actin rich structure (ARS) at the pIIa-pIIb interface and
regulates the trafficking of Delta towards the apical side of this structure (see subsection
2.3.4. for a detailed description of the model).
3.3. Arp2/3 role in Notch-dependent processes
115
The first limitation of this model appears when one considers the different modes of
ACD occurring in the SO lineage: half of the lineage, that gives rise to the external cells of
the organ, together with the SOP divide along the anterior-posterior axis while the second
half, that produces the internal cells, divide along the apical-basal axis like neuroblasts. As
Arp2/3 is also required for fate specification following pIIb and pIIIb “NB-like” ACDs, it is
unclear how apical microvilli could be involved in signaling as the pIIIb-glial cell and the
neuron-sheath interfaces does not have this type of apical-basal polarity. Consequently, the
idea that Delta must be addressed to the apical side of the ARS seems less plausible in this
context.
The second limitation is the discrepancy between the requirement for Notch activation
at cytokinesis (Remaud et al., 2008) and the kinetics proposed for Delta trafficking in pIIb.
Delta molecules were pulse-chased for one hour prior their detection at the apical side of the
ARS. Moreover, pulse-chases were started at random time points after SOP division. This
means that Delta apical addressing occurs between one hour after SOP division and pIIb
mitosis entry, a time window that does not fit with Notch signaling onset at cytokinesis.
Finally, it was unclear whether apical Delta molecules were still located in endosomes or
were distributed at the pIIb cell surface.
Finally, this model assumed original recycling model where Delta recycling is
necessary to prime the ligand for activation (Wang and Struhl, 2004). Not only has no such
“activating” modification been found to date, but several lines of evidence strongly contradict
the requirement of Delta recycling to activate Notch receptors (Langridge and Struhl, 2017;
Meloty-Kapella et al., 2012).
Together, these remarks rule out the proposed molecular functions for Arp2/3 and
WASp in Notch signaling, although they highlight a role for actin and Arp2/3 in regulating
Delta distribution to activate Notch receptors.
3.3.3. Alternative hypotheses
Contact formation and/or expansion
The most straightforward hypothesis is that the Arp2/3 complex together with WASp regulate
Notch activation at cytokinesis by generating the contact surface between pIIa and pIIb
(Figure 62). If Arp2/3 and WASp were required for contact formation, signaling would be
completely abolished between pIIa and pIIb. Conversely, if Arp2/3 and WASp were rather
regulating contact expansion in accordance with the described role of Arp3 in epidermal cell
Chapter 3. Arp2/3, Notch activation and cytokinesis
116
cytokinesis (Herszterg et al., 2013), pIIa-pIIb interfaces would be formed but with small
contact surfaces in arp3 or WASp cells. Signaling levels would then be decreased, as Notch
activity depends on the contact surface area (Shaya et al., 2017), and presumably insufficient
to drive the expression of all target genes in pIIa. Thus, Arp2/3 and WASp would link
cytokinesis to Notch signaling through the regulation of the surface contact area during
furrowing.
Despite being parsimonious and elegant, this hypothesis is based on the assumption
that WASp activates Arp2/3 to drive contact expansion. Although not impossible, the
literature rather indicates the associated NPF in similar processes is SCAR/WAVE (Alekhina
et al., 2017). Moreover, SCAR activity appears to be required to form the ARS and expand
the pIIa-pIIb contact surface (King et al., 2010), albeit it is not required for fate specification
in SO lineages (Zallen et al., 2002). Therefore, it is important to assess WASp involvement in
the expansion of the pIIa-pIIb contact to test this hypothesis.
Figure 62. Alternative functions for the Arp2/3 complex at cytokinesis. See text
for details. Adapted from Herszterg et al., 2014, Kaksonen and Roux, 2018 and
Kapus and Janmey, 2013.
3.3. Arp2/3 role in Notch-dependent processes
117
Delta endocytosis
WASp-dependent Arp2/3 branching activity was found to generate the pushing forces driving
membrane inward invagination during endocytosis (Kaksonen and Roux, 2018; Mund et al.,
2018; Picco et al., 2018) (Figure 62). In the fly notum, this function seems to be conserved as
Arp2/3 and WASp promote E-Cad endocytosis in epidermal cells (Georgiou et al., 2008;
Leibfried et al., 2008). Thus, in addition to contact expansion, Arp2/3 and WASp might also
be required to promote Delta endocytosis at the pIIa-pIIb interface.
Nonetheless, this hypothesis was ruled out by Rajan et al. based on an antibody uptake
assay performed in arp3 and arpc1 backgrounds (Rajan et al., 2009). They observed Delta
being internalized in arp3 and arpc1 pIIa-pIIb pairs while Delta was mainly detected at the
membrane when Dynamin activity was impaired. Careful analysis of this experiment reveals
out that authors only addressed whether Arp2/3 is essential for Delta endocytosis in pIIa and
pIIb. First, as endo-Delta vesicles were not quantified, it remains unclear whether loss of
Arp2/3 activity affects specifically a subset of Delta endocytic events. Second, the uptake
assay was performed at a random time point following SOP division in each condition. As
Notch is activated at cytokinesis, this means that that the requirement of Arp2/3 and WASp
roles in Delta endocytosis within this time window remains untested. Last, precise
interpretation of arp3 and WASp phenotypes in the notum already indicates that these two
actin regulators are not essential effectors of Neur-mediated Delta endocytosis. Indeed, lateral
inhibition, which depends on Neur and Delta, is unaffected in arp3 or WASp tissues. This
reinforces the idea that Arp2/3 and WASp are only required in Delta- and Neur-dependent
processes involving cytokinesis. Mechanistically, Arp2/3 recruitment and concentration at the
newly-forming contact during furrowing might be necessary for its activation by WASp and
the subsequent endocytosis of Delta (Chapter 5).
Anchoring Notch receptors to the cortex
To end this introduction, a final speculative hypothesis will be proposed. As the
mechanotransduction model relies on pulling forces exerted by the ligand on the NECD, it
implies that the membrane where the receptor is tethered must resist this pulling force.
Otherwise, the receptor would simply follow its bound ligand and the force would not be
transmitted to the NNR (Figure 62).
Therefore, Arp2/3 activity in pIIa might polymerize a cortical actin network, such as
the ARS, to which Notch receptors would be anchored to resist forces exerted by Delta
endocytosis. In the same line, Arp2/3 could mediate Notch endocytosis as well accordingly
3.4. Axes of the thesis
118
with a bilateral endocytosis model (Chastagner et al., 2017), yet simultaneous coordination of
ligand and receptor endocytoses is lacking a mechanistic basis.
Although tantalizing, this hypothesis is undermined by the current lack of knowledge
on Notch association with the actomyosin cytoskeleton at the cell surface.
3.4. Axes of the thesis
This thesis interrogates the interplay between Notch signaling and cytokinesis in the sensory
organ lineage around two questions, each being addressed by a Chapter written in the form of
a paper:
Question 1: Where are Notch receptors activated along the pIIa-pIIb interface at
cytokinesis? (Chapter 4)
Question 2: What is the molecular mechanism ensuring Notch activation at cytokinesis?
(Chapter 5)
121
Chapter 4
Paper 1: Intra-lineage Fate Decisions Involve Activation of Notch receptors
basal to the midbody in Drosophila Sensory Organ Precursor Cells
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
122
Article
Intra-lineage Fate Decisions Involve Activation ofNotch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells
Highlightsd Photo-tracking fluorescent Notch receptors reveals where
nuclear Notch comes from
d A specific subset of receptors contributes to signaling in
asymmetric cell division
d Signaling is restricted to sister cells to ensure intra-lineage
fate decision
Authors
Mateusz Trylinski, Khalil Mazouni,
Francois Schweisguth
In BriefWhere Notch receptors are activated at
the cell surface is not known. To address
this, Trylinski et al. used photo-bleaching
and photo-conversion approaches in
Drosophila. Only a specific subset of
receptors, located basal to the midbody,
were shown to contribute to signaling and
binary fate decision in the context of
asymmetric cell division.
Trylinski et al., 2017, Current Biology 27, 1–9August 7, 2017 ª 2017 Elsevier Ltd.http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
123
Current Biology
Article
Intra-lineage Fate Decisions Involve Activationof Notch Receptors Basal to the Midbodyin Drosophila Sensory Organ Precursor CellsMateusz Trylinski,1,2,3 Khalil Mazouni,1,2 and Francois Schweisguth1,2,4,*1Institut Pasteur, Paris 75015, France2CNRS, UMR 3738, Paris 75015, France3Universit!e Pierre et Marie Curie, Cellule Pasteur UPMC, Rue du Dr Roux, Paris 75015, France4Lead Contact*Correspondence: [email protected]://dx.doi.org/10.1016/j.cub.2017.06.030
SUMMARY
Notch receptors regulate cell fate decisions duringembryogenesis and throughout adult life. In manycell lineages, binary fate decisions are mediated bydirectional Notch signaling between the two sistercells produced by cell division. How Notch signalingis restricted to sister cells after division to regulateintra-lineage decision is poorly understood. Moregenerally, where ligand-dependent activation ofNotch occurs at the cell surface is not known, asmethods to detect receptor activation in vivo arelacking. In Drosophila pupae, Notch signals duringcytokinesis to regulate the intra-lineage pIIa/pIIb de-cision in the sensory organ lineage. Here, we identifytwo pools of Notch along the pIIa-pIIb interface, api-cal and basal to the midbody. Analysis of the dy-namics of Notch, Delta, and Neuralized distributionin living pupae suggests that ligand endocytosisand receptor activation occur basal to the midbody.Using selective photo-bleaching of GFP-taggedNotch and photo-tracking of photo-convertibleNotch, we show that nuclear Notch is indeed pro-duced by receptors located basal to the midbody.Thus, only a specific subset of receptors, locatedbasal to the midbody, contributes to signaling inpIIa. This is the first in vivo characterization of thepool of Notch contributing to signaling. We proposea simple mechanism of cell fate decision basedon intra-lineage signaling: ligands and receptorslocalize during cytokinesis to the new cell-cell inter-face, thereby ensuring signaling between sister cells,hence intra-lineage fate decision.
INTRODUCTION
Cell-cell interactions mediated by the Notch receptor regulatecell fate in a wide range of developmental processes during an-imal development. One conserved function of Notch is to regu-late binary fate decisions between sister cells within various
cell lineages in insects [1–5] and mammals [6, 7]. Notch recep-tors are mechanosensitive transmembrane proteins with anextracellular ligand-binding domain and an intracellular domainacting as a membrane-tethered transcriptional coactivator [8].In the absence of ligands, receptors are in an auto-inhibitedstate. Ligand binding allows cellular forces to pull onto ligand-re-ceptor complexes and unmask a cleavage site in the extracel-lular domain of Notch [9, 10]. Extracellular cleavage producesa membrane-tethered form of Notch, which is then further pro-cessed to release the Notch intracellular domain (NICD) thatlocalizes to the nucleus and regulates gene expression.Whereas the mechanism of receptor activation is well estab-
lished, where ligand-dependent activation of Notch occurs atthe cell surface remains unknown. Because both receptorsand ligands accumulate at adherens junctions (AJs) in manyepithelia [11–16] and because Notch signaling appears to befunctionally linked with E-cadherin [16–20], it is often assumedthat signaling takes place at the level of AJs. Nevertheless, earlierstudies have suggested that receptor activation may occurat various locations, depending on developmental contexts,including apical cell surface [21], cell-cell junctions [16], basal-lateral membrane [22], and basal filopodia [23]. Because thesize and geometry of the contact site may regulate both thestrength and the range of signaling [23, 24], it is key to determinewhere at the cell surface Notch activation takes place.Sensory lineages in Drosophila are well suited to study Notch-
dependent intra-lineage fate decisions [25]. In the dorsal thorax,or notum, sensory organ precursor cells (SOPs) are specifiedwithin a single-layered epithelium in early pupae [26] and divideasymmetrically to produce sensory organs [27]. SOPs first divideasymmetrically along the fly body axis to generate an anteriorpIIb cell (precursor of the internal cells) and a posterior pIIa cell(precursor of the external cells) [28]. Fate asymmetry resultsfrom the unequal segregation of Numb and Neuralized (Neur)into pIIb [29–31] so that Notch is activated in pIIa and inhibitedin pIIb [32, 33]. Numb inhibits the recycling of Notch and pro-motes its late-endosome targeting in pIIb [32, 34–38], whereasNeur regulates the endocytosis of Delta (Dl) in pIIb [30, 31]. Usinglive imaging of GFP-tagged Notch, we previously showed thatNICD was produced in pIIa during cytokinesis [32]. However,where NICD came from was not determined.Here, we show that NICD is produced mostly from a subset of
receptors located basal to the midbody during cytokinesis. This
Current Biology 27, 1–9, August 7, 2017 ª 2017 Elsevier Ltd. 1
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
124
suggests a simplemechanism linking cytokinesis to intra-lineagefate decision via directional signaling by this pool of Notch.
RESULTS
Two Pools of Notch along the pIIa-pIIb InterfaceWe first re-examined the dynamics of Notch in living pupae usinga GFP-tagged Notch, NiGFP, which we generated by CRISPR-mediated homologous recombination (HR) (see STARMethods).Low Notch levels were detected in SOPs prior to division and atthe apical pIIa-pIIb interface during cytokinesis [32] (Figures 1A–1A’’ and S1A–S1A’’). We also confirmed that directional signalingoccurred during cytokinesis, as measured using nuclear NiGFPlevel (Figure 1B; NICD levels reached a plateau at t30 in pIIa). Nu-clear Notch levels appeared to correlate with the transcriptionalactivation of the E(spl)m8-HLH gene, a direct Notch target [39]:a similar kinetics was seen for a bacterial artificial chromosome(BAC)-encoded GFP-tagged E(spl)m8-HLH transgene (Fig-ure 1C; see STAR Methods). This indicated that Notch is rapidlyactivated after division to regulate the pIIa/pIIb decision.
In epithelia, cytokinesis can be viewed as a multicellular pro-cess, with both dividing cell and its immediate neighbors regu-lating the formation of the new contact region [40]. As reportedearlier [41], we observed that epidermal cells formed stablefinger-like protrusions separating the two SOP daughters atthe level of the midbody between t15 and t30 (Figures 1D and1E; arrow in Figure 1D’). Thus, the pIIa andpIIb cellswere in direct
contact both apical to the midbody (Figures 1D and 1E), wherenew AJ complexes form (Figures S1A–S1A’’), and basal to themidbody (Figures 1D’’ and 1E). Using the midbody as a positionlandmark (detected as a faint spot using iRFP670nls; FiguresS1B–S1B’’), we defined an apical and a lateral pool of Notch. Api-cal NiGFP transiently accumulated [13, 32], reaching a peak!15min after anaphase (Figure 1F), whereas low levels of NiGFPwere detected basal to the midbody (Figures 1A’, 1F’, and S1A’).
Delta and Neuralized Localize Basal to the Midbodyduring CytokinesisThe observation of these two pools of Notch raised the questionof their relative contribution to the production of NICD. Severalobservations suggested that the lateral pool of Notch mightcontribute to signaling. First, ectopic activation of Notch innumb mutant cells correlated with an accumulation of Notchbasal, but not apical, to the midbody during cytokinesis (Figures1F–1G’’) [32]. Thus, Numb appeared to inhibit the recycling ofNotch toward the lateral pIIa-pIIb interface [34–36], and thislateral Notch might contribute to ectopic signaling in pIIb (Fig-ure S2A). Second, blocking g-secretase activity in Presenilin(Psn) mutant cells led to increased NiGFP levels basal to themid-body (Figures 1H–1H’’), consistent with lateral Notch remainingunprocessed in Psn mutant cells. Third, in fixed nota, endoge-nous Dl was primarily detected along the lateral pIIa-pIIb inter-face, basal to the midbody, and not at the level of AJs (Figures2A–2A’’) [31, 42, 43]. Similarly, a GFP-tagged Dl generated by
A D G
G’
G” H”
H’
H
D’
D”
A’
A”
B
E
F
F’C
Figure 1. Two Pools of Notch along the pIIa-pIIb Interface(A–A’’) NiGFP (green) transiently accumulated at the apical pIIa-pIIb interface at t15 in living pupae. The pIIa/pIIb nuclei (outlined in A’) were marked with
iRFP670nls. A faint NiGFP signal was detected along the lateral interface at t15 (arrow, A’; the apical surface area of the pIIa and pIIb cells are indicated in A). In
these and other panels, the ‘‘apical’’ and ‘‘basal’’ labels refer to the x,y sections showing the apical and ‘‘lateral’’ populations of Notch receptors (see E).
(B andC) Quantification of nuclear NiGFP (B) andGFP-E(spl)m8-HLH (C) levels during cytokinesis (t0; metaphase-anaphase transition). Nuclear NiGFP (nR 21 for
each time point) and GFP-E(spl)m8-HLH (n R 18) reached a plateau at t30. Data are represented as mean ± SEM.
(D–D’’) Morphology of the pIIa-pIIb contact at t30 (BazCherry, magenta; DlgGFP, green; iRFP670nls, red). Two contact regions were seen apical and basal to the
midbody. Note the absence of pIIa-pIIb contact at the level of the midbody (arrow in D’).
(E) Schematic representation of the apical and lateral contact regions along the pIIa-pIIb interface.
(F and F’) Quantification of the apical (F) and lateral (F’) pools of NiGFP in wild-type (green; nR 21) and numbRNAi (red; nR 27) pupae. Significant levels of NiGFP
were transiently detected apical to the midbody in wild-type pupae. The silencing of numb led to NiGFP accumulation specifically at the lateral interface. Data are
represented as mean ± SEM.
(G–G’’) NiGFP (green; iRFP670nls; marking the pIIa/pIIb nuclei, red) accumulated in dots along the lateral interface (arrow) at t15 in numbRNAi pupae.
(H–H’’) The loss ofPsn activity inmutant clones led to the accumulation of NiGFP (green) along the lateral pIIa-pIIb interface in livingmosaic pupae (arrow; pIIa/pIIb
nuclei were identified using iRFP670nls, red; mutant cells were marked by the loss of a RFP marker, white; only isolated mutant SOPs were studied).
In these and all other panels, anterior is left (i.e., pIIb, left, and pIIa, right) and scale bars are 5 mm. See also Figure S1.
2 Current Biology 27, 1–9, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
125
CRISPR-HR [26] was clearly detected along the lateral pIIa-pIIbinterface in fixed nota (Figures 2B–2B’’). By contrast, DlGFP wasbarely detected along the pIIa-pIIb interface in living pupae (Fig-ures 2C–2C’’; quantified in Figures S2C and S2C’). This differ-ence between live and fixed samples suggested that mostDlGFP molecules are in a non-fluorescent state in SOPs dueto its rapid turnover relative to GFP maturation. Consistentwith this, inhibition of Dl endocytosis using a stabilized versionof Bearded that acts as a strong antagonist of Neur (BrdR)[44–47] increased the direct fluorescence of DlGFP (Figures2D–2D’’; BrdR efficiently blocked Notch signaling; Figure S2B).Importantly, DlGFP strongly accumulated basal to the midbody(and also, to a lesser extent, apical) at t15 upon inhibition ofNeur (Figures S2C and S2C’). Thus, Neur appeared to regulatethe endocytosis of Dl from the lateral membrane. Because theendocytosis of Dl by Neur is essential in pIIb for the activationof Notch in pIIa [31], receptor activation most likely occurredbasal to the midbody. Consistently, Neur localized transientlyalong the lateral pIIa-pIIb interface from t5 to t15, before accu-mulating apically (Figures 2E–2E’’, S2D, and S2D’; Neur dy-namics was monitored using a functional GFP-tagged versionof Neur). Together, these data suggested that Dl is endocytosedin a Neur-dependent manner from the lateral membrane of pIIbto activate the lateral pool of Notch in pIIa.
NICD Is Produced from Receptors that Turn OverRapidlyWe next addressed where Notch is activated, i.e., where NICDcomes from. We previously reported that GFP-tagged Notch
was present at the plasma membrane, early endosomes, andlate endosomes but that receptors accumulating in late endo-somes were not detected by direct fluorescence in living fliesdue to quenching at low pH [38]. However, because GFP re-sponds reversibly to pH changes [48], GFP-tagged NICD pro-duced from receptors located at late endosomes should befluorescent in the nucleus. To address whether late endosomalNotch contributed to NICD production, we took advantage of adual-tagged Notch marked intracellularly with both GFP andCherry, NiGFP4Cherry5 [38] (Figure 3A). Because it takes longerfor Cherry to become fluorescent relative to GFP, due to slowerprotein folding and/or chromophore maturation [38, 49], this dualtag acts as a pH-sensitive protein timer for Notch: ‘‘young’’ re-ceptors located at the plasma membrane and in early endo-somes are mostly GFP-positive and Cherry-negative whereas‘‘old’’ receptors accumulating in endo-lysosomes are GFPquenched and Cherry-positive (Figure 3B) [38]. These wouldtherefore produce GFP- and Cherry-positive NICD. To testwhether NICD originates in part from late endosomes, wemeasured the fluorescence of GFP- and Cherry-tagged NICD.We found that NICD was GFP-positive but Cherry-negative inpIIa (Figures 3C–3E; no signal was detected in pIIb). This indi-cated that receptors localizing within late endosomes did notparticipate to signaling in pIIa. However, it is conceivable thatGFP-positive and Cherry-negative receptors exist at the limitingmembrane and contribute to the generation of NICD. It alsoindicated that NICD half-life was shorter than Cherry maturationhalf-time [49] and that NICD was produced from receptors thatturn over too rapidly to become Cherry-positive.
A
A’
A” B” C” D” E”
B’ C’ D’ E’
B C D E
Figure 2. Ligand Endocytosis from the Lateral pIIa-pIIb Interface(A–A’’) Dl (anti-Dl intracellular domain, green) localized mostly below the midbody (marked with MyoII, not shown; CadGFP, magenta). High-magnification views
of the pIIa-pIIb interface (arrows in A and A’; pIIa and pIIb nuclei were marked with iRFP670nls, not shown) are shown as insets.
(B–C’’) DlGFP (green) was detected in fixed nota (B–B’’) and in living pupae at t15 (C–C’’). The pIIa and pIIb nuclei were marked with iRFP670nls (red in C–C’’; not
shown in B–B’’). A faint DlGFP signal was detected along the pIIa-pIIb interface in living pupae. By contrast, a clear anti-GFP signal was seen basal to AJs (Cad,
magenta in B–B’’) and midbody (MyoII; not shown) in fixed nota.
(D–D’’) DlGFP (green) specifically accumulated along the lateral interface (arrow in D’) in living neur > BrdR pupae at t15, suggesting that Dl is endocytosed in a
Neur-dependent manner from the lateral pIIa-pIIb interface.
(E–E’’) Distribution of NeurGFP (green) at t15 in living pupae. NeurGFP localized both apical and basal (arrow in E’) to the midbody (iRFP670nls, red).
See also Figure S2.
Current Biology 27, 1–9, August 7, 2017 3
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
126
Tracking the Origin of NICD Using Selective Photo-bleachingWe next sought to determine the relative contribution of apicaland lateral Notch to NICD production in pIIa using photo-bleach-ing. In principle, selective bleaching of one specific pool of Notchcould reveal its contribution to NICD production through a corre-sponding decrease in nuclear fluorescence in pIIa (Figure 4A).This approach had two pre-requisites. First, selective bleachinghad to be achieved along the z axis. This was possible at posi-tions where the pIIa-pIIb interface was tilted relative to the laserpath (Figures 4B–4B’’). Second, the exchange rate of Notch be-tween the apical and lateral contact regions should be slow rela-tive to the timescale of nuclear Notch accumulation. Otherwise,bleaching one pool would also result in a fluorescence decreaseof the other pool, thus preventing us from tracking back theorigin of bleached NICD. We found that bleaching apical NiGFPat t15, t20, and t25 efficiently bleached the apical pool of NiGFPwith no significant effect on lateral NiGFP fluorescence at t30(Figures 4C, 4C’, and S3A–S3B’; the effect of photo-bleachingwas measured at t30 because NICD levels reached a plateauat t30 in pIIa). Conversely, repeated bleaching of lateral NiGFPefficiently reduced fluorescence levels at this location with nosignificant effect on apical NiGFP fluorescence (Figures 4E,4E’, and S3C–S3D’). We could therefore use photo-bleachingto examine where NICD comes from. We first found that bleach-ing the lateral pool at t15, t20, and t25 decreased nuclear NiGFPfluorescence in pIIa at t30 (Figures 4E and 4F). Thus, receptorslocated in the bleached area were processed to generateNICD molecules translocating to the pIIa nucleus within 5–15 min. A single photo-bleaching at t15 was sufficient todecrease nuclear fluorescence at t30 (Figures S3G and S3H),indicating that receptors present along the lateral interface att15 produced a fraction of NICD found at t30 in the nucleus.By contrast, bleaching the apical pool of NiGFP had no signifi-cant effect of the level of nuclear GFP in pIIa (Figures 4D, S3E,and S3F). Thus, receptors apical to the midbody did not signifi-cantly contribute to signaling.
We repeated these photo-bleaching experiments in pupallegs, which can be imaged as cross-section views (Figure 4G),hence providing better spatial resolution along the apical-basalaxis. SOPs divide around the same time in pupal legs and notaand GFP-tagged NICD similarly accumulated in pIIa (FiguresS4A and S4A’). Also, a lateral pool of NiGFP was detected alongthe pIIa-pIIb interface (Figure 4H). Photo-bleaching this lateralpool resulted in low nuclear GFP fluorescence, whereas bleach-ing apical NiGFP had no significant effect (Figures 4I and 4J).These results confirmed that receptors located along the lateralpIIa-pIIb interface produced NICD in pIIa, whereas signaling byapical Notch was not detectable by this approach.
Photo-Convertible Notch Confirms that Lateral NotchProduces NICDNext, to positively mark selective pools of Notch, we used thegreen-to-red photo-convertible fluorescent protein mMaple3[50] and generated a knockin NimMaple3 receptor by CRISPR-mediated HR (Figure 5A; mMaple3 was introduced at the sameposition as GFP in NiGFP). NimMaple3 flies were viable and fertile,with no detectable phenotype, indicating that the NimMaple3receptor was functional. Importantly, the maturation kinetics ofmMaple3 was fast enough to detect the green fluorescence ofNimMaple3 at the cell cortex in the absence of photo-conversion(Figure 5B) and NimMaple3 was efficiently photo-convertedby UV light (Figures 5B–5C’). Additionally, photo-convertedNimMaple3 was detected in the pIIa nucleus at t30 (Figures5D–5E’’): using raw intensity values to calculate pIIa/pIIb ratios,we found a weak but statistically significant difference uponUV illumination (Figure 5F). Because a small number of photo-converted NICD molecules might be present in the volume ofthe pIIa nucleus, only few pixels might actually measure photo-converted NimMaple3, whereas most pixels measured noise.We therefore applied increasing threshold values (to selectfrom 50% to 5% of the brightest pixels of the pIIa nucleus) andcalculated pIIa/pIIb ratios using thresholded images (see STARMethods). This image processing led to increasing pIIa/pIIb
AD
E
C
B C’
Figure 3. NICD Originated from RecentlySynthetized Receptors(A and B) Structure (A) and properties (B) of
NiGFP4Cherry5 (adapted from [38]). GFP (green)
and Cherry (red) are intracellular. Upon synthesis of
Notch, GFP, and Cherry are in a dark immature
state. NiGFP4Cherry5 molecules are more likely to
become first GFP-bright and Cherry-dark due to the
faster maturation of GFP relative to Cherry, before
being both GFP- and Cherry-bright. GFP-bright-
only molecules were detected at the cell surface
and in early endosomes, whereas Cherry-bright
receptors were detected into acidic intracellular
compartments (where GFP is quenched at low pH).
(C and C’) Snapshots showing the fluorescence of
NiGFP4Cherry5 at t30 (GFP, green and Cherry, red).
The pIIa and pIIb nuclei, marked with iRFP670nls
(not shown), are outlined. Nuclear NiGFP4Cherry5
was detected in pIIa only by GFP fluorescence.
(D and E) Quantification of the GFP (D) and
Cherry (E) fluorescence produced by nuclear
NiGFP4Cherry5 (n = 24). NICD came from a pool
of GFP-bright and Cherry-dark receptors. Data
are represented as mean ± SEM.
4 Current Biology 27, 1–9, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
127
A
C
E
G I JH
E’ F
C’ D
B B’
B”
Figure 4. Tracing the Origin of NICD Using Photo-Bleaching(A) Principle of Notch photo-tracking using photo-bleaching. A loss of nuclear fluorescence upon the photo-bleaching of a specific pool of NiGFP (lateral pool,
greyed) would indicate that photo-bleached receptors contribute to NICD production.
(B–B’’) Selective photo-bleaching of the pIIa-pIIb interface (shown here using CadGFP, green; nuclei marked with iRFP670nls, red) in the notum. The position of
the apical interface (yellow dotted box in B) did not coincide with the lateral membrane (B’) due to a posterior tilt of the pIIa-pIIb interface (B’’; white dotted lines
show the angle of the pIIa-pIIb interface relative to the apical-basal axis).
(C–F) Effect of selective photo-bleaching (apical pool, C and C’; lateral pool, E and E’) on nuclear NiGFP fluorescence (D and F). The apical and lateral fluo-
rescence profiles of NiGFP at t30 (control, green) were specifically changed upon repeated photo-bleaching. Apical photo-bleaching efficiently reduced the
fluorescence of apical NiGFP (C, blue) but had no effect on basal NiGFP (C’, blue profile) and vice versa (E and E’; brown profiles). Photo-bleaching the lateral pool
of NiGFP specifically reduced the level of nuclear NiGFP fluorescence in pIIa at t30 (F; n = 19). By contrast, photo-bleaching the lateral pool of NiGFP had no
significant effect (D; n = 21). In (C), (C’), (E), and (E’), data are represented as mean ± SEM.
(G) Live imaging of sensory cells in pupal legs. Pupae aremounted legs up (top). Pupal legs appeared as tubular epithelia at the body surface so that pIIa-pIIb cells
located laterally could be imaged on side views (bottom).
(legend continued on next page)
Current Biology 27, 1–9, August 7, 2017 5
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
128
ratios (Figure 5F), indicative of higher signal-to-noise ratios.Thus, photo-converted nuclear Notch was detectable in pIIa.Additionally, applying this image processing to the GFP andCherry signals of NiGFP4Cherry5 increased signal-to-noiseratios for GFP, but not Cherry (Figures S4B and S4B’). Thisconfirmed that Cherry-fluorescent Notch did not contribute toNICD production.
We then photo-converted the apical and basal pools ofNimMaple3 in pIIa-pIIb cell pairs in pupal legs. Repeatedphoto-conversion of the apical pool had a minor effect on thepIIa/pIIb ratio relative to the no UV illumination control (Figures5H, S4C–S4C’’, S4E, and S4E’), indicating that apical receptorshad only a minor contribution to the production of NICD. Bycontrast, photo-conversion of the lateral pool led to a clear in-crease of the pIIa/pIIb ratio at t30 (Figures 5G, 5H, and S4D–S4E’). We conclude that NICD was produced in pIIa mostlyfrom a pool of receptors located at (or close to) the lateral inter-
face at t15-t25. Thus, using two different photo-tracking ap-proaches, we found that Notch receptors present basal to themidbody along the pIIa-pIIb interface at any time between t15and t25 contributed to the accumulation of NICD at t30, whereasreceptors located apical to the midbody did not significantlycontribute to NICD production. We therefore propose that Notchreceptor activation mostly occurs on the pIIa side of the pIIa-pIIbinterface and that only a specific subset of Notch receptorsregulates the pIIa-pIIb fate decision.
DISCUSSION
Several methods are currently available to monitor in vivo thesignaling activity of Notch by measuring the level and/or activityof NICD [32, 51, 52]. By contrast, in vivo reporters for ligand-re-ceptor interaction, conformational change of Notch in responseto mechanical force, and S2 cleavage of Notch are lacking.
(H) Distribution of NiGFP (green) and BazCherry (magenta) along the pIIa-pIIb interface in pupal legs of living pupae. The lateral pool of NiGFP was clearly
observed at t15.
(I and J) Nuclear NiGFP fluorescence at t30 following selective photo-bleaching in pupal legs. Bleaching the apical pool of NiGFP had no significant effect
(I; n = 19), whereas bleaching the lateral pool specifically reduced nuclear NiGFP fluorescence in pIIa (J; n = 21).
n.s., not significant; ***p < 0.001. See also Figure S3.
A F
H
B
D
E
G G’ G”
E’ E”
D’ D”
B’
C
C’
Figure 5. Photo-Tracking Notch Using Photo-Convertible Receptors(A) Structure of NimMaple3 (as in Figure 3A). mMaple3 was inserted at position 2388 by CRISPR-mediated HR.
(B–C’) NimMaple3 was detected at the cell cortex prior to photo-conversion (B; green channel) and was efficiently photo-converted (C’, red channel).
(D–E’’) Photo-converted NimMaple3 (red/false colors) was detected in pIIa nuclei (SensGFP, green) at t30 in pupal legs. The red fluorescence emitted by
NimMaple3 was measured before (D–D’’) and after photo-conversion (E–E’’). Raw (D’ and E’) and processed signals (D’’ and E’’; using a threshold selecting the
5% brightest pixels of pIIa) are shown. Note the strong auto-fluorescence signal from the pre-cuticle (asterisk in D and E).
(F) Plot showing the pIIa/pIIb ratio values of nuclear photo-converted NimMaple3 for different thresholds (indicated as the percentage of brightest pixels in the pIIa
nucleus). Raw data (threshold value 100; lateral photo-conversion versus control) displayed statistically significant differences. Image processing efficiently
extracted the signal of nuclear photo-converted NimMaple3, as shown by the increasing difference between ratio values measured before (!405 nm) and after
photo-conversion (+405 nm; n = 6).
(G–G’’) Photo-converted NimMaple3 (red/false colors) was detected in pIIa nuclei (SensGFP, green) at t30 in pupal legs following repeated UV illumination of the
lateral domain at t15, t20, and t25.
(H) Plot showing the pIIa/pIIb ratio values of photo-converted NimMaple3 (as in F) in control cells (no photo-conversion, black) and upon photo-conversion of the
apical (red) and lateral (blue) pools. Higher levels of photo-converted NICDwere detected in pIIa upon photo-conversion of the lateral versus apical pool of Notch
(n = 25 for each condition).
In (F)–(H), data are represented as mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001. See also Figure S4.
6 Current Biology 27, 1–9, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
129
Consequently, the subcellular location of Notch receptor activa-tion in vivo and the relative contribution of the different pools ofNotch to signaling remain unknown. Here, we developed twocomplementary fluorescent-based approaches to track for thefirst timewhere NICD comes from.We showed that Notch recep-tors present basal to the midbody along the pIIa-pIIb interfacecontributed to the accumulation of NICD, whereas receptorslocated apical to the midbody did not significantly contribute toNICD production. To our knowledge, this study provides the firstin vivo analysis of ligand-dependent Notch receptor activation atthe cell surface. Moreover, the photo-bleaching and photo-con-version approaches used here should be broadly applicable inmodel organisms that can be genetically engineered and easilyimaged.Other sites of Notch activation had previously been proposed in
pIIa. In one model, based on the specific requirements for Arp2/3and WASp activities for both Notch signaling and actin organiza-tion [53, 54], Dl at apical microvilli in pIIb would activate Notchlocated apically in pIIa [53]. However, loss of Arp2/3 activity alsodisruptedcorticalactinalong thebasalpIIa-pIIb interface [53], sug-gesting that regulation of the actin cytoskeleton at this location,rather than at microvilli, may be key for receptor activation. In asecond model, Dl-Notch signaling was proposed to occur at thenew apical pIIa-pIIb junction [13]. This model was largely basedon thedetectionofNotchat this location.Our study, however, indi-cated that this pool of Notch did not significantly contribute to theproduction of NICD in pIIa. In a third model, Notch activation wasproposed tooccur inspecificSara-positiveendosomes inpIIa [55].Whereas the possible contribution of these endosomes to NICDproduction could not be directly addressed by photo-tracking,two lines of evidence suggest that their contribution can only beminor. First, live imaging of Notch failed to detect this pool [32,38], indicating that this pool represents a minor fraction of Notchin pIIa. Second, symmetric partitioning of Sara endosomes didnot affect the pIIa-pIIb decision, indicating that this proposedpool is not essential for fate asymmetry [56]. Finally, the nature ofthe mechanical force acting on Notch at the limiting membraneof the Sara-positive endosomes remains to be addressed. In sum-mary, all available data are fully consistentwith our conclusion thatreceptor activation occurs mostly basal to the midbody.Whereas our experiments identified the signaling pool of
Notch along the pIIa-pIIb, they did not, however, addresswhether S3 cleavage takes place at the cell surface or intracellu-larly following endocytosis. Indeed, the photo-tracking approachused here did not inform whether the activation of Notch byDelta, i.e., s2 cleavage, is followed by S3 cleavage at the samelocation or whether S2-processed Notch is internalized to befurther processed in signaling endosomes [57]. We note, how-ever, that the accumulation of lateral Notch observed in Psnmutant cells is consistent with S3 cleavage taking place, at leastin part, at the cell surface.Our work also sheds new light on the general mechanism
whereby Notch signaling is specifically restricted to sister cellswithin a lineage. In several tissues, including the gut [58, 59],lung [7], and CNS [3], Notch regulates intra-lineage decisionsbetween sister cells soon after mitosis. Here, we propose thatNotch-mediated intra-lineage decisions are directly linked to di-vision. Indeed, we suggest that ligands and receptors localize tothe lateral membranes that separate the two sister cells at cyto-
kinesis so that Dl-Notch signaling is primarily restricted to sistercells. Thus, neighboring cells—belonging to other cell lineages—would not interfere with intra-lineage fate decisions. Our dataindicating that Neur-dependent activation of Notch by Dl pre-dominantly occurs along the pIIa-pIIb lateral interface, basal tothe midbody during cytokinesis, fully support this model. Also,the observation that core components of the secretory machin-ery, e.g., Sec15, are specifically required for Notch signaling inthe context of intra-lineage decisions [60] is also consistentwith this view. Thus, targeting both receptors and ligands alongthe newly formed interface during cytokinesis provides anelegant mechanism to restrict signaling between sister cells,thereby ensuring that intra-lineage signaling regulates intra-line-age fate decision. Because Notch generates fate diversity withinneural lineages in both vertebrates and invertebrates, this mech-anism of intra-lineage signaling may be conserved.
STAR+METHODS
Detailed methods are provided in the online version of this paperand include the following:
d KEY RESOURCES TABLEd CONTACT FOR REAGENT AND RESOURCE SHARINGd EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Flies and CRISPR-mediated HRB Genotypes
d METHOD DETAILSB Immunostaining and live imagingB Photo-bleaching and photo-conversion
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information includes four figures and can be found with this
article online at http://dx.doi.org/10.1016/j.cub.2017.06.030.
AUTHOR CONTRIBUTIONS
M.T. performed imaging experiments and data analysis. K.M. performed mo-
lecular biology experiments. M.T. and F.S. designed the experiments and
wrote the paper.
ACKNOWLEDGMENTS
We thank H. Bellen, D. Kiehart, M. Rand, the Bloomington Drosophila Stock
Center, the Developmental Studies Hybridoma Bank (DSHB), and Flybase
for flies, antibodies, and other resources. We thank L. Couturier and V. Roca
for embryo injection, L. Bally-Cuif and R. Levayer for critical reading, and
all lab members for discussion. This work was supported by grant nos.
ARC-PGA120140200771 and ANR-10-LABX-0073. M.T. received a fellowship
from the UPMC.
Received: May 6, 2017
Revised: June 7, 2017
Accepted: June 12, 2017
Published: July 20, 2017
REFERENCES
1. Bertet, C., Li, X., Erclik, T., Cavey, M., Wells, B., and Desplan, C. (2014).
Temporal patterning of neuroblasts controls Notch-mediated cell survival
through regulation of Hid or Reaper. Cell 158, 1173–1186.
Current Biology 27, 1–9, August 7, 2017 7
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
130
2. Bivik, C., MacDonald, R.B., Gunnar, E., Mazouni, K., Schweisguth, F., and
Thor, S. (2016). Control of neural daughter cell proliferation by multi-level
Notch/Su(H)/E(spl)-HLH signaling. PLoS Genet. 12, e1005984.
3. San-Juan, B.P., and Baonza, A. (2011). The bHLH factor deadpan is a
direct target of Notch signaling and regulates neuroblast self-renewal in
Drosophila. Dev. Biol. 352, 70–82.
4. Perdigoto, C.N., Gervais, L., Overstreet, E., Fischer, J., Guichet, A., and
Schweisguth, F. (2008). Overexpression of partner of numb induces asym-
metric distribution of the PI4P 5-Kinase Skittles in mitotic sensory organ
precursor cells in Drosophila. PLoS ONE 3, e3072.
5. Ohlstein, B., and Spradling, A. (2007). Multipotent Drosophila intestinal
stem cells specify daughter cell fates by differential notch signaling.
Science 315, 988–992.
6. Dong, Z., Yang, N., Yeo, S.Y., Chitnis, A., and Guo, S. (2012). Intralineage
directional Notch signaling regulates self-renewal and differentiation of
asymmetrically dividing radial glia. Neuron 74, 65–78.
7. Pardo-Saganta, A., Tata, P.R., Law, B.M., Saez, B., Chow, R.Dz., Prabhu,
M., Gridley, T., and Rajagopal, J. (2015). Parent stem cells can serve as
niches for their daughter cells. Nature 523, 597–601.
8. Kopan, R., and Ilagan, M.X. (2009). The canonical Notch signaling
pathway: unfolding the activation mechanism. Cell 137, 216–233.
9. Gordon, W.R., Vardar-Ulu, D., Histen, G., Sanchez-Irizarry, C., Aster, J.C.,
andBlacklow, S.C. (2007). Structural basis for autoinhibition of Notch. Nat.
Struct. Mol. Biol. 14, 295–300.
10. Tiyanont, K., Wales, T.E., Aste-Amezaga, M., Aster, J.C., Engen, J.R., and
Blacklow, S.C. (2011). Evidence for increased exposure of the Notch1
metalloprotease cleavage site upon conversion to an activated conforma-
tion. Structure 19, 546–554.
11. Sasaki, N., Sasamura, T., Ishikawa, H.O., Kanai, M., Ueda, R., Saigo, K.,
and Matsuno, K. (2007). Polarized exocytosis and transcytosis of Notch
during its apical localization in Drosophila epithelial cells. Genes Cells
12, 89–103.
12. Mizuhara, E., Nakatani, T., Minaki, Y., Sakamoto, Y., Ono, Y., and Takai, Y.
(2005). MAGI1 recruits Dll1 to cadherin-based adherens junctions and sta-
bilizes it on the cell surface. J. Biol. Chem. 280, 26499–26507.
13. Benhra, N., Lallet, S., Cotton, M., Le Bras, S., Dussert, A., and Le Borgne,
R. (2011). AP-1 controls the trafficking of Notch and Sanpodo toward
E-cadherin junctions in sensory organ precursors. Curr. Biol. 21, 87–95.
14. P!erez-Gomez, R., Slovakova, J., Rives-Quinto, N., Krejci, A., and
Carmena, A. (2013). A Serrate-Notch-Canoe complex mediates essential
interactions between glia and neuroepithelial cells during Drosophila optic
lobe development. J. Cell Sci. 126, 4873–4884.
15. Banda, E., McKinsey, A., Germain, N., Carter, J., Anderson, N.C., and
Grabel, L. (2015). Cell polarity and neurogenesis in embryonic stem cell-
derived neural rosettes. Stem Cells Dev. 24, 1022–1033.
16. Hatakeyama, J.,Wakamatsu,Y.,Nagafuchi, A., Kageyama,R., Shigemoto,
R., and Shimamura, K. (2014). Cadherin-based adhesions in the apical
endfoot are required for active Notch signaling to control neurogenesis in
vertebrates. Development 141, 1671–1682.
17. Sanders, P.G., Munoz-Descalzo, S., Balayo, T., Wirtz-Peitz, F., Hayward,
P., and Arias, A.M. (2009). Ligand-independent traffic of Notch buffers
activated Armadillo in Drosophila. PLoS Biol. 7, e1000169.
18. Clark, B.S., Cui, S., Miesfeld, J.B., Klezovitch, O., Vasioukhin, V., and Link,
B.A. (2012). Loss of Llgl1 in retinal neuroepithelia reveals links between
apical domain size, Notch activity and neurogenesis. Development 139,
1599–1610.
19. Rodrıguez-Fraticelli, A.E., Bagwell, J., Bosch-Fortea, M., Boncompain, G.,
Reglero-Real, N., Garcıa-Leon, M.J., Andr!es, G., Toribio, M.L., Alonso,
M.A., Millan, J., et al. (2015). Developmental regulation of apical endocy-
tosis controls epithelial patterning in vertebrate tubular organs. Nat. Cell
Biol. 17, 241–250.
20. Miyamoto, Y., Sakane, F., and Hashimoto, K. (2015). N-cadherin-based
adherens junction regulates the maintenance, proliferation, and differenti-
ation of neural progenitor cells during development. Cell Adhes. Migr. 9,
183–192.
21. Lopez-Schier, H., and St Johnston, D. (2001). Delta signaling from the
germ line controls the proliferation and differentiation of the somatic follicle
cells during Drosophila oogenesis. Genes Dev. 15, 1393–1405.
22. Del Bene, F., Wehman, A.M., Link, B.A., and Baier, H. (2008). Regulation of
neurogenesis by interkinetic nuclear migration through an apical-basal
notch gradient. Cell 134, 1055–1065.
23. Cohen, M., Georgiou, M., Stevenson, N.L., Miodownik, M., and Baum, B.
(2010). Dynamic filopodia transmit intermittent Delta-Notch signaling to
drive pattern refinement during lateral inhibition. Dev. Cell 19, 78–89.
24. Khait, I., Orsher, Y., Golan, O., Binshtok, U., Gordon-Bar, N., Amir-
Zilberstein, L., and Sprinzak, D. (2016). Quantitative analysis of Delta-
like 1 membrane dynamics elucidates the role of contact geometry on
Notch signaling. Cell Rep. 14, 225–233.
25. Schweisguth, F. (2015). Asymmetric cell division in the Drosophila bristle
lineage: from the polarization of sensory organ precursor cells to Notch-
mediated binary fate decision. Wiley Interdiscip. Rev. Dev. Biol. 4,
299–309.
26. Corson, F., Couturier, L., Rouault, H., Mazouni, K., and Schweisguth, F.
(2017). Self-organized Notch dynamics generate stereotyped sensory or-
gan patterns in Drosophila. Science 356, eaai7407.
27. Gho, M., Bellaıche, Y., and Schweisguth, F. (1999). Revisiting the
Drosophila microchaete lineage: a novel intrinsically asymmetric cell divi-
sion generates a glial cell. Development 126, 3573–3584.
28. Gho, M., and Schweisguth, F. (1998). Frizzled signalling controls orienta-
tion of asymmetric sense organ precursor cell divisions in Drosophila.
Nature 393, 178–181.
29. Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of
numb protein during division of the sensory organ precursor cell confers
distinct fates to daughter cells. Cell 76, 477–491.
30. Weinmaster, G., and Fischer, J.A. (2011). Notch ligand ubiquitylation: what
is it good for? Dev. Cell 21, 134–144.
31. Le Borgne, R., and Schweisguth, F. (2003). Unequal segregation of
Neuralized biases Notch activation during asymmetric cell division. Dev.
Cell 5, 139–148.
32. Couturier, L., Vodovar, N., and Schweisguth, F. (2012). Endocytosis by
Numb breaks Notch symmetry at cytokinesis. Nat. Cell Biol. 14, 131–139.
33. Hartenstein, V., and Posakony, J.W. (1990). A dual function of the Notch
gene in Drosophila sensillum development. Dev. Biol. 142, 13–30.
34. Cotton, M., Benhra, N., and Le Borgne, R. (2013). Numb inhibits the recy-
cling of Sanpodo in Drosophila sensory organ precursor. Curr. Biol. 23,
581–587.
35. Johnson, S.A., Zitserman, D., and Roegiers, F. (2016). Numb regulates
the balance between Notch recycling and late-endosome targeting in
Drosophila neural progenitor cells. Mol. Biol. Cell 27, 2857–2866.
36. Couturier, L., Mazouni, K., and Schweisguth, F. (2013). Numb localizes at
endosomes and controls the endosomal sorting of notch after asymmetric
division in Drosophila. Curr. Biol. 23, 588–593.
37. Berdnik, D., Torok, T., Gonzalez-Gaitan, M., and Knoblich, J.A. (2002). The
endocytic protein alpha-Adaptin is required for numb-mediated asym-
metric cell division in Drosophila. Dev. Cell 3, 221–231.
38. Couturier, L., Trylinski, M., Mazouni, K., Darnet, L., and Schweisguth, F.
(2014). A fluorescent tagging approach in Drosophila reveals late endoso-
mal trafficking of Notch and Sanpodo. J. Cell Biol. 207, 351–363.
39. Bailey, A.M., and Posakony, J.W. (1995). Suppressor of hairless directly
activates transcription of enhancer of split complex genes in response
to Notch receptor activity. Genes Dev. 9, 2609–2622.
40. Herszterg, S., Pinheiro, D., and Bellaıche, Y. (2014). A multicellular view of
cytokinesis in epithelial tissue. Trends Cell Biol. 24, 285–293.
41. Founounou, N., Loyer, N., and Le Borgne, R. (2013). Septins regulate the
contractility of the actomyosin ring to enable adherens junction remodel-
ing during cytokinesis of epithelial cells. Dev. Cell 24, 242–255.
8 Current Biology 27, 1–9, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
131
42. Giagtzoglou, N., Yamamoto, S., Zitserman, D., Graves, H.K., Schulze,
K.L., Wang, H., Klein, H., Roegiers, F., and Bellen, H.J. (2012). dEHBP1
controls exocytosis and recycling of Delta during asymmetric divisions.
J. Cell Biol. 196, 65–83.
43. Benhra, N., Vignaux, F., Dussert, A., Schweisguth, F., and Le Borgne, R.
(2010). Neuralized promotes basal to apical transcytosis of delta in epithe-
lial cells. Mol. Biol. Cell 21, 2078–2086.
44. Perez-Mockus, G., Roca, V., Mazouni, K., and Schweisguth, F. (2017).
Neuralized regulates Crumbs endocytosis and epithelium morphogenesis
via specific Stardust isoforms. J. Cell Biol. 216, 1405–1420.
45. Bardin, A.J., and Schweisguth, F. (2006). Bearded family members inhibit
Neuralized-mediated endocytosis and signaling activity of Delta in
Drosophila. Dev. Cell 10, 245–255.
46. Lai, E.C., Bodner, R., Kavaler, J., Freschi, G., and Posakony, J.W. (2000).
Antagonism of notch signaling activity by members of a novel protein fam-
ily encoded by the bearded and enhancer of split gene complexes.
Development 127, 291–306.
47. Leviten, M.W., Lai, E.C., and Posakony, J.W. (1997). The Drosophila gene
Bearded encodes a novel small protein and shares 30 UTR sequence mo-
tifs with multiple Enhancer of split complex genes. Development 124,
4039–4051.
48. Kneen, M., Farinas, J., Li, Y., and Verkman, A.S. (1998). Green fluorescent
protein as a noninvasive intracellular pH indicator. Biophys. J. 74, 1591–
1599.
49. Khmelinskii, A., Keller, P.J., Bartosik, A., Meurer, M., Barry, J.D., Mardin,
B.R., Kaufmann, A., Trautmann, S., Wachsmuth, M., Pereira, G., et al.
(2012). Tandem fluorescent protein timers for in vivo analysis of protein dy-
namics. Nat. Biotechnol. 30, 708–714.
50. Wang, S., Moffitt, J.R., Dempsey, G.T., Xie, X.S., and Zhuang, X. (2014).
Characterization and development of photoactivatable fluorescent
proteins for single-molecule-based superresolution imaging. Proc. Natl.
Acad. Sci. USA 111, 8452–8457.
51. Housden, B.E., Li, J., and Bray, S.J. (2014). Visualizing Notch signaling
in vivo in Drosophila tissues. Methods Mol. Biol. 1187, 101–113.
52. Ilagan, M.X., Lim, S., Fulbright, M., Piwnica-Worms, D., and Kopan, R.
(2011). Real-time imaging of notch activation with a luciferase comple-
mentation-based reporter. Sci. Signal. 4, rs7.
53. Rajan, A., Tien, A.C., Haueter, C.M., Schulze, K.L., and Bellen, H.J. (2009).
The Arp2/3 complex and WASp are required for apical trafficking of Delta
into microvilli during cell fate specification of sensory organ precursors.
Nat. Cell Biol. 11, 815–824.
54. Ben-Yaacov, S., Le Borgne, R., Abramson, I., Schweisguth, F., and
Schejter, E.D. (2001). Wasp, the Drosophila Wiskott-Aldrich syndrome
gene homologue, is required for cell fate decisions mediated by Notch
signaling. J. Cell Biol. 152, 1–13.
55. Coumailleau, F., Furthauer, M., Knoblich, J.A., and Gonzalez-Gaitan, M.
(2009). Directional Delta and Notch trafficking in Sara endosomes during
asymmetric cell division. Nature 458, 1051–1055.
56. Loub!ery, S., Seum, C., Moraleda, A., Daeden, A., Furthauer, M., and
Gonzalez-Gaitan, M. (2014). Uninflatable and Notch control the targeting
of Sara endosomes during asymmetric division. Curr. Biol. 24, 2142–2148.
57. Vaccari, T., Lu, H., Kanwar, R., Fortini, M.E., and Bilder, D. (2008).
Endosomal entry regulates Notch receptor activation in Drosophila mela-
nogaster. J. Cell Biol. 180, 755–762.
58. Ohlstein, B., and Spradling, A. (2006). The adult Drosophila posterior
midgut is maintained by pluripotent stem cells. Nature 439, 470–474.
59. Perdigoto, C.N., Schweisguth, F., and Bardin, A.J. (2011). Distinct levels of
Notch activity for commitment and terminal differentiation of stem cells in
the adult fly intestine. Development 138, 4585–4595.
60. Jafar-Nejad, H., Andrews, H.K., Acar, M., Bayat, V., Wirtz-Peitz, F., Mehta,
S.Q., Knoblich, J.A., and Bellen, H.J. (2005). Sec15, a component of the
exocyst, promotes Notch signaling during the asymmetric division of
Drosophila sensory organ precursors. Dev. Cell 9, 351–363.
61. Delwig, A., Bland, C., Beem-Miller, M., Kimberly, P., and Rand, M.D.
(2006). Endocytosis-independent mechanisms of Delta ligand proteolysis.
Exp. Cell Res. 312, 1345–1360.
62. Kiehart, D.P., and Feghali, R. (1986). Cytoplasmic myosin from Drosophila
melanogaster. J. Cell Biol. 103, 1517–1525.
63. Huang, J., Zhou, W., Dong, W., Watson, A.M., and Hong, Y. (2009). From
the cover: directed, efficient, and versatile modifications of the Drosophila
genome by genomic engineering. Proc. Natl. Acad. Sci. USA 106, 8284–
8289.
64. Bosveld, F., Bonnet, I., Guirao, B., Tlili, S., Wang, Z., Petitalot, A.,
Marchand, R., Bardet, P.L., Marcq, P., Graner, F., and Bellaıche, Y.
(2012). Mechanical control of morphogenesis by Fat/Dachsous/Four-
jointed planar cell polarity pathway. Science 336, 724–727.
65. Chanet, S., Vodovar, N., Mayau, V., and Schweisguth, F. (2009). Genome
engineering-based analysis of Bearded family genes reveals both func-
tional redundancy and a nonessential function in lateral inhibition in
Drosophila. Genetics 182, 1101–1108.
66. Couturier, L., and Schweisguth, F. (2014). Antibody uptake assay and
in vivo imaging to study intracellular trafficking of Notch and Delta in
Drosophila. Methods Mol. Biol. 1187, 79–86.
Current Biology 27, 1–9, August 7, 2017 9
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
132
STAR+METHODS
KEY RESOURCES TABLE
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, FrancoisSchweisguth ([email protected])
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Flies and CRISPR-mediated HRFlies were kept at 25!C, unless noted otherwise. The following flies and transgeneswere used in this study:DlGFP, a GFP knock-in lineproduced by CRISPR-HR (GFP at amino acid position 765 in the intracellular domain; the 3xP3-RFPmarked was still present 30 of theDl gene in this chromosome) [26]; NiGFP4Cherry5, a BAC transgenic line encoding a dual-tagged version of Notch [38]; NeurGFP,two BAC transgenic lines encoding a GFP-tagged version of Neur integrated at positions 22A3 (VK0037) and 99F8 (VK0020) [44];Cad-GFP, a GFP knock-in allele of shotgun [63]; Baz-Cherry, a transgene expressing mCherry-tagged Baz under the control of anubiquitous promoter [64]; Dlg1-GFP (BL-50859); Cherry-MyoII, a transgene expressing Cherry-tagged MyoII under the control ofthe sqh promoter (BL-59024); neur-iRFP670nls, a transgene expressing the far-red fluorescent protein iRFP670 fused to a nuclearlocalization sequence (nls) under the control of the neur regulatory sequences [38]; SensGFP, a BAC transgenic line encodingGFP-tagged Senseless (Sens; BL-38666); other flies were: Ubx-flp; UAS-BrdR [44]; UAS-dsRNA-numb (from R. Ueda); N55e11;Psn143; neurPGal4 [27]; pnr-Gal4 and tub-Gal80ts (BL-7019). FLP/FRT clones were detected using loss of nuclear RFP. To studythe effect of BrdR overexpression, neurPGal4 UAS-BrdR larvae were grown at 20!C to prevent ectopic and lethal expression ofBrdR and staged 0h APF pupae were switched to 29!C to increase Gal4 activity.
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Goat polyclonal anti-GFP Abcam ab6673; RRID: AB_305643
Rat monoclonal anti-DeltaICD (Intracellular Domain) [61] N/A
Rabbit polyclonal anti-MyoII [62] N/A
Experimental Models: Organisms/Strains
D. melanogaster: NiGFP CRISPR knock-in, with 3xP3-RFP
marker: w NiGFP
This study N/A
D. melanogaster: NimMaple3 CRISPR knock-in: w NimMaple3 This study N/A
D. melanogaster: dual-tagged Notch receptor encoded in a
BAC transgene: w ; ; PBac[y+-attP-9A-NiGFP4Cherry5]
VK00019
[38] N/A
D. melanogaster: DlGFP CRISPR knock-in line, with
3xP3-RFP marker: w ; ; DlGFP
[26] N/A
D. melanogaster: NeurGFP GFP-tagged BAC-encoded
transgenic lines: w; PB[y+ attP-3B NeurGFP] 22A3
and w;; PB[y+ attP-9A NeurGFP] 99F8
[44] N/A
D. melanogaster: nuclear fluorescent marker expressed
under the control of SOP-specific regulatory elements from
the neur gene, in a transgenic line: w neur-iRFP670nls
[38] N/A
D. melanogaster: mutant (stabilized) version of Brd, an
inhibitor of Neur activity, expressed under the control
of UAS: w ; ; UAS-BrdR
[44] N/A
D. melanogaster: dsRNA of numb, under the control of
UAS in a transgenic line: w ; ;UAS-dsRNA-numb
[32]; Japanese National
Institute of Genetics
3779R-3
Oligonucleotides
gRNA50 sequence used for CRISPR-mediated HR at
Notch locus: GAACTGGTGTCGTACGGACT
This study N/A
gRNA30 sequence used for CRISPR-mediated HR at
Notch locus: GTATTTATATATAGCATGTG
This study N/A
e1 Current Biology 27, 1–9.e1–e3, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
133
The BAC encodingGFP-E(spl)m8-HLHwas generated from the attB-P[acman]-Ap BAC encoding thewhole E(spl)-C [65]. This BACwasmodified using recombineeringmediated gap-repair to introduce GFP at the N terminus, with a GVG linker. Recombined regionswere verified by sequencing prior to phiC31-mediated integration at the M{3xP3-RFP.attP}ZH-51D site. The transgenic GFP-E(spl)m8-HLH BAC rescued the lethality associated with a deletion of the E(spl)-C.We used CRIPSR-mediated HR to tag intracellularly the endogenous N gene with GFP and Maple3. The NiGFP and NimMaple3
receptors resulted from the insertion of sfGFP and mMaple3, respectively, at amino acid position 2388 in the intracellular domainof Notch (exactly as in the BAC-encoded NiGFP that we generated earlier; see [32]). CRISPR-mediated GFP knock-in was achievedby injecting three plasmids, a donor template with two gRNAs, into Cas9-expressing embryos. The following gRNAs were selectedusing the Optimal Target Finder tool (http://flycrispr.molbio.wisc.edu/tools):
gRNA50: GAACTGGTGTCGTACGGACTgRNA30: GTATTTATATATAGCATGTG
Oligonucleotides were cloned into pU6-BbsI-chiRNA (Addgene #45946) as described in http://www.addgene.org/crispr/OConnor-Giles/. Donor templates for HR were produced by BAC recombineering in E. coli using a Notch BAC [32]. The PAM se-quences targeted by the gRNAs were mutated in the donor templates to avoid their Cas9-mediated cleavage. The 3xP3-RFPmarkerflanked by loxP sites was produced by gene synthesis and inserted 613 nucleotides downstream of the stop codon of Notch. The flyoptimized sequence of mMaple3 [50] flanked by 80nt-long homology arms was obtained by gene synthesis. Left and right homologyarms for CRISPR-mediated HR were 1 kb long. Additional cloning details will be provided upon request. A mix of donor template(300 ng/ml) and gRNA plasmids (150 ng/ml) was injected into 900-1,200 embryos from the PBac{vas-Cas9}VK00027 stock (BL-51324). Correct recombination events were checked by PCR. These new knock-in alleles of N were viable and fertile and adult fliesdisplayed no obvious developmental defects, indicating that these modified N receptors were active. The alleles used in this studystill carried the 3xP3-RFP marker located 30 of the N gene. These flies are noted NiGFP and NiMaple3.
GenotypesFigure 1
(A-B) NiGFP neur-iRFP670nls / Y(C) w ; M[p3xP3-RFP, GFP-E(spl)m8-HLH]51D neur-iRFP670nls / M[p3xP3-RFP, GFP-E(spl)m8-HLH]51D(D-D’’) Dlg1-GFP / + ; neur-iRFP670nls / + ; ubi-Baz-mCherry / +(F-G’’) NiGFP neur-iRFP670nls / Y ; ; pnrGal4 UAS-dsRNA-Numb / +(H-H’’) NiGFP Ubx-FLP neur-iRFP670nls / Y ; ; FRT82B e Psn143 / FRT82B ubi-RFPnls
Figure 2
(A-A’’) w ; Cad-GFP / neur-iRFP670nls(B-B’’) w ; neur-iRFP670nls / + ; DlGFP / DlGFP
(C-C’’) w ; neur-iRFP670nls / + ; DlGFP / DlGFP
(C-C’’) w ; neur-iRFP670nls / tub-Gal80ts ; DlGFP neurPGal4 / DlGFP UAS-BrdR
(E-E’’) w ; PB[y+ attP-3B NeurGFP] 22A3] neur-iRFP670nls / PB[y+ attP-3B NeurGFP] 22A3] ; PB[y+ attP-9A NeurGFP] 99F8 / +
Figure 3
(C-E) N55e11 / Y ; neur-iRFP670nls / + ; PBac[y+-attP-9A-NiGFP4Cherry5]VK00019 / +
Figure 4
(B-F, I-J) NiGFP neur-iRFP670nls / Y(H) NiGFP / Y ; neur-iRFP670nls / + ; ubi-Baz-mCherry / +
Figure 5
(B-C’) NiMaple3 / Y(D-H) NiMaple3 / Y ; SensGFP / +
METHOD DETAILS
Immunostaining and live imagingPupaewere collected at puparium formation (0h APF, hours After Puparium Formation) and processed for staining and live imaging at16h30 APF for SOP analysis in the notum (at 25!C; or 14h APF at 29!C) and at 15h APF for SOPs of the pupal legs.
Current Biology 27, 1–9.e1–e3, August 7, 2017 e2
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
134
Staged pupae were dissected according to standard procedures. The following antibodies were used: GFP (goat, 1:1000, Abcam),DlICD (rat, 1:1000, gift from M. Rand) [61] and MyoII (rabbit, 1:2000, gift from D. Kiehart) [62]. Secondary antibodies (Jackson Immu-noResearch Laboratories) were used at 1:1000 dilution.
Live pupae were staged, mounted and imaged as described in [66]. Image acquisitions were performed at 20 ± 2!C, using a laserscanning confocal microscope (LSM780; Zeiss) with a 63x (Plan APO, N.A. 1.4 DIC M27) objective. In all experiments, t = 0 was themetaphase-anaphase transition.
Tomeasure the apical and lateral pools of GFP-tagged Notch aswell as GFP-tagged NICD, we quantifiedGFP signals using large zstacks (Dz = 0.5 mm) encompassing the whole epithelium. To avoid bleaching, these cells were imaged at a single time point. Bycontrast, nuclear GFP was measured over time in NiGFP4Cherry5 pupae in small z stacks centered at the nucleus level (from t10to t40). Nuclei were identified using the SOP-specific iRFP670nls marker. ROIs delimiting the nuclei were drawn manually. GFP sig-nals were measured on 2 images (Dz = 1 mm; sum projection). Similarly, Notch levels at the apical and lateral pIIa-pIIb interface werequantified on maximal projection of 2 images (Dz = 1 mm) using the ‘‘auc’’ function under R software applied to intensity profilesmeasured with ROIs of fixed dimensions that were manually set across the pIIa-pIIb interface. The same approach was applied tomeasure DlGFP and NeurGFP levels.
Photo-bleaching and photo-conversionPhoto-bleaching of NiGFPwas performed using the Zeiss LSM780 FRAPmodule with a 405nmdiode laser (30mW) atmaximal power(no iteration, pixel dwell = 3.21 ms). ROIs corresponding to the apical or lateral area of the pIIa-pIIb interface were bleached at t15, t20and t25. Nuclear and interface GFP levels were quantified at t30. In both notum and legs, apical ROIs were defined using the NiGFPsignal at t15 whereas lateral ROIs were defined based on the position of pIIa/pIIb nuclei.
mMaple3-tagged molecules were photo-converted using a 405nm diode laser (30mW) at 1.8% power (40 iterations, pixel dwell:1.58 msec). In experiments involving photo-conversion of mMaple3-tagged Notch at the cell cortex, an initial pre-bleach step (561 nmlaser, 20mW at 30%) was performed at t10 on ROIs covering the pIIa and pIIb nuclei to decrease background signals in the acqui-sition channel for photo-converted MimMaple3. Repeated photo-activation was performed at t10, t15, t20 and t25, and nuclear sig-nals were acquired at t30 using two-slice z stacks (Dz = 0.5 mm) centered on pIIa and pIIb nuclei. In initial experiments, we found thatthe laser used for photo-converted NimMaple3 also excited the iRFP670nls far-red marker used to identify SOP. This prevented usfrom measuring photo-converted NimMaple3 in nuclei marked by iRFP670nls. We therefore used SensGFP as a SOP-specificmarker. However, since SensGFP remained partly cytoplasmic after mitosis, the apical pIIa-pIIb interface could not be identifiedin the notum.
Images were then processed using Fiji scripts. First, ROIs delimiting the pIIa and pIIb nuclei were automatically drawn and photo-converted NimMaple3 signals were measured on 2 images (Dz = 1 mm; sum projection). We then applied an intensity threshold thatwas calculated so as to select a given percentage of pixels in pIIa (from 100% to 5%). This threshold value was then subtracted to allpixel values in pIIa and pIIb nuclei (to substract noise) and pixels with positive intensity values were kept to calculate a mean pIIa/pIIbratio. The same imaging processing was applied to the no UV-illumination controls as well as to the NiGFP4Cherry5 signals.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical details (n, number of cells, and p values) aswell as dispersionmeasures (standard error to themean, s.e.m.) are given in thefigures and figure legends. Statistical significance was tested by t tests or Wilcoxon tests depending on the normal distribution of thedata sample as determined using a Shapiro test. Statistical significancewas represented as follow: * p < 0.05, ** p < 0.01, *** p < 0.001
e3 Current Biology 27, 1–9.e1–e3, August 7, 2017
Please cite this article in press as: Trylinski et al., Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in DrosophilaSensory Organ Precursor Cells, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.06.030
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
135
Current Biology, Volume 27
Supplemental Information
Intra-lineage Fate Decisions Involve Activation
of Notch Receptors Basal to the Midbody
in Drosophila Sensory Organ Precursor Cells
Mateusz Trylinski, Khalil Mazouni, and François Schweisguth
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
136
Figure S1: Localization of NiGFP relative to the midbody (related to Figure 1)
A-A’’) NiGFP (green; white in right panels) transiently accumulated at the apical pIIa-pIIb interface in living
pupae at t15 (A) and along the lateral interface (arrows in A’,A’’). The apical pIIa-pIIb junction was marked
with BazCherry (magenta; pIIa and pIIb nuclei were marked with iRFP670nls, red). NiGFP co-localized with
BazCherry into dots along the lateral pIIa-pIIb interface (A’).
B-B’’) The apical and lateral pools of NiGFP (green) were defined relative to the position of the midbody,
marked here by MyoIICherry (magenta, arrow in B’ left) in living pupae at t15. The nuclear iRFP670nls marker
(red/white) also weakly accumulated at the midbody (B’, right). This marker was used to define the apical and
lateral pools of NiGFP.
NiGFP iRFP670nlsMyoIICherryNiGFP iRFP670nlsBazCherry
A
A’
A’’
B
B’
B’’
apical
basal
z section
apical
midbody
basal
NiGFP iRFP670nls
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
137
Figure S2: Distribution of DlGFP and NeurGFP (related to Figure 2)
A,B) Quantification of nuclear NiGFP in the pIIa and pIIb nuclei during cytokinesis (t0, metaphase-anaphase
transition) in wild-type (green; same data as shown in Figure 1B), numbRNAi (A, red; n=22) and neur>BrdR (Brd
o/e in B, blue; n=12) pupae. Ectopic NICD was detected in the anterior ‘pIIb’ cell upon loss of numb activity
(A). Note that NICD levels were lower in pIIb than in pIIa, possibly reflecting the bias in Dl signaling resulting
from the unequal segregation of Neur [S1]. Conversely, NICD was not detected in the posterior ‘pIIa’ cell upon
inhibition of Neur (B). Data are represented as mean ± SEM.
C,C’) Quantification of the apical (C) and lateral (C’) pools of DlGFP in wild-type (green; n≥15) and upon
overexpression of BrdR (Brd o/e, blue; n≥21). Very low DlGFP levels were detected in wild-type cells. Upon
inhibition of Neur by BrdR, elevated DlGFP levels were measured at the lateral pIIa-pIIb interface (C’). Data are
represented as mean ± SEM.
D,D’) Quantification of NeurGFP levels at the apical (D) and lateral (D’) contact regions (n≥6). Decreasing Neur
levels were detected at the lateral pIIa-pIIb interface (D’). Neur eventually localized at the apical cortex (D).
Data are represented as mean ± SEM.
5 10 15 20 25 30
6080
100
120
140
160
5 10 15 20 25 30
4050
6070
80
time (min)
time (min)
D
D’
wild-type
wild-type
5 10 15 20 25 30
050
100
150
200
5 10 15 20 25 30
050
100
150
200
time (min)
time (min)
C
C’
wild-type
wild-type
Brd o/e
Brd o/e
apical pool - DlGFP apical pool - NeurGFP
lateral pool - DlGFP lateral pool - NeurGFP
10 15 20 25 30
6070
8090
100
●
●
●
●●
●
●
● ●
●
●● ●
●●
●● ● ●
●
pIIa wild-typepIIb wild-type
pIIa Brd o/e pIIb Brd o/e
time (min)
GFP
inte
nsity
(a.u
.)
10 15 20 25 30
6070
8090
100
●
●
●
●●
●
●
● ●
●
●
●
● ●●
●●
●
●●
time (min)
GFP
inte
nsity
(a.u
.)
pIIa wild-type
pIIb wild-typepIIb numbRNAi
pIIa numbRNAiA
B nuclear Notch
nuclear Notch
GFP
inte
nsity
(a.u
.)G
FP in
tens
ity (a
.u.)
GFP
inte
nsity
(a.u
.)G
FP in
tens
ity (a
.u.)
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
138
Figure S3: Photo-bleaching of NiGFP in the pupal notum (related to Figure 4)
A-D’) Time series of repeated photobleaching of NiGFP (green) at t15 (A,C), t20 (A’,C’) and t25 (A’’,C’’)
followed by quantification of NiGFP levels in the nucleus and along the pIIa-pIIb interface at t30 (B,D: surface
views; B’,D’: views taken at the level of the nuclei; iRFP670nls, red). The apical (A-B’) and basal (C-D’) pools
of NiGFP were photobleached in separate experiments (pre, pre-bleaching views; post, post-bleaching views).
Photo-bleached area are shown as enlarged insets (fluorescence signals are color-coded). These showed both a
loss of fluorescence signals upon bleaching and fluorescence recovery.
E-H) Photo-bleaching the apical pool of NiGFP only once at t15 led to reduced fluorescence signal at the apical
(E) but not lateral pIIa-pIIb interface (E’) at t30 (blue, fluorescence levels after photo-bleaching; green, no
photo-bleaching control). It also had no significant effect on nuclear NiGFP levels in pIIa at t30 (F; n≥24). By
contrast, photo-bleaching once the lateral pool at t15 led to low nuclear NiGFP levels in pIIa at t30 (H; n≥18).
The lateral NiGFP fluorescence signal was fully recovered at t30 (G’). Also, no change in fluorescence was seen
for apical NiGFP (G). Thus, a fraction of Notch receptors located along the lateral cortex at t15 appeared to
contribute to the production of NICD present in the nucleus at t30. Data are represented as mean ± SEM.
*** p <0.001
A A’ A’’ B B’
C C’ C’’ D D’
pre post pre post pre post
pre post pre post pre postt15 t20 t25
t15 t20 t25
t30
t30
apical
apical
basal
basal
0 5 10 15 20 25
100
150
200
250
300
0 10 20 30 40
4060
80100
120
0 5 10 15 20 25
100
150
200
250
300
0 10 20 30 40
4060
80100
120
4060
80100
120
4060
80100
120
E E’
G G’
x position (pixels)
x position (pixels)
x position (pixels)
x position (pixels)
controlbleaching
controlbleaching
controlbleaching
controlbleaching
F
H***
apical pool lateral pool nuclear Notch
bleaching: - + - +pIIa pIIb
bleaching: - + - +pIIa pIIb
pIIb pIIa pIIb pIIa
pIIb pIIa pIIb pIIa
apical pool lateral pool nuclear NotchG
FP in
tens
ity (a
.u.)
GFP
inte
nsity
(a.u
.)
GFP
inte
nsity
(a.u
.)G
FP in
tens
ity (a
.u.)
GFP
inte
nsity
(a.u
.)G
FP in
tens
ity (a
.u.)
n.s.
NiGFPiRFP670nls
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
139
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
140
Figure S4: Photo-conversion of NimMaple3 and data analysis (related to Figure 5)
A,A’) Nuclear NiGFP levels in pIIa and pIIb cells at t15 and t30 in pupal nota (A) and legs (A’). Nuclear NiGFP
accumulation levels in pIIa were similar in both epithelia.
B,B’) Plots showing the pIIa/pIIb ratio measured at t30 for nuclear NiGFP4Cherry5 (same data as in Figure
3D,E). The GFP (B) and Cherry (B’) fluorescence signals of NiGFP4Cherry5 were treated as described for
photo-converted NimMaple3 (Figure 5). Increasing pIIa/pIIb ratios were seen for GFP upon higher threshold
values, indicating that a small proportion of nuclear pixels contributed to the GFP signal in pIIa (B). By contrast,
no Cherry-fluorescent nuclear NiGFP4Cherry5 signal was detected following the same image processing (B’).
C-D’’) Photoconversion of the apical (C-C’’) and lateral pools (D-D’’) of NimMaple3 (red/false colors) along
the pIIa-pIIb interface in pupal legs (UV illumination in boxed areas). The pIIa and pIIb nuclei were marked
using SensGFP (green in C,D). A faint signal was detected in the boxed area following UV illumination (C’,D’:
pre-UV illumination; C’’,D’’: post-UV illumination).
E,E’) Plots showing the nuclear signal measured for photo-converted NimMaple3 in pIIa (E) and pIIb (E’) at t30
using a high threshold value (allowing to retain the 5% brightest pixels in the pIIa nucleus; correspond to the
data plotted as pIIa/pIIb ratios in Figure 5H). Background signals were measured in the no-UV control (black).
UV-illumination of the apical contact region (red) led to a weak but significant signal increase in pIIa (red in E)
but not pIIb (red in E’). A stronger increase was seen upon UV-illumination of the lateral pIIa-pIIb interface
(blue). Thus, selection of the brightest pixels indicated that only a fraction of the pixels detected the photo-
converted NimMaple3 signal in the pIIa nucleus. This in turn showed that receptors located along the lateral
pIIa-pIIb interface contributed to NICD production in pIIa whereas receptors located at the apical contact area
might contribute to a lesser extent.
*** p <0.001
Chapter 4. Results. Intra-lineage fate decisions involve activation of Notch receptors basal to the midbody in Drosophila SOPs
141
Genotypes shown in Supplemental Figures
Figure S1
A-A’’) NiGFP / Y ; neur-iRFPnls / + ; ubi-Baz-mCherry / +
B-B’’) NiGFP neur-iRFPnls / Y ; ; sqh-mCherry-MyoII / +
Figure S2
A) related to Figure 1F-G’’
B) NiGFP neur-iRFPnls / Y ; tub-Gal80ts/+ ; neurPGal4 / UAS-BrdR
C-C’) related to Figure 2C-C’’ (green curves) and Figure 2D-D’’ (blue curves)
D-D’) related to Figure 2E-E’’
Figure S3
A-H) NiGFP neur-iRFPnls / Y
Figure S4
A) related to Figure 1B
A’) NiGFP neur-iRFPnls / Y
B-B’) related to Figure 3D-E
C-D’’) NiMaple3 / Y ; SensGFP / +
E-E’) related to Figure 5H
Supplemental References
S1. Le Borgne, R., and Schweisguth, F. (2003). Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev Cell 5, 139-148.
142
Chapter 5
Paper 2: The Arp2/3 complex couples cytokinesis to Notch activation in the
Drosophila sensory organ lineage
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
143
The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory
organ lineage
Mateusz Trylinski1,2,3 and François Schweisguth2,3,4
1. Sorbonne Université, Collège Doctoral, F-75005, France
2. Institut Pasteur, Paris, F-75015, France
3. CNRS, UMR 3738, Paris, F-75015, France
4. corresponding author ([email protected])
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
144
Summary Notch signaling directs fate decisions between daughter cells in numerous lineages across the
animal kingdom. How Notch-dependent fate acquisition is coordinated with lineage
progression is currently not known. In Drosophila, following asymmetric cell division of the
sensory organ precursor cell (SOP), activation of Notch receptors at cytokinesis is necessary
to correctly establish cell identities. However, the molecular basis for this interplay remains
undetermined. Here, we show that the Arp2/3 complex acts as molecular pivot between
cytokinesis and Notch activation. By quantifying three distinct readouts at cytokinesis
(contact expansion, actin polymerization and Notch activity), we were able to show that
Arp2/3 integrates two inputs to elicit two distinct functions: Rac-SCAR signaling to expand
the interface contact area and WASp signaling to promote Notch activation. In addition, we
demonstrated that WASp-dependent Arp2/3 activity was required to promote Delta
endocytosis at cytokinesis in the signal-sending cell, thereby activating Notch receptors in the
second daughter cell. Thus, given that the requirement of Arp2/3 and WASp in Notch
signaling appears to be restricted to lineages, we propose that cytokinesis-dependent
recruitment of Arp2/3 at the newly formed interface permits WASp-dependent Arp2/3-
mediated Dl endocytosis at the newly-formed interface to ensure Notch activation onset at
cytokinesis.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
145
Introduction Notch signaling is an evolutionary conserved pathway regulating fate decisions in lineages
among Metazoans. Notch receptors are transmembrane proteins made of an extracellular
domain that binds to ligands (Delta (Dl) and Serrate (Ser) in Drosophila) harbored at the
surface of a neighboring cell and a membrane-tethered intracellular domain released upon
receptor activation (Kovall et al., 2017). Following receptor-ligand binding, a pulling force
exerted on the ligand-receptor complex by ligand endocytosis unfolds a buried cleavage site
on the receptor extracellular domain (Langridge and Struhl, 2017; Lovendahl et al., 2018).
The receptor then undergoes a sequence of proteolytic cleavages leading to the release of
Notch intracellular domain (NICD) in the cytosol. Finally, NICD translocates to the nucleus
and binds to a CSL protein (CBF-1, Suppressor of Hairless, Lag-2) to direct target gene
expression (Bray and Gomez-Lamarca, 2018).
In the context of lineages where Notch-dependent fate decisions are mediated between
the daughter cells, fate specification is constrained by the division rate. In other words, all
Notch target genes required for fate acquisition must be expressed prior to the next division
round. As Notch transcriptional responses are characterized by time-demanding feedforward
interactions (Housden et al., 2013), this raises the question whether cells adopt a specific
strategy to coordinate fate acquisition with lineage progression.
To address this question, we used as a model the Drosophila sensory organ (SO)
lineage, a stereotyped lineage of the fly peripheral nervous system (Hartenstein and Posakony,
1989). In the notum, a monolayered epithelium covering Drosophila back, sensory organ
precursor cells (SOPs) are first singled out among proneural clusters through lateral inhibition
(Cabrera, 1990; Heitzler and Simpson, 1991; Simpson, 1990). Later on, they undergo a finite
number of stereotyped asymmetric cell divisions (ACDs) where binary fate choices are
regulated by directional Notch signaling (Gho et al., 1999; Guo et al., 1996; Hartenstein and
Posakony, 1990). SOPs first divide along the anterior-posterior axis to produce a posterior
pIIa cell where Notch is activated and an anterior pIIb cell where Notch is turned off (Figure
1a-b’) (Schweisguth, 2015). Notch activity is biased between the daughter cells by the
unequal segregation in pIIb of two cell fate determinants, Neuralized (Neur) and Numb (Le
Borgne and Schweisguth, 2003; Rhyu et al., 1994). Neur is an E3 ubiquitin ligase promoting
Delta (Dl, the key ligand in this context) endocytosis and thereby increasing the signal-
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
146
sending activity of pIIb (Le Borgne and Schweisguth, 2003). Numb, on the other hand,
inhibits Notch recycling towards the cell surface and promotes receptor targeting towards
degradation in pIIb, hence avoiding ectopic activation of Notch receptors in pIIb (Cotton et
al., 2013; Couturier et al., 2013, 2014).
Cells composing the SO lineage divide approximately every 2 hours (Gho et al.,
1999). In particular, following SOP division, pIIb enters mitosis within 120 minutes. As it is
the single signaling source for pIIa, this implies that the pIIa fate must be specified within this
time window. Moreover, a functional study probing the temporal requirement of Notch
activity in pIIa provided evidence that Notch receptors must be activated in pIIa within a 30-
minute time window after SOP division to ensure robust fate specification (Remaud et al.,
2008). When activation was delayed by one hour, only a few normal lineages were recovered.
Consistently, we recently showed by monitoring GFP-tagged Notch receptors in vivo that
NICD starts accumulating in pIIa nucleus at cytokinesis following telophase completion
(Couturier et al., 2012; Trylinski et al., 2017). Collectively, these observations point towards
an interplay between cytokinesis and Notch activation that coordinates fate acquisition with
lineage progression.
Mechanistically, this interplay might rely on the Arp2/3 complex, an actin regulator
polymerizing branched actin network (Pollard, 2007). Arp2/3 is a multiprotein complex
composed by the two subunits Arp2 and Arp3 that initiate daughter filament elongation and
five structural subunits Arpc1-5 that mediate binding to the mother filament. By itself, Arp2/3
is weakly active and requires activation by a nucleating promoting factor (NPF) (Pollard,
2007; Rotty et al., 2013). In the SO lineage, Arp3 and the NPF WASp (Wiskott-Aldrich
syndrome protein) are required for Notch-dependent fate acquisition (Ben-Yaacov et al.,
2001; Rajan et al., 2009). The pending model for Arp2/3 and WASp functions proposes that
their molecular activities are required in pIIb to traffic Dl from recycling endosomes towards
the apical side of the pIIa-pIIb interface (Rajan et al., 2009). However, Dl pulse-chase assays
supporting this model reported Dl apical localization after a one-hour chase, which does not
fit with Notch activation at cytokinesis (Couturier et al., 2012; Remaud et al., 2008; Trylinski
et al., 2017). In addition, we recently demonstrated that Notch receptors are activated at the
lateral side of the pIIa-pIIb interface, and not the apical one (Trylinski et al., 2017), which
directly contradicts the aforementioned model. Therefore, we decided to reinvestigate in this
study Arp2/3 function at cytokinesis during SOP division in light of two hypotheses. First,
given that Arp2/3 regulates contact expansion during cytokinesis (Herszterg et al., 2013) and
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
147
that Notch signaling is a juxtacrine pathway whose activity can scale with the contact area
(Khait et al., 2016; Shaya et al., 2017), we hypothesized that Arp2/3 and WASp are required
to establish and expand the pIIa-pIIb lateral contact to ensure high levels of Notch activity at
cytokinesis. Second, knowing that Arp2/3 and WASp can mediate endocytosis in many
systems (Kaksonen and Roux, 2018), we speculated that their activities might be required to
promote Dl endocytosis in pIIb at cytokinesis.
Results Arp2/3 activity is required for Notch activation in a cell-autonomous manner
To uncover Arp2/3 function at cytokinesis, we first wanted to test whether Arp2/3 activity is
indeed required for Notch activation in pIIa at cytokinesis. To do so, we used a previously
characterized GFP-tagged knock-in allele of Notch (NiGFP) (Trylinski et al., 2017) and
quantified GFP intensities in pIIa and pIIb nuclei as a proxy for Notch activity (Figure 1d-f).
Control cells displayed an initial strong activation step at cytokinesis (t = 10-30 min, t = 0 min
corresponding to metaphase-anaphase transition) before reaching a plateau that stabilized over
time (Figure 1f, green curves). In control pIIb cells, consistently with Notch being turned off,
no GFP fluorescence could be detected over the studied time course. In absence of Arp3, the
initial bulk of activation occurring at cytokinesis in pIIa cells was lost (Figure 1f, orange
curves). Only some residual activation was detected at later time points (t = 30-60 min), but
as loss of Arp3 triggers pIIa-to-pIIb fate changes (Rajan et al., 2009), we assumed that these
activity levels were insufficient to specify the pIIa fate. In addition, aggregates of NiGFP
molecules could be observed in the lateral side of the pIIa-pIIb interface of arp3 cells, but not
in control cells (Figure 1d-e). Since the GFP is intracellularly inserted in the protein sequence,
such aggregates might reflect the accumulation of unprocessed Notch molecules at the cell
surface, as reported in pIIa-pIIb pairs lacking gamma-secretase activity (Trylinski et al.,
2017). Thus, Arp2/3 activity is required to elicit high Notch activity levels at cytokinesis.
Next, we wondered whether this loss of Notch activity at cytokinesis was due to loss
of Arp2/3 activity in the SOP progeny or in surrounding epidermal cells. Indeed, cytokinesis
in epithelia can be viewed as a multicellular process where immediate neighbors play a
crucial role in setting the geometry of the adhesive contact between the daughter cells
(Founounou et al., 2013; Herszterg et al., 2013). In brief, during cytokinetic ring constriction,
myosin activity in immediate neighbors helps in juxtaposing the membranes of the dividing
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
148
cell and thereby facilitates formation and expansion of the new adhesive contact. Hence,
Arp2/3 activity in neighboring epidermal cells might theoretically contribute to set the contact
geometry in dividing SOPs. Then, in accordance with the first hypothesis, loss of Arp3 in
immediate neighbors might affect the pIIa-pIIb contact area, and consequently Notch activity
levels. To test this idea, we compared late pIIa/pIIb nuclear ratios (when residual Notch
activity is detected) of arp3 cells whose interface was surrounded either by two, one or no
mutant cell (Figure S1). If Arp2/3 activity is required in immediate neighbors, the genotype of
the neighbors should affect the values of the pIIa/pIIb ratios, with decreased values when
SOPs are surrounded by arp3 epidermal cells. As no difference could be observed between
the different conditions (Figure S1a), we concluded that Arp2/3 activity is required in a cell-
autonomous manner for Notch activation at cytokinesis.
Arp2/3 activity is required for contact formation and expansion at cytokinesis
Given that Arp3 is required in an autonomous manner in pIIa-pIIb pairs for Notch activation
and that Arp2/3 regulates cell-autonomously contact expansion at cytokinesis in epidermal
cells of the notum (Herszterg et al., 2013), we next sought to test whether Arp2/3 activity was
also setting the geometry of the lateral contact between pIIa and pIIb.
To do so, we used the FLP/FRT system to generate mosaic epithelia and selected
control or arp3 SOPs surrounded by the negative clone marker PH-ChFP (humain pleckstrin
membrane domain tagged with ChFP) (Figure 1g-h’, t = 0 min). PH-ChFP labeling
membranes, we could monitor the intercalation of immediate neighbors in between pIIa and
pIIb cells. In absence of this negative marker, due to the diffraction-limited resolution of
conventional fluorescent microscopy, loss of contact between pIIa and pIIb could not be
directly resolved with a GFP-tagged basolateral membrane marker. Therefore, this strategy
allowed us to unambiguously determine the edges of lateral contacts. Consistently with
reports pointing out that Arp2/3-mediated actin polymerization is not required during mitosis
progression (Herszterg et al., 2013; Rosa et al., 2015), arp3 mutant cells did not exhibit major
defects or delays from late anaphase till telophase completion (Figure 1g, h). However, at
cytokinesis, lateral membranes of immediate neighbors remained longer in between arp3
pIIa-pIIb pairs, leading to the formation of markedly reduced contact surface areas (Figure 1h,
h’). At t = 10 minutes, almost no contact could be measured between arp3 pIIa and pIIb cells
(Figure 1h-k). Later on, lateral contact expanded but remained significantly smaller compared
to control cells (Figure 1i). More specifically, these defects were mostly due to a failure in
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
149
pushing on the immediate neighbors, since decreased contact areas were due to reduced
lateral contact width, but not axial length (Figure 1j-k). Therefore, Arp2/3 activity is required
at cytokinesis to generate large contact surfaces at the lateral pIIa-pIIb interface. In addition,
we found that this functional requirement was consistent with Arp3 recruitment and
localization at the lateral side of the pIIa-pIIb interface at cytokinesis (Figure 1c-c’).
Lastly, Arp2/3 was shown to regulate the formation of an actin-rich structure (ARS)
found at the pIIa-pIIb interface, although this structure was not linked to cytokinesis (Rajan et
al., 2009). In epidermal cells, Arp2/3 activity expands contact by the polymerization of an
actin wave at cytokinesis (Herszterg et al., 2013). Thus, we wanted to know whether the ARS
and the actin polymerization wave correspond to the same structure appearing at cytokinesis,
and whether its formation depends on Arp2/3 activity. To do so, we followed actin dynamics
during SOP division using the F-actin marker utrophin-GFP (utro-GFP, utrophin actin-
binding-domain fused to GFP) and observed in control cells a transient actin polymerization
wave occurring around the midbody after cytokinetic ring closure (Figures 1a-b’, S2a). At
later time points, actin lateral levels decreased (Fig1a-a’, S2a, c) and the ARS was restricted
to apical side of the pIIa-pIIb interface (Figure 1a). As the shape of this actin network
resembled the ARS, we concluded that these two terminologies describe the same structure.
The term ARS will be kept for the rest of this study. In absence of Arp2/3 activity, as
expected from published results (Herszterg et al., 2013; Rajan et al., 2009), the ARS was not
detected at the lateral side of the pIIa-pIIb interface (Figure S1b, c’). Actin levels were close
to background fluorescence (Figure S1c’), suggesting that loss of Arp3 fully prevented the
polymerization of any actin network at this location after telophase completion.
Taken together, these results indicate that Arp2/3 activity regulates lateral contact
expansion in SOPs via the polymerization of an actin branched network.
WASp activity is not required for contact formation and expansion at cytokinesis
WASp role in specifying fates in the SO lineage was shown to be dependent on its Arp2/3
activating domain (Tal et al., 2002). Therefore, we hypothesized that pIIa-pIIb pairs lacking
WASp should display similar phenotypes to arp3 ones. First, Notch activity was identically
affected in WASp pIIa-pIIb pairs (of note, WASp corresponds in this study to a
WASp3/Df(3R)6210 deficient background): the initial bulk of activation was lost while some
residual activity was similarly detected at later time points (Figure 2a-c). Similar to arp3 cells,
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
150
NIGFP aggregates were found at the lateral side of the pIIa-pIIb interface (Figure 2b),
presumably reflecting the accumulation of unprocessed receptors.
To probe WASp role in lateral contact expansion, we first analyzed contact expansion
in WASp3 pIIa-pIIb pairs surrounded by epidermal cells expressing the Dlg-RFP membrane
marker (Figure 2e-e’). To our surprise, WASp3 pIIa-pIIb pairs did not exhibit any defects in
contact expansion (Figure 2e-h). Membranes of immediate neighbors did not remain between
pIIa and pIIb lateral membranes, and contact surface areas expanded similarly to control cells
(Figure 2e-f). The same experiments are currently carried out in the WASp deficient
background using the UAS/Gal4/Gal80 system to mark specifically membranes of epidermal
cells. Therefore, our preliminary data strongly indicate that WASp is not required for the
Arp2/3-mediated contact expansion. In line with this conclusion, formation of the ARS was
not affected by the absence of WASp (Figure S3). The actin polymerization wave was
detected at the same time points as control cells and with the exact same intensity levels
(Figure S3b’).
Nonetheless, using a GFP-trap line, we could detect WASp at the lateral pIIa-pIIb
contact at cytokinesis, albeit at low levels (Figure 2d-d’’), implying that the protein is present
but does not promote Arp2/3-dependent contact expansion and ARS formation at the pIIa-
pIIb interface. Given that WASp function in specifying fates in the SO lineage depends on
this Arp2/3 activating domain (Tal et al., 2002), it suggests that WASp-dependent Arp2/3
activity regulates another mechanism required for Notch activation. These puzzling results
raised the three following questions: (1) is Arp2/3 function in lateral contact formation and
expansion required for Notch activation at cytokinesis?, (2) is the ARS required for Notch
activation?, and (3) what is the cellular process regulated by WASp through Arp2/3 and
required for Notch activation? The next sections will address each of them.
WAVE and Rac activities are required for contact formation and expansion at
cytokinesis, but not to elicit high Notch activity levels
The Arp2/3 complex can be activated by multiple NPFs to regulate context-specific cellular
processes (Alekhina et al., 2017; Rotty et al., 2013). We therefore reasoned that other
upstream activators than WASp might activate Arp2/3 to direct contact expansion. In
neighboring epidermal cells, polymerization of the Arp2/3-dependent actin wave was shown
to rely on Rac activity (Herszterg et al., 2013). We thus examined whether this dependency
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
151
was conserved in SOPs, and more importantly whether Rac activity was required for Notch
activation.
In flies, three different genes encode for Rac activity: rac1, rac2 and mtl (Hakeda-
Suzuki et al., 2002). We analyzed contact expansion, ARS formation and Notch activity in a
Rac1 Rac2 homozygous null Mtl heterozygous null (termed hereafter rac) background where
some Rac activity can still be mediated by Mtl (Figure 3) and in SO lineages where the Rac1
dominant negative form Rac1N17 (referred to as Rac1DN hereafter) was co-expressed by the
SOP-specific driver neurPGal4 to interfere with Rac signaling together with the F-actin marker
LifeAct-GFP to visualize actin dynamics and cell contours (Figure S4). Under both
conditions, contact expansion and ARS formation were affected at cytokinesis but with
different penetrance (Figure 3e-h, S4a-e, S5). In the rac background, similar to arp3 pIIa-pIIb
interfaces, neighboring cells were still largely intervening at t = 10 min (Figure 3e), thereby
generating strongly reduced contact areas (Figure 3f-h). Later on, rac lateral interfaces
appeared to expand normally and presented similar geometric properties to control interfaces
from t = 30 min onwards (Figure 3f-h). In Rac1DN pIIa-pIIb pairs, lateral contact areas were
also markedly reduced at t = 10 min (Figure S4c-d). However, later on, contact expansion
appeared to be more affected than in rac pIIa-pIIb interfaces with smaller lateral interface
widths (Figure S4c-d). These defects were reminiscent of the ones observed in absence of
Arp3 (Figure 1j-k). Consistently, formation of the ARS was strongly affected under both
conditions, albeit to a lesser extent in the rac background (Figure S4e, S5) (Of note, the
remaining copy of Mtl in the rac background likely explains the milder defects reported
compared to Rac1N17 pIIa-pIIb pairs). Thus, our results support that Rac-dependent activation
of Arp2/3 at cytokinesis to expand the newly-forming contact is conserved in SOPs. Finally, a
GFP-tagged Rac1 transgene localized similarly to Arp3GFP along the lateral pIIa-pIIb
interface at cytokinesis (Figure 3d-d’), reinforcing the idea of a local activation of Arp2/3 by
Rac1 to mediate contact expansion through an actin polymerization wave (i.e., the ARS).
To our surprise, despite the defects we observed in lateral contact establishment and
unlike in arp3 pIIa cells, Notch signaling was only mildly affected in rac and Rac1DN pIIa
cells (Figure 3a-c, S4f-h). At early time points (t = 10-30 min), activity was indeed
diminished but later recovered at comparable levels with control cells (t = 60 min). Therefore,
expansion of the lateral pIIa-pIIb contact regulated by Rac-mediated Arp2/3 activity is not
required to elicit high levels of Notch activity at cytokinesis. The fact that the initial decrease
in Notch activity correlates with the delay in contact expansion in rac and Rac1DN
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
152
backgrounds might suggest that the establishment of the lateral contact is required for Notch
activity. Alternatively, in addition to promote Arp2/3-dependent contact expansion, Rac
activity might be specifically required in early time points (10 to 20 minutes) to stimulate
Notch activity.
To deepen our understanding on Arp2/3 regulation at the pIIa-pIIb interface, we
sought to identify the NPF involved in Arp2/3-mediated contact expansion. Indeed, the
Arp2/3 complex is not a direct target of any Rac GTPases, letting the connection between the
two effectors undetermined. In addition, as Rac GTPases have pleiotropic functions in cells,
the phenotypes we reported in rac and Rac1DN genetic backgrounds might be caused by other
Rac targets. Based on the literature, we chose to focus on SCAR/WAVE (suppressor of cyclic
AMP repressor/WASp-family verpolin-homologous protein), a WASP family member that is
found in cells within the WAVE regulatory complex (WRC). Importantly, SCAR is
maintained in an inactive state within the WRC (Campellone and Welch, 2010) and requires
Rac-dependent activation to stimulate Arp2/3 activity (Eden et al., 2002). Lastly, given that
the WRC was found to mediate contact expansion through Arp2/3 in multiple cell types
(Alekhina et al., 2017; Del Signore et al., 2018), we speculated that SCAR was the missing
link between Rac signaling and Arp2/3 activity during lateral contact expansion. Accordingly,
ARS formation was impaired in SCAR pIIa-pIIb pairs (Figure S6). Contact expansion in
SCAR cells is yet to be determined but appears to be affected in SCAR cells expressing utro-
GFP. Indeed, at early time points, pIIa and pIIb cell cortices were found separated, implying
the immediate neighboring cells were still intervening (Figure S6a, t = 10 min). In addition,
consistently with our results obtained in rac and Rac1DN backgrounds, Notch activity was
only mildly affected at early time points in absence of SCAR (Figure 4a-c). Of note, as Notch
signaling levels were less affected in SCAR than in rac and Rac1DN pIIa cells, it suggests that
Rac activity might stimulate Notch activation at early time points.
We therefore conclude that (1) the Rac-SCAR pathway, but not WASp, regulates
Arp2/3-mediated contact expansion in dividing SOPs, (2) this process does not play a key role
in triggering high levels of Notch activity at cytokinesis and (3) contrary to what was
proposed formerly (Rajan et al., 2009), the ARS as structure is not required to organize the
subcellular site for Notch activation. As a consequence, only the activation of Arp2/3 by
WASp appears to be required for strong Notch activation at cytokinesis.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
153
WASp and Arp2/3 promote Delta endocytosis at cytokinesis
Given that the activation of Arp2/3 by the Rac-SCAR pathway does not explain the
requirement of Arp3 for Notch activation in the SO lineage, we sought to test our second
hypothesis where WASp and Arp2/3 promote Dl endocytosis at the pIIa-pIIb interface in pIIb,
thereby generating the pulling force required for activation of Notch receptors in pIIa. Rajan
et al. reported that Arp2/3 was not regulating Dl endocytosis in SOPs (Rajan et al., 2009),
albeit endocytosis assays were performed at random time points after cytokinesis and were
not quantified. Therefore, whether Arp2/3 and WASp regulate at cytokinesis the endocytosis
of a specific pool of Dl molecules located at the pIIa-pIIb interface remains an open question.
To test our hypothesis, we first analyzed Dl distribution with a GFP-tagged CRISPR
knock-in allele of Dl (DlGFP, (Corson et al., 2017)) in arp3 and WASp backgrounds (Figure
5a-c). In control cells, accordingly with our published data, DlGFP could not be detected at
the pIIa-pIIb interface (Figure 5a) (Trylinski et al., 2017). Noteworthy, this absence of
fluorescence is due to Neur activity instead of the absence of the protein (Trylinski et al.,
2017). Indeed, where Neur activity is impaired in SOPs, DlGFP can be detected in vivo at the
lateral pIIa-pIIb contact, thereby implying that DlGFP is endocytosed in a Neur-dependent
manner prior to GFP maturation (Trylinski et al., 2017). In arp3 and WASp cells, conversely,
DlGFP aggregates were detected at cytokinesis at the pIIa-pIIb lateral contact, likely
reflecting a defect in Dl endocytosis at this specific location (Figure 5b-c). These aggregates
further suggest that Dl addressing towards the interface is not affected in absence of WASp or
Arp2/3 activity.
Then, to directly test whether Dl endocytosis was impaired in arp3 and WASp pIIb
cells, we designed an antibody uptake assay at cytokinesis to probe Dl endocytosis (Methods,
Figure 4d-d’’) in the time window of Notch initial activation step (Figure 1f, green curves,
10-30 min). As loss of Arp3 and WASp strongly affects this first phase of Notch activity, we
expected that WASp and Arp2/3 activities would regulate Dl endocytosis within this period.
Accordingly, we observed a significant decrease of Dl-positive vesicles in arp3 and WASp
pIIb cells after performing our assay (Figure 5e-i). Moreover, the decrease in vesicle number
(Figure 5h) was not compensated by an increased amount of Dl molecules per endosomes or
an increased size of Dl-positive endosomes: total amounts of endocytosed Dl per cell were
also significantly decreased in arp3 and WASp cells (Figure 5i) and endosome volumes and
numbers of Dl molecules per endosome were similar among the different conditions (Figure
S7a-b). Therefore, the decrease in Dl-positive endosome numbers in arp3 and WASp pIIb
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
154
cells does reflect an impairment in Dl endocytosis. This demonstrates that Arp2/3 and WASp
activities do regulate Dl endocytosis in pIIb at cytokinesis.
It is noteworthy that Dl endocytosis was not abolished, but only decreased in arp3 and
WASp pIIb cells. This implies that Arp2/3 and WASp are not absolutely required for all Dl
endocytic events, but only for a subset of them. Indeed, some residual Notch can still be
detected at later time points in arp3 and WASp pIIa cells (Figure 1f, orange curves and 2c, red
curves), implying that some Notch receptors are still processed in pIIa cells, but at a much
slower rate. Thus, Arp2/3 and WASp have a quantitative effect on Notch signaling rather than
a qualitative one. Furthermore, as Arp3 and WASp are detected at the pIIa-pIIb interface
when Notch signaling starts and that DlGFP aggregates are detected at this location at
cytokinesis in arp3 and WASp backgrounds, we propose that WASp and Arp2/3 function
during cytokinesis is to promote and enhance Dl endocytosis at the pIIa-pIIb interface on the
pIIb side to activate Notch receptors in pIIa.
Collectively, our results favor a model where the Arp2/3 is initially recruited to the
newly-forming interface to expand contact in a Rac-SCAR-dependent manner. In the same
time, WASp-mediated Arp2/3 activation promotes and enhances Dl endocytosis in pIIb,
thereby ensuring high Notch activity levels in pIIa at cytokinesis.
Discussion
In cell lineages, coordinating fate acquisition with lineage progression is key to ensure
maintenance and diversification of cellular identities. In the fly SO lineage, activation of
Notch receptors at cytokinesis emerged as a potential mechanism mediating this interplay
(Couturier et al., 2012; Remaud et al., 2008; Trylinski et al., 2017), although its molecular
details were not determined. Here, by combining live-imaging, quantitative approaches and
genetic manipulations, we find that, during SOP division, the Arp2/3 complex acts as a
molecular pivot between the molecular mechanisms of cytokinesis and Notch activation to
select the pIIa fate in a timely manner. On one hand, as in the epidermal cells of the notum
(Herszterg et al., 2013), Arp2/3 integrates Rac-SCAR signaling to regulate expansion of the
lateral pIIa-pIIb contact (Figure 1, 3-4, S4-6). Counterintuitively, even though Notch activity
was shown to be dependent on contact area in in vitro systems (Shaya et al., 2017), impairing
Arp2/3-mediated contact expansion affects only mildly Notch activity levels (Figure 3-4, S4).
Thus, the conserved function of Arp2/3 in cytokinesis does not explain Arp3 requirement in
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
155
Notch signaling. On the other hand, we reported in this study that Arp2/3 activation by WASp
enhances Dl endocytosis at the pIIa-pIIb interface and consequently triggers high Notch
activity levels in pIIa at cytokinesis (Figure 5). As these two functions of Arp2/3 are elicited
at the same time, we speculate that the recruitment of Arp2/3 complexes by the cytokinesis
machinery at the pIIa-pIIb interface is hijacked by WASp to enhance locally Dl endocytosis.
In support of this model, WASp and Arp2/3 appear to affect Notch signaling only in
lineages. In the pioneering study characterizing WASp in flies, authors analyzed WASp
pharates (i.e. adults that did not hatch) and the only Notch-related phenotypes they reported
were found in the SO lineage (Ben-Yaacov et al., 2001). Other Notch-dependent cytokinesis-
independent processes, including wing margin formation, leg segmentation or wing vein
specification seemed unaffected. Further analyses during embryogenesis revealed that WASp
was also required in neural lineages to mediate Notch-dependent fate decisions (Ben-Yaacov
et al., 2001), confirming its lineage-specific requirement. In the same line, impairing Arp2/3
activity did not disturb Notch signaling in wing margin formation (Legent et al., 2012) nor
wing vein specification (Gohl et al., 2010). Finally, given that we were able to analyze
isolated SOPs in arp3 and WASp backgrounds, it indicates that lateral inhibition does not
depend either on WASp-dependent Arp2/3 activity. Hence, these context-specific
requirements of WASp and Arp2/3 point towards a general view where their role in
enhancing Dl endocytosis at cytokinesis is conserved among Notch-dependent lineages.
Mechanistically, this specific requirement in lineages implies that Arp2/3 and WASp
are not necessary to mediate Dl endocytosis nor Notch activation. Instead, they rather
potentiate Notch signaling by enhancing Dl endocytosis. Indeed, in arp3 and WASp pIIa cells,
low Notch activity was still detected at later time points (Figure 1f, orange curves and 2c, red
curves) and in their siblings, Dl was still endocytosed, albeit with a lower efficiency (Figure
5h-i). Accordingly, WASp phenotype was found to be rescued when one copy of Hairless, a
Notch antagonist that binds to CSL, was removed (Ben-Yaacov et al., 2001). Therefore, when
the inhibitory threshold is lowered in the WASp background, low Notch activity levels are
sufficient to specify the pIIa fate. This reinforces the idea that Arp2/3 and WASp exert a
quantitative effect on Notch activity, which translates from the developmental viewpoint into
a qualitative output.
Molecularly, our results suggest that WASp and Arp2/3 regulate a specific subclass of
Dl endocytic events which efficiently activate Notch receptors. Recent studies provided
experimental evidence that WASp-dependent Arp2/3-mediated actin polymerization
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
156
generates forces that are required for membrane invagination of the newly-forming endocytic
vesicle (Mund et al., 2018; Picco et al., 2018). In the context of Notch signaling, forces
generated by WASp and Arp2/3 during Dl endocytosis might exactly meet the requirements
of the mechanostranduction model (Lovendahl et al., 2018), although this remains to be
experimentally tested. Alternatively, as forces generated by endocytosis appear to be variable
(Meloty-Kapella et al., 2012), one might speculate that WASP-Arp2/3-dependent Dl
endocytosis exerts pulling forces in a more reproducible manner than other endocytic
pathways, thereby increasing the probability of Notch activation per endocytic event. Finally,
given that Notch activation in the SO lineage is independent of the Notch-related endocytic
adaptor Epsin (Wang and Struhl, 2004), we propose that the WASp-Arp2/3 pathway is an
alternative mechanism to the Epsin-dependent pathway (Langridge and Struhl, 2017) in
generating forces through ligand endocytosis. This also implicates that different actin
nucleators can drive Dl endocytosis depending on the context.
To conclude, we propose that the Arp2/3 coupling between cytokinesis and Notch
activation might be a conserved mechanism among phyla in neural lineages. During
mammalian corticogenesis, both Arp2/3 and Notch activities are required to maintain radial
glial cell fate and to diversify cell fates (Bigas and Porcheri, 2018; Bultje et al., 2009; Dong et
al., 2012; Wang et al., 2016). In addition, N-WASp is generally required in mammalian
neurogenesis (Jain et al., 2014; Liebau et al., 2011), although the connection with Notch
signaling and intralineage fate decisions remains to be explored. More broadly, given that
Notch signaling also regulates intralineage decisions in multiple tissues, including the thymus
(Radtke et al., 2004), the lung (Pardo-Saganta et al., 2015), the intestine (Ohlstein and
Spradling, 2006), the epidermis (Moriyama et al., 2006) and muscles (Mayeuf-Louchart et al.,
2014), one might speculate that the coupling between cytokinesis and Notch activation is used
in other contexts than neural lineages. Finally, this coupling might have dramatic effects in
cancer lineages where Notch activity is dysregulated. Given that Myc, an oncogenic gene, is a
direct target of Notch signaling in leukemia (Sanchez-Martin and Ferrando, 2017), synergy
between Notch-dependent Myc expression and Notch activation at cytokinesis might be a
potent mechanism of cancer cell proliferation.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
157
Material and Methods Flies
Flies were grown at 25°C unless otherwise stated. The following lines were used in this study:
NiGFP, a GFP knock-in line produced by CRISPR-Homology Recombination (HR) where
GFP is inserted at amino acid position 2388 (Trylinski et al., 2017), DlGFP, a GFP knock-in
line produced by CRISPR-Homology Recombination (HR) where GFP is inserted at amino
acid position 765 (Corson et al., 2017), arp3515FC (BL-39727), WASp3 (BL-39725),
Df(3R)Exel6210 (BL-7688), Dlg-GFP (BL-50859), SCARD37 (BL-8754), Rac1J11 Rac2D
FRT2A MtlD (BL6678), UAS-Rac1N17 (BL-6292), Resille-GFP (Buszczak et al., 2006), UAS-
Arp3GFP (BL-39721), UAS-CAAX-mCherry (BL-59021), PH-ChFP (Herszterg et al., 2013),
Dlg-RFP (Pinheiro et al., 2017), utro-GFP (Rauzi et al., 2010), LifeAct-GFP (BL-35554),
LifeAct-Ruby (BL35545) Cherry-MyoII (BL-59024), neur-iRFP670nls (Couturier et al.,
2014), neur-PH-iRFP670 (PLC-g fused to iRFP670 under the control of neur regulatory
sequences), ubxFLP, neurPGal4, pnrGal4 and tub-Gal80ts (BL-7017 and BL-7019).
In Rac1DN experiments, expression of the UAS transgene by neurPGal4 was made
conditional with tub-Gal80ts to avoid embryonic lethality. At 0hAPF, pupae were collected
and grown at 29°C.
To express the membrane marker CAAX-mCherry specifically in epidermal cells, its
tissue-wide expression driven by pnr-Gal4 was inhibited in SOPs by neur-Gal80.
Additionally, to prevent expression of CAAX-mCherry prior to SOP selection, the system
was made conditional with tub-Gal80ts. 0hAPF pupae were kept for 17h at 18°C to inhibit
Gal4 activity during SOP selection, then shifted at 29°C for 7h to allow expression of CAAX-
mCherry prior to SOP divisions.
Live-imaging and quantifications
Pupae were collected at puparium formation (0hAPF, hours After Puparium Formation) and
prepared for live-imaging at 16h30 APF, unless otherwise stated. Pupae were dissected and
mounted according to standard procedures (Couturier and Schweisguth, 2014). Live-imaging
was performed at 20±2°C with a scanning confocal microscope (LSM780, Zeiss) with a 63x
Plan APO N.A. 1.4 DIC M27 objective. The t=0-minute time point corresponds to the SOP
metaphase-anaphase transition.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
158
All parameters were quantified using z-stacks (Dz=0.5µm) covering cells from apical
to basal. Notch activity dynamics were determined by measuring the GFP fluorescence in pIIa
and pIIb nuclei, as described in (Trylinski et al., 2017). pIIa-pIIb pairs were imaged at single
time points at prevent photobleaching Specifically, in this study, raw values were pondered by
GFP signals measured at 10 minutes (i.e. when signaling is about to start) to buffer variability
between pupae. Actin levels were quantified on 2-image projections (Dz=1µm) corresponding
to the region just below the midbody. Intensity profiles were obtained after positioning
manually an ROI spanning the pIIa-pIIb interface. Images of the same pIIa-pIIb pairs were
acquired at 10, 20 and 30 minutes. Lateral surfaces were quantified in SOPs surrounded by
epidermal cells expressing a membrane marker. First, lateral interfaces were segmented semi-
automatically slice per slice based on the basolateral marker used in a given experiment.
Edges of the contact were determined using the fluorescent signal emitted by the neighboring
epidermal cells. Segmented interfaces were subsequently processed using the “3D ImageJ
Suite” on Fiji to reconstruct a 3D object and determine its surface area. Segmented interfaces
were further used to determine contact width and contact axial length with homemade Fiji
scripts. Raw data are presented. Images of the same pIIa-pIIb pairs were acquired at 10, 20,
30 and 60 minutes. In Rac1DN cells, edges of interfaces were determined using the weak actin
patches detected at lateral tricellular junctions. Contact width corresponds here to the distance
between these two vertices. Axial length was determined based on the distance between the
midbody and the most-basal actin signal.
Movies were acquired with a 1-minute (Fig1a-b’, 3d) or a 10-second frame rate
(Fig1c-c’, g-h’, 3d-d’, S2a-b, S3a, S4a-b, S5a, S6a) and a Dz=0.5µm step. Images were
furthered filtered with a Gaussian blur (s=1) for presentation.
Dl endocytosis assay
SOPs undergoing the metaphase-anaphase transition were first selected in living pupae within
a 10-minute window to stay in the timing of cytokinesis. After the selection step, pupae were
removed from the microscope and dissected for an antibody uptake assay according to
standard procedures (Couturier and Schweisguth, 2014). Right after being dissected, the
explanted notum was incubated at 25°C for 15 minutes in Schneider medium supplemented
with an antibody recognizing Dl ectodomain (mouse, 594.9B concentrate, 1:10, DHSB).
Antibody uptake was blocked by a 30-minute fixation step (paraformaldehyde 4%). The
tissue was subsequently stained with a goat anti-GFP (1:1000, Abcam) to enhance the
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
159
basolateral Dlg-GFP signal. Secondary antibodies (Jackson ImmunoResearch Laboratories)
used in this study were diluted at 1:1000.
Initially selected SOPs, which divided during the uptake assay, were tracked back in
fixed tissues based on their position in the SOP pattern and on somatic clone shapes. Dl-
positive vesicles were automatically detected for quantification using the Spot Detector plugin
under Icy (de Chaumont et al., 2012).
References
Alekhina, O., Burstein, E., and Billadeau, D.D. (2017). Cellular functions of WASP family proteins at a glance. J. Cell Sci. 130, 2235–2241.
Ben-Yaacov, S., Le Borgne, R., Abramson, I., Schweisguth, F., and Schejter, E.D. (2001). Wasp, the Drosophila Wiskott-Aldrich Syndrome Gene Homologue, Is Required for Cell Fate Decisions Mediated by Notch Signaling. J. Cell Biol. 152, 1–14.
Bigas, A., and Porcheri, C. (2018). Notch and Stem Cells. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 235–263.
Bray, S.J., and Gomez-Lamarca, M. (2018). Notch after cleavage. Curr. Opin. Cell Biol. 51, 103–109.
Bultje, R.S., Castaneda-Castellanos, D.R., Jan, L.Y., Jan, Y.-N., Kriegstein, A.R., and Shi, S.-H. (2009). Mammalian Par3 Regulates Progenitor Cell Asymmetric Division via Notch Signaling in the Developing Neocortex. Neuron 63, 189–202.
Buszczak, M., Paterno, S., Lighthouse, D., Bachman, J., Planck, J., Owen, S., Skora, A.D., Nystul, T.G., Ohlstein, B., Allen, A., et al. (2006). The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies. Genetics 175, 1505–1531.
Cabrera, C.V. (1990). Lateral inhibition and cell fate during neurogenesis in Drosophila: the interactions between scute, Notch and Delta. Dev. Camb. Engl. 110, 733–742.
Campellone, K.G., and Welch, M.D. (2010). A nucleator arms race: cellular control of actin assembly. Nat. Rev. Mol. Cell Biol. 11, 237–251.
de Chaumont, F., Dallongeville, S., Chenouard, N., Hervé, N., Pop, S., Provoost, T., Meas-Yedid, V., Pankajakshan, P., Lecomte, T., Le Montagner, Y., et al. (2012). Icy: an open bioimage informatics platform for extended reproducible research. Nat. Methods 9, 690–696.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
160
Corson, F., Couturier, L., Rouault, H., Mazouni, K., and Schweisguth, F. (2017). Self-organized Notch dynamics generate stereotyped sensory organ patterns in Drosophila. Science 356.
Cotton, M., Benhra, N., and Le Borgne, R. (2013). Numb Inhibits the Recycling of Sanpodo in Drosophila Sensory Organ Precursor. Curr. Biol. 23, 581–587.
Couturier, L., and Schweisguth, F. (2014). Antibody Uptake Assay and In Vivo Imaging to Study Intracellular Trafficking of Notch and Delta in Drosophila. In Notch Signaling, H.J. Bellen, and S. Yamamoto, eds. (New York, NY: Springer New York), pp. 79–86.
Couturier, L., Vodovar, N., and Schweisguth, F. (2012). Endocytosis by Numb breaks Notch symmetry at cytokinesis. Nat. Cell Biol. 14, 131–139.
Couturier, L., Mazouni, K., and Schweisguth, F. (2013). Numb Localizes at Endosomes and Controls the Endosomal Sorting of Notch after Asymmetric Division in Drosophila. Curr. Biol. 23, 588–593.
Couturier, L., Trylinski, M., Mazouni, K., Darnet, L., and Schweisguth, F. (2014). A fluorescent tagging approach in Drosophila reveals late endosomal trafficking of Notch and Sanpodo. J. Cell Biol. 207, 351–363.
Del Signore, S.J., Cilla, R., and Hatini, V. (2018). The WAVE Regulatory Complex and Branched F-Actin Counterbalance Contractile Force to Control Cell Shape and Packing in the Drosophila Eye. Dev. Cell 44, 471-483.e4.
Dong, Z., Yang, N., Yeo, S.-Y., Chitnis, A., and Guo, S. (2012). Intralineage Directional Notch Signaling Regulates Self-Renewal and Differentiation of Asymmetrically Dividing Radial Glia. Neuron 74, 65–78.
Eden, S., Rohatgi, R., Podtelejnikov, A.V., Mann, M., and Kirschner, M.W. (2002). Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature 418, 790–793.
Founounou, N., Loyer, N., and Le Borgne, R. (2013). Septins Regulate the Contractility of the Actomyosin Ring to Enable Adherens Junction Remodeling during Cytokinesis of Epithelial Cells. Dev. Cell 24, 242–255.
Gho, M., Bellaïche, Y., and Schweisguth, F. (1999). Revisiting the Drosophila microchaete lineage: a novel intrinsically asymmetric cell division generates a glial cell. Dev. Camb. Engl. 126, 3573–3584.
Gohl, C., Banovic, D., Grevelhörster, A., and Bogdan, S. (2010). WAVE Forms Hetero- and Homo-oligomeric Complexes at Integrin Junctions in Drosophila Visualized by Bimolecular Fluorescence Complementation. J. Biol. Chem. 285, 40171–40179.
Guo, M., Jan, L.Y., and Jan, Y.N. (1996). Control of Daughter Cell Fates during Asymmetric Division: Interaction of Numb and Notch. Neuron 17, 27–41.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
161
Hakeda-Suzuki, S., Ng, J., Tzu, J., Dietzl, G., Sun, Y., Harms, M., Nardine, T., Luo, L., and Dickson, B.J. (2002). Rac function and regulation during Drosophila development. Nature 416, 438–442.
Hartenstein, V., and Posakony, J.W. (1989). Development of adult sensilla on the wing and notum of Drosophila melanogaster. Dev. Camb. Engl. 107, 389–405.
Hartenstein, V., and Posakony, J.W. (1990). A dual function of the Notch gene in Drosophila sensillum development. Dev. Biol. 142, 13–30.
Heitzler, P., and Simpson, P. (1991). The choice of cell fate in the epidermis of Drosophila. Cell 64, 1083–1092.
Herszterg, S., Leibfried, A., Bosveld, F., Martin, C., and Bellaiche, Y. (2013). Interplay between the Dividing Cell and Its Neighbors Regulates Adherens Junction Formation during Cytokinesis in Epithelial Tissue. Dev. Cell 24, 256–270.
Housden, B.E., Fu, A.Q., Krejci, A., Bernard, F., Fischer, B., Tavaré, S., Russell, S., and Bray, S.J. (2013). Transcriptional Dynamics Elicited by a Short Pulse of Notch Activation Involves Feed-Forward Regulation by E(spl)/Hes Genes. PLoS Genet. 9, e1003162.
Jain, N., Lim, L.W., Tan, W.T., George, B., Makeyev, E., and Thanabalu, T. (2014). Conditional N-WASP knockout in mouse brain implicates actin cytoskeleton regulation in hydrocephalus pathology. Exp. Neurol. 254, 29–40.
Kaksonen, M., and Roux, A. (2018). Mechanisms of clathrin-mediated endocytosis. Nat. Rev. Mol. Cell Biol. 19, 313–326.
Khait, I., Orsher, Y., Golan, O., Binshtok, U., Gordon-Bar, N., Amir-Zilberstein, L., and Sprinzak, D. (2016). Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Rep. 14, 225–233.
Kovall, R.A., Gebelein, B., Sprinzak, D., and Kopan, R. (2017). The Canonical Notch Signaling Pathway: Structural and Biochemical Insights into Shape, Sugar, and Force. Dev. Cell 41, 228–241.
Langridge, P.D., and Struhl, G. (2017). Epsin-Dependent Ligand Endocytosis Activates Notch by Force. Cell 171, 1383-1396.e12.
Le Borgne, R., and Schweisguth, F. (2003). Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev. Cell 5, 139–148.
Legent, K., Steinhauer, J., Richard, M., and Treisman, J.E. (2012). A Screen for X-Linked Mutations Affecting Drosophila Photoreceptor Differentiation Identifies Casein Kinase 1α as an Essential Negative Regulator of Wingless Signaling. Genetics 190, 601–616.
Liebau, S., Steinestel, J., Linta, L., Kleger, A., Storch, A., Schoen, M., Steinestel, K., Proepper, C., Bockmann, J., Schmeisser, M.J., et al. (2011). An SK3 Channel/nWASP/Abi-1 Complex Is Involved in Early Neurogenesis. PLoS ONE 6, e18148.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
162
Lovendahl, K.N., Blacklow, S.C., and Gordon, W.R. (2018). The Molecular Mechanism of Notch Activation. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 47–58.
Mayeuf-Louchart, A., Lagha, M., Danckaert, A., Rocancourt, D., Relaix, F., Vincent, S.D., and Buckingham, M. (2014). Notch regulation of myogenic versus endothelial fates of cells that migrate from the somite to the limb. Proc. Natl. Acad. Sci. 111, 8844–8849.
Meloty-Kapella, L., Shergill, B., Kuon, J., Botvinick, E., and Weinmaster, G. (2012). Notch Ligand Endocytosis Generates Mechanical Pulling Force Dependent on Dynamin, Epsins, and Actin. Dev. Cell 22, 1299–1312.
Moriyama, M., Osawa, M., Mak, S.-S., Ohtsuka, T., Yamamoto, N., Han, H., Delmas, V., Kageyama, R., Beermann, F., Larue, L., et al. (2006). Notch signaling via Hes1 transcription factor maintains survival of melanoblasts and melanocyte stem cells. J. Cell Biol. 173, 333–339.
Mund, M., van der Beek, J.A., Deschamps, J., Dmitrieff, S., Hoess, P., Monster, J.L., Picco, A., Nédélec, F., Kaksonen, M., and Ries, J. (2018). Systematic Nanoscale Analysis of Endocytosis Links Efficient Vesicle Formation to Patterned Actin Nucleation. Cell 174, 884-896.e17.
Ohlstein, B., and Spradling, A. (2006). The adult Drosophila posterior midgut is maintained by pluripotent stem cells. Nature 439, 470–474.
Pardo-Saganta, A., Tata, P.R., Law, B.M., Saez, B., Chow, R.D.-W., Prabhu, M., Gridley, T., and Rajagopal, J. (2015). Parent stem cells can serve as niches for their daughter cells. Nature 523, 597–601.
Picco, A., Kukulski, W., Manenschijn, H.E., Specht, T., Briggs, J.A.G., and Kaksonen, M. (2018). The contributions of the actin machinery to endocytic membrane bending and vesicle formation. Mol. Biol. Cell 29, 1346–1358.
Pinheiro, D., Hannezo, E., Herszterg, S., Bosveld, F., Gaugue, I., Balakireva, M., Wang, Z., Cristo, I., Rigaud, S.U., Markova, O., et al. (2017). Transmission of cytokinesis forces via E-cadherin dilution and actomyosin flows. Nature 545, 103–107.
Pollard, T.D. (2007). Regulation of Actin Filament Assembly by Arp2/3 Complex and Formins. Annu. Rev. Biophys. Biomol. Struct. 36, 451–477.
Radtke, F., Wilson, A., and MacDonald, H.R. (2004). Notch signaling in T- and B-cell development. Curr. Opin. Immunol. 16, 174–179.
Rajan, A., Tien, A.-C., Haueter, C.M., Schulze, K.L., and Bellen, H.J. (2009). The Arp2/3 complex and WASp are required for apical trafficking of Delta into microvilli during cell fate specification of sensory organ precursors. Nat. Cell Biol. 11, 815–824.
Rauzi, M., Lenne, P.-F., and Lecuit, T. (2010). Planar polarized actomyosin contractile flows control epithelial junction remodelling. Nature 468, 1110–1114.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
163
Remaud, S., Audibert, A., and Gho, M. (2008). S-Phase Favours Notch Cell Responsiveness in the Drosophila Bristle Lineage. PLoS ONE 3, e3646.
Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76, 477–491.
Rosa, A., Vlassaks, E., Pichaud, F., and Baum, B. (2015). Ect2/Pbl Acts via Rho and Polarity Proteins to Direct the Assembly of an Isotropic Actomyosin Cortex upon Mitotic Entry. Dev. Cell 32, 604–616.
Rotty, J.D., Wu, C., and Bear, J.E. (2013). New insights into the regulation and cellular functions of the ARP2/3 complex. Nat. Rev. Mol. Cell Biol. 14, 7–12.
Sanchez-Martin, M., and Ferrando, A. (2017). The NOTCH1-MYC highway toward T-cell acute lymphoblastic leukemia. Blood 129, 1124–1133.
Schweisguth, F. (2015). Asymmetric cell division in the Drosophila bristle lineage: from the polarization of sensory organ precursor cells to Notch-mediated binary fate decision. Wiley Interdiscip. Rev. Dev. Biol. 4, 299–309.
Shaya, O., Binshtok, U., Hersch, M., Rivkin, D., Weinreb, S., Amir-Zilberstein, L., Khamaisi, B., Oppenheim, O., Desai, R.A., Goodyear, R.J., et al. (2017). Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Dev. Cell 40, 505-511.e6.
Simpson, P. (1990). Lateral inhibition and the development of the sensory bristles of the adult peripheral nervous system of Drosophila. Dev. Camb. Engl. 109, 509–519.
Tal, T., Vaizel-Ohayon, D., and Schejter, E.D. (2002). Conserved Interactions with Cytoskeletal but Not Signaling Elements Are an Essential Aspect of Drosophila Wasp Function. Dev. Biol. 243, 260–271.
Trylinski, M., Mazouni, K., and Schweisguth, F. (2017). Intra-lineage Fate Decisions Involve Activation of Notch Receptors Basal to the Midbody in Drosophila Sensory Organ Precursor Cells. Curr. Biol. 27, 2239-2247.e3.
Wang, W., and Struhl, G. (2004). Drosophila Epsin mediates a select endocytic pathway that DSL ligands must enter to activate Notch. Dev. Camb. Engl. 131, 5367–5380.
Wang, P.-S., Chou, F.-S., Ramachandran, S., Xia, S., Chen, H.-Y., Guo, F., Suraneni, P., Maher, B.J., and Li, R. (2016). Crucial roles of the Arp2/3 complex during mammalian corticogenesis. Development 143, 2741–2752.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
164
Figures and Legend
Figure 1: The Arp2/3 complex is required for Notch activation and lateral contact
expansion at cytokinesis
a-b’) Time-lapse images of an SOP expressing utro-GFP, MyoII-Cherry (a-a’) and PH-
iRFP670 (b-b’). t = 0 minute (min) corresponds to the metaphase-anaphase transition. Lateral
(a, b) and orthogonal views (a’, b’) are shown. Anterior is to the left, posterior to the right. In
orthogonal views, apical is to the top, basal to the bottom. Stars in a’, t = 10 min and t = 20
min highlight the apically positioned midbody and the formation of the actin rich structure
(ARS).
c-c’) Time-lapse images of an SOP expressing H2B-RFP and Arp3-GFP. Lateral (c) and
orthogonal (c’) views are shown. Arp3-GFP accumulated at the membrane during lateral
membrane ingression and contact expansion (arrow at t = 5 min, compare with Fig1a-b’, t = 5
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
165
min). Later on, Arp3-GFP signal is restricted above and below the midbody (stars at t = 10
min and t = 20 min).
d-e’) Snapshots showing the nuclear accumulation of NiGFP in control (d-d’), but not in arp3
pIIa cells (e-e’) at t = 30 min. Clones were negatively marked by the PH-ChFP marker and
outlined by the orange dotted line. pIIa and pIIb nuclei, outlined in d’ and e’, were identified
using iRFP670nls. NiGFP molecules accumulated at the lateral pIIa-pIIb interface in absence
of Arp3 (orange arrow, e).
f) Quantification of NiGFP nuclear levels in control (green curves) and arp3 (orange curves)
backgrounds. High Notch activity levels were not observed in arp3 pIIa cells (t = 10-30
minutes, light orange curve). Weak Notch activity could be detected at later time points (t =
30-60min, light orange curve). Standard errors to the mean are shown (as in all the following
graphs). n≥20 for each time point.
g-h’) Time-lapse images of control (g-g’) or arp3 (h-h’) SOPs expressing Dlg-GFP and
iRFP670nls. Neighboring cells were marked by PH-ChFP (magenta in c, d, grey in c’, d’). In
arp3 pIIa-pIIb pairs, membranes of neighboring cells remained longer in between the lateral
pIIa-pIIb interface (arrows, d’).
i-k) Quantification of the lateral contact geometric properties. Surface area (i), interface width
(j) and interface axial length (k) were markedly reduced in arp3 pIIa-pIIb pairs (orange
curves) compared to control pairs (green curves). Note that arp3 pIIa-pIIb interfaces
preferentially expanded along the z-axis (compare t = 60 min, j and k). n=8 (resp. 15) for
control (resp. arp3) cells.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
166
Figure 2: WASp is required for Notch activation at cytokinesis, but not for contact
expansion
a-b’) Snapshots showing the nuclear accumulation of NiGFP in control (a-a’), but not in
WASp pIIa cells (e-e’) at t = 30 min. Clones were negatively marked by the PH-ChFP marker
and outlined by the orange dotted line. pIIa and pIIb nuclei, outlined in a’ and b’, were
identified using iRFP670nls. NiGFP molecules accumulated at the lateral pIIa-pIIb interface
in absence of WASp (orange arrow, e). Images in a, a’ are the same as Fig1d-d’.
c) Quantification of NiGFP nuclear levels in control (green curves from Fig1f) and WASp (red
curves) backgrounds. High Notch activity levels were not observed in WASp pIIa cells (t =
10-30 minutes, red curve). Weak Notch activity could be detected at later time points (t = 30-
60min, red curve). n≥20 for each time point.
d-d’) Snapshots showing weak WASp-GFP (green in c, grey in c’) lateral localization
(arrows) at the lateral pIIa-pIIb interface at cytokinesis.
e-e’) Time-lapse images of WASp3 (e-e’) SOPs expressing Dlg-GFP and iRFP670nls.
Neighboring cells were marked by Dlg-RFP (magenta in e, grey in e’). In WASp3 pIIa-pIIb
pairs, membranes of neighboring cells did not intervene longer in between pIIa and pIIb.
f-h) Quantification of the lateral contact geometric properties. Surface area (f), interface width
(g) and interface axial length (h) were not affected in WASp3 pIIa-pIIb pairs (red curves)
compared to control pairs (green curves, same as in Fig1i-k). n=3 for WASp3 cells.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
167
Figure 3: Rac activity regulates contact expansion at cytokinesis, but affects only mildly
Notch activity
a-b’) Snapshots showing the nuclear accumulation of NiGFP in control (a-a’) and in rac pIIa
cells (e-e’) at t = 30 min. GFP levels appears slightly weaker in the rac pIIa cell. Clones were
negatively marked by the PH-ChFP (a) or His-RFP (b) marker and outlined by the orange
dotted line. pIIa and pIIb nuclei, outlined in a’ and b’, were identified using iRFP670nls.
c) Quantification of NiGFP nuclear levels in control (green curves from Fig1f) and rac (light
blue curves) backgrounds. Notch activity was diminished at early time points in rac pIIa cells
(t = 10-30 minutes, light blue curve) but reached similar levels to control pIIa cells at later
time points (t = 30-60min, green and light blue curves). n≥15 for each time point.
d-d’) Time-lapse images of an SOP expressing LifeAct-Ruby and Rac1-GFP (green in d, grey
in d’). Rac1-GFP accumulated at the membrane during lateral membrane ingression and
contact expansion similarly to Arp3GFP (arrows, compare with Fig1a-c’).
e-e’) Time-lapse images of WASp3 (e-e’) SOPs expressing Dlg-GFP and iRFP670nls.
Neighboring cells were marked by PH-ChFP (magenta in e, grey in e’). In rac pIIa-pIIb pairs,
membranes of neighboring cells remained longer in between the lateral pIIa-pIIb interface
(arrows, e’).
f-h) Quantification of the lateral contact geometric properties. Surface area (f), interface width
(g) and interface axial length (h) were markedly reduced in rac pIIa-pIIb pairs (red curves)
compared to control pairs at t = 10 min (green curves, same as in Fig1i-k). Later on, lateral
appeared to expand similarly to control cells. n=5 for rac cells.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
168
Figure 4: SCAR is not required for Notch activation at cytokinesis
a-b’) Snapshots showing the nuclear accumulation of NiGFP in control (a-a’) and in SCAR
pIIa cells (e-e’) at t = 30 min. GFP levels appears slightly weaker in the SCAR pIIa cell.
Clones were negatively marked by the PH-ChFP (a) or RFPnls (b) marker and outlined by the
orange dotted line. pIIa and pIIb nuclei, outlined in a’ and b’, were identified using
iRFP670nls.
c) Quantification of NiGFP nuclear levels in control (green curves from Fig1f) and SCAR
(purple curves) backgrounds. Notch activity was only weakly diminished at early time points
in SCAR pIIa cells (t = 10-30 minutes, light blue curve) and reached similar levels to control
pIIa cells at later time points (t = 30-60min, green and light blue curves). n≥16 for each time
point.
10 20 30 40 50 60
1.0
1.2
1.4
1.6
1.8
●
●
●
●
●
● ● ●●
●
●
●
●●
● ●
NiGFP PH-ChFP/RFPnls (neighbor) iRFP670nls
NiGFP
a
30 minlateral
ctrl
pIIb pIIa
pIIb
pIIa
a’
SCARb
b’
c
time (min)
Notch activity
pIIa ctrl
pIIa SCAR
pIIb ctrl
pIIb SCAR
Fig4
norm
alized G
FP
inte
nsity (
a.u
.)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
169
05
1015
01000
2000
3000
DlgGFP PH-ChFP (neighbor) iRFP670nlsendo-Dl
e fctrl arp3 WASpg
lateral
d’
d
d’’
DlGFP PH-ChFP (neighbor) iRFP670nls
Fig5
a bctrl arp3 WASpc
ctrl
Number of Dl-vesicles in pIIb Total intensity of endo-Dl per pIIb cell
arp3 WASp ctrl arp3 WASp
*** *** *** ***
h i
in vivo fixed* **
*
*
*
(1) selection of dividing SOPs in vivo (10 min)
(2) dissection and incubationwith anti-Dl (15 min)
(3) Imaging divided SOPsin fixed tissues
anti-DlECD
uptake assay
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
170
Figure 5: Arp2/3 and WASp regulate Dl endocytosis at cytokinesis
a-c) Snapshots showing the lateral distribution of DlGFP in control (a), arp3 (b) and WASp (c)
pIIa-pIIb pairs at t ≥ 20 min. DlGFP accumulated laterally in arp3 and WASp backgrounds.
PH-ChFP marked epidermal neighbors in b.
d-d’’) Dl endocytosis assay at cytokinesis. Principle of the experiment (d) (adapted from
Besson et al., 2015 and Le Borgne and Schwesiguth, 2003). Snapshots of the same tissue area
before (d’) and after (d’’) the uptake assay. Stars highlight monitored SOPs that divided
during the experiment.
e-g) Snapshots of monitored SOPs during the endocytosis assay in control (e), arp3 (f) and
WASp (g) backgrounds. Bright magenta puncta represent vesicles containing endocytosed Dl
molecules (endo-Dl). DlGFP (green) marks the lateral membranes. Weak magenta signal in e
comes from PH-ChFP expressed by epidermal cells.
h-i) Quantifications of the Dl endocytosis assay. The number Dl-positive vesicles (h) and the
integrated intensity of endo-Dl per cell (i) were decreased in arp3 (orange) and WASp (red)
pIIb cells compared to control (green). *** p<0.001 (Student t-test). n≥16.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
171
Supplementary Figures and Legends
Figure S1: The Arp2/3 complex affects Notch activity in a cell-autonomous manner
a) Quantifications of pIIa/pIIb ratios at t = 60 minutes in arp3 pIIa-pIIb pairs whose interface
contacted two arp3 epidermal cells (orange), one arp3 epidermal cell (dark orange), no arp3
cell (brown) and in control pIIa-pIIb pairs (green). No statistical difference was found
between the different arp3 conditions. n≥9.
b-d) Snapshots of the different arp3 conditions. Stars highlight non-mutant arp3 neighbors
(either arp3+/- or arp3+/+). Clones are negatively marked by PH-ChFP and outlined by an
orange dotted line.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
172
Figure S2: The Arp2/3 complex is required for the formation of the ARS at cytokinesis
a-b) Time-lapse images showing actin dynamics using utro-GFP in control (a) or arp3 (b)
SOPs. The lateral tail of the ARS is only detected in control pIIa-pIIb pairs (arrow, compare
with Fig1a-a’).
c-c’) Actin intensity profiles in control (c) and arp3 (c’) pIIa-pIIb pairs at cytokinesis. Three
time points were quantified: t = 10 (light colors), 20 (intermediate colors) and 30 (dark colors)
minutes. Note the absence of ARS formation in arp3 pIIa-pIIb interfaces (t = 10 min, light
orange curve). n≥18.
a
b
0 min 5 min 10 min 20 min 30 minlateral
ctrl
Arp3
utroGFP PH-ChFP (neighbor) iRFP670nls
pIIbpIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
FigS2
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
Actin intensity profile
Control arp310 min
20 min
30 min
10 min
20 min
30 min
c c’
GF
P in
ten
sity (
a.u
.)
x position (pix) x position (pix)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
173
Figure S3: WASP is not required for the formation of the ARS at cytokinesis
a) Time-lapse images showing actin dynamics using utro-GFP in WASp SOPs. The formation
of the ARS appeared unaffected in WASp pIIa-pIIb interfaces (arrow, compare with Fig1a-a’).
b-b’) Actin intensity profiles in control (b, curves from FigS1c) and WASp (b’) pIIa-pIIb pairs
at cytokinesis. Three time points were quantified: t = 10 (light colors), 20 (intermediate
colors) and 30 (dark colors) minutes. n≥18.
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
a
0 min 5 min 10 min 20 min 30 minlateral
WASputroGFP iRFP670nls
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
FigS3
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
Actin intensity profile
Control WASp10 min20 min30 min
10 min20 min30 min
b b’
GFP
inte
nsity
(a.u
.)
x position (pix) x position (pix)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
174
Figure S4: Disturbing Rac activity with Rac1DN impairs contact expansion and mildly
affects Notch activity at cytokinesis
a-b) Time-lapse images showing actin dynamics using LifeAct-GFP in control and Rac1DN
SOPs. Both constructs were driven using the SOP-specific neurPGal4 driver. The formation
of the ARS could only be detected in control pIIa-pIIb pairs (arrow).
c-d) Quantification of the lateral contact geometric properties. Interface width (c) and axial
length are strongly reduced in Rac1DN pIIa-pIIb pairs (blue curves) compared to control ones
10 20 30 40 50 60
02
46
810
12
●
●
●
●
●
●
●
●
0 5 10 15 20 25 30
01000
2000
3000
4000
0 5 10 15 20 25 30
01000
2000
3000
4000
10 20 30 40 50 60
23
45
67
●
●
●
●
●
●●
●
a
b
c d e
ctrl
Rac1DN
LifeActGFP
0 min 5 min 10 min 20 min 30 min
time (min) time (min) x position (pix) x position (pix)
Interface lateral width Interface axial lengthActin intensity profile
control Rac1DNctrlRac1DN
ctrl 10 minRac1DN
30 min20 min 20 min
10 min
30 min
10 20 30 40 50 60
1.0
1.2
1.4
1.6
1.8
●
●
●
●
●●
●●
●
●
●
●
●●
●
●
pIIa ctrl
pIIa Rac1DN
pIIb ctrl pIIb Rac1DN
Notch activity
time (min)
NiGFP
NiGFP
30 min
ctrl Rac1DNiRFP670nls
pIIbpIIa pIIb pIIa
f g
f’ g’
h
lateral
pIIbpIIa
pIIb
pIIa
FigS4
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
leng
th (µ
m)
leng
th (µ
m)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
175
(green curves). Note that similarly to arp3 cells (Fig1j-k), contact expanded preferentially
along the z-axis.
e) Actin intensity profiles in control (green curves) and Rac1DN pIIa-pIIb pairs (blue curves).
Three time points were quantified: t = 10 (light colors), 20 (intermediate colors) and 30 (dark
colors) minutes. n≥24. Note that at t = 10 min, Rac1DN pIIa and pIIb actin cortices could be
resolved, indicating that the two cells were physically separated (light blue curve).
f-g’) Snapshots showing the nuclear accumulation of NiGFP in control (f-f’) and in Rac1DN
pIIa cells (g-g’) at t = 30 min. GFP levels appears slightly weaker in the Rac1DN pIIa cell. pIIa
and pIIb nuclei, outlined in f’ and g’, were identified using iRFP670nls.
h) Quantification of NiGFP nuclear levels in control (green curves) and Rac1DN (blue curves)
backgrounds. Notch activity was diminished at early time points in Rac1DN pIIa cells (t = 10-
30 minutes, light blue curve) but reached similar levels to control pIIa cells at later time
points (t = 30-60min, green and light blue curves). n≥18 for each time point.
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
176
Figure S5: Rac activity is required for the formation of the ARS at cytokinesis
a) Time-lapse images showing actin dynamics using utro-GFP in rac SOPs. The formation of
the ARS was not detected in rac pIIa-pIIb interfaces (arrow, compare with Fig1a-a’ and
FigS1a).
b-b’) Actin intensity profiles in control (b, curves from FigS1c) and rac (b’) pIIa-pIIb pairs at
cytokinesis. Three time points were quantified: t = 10 (light colors), 20 (intermediate colors)
and 30 (dark colors) minutes. n≥11.
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
a
0 min 5 min 10 min 20 min 30 minlateral
racutroGFP iRFP670nls
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
FigS5
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
Actin intensity profile
Control rac10 min
20 min
30 min
10 min
20 min
30 min
PH-ChFP (neighbor)
b b’
GF
P in
ten
sity (
a.u
.)
x position (pix) x position (pix)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
177
Figure S6: SCAR is required for the formation of the ARS at cytokinesis
a) Time-lapse images showing actin dynamics using utro-GFP in SCAR SOPs. The formation
of the ARS was not detected in SCAR pIIa-pIIb interfaces (arrow, compare with Fig1a-a’ and
FigS1a). Note that pIIa and pIIb
b-b’) Actin intensity profiles in control (b, curves from FigS1c) and SCAR (b’) pIIa-pIIb pairs
at cytokinesis. Three time points were quantified: t = 10 (light colors), 20 (intermediate
colors) and 30 (dark colors) minutes. n≥18. Note that at t = 10 min, SCAR pIIa and pIIb actin
cortices could be resolved with utro-GFP, indicating that the two cells were physically
separated and likely that the pIIa-pIIb lateral contact was affected.
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
a
0 min 5 min 10 min 20 min 30 minlateral
SCARutroGFP iRFP670nls
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
pIIb
pIIa
FigS6
0 5 10 15 20 25 30
0200
400
600
800
1000
1200
1400
Actin intensity profile
Control SCAR10 min20 min30 min
10 min20 min30 min
RFPnls (neighbor)
b b’
GFP
inte
nsity
(a.u
.)
x position (pix) x position (pix)
Chapter 5. Results. The Arp2/3 complex couples cytokinesis to Notch activation in the Drosophila sensory organ lineage
178
Figure S7: Decreased number in Dl-positive vesicles is not compensated by increased
numbers of Dl molecules per endosome or increased vesicle size
a) Boxplot showing average endo-Dl intensity per endosome in control (green), arp3 (orange)
and WASp (red) backgrounds. Levels are comparable, indicating that the same amounts of Dl
molecules are incorporated per vesicle between the different conditions. n≥16.
b) Boxplot showing volumes of Dl-positive vesicles in control (green), arp3 (orange) and
WASp (red) backgrounds. No significant change was observed between the different
conditions. n≥16.
0100
200
300
400
0.2
0.4
0.6
0.8
1.0
FigS7
ctrl
Intensity of Dl-vesicles in pIIb Volume of Dl-vesicles in pIIb
arp3 WASp ctrl arp3 WASp
a ben
do-D
l int
ensi
ty (a
.u.)
volu
me
(µm
3 )
181
Chapter 6
Discussion
6.1. Apical VS lateral Notch signaling
The first axis of my thesis consisted in developing a new experimental strategy to identify
Notch activation site in vivo during SOP ACD. This work led to the conclusion that apical
Notch receptors, albeit easily detectable by fluorescence, do not contribute significantly to
signaling in pIIa. On the other hand, the significant pool located laterally along the pIIa-pIIb
interface is barely detectable in vivo. This conclusion raises several points that will be
discussed below. First, it appears that localization of Notch receptors does not, in this context,
reflect their function. However, such conclusion might confuse qualitative function and
biological significance. Second, it questions why Notch receptors are still addressed above the
midbody if they are not required for signaling. Third, why the lateral side of the pIIa-pIIb
interface is favored against the apical one lacks a molecular basis.
6.1.1. Notch receptors: is localization reflecting function?
Investigators often illustrate the tension between protein localization and function by referring
to the American school bus parabola. From a top view, yellow school buses are easily
detectable when concentrated at a parking lot, i.e. when they are inactive. Conversely, once
mobilized for school transport, they become diluted in the traffic and thereby barely
detectable. By analogy, accumulation of fluorophore-tagged proteins at subcellular sites might
lead to erroneous interpretations when the connection between localization and function is set
too rapidly.
Nonetheless, in the case of Notch receptors, the analogy itself might be misleading.
Indeed, it associates accumulation with inactivity and dilution/relocalization with
functionality. When transposed to the context of the SOP division, it suggests that apical
Notch receptors serve as an inactive reservoir for the lateral interface, or any signaling site.
However, photobleaching data (Chapter 4) show that the apical pool and the lateral pool are
Chapter 6. Discussion
182
largely independent since (1) photobleaching the apical pool does not change Notch levels at
the lateral interface and vice versa, and (2) photobleaching/photoconverting the apical pool
affects only weakly and non-significantly fluorescence levels in pIIa nucleus.
In fact, this weak and non-significant contribution might rather hint that Notch
receptors are activated apically (i.e. are functional), but in much lesser amounts compared to
the lateral interface. Following that idea, it would mean that Notch receptors are either
activated more efficiently laterally (discussed below) or in larger numbers at this location,
although they are weakly detected. One explanation to this contrast between Notch
distribution and contribution to signaling might reside in the size of the contact surfaces.
Because Notch receptors are accumulating on a reduced area at the level of AJs forming the
adhesive belt, they can be easily detected (in addition to the fact that they are closer to the
microscope objective). Conversely, as the lateral contact area is 10- to 20-time larger,
receptors would be diluted over a large surface and difficult to observe with conventional
fluorescent microscopy.
Therefore, this contrast between receptor distribution and function might finally be
due to the limitations of our optic systems. It would be intriguing to test in other epithelia
experiencing Notch signaling whether apical accumulation and lateral activation of Notch
receptors is a conserved feature or a cytokinesis-specific phenomenon.
6.1.2. Why an apical pool of Notch receptors in SOPs?
Then, if apical Notch receptors do not contribute significantly to signaling activity in pIIa,
why would cells spend energy to synthetize and traffic them towards the apical AJs? A
comparison with the neighboring epidermal cells reveals that Notch receptors are
physiologically addressed towards this subcellular location in the notum. As SOPs share both
a proneural and an epithelial identity, one might simply infer that apical addressing of Notch
receptors is their default trafficking route in a polarized epithelium.
Therefore, knowing whether Notch receptors are activated laterally or apically in
epithelia might provide valuable information concerning this paradox specific to SOPs.
Indeed, if lateral activation would appear to be specific to cell division, a tantalizing idea
might be that apical activation of Notch receptors is the common mechanism for Notch
signaling in epithelia, albeit with slow dynamics, while lateral activation specifically
occurring at cytokinesis would sustain rapidly high levels of Notch activity.
6.1. Apical VS lateral Notch signaling
183
Experimentally, this question could be addressed with a new set of nanobody-based
GFP-traps, termed GrabFP, which allows the control of transmembrane protein distribution
(Harmansa et al., 2017). These tools consist in the fusion of a lateral or apical membrane
tether with a nanobody recognizing the GFP. Thereby, GrabFPs can be used to force the
localization of GFP-tagged transmembrane proteins either to apical or lateral domains.
Applied to Notch, it could help in understanding the requirement of its polarized distribution
in epithelia.
6.1.3. The lateral contact: a simple matter of area?
Why signaling between pIIa and pIIb is mostly, if not completely, mediated laterally is not
determined in the here presented work. The simplest hypothesis would assume that the lateral
contact is favored due to its large area compared to apical AJs, in accordance with recent
reports (Khait et al., 2016; Shaya et al., 2017). Although this question was not experimentally
addressed in this thesis, reducing the lateral pIIa-pIIb contact area does not seem to strongly
impair Notch activity levels. In Rac1DN pIIa-pIIb pairs (Chapter 5), signaling levels reached
similar values to control cells even though the lateral area was much smaller. In SCAR cells,
Notch activity is even less affected and actin quantifications hint towards similar defects in
contact expansion. In fact, it rather appears that as soon as the lateral contact is set between
pIIa and pIIb, Notch signaling starts. A careful examination of the interplay between lateral
contact areas and signaling dynamics in diverse genetic backgrounds might help in
determining the nature of the correlation, if any, between these two parameters.
Alternatively, the explanation for lateral Notch activation might lie in the distribution
of Notch pathway components. Both Notch and Neur can be detected apically, but not Delta
either in fixed tissues or in vivo in absence of Neur activity (Chapter 4). Thereby, Notch
receptors cannot be activated apically, or only by a weak pool of Delta molecules that I could
not detect. Intriguingly, Delta localizes at the AJs in neighboring epidermal cells. Why it is
weakly detected at this location, even under favorable conditions (Brd overexpression), in
pIIa-pIIb interfaces is a mystery. Analysis of the components forming the exocyst, in
particular Sec15 (Jafar-Nejad et al., 2005), might be a promising direction to understand why
Delta would only be targeted laterally at cytokinesis. On the other side of the membrane,
considering that Notch receptors display a large array of glycosylation patterns in vivo
(Harvey et al., 2016), one might consider that differentially modified receptors enter distinct
trafficking routes and bind to Delta with different affinities.
Chapter 6. Discussion
184
Lastly, local molecular microenvironments might also explain why signaling is
preferentially mediated at the lateral contact. First, composition in polarity proteins is
completely different above and below the midbody. Given that Crumbs was proposed to
prevent Notch ligand-independent activation by direct binding (Nemetschke and Knust,
2016), one might hypothesize that other polarity can modulate signaling either by promoting
or inhibiting activation. Such additional layers of regulation are yet to be determined. Second,
the different domains of the interface might also determine how Notch and Delta distribute at
their surface. The idea that ligand-receptor clustering influences Notch activity has emerged
in the Notch field the last years (Nandagopal et al., 2018; Narui and Salaita, 2013), although
supporting experimental evidence is still lacking. This hypothesis assumes that concentrating
signaling molecules (receptor, ligand, endocytosis effector) in discrete points of a large
contact area translates into larger rates of NICD production. In the context of the pIIa-pIIb
interface, Notch clustering specifically occurring below the midbody could provide a
molecular basis for the high Notch activity levels detected in pIIa. Furthermore, given that
Notch interacts physically with E-Cad (Sasaki et al., 2007) and Spdo (O’Connor-Giles and
Skeath, 2003), distribution of these two transmembrane proteins could be key in organizing
Notch “signaling hubs”. Lastly, organization of the plasma membrane itself may determine
the lateral location of Notch activation site. Specific domains characterized by lipid
compositions were shown in many contexts to influence multiple signaling pathways,
including the famous lipid rafts (Santos and Preta, 2018; Sunshine and Iruela-Arispe, 2017).
In line with this idea, several reports showed an influence of membrane composition on
ligand ability to activate Notch receptors (Chillakuri et al., 2013; Hamel et al., 2010; Suckling
et al., 2017) Whether the pIIa-pIIb interface displays differential lipid compositions along the
apical-basal axis, and whether this correlates with Notch and Delta distributions, would be
exciting and not the least challenging to determine.
6.2. Interplay between cytokinesis and Notch signaling
The two axes of my theses point towards an interplay between cytokinesis and Notch
signaling: the first revealing the location of Notch activation site, the second providing a
molecular mechanism bridging the two processes. Nonetheless several questions
6.2. Interplay between cytokinesis and Notch signaling
185
remain unaddressed, including the coordination between cytokinesis and exocytosis in the
context of Notch signaling, the molecular details of Arp2/3 dual activation mode at the pIIa-
pIIb interface and the role of Notch activation at cytokinesis in the SO lineage.
6.2.1. Contact formation and exocytosis
During cytokinesis, a new interface needs to be generated to resolve the daughter cells’ own
membranes. This process requires active exocytosis to provide membrane materials (Frémont
and Echard, 2018) and, in the context of an epithelium, presumably adhesive transmembrane
proteins to establish stable cell-cell contacts. In addition to these conserved requirements,
SOPs need to address signaling molecules (Notch, Delta, Neur…) to the newly-forming pIIa-
pIIb interface to ensure that signaling will occur after telophase completion.
Whether this additional requirement relies on a SOP-specific mechanism is currently
not known. One appealing candidate is Sec15, a member of the exocyst. Sec15 was shown to
be required for Notch signaling in the SO lineage, although its potential function at
cytokinesis has been overshadowed by the Delta recycling model (Jafar-Nejad et al., 2005).
Similar to Arp2/3 and WASp, Sec15 was not found to regulate other Notch-dependent
developmental processes and appears to be lineage-specific. Therefore, exploring its function
at cytokinesis using optogenetic-based tools to induce temporally-controlled perturbations,
thereby avoiding earlier pleiotropic effects, might help in understanding the interplay between
Notch signaling at cytokinesis and exocytosis in the context of lineages.
6.2.2. Dual mode of Arp2/3 activation
The model proposed for the interplay between cytokinesis and Notch activation implicates
that Arp2/3 complexes located at the pIIa-pIIb interface might either be activated by
SCAR/WAVE or by WASp. This implication in turn interrogates how at the molecular scale
the two signaling inputs are coordinated to efficiently mediate contact expansion and Delta
endocytosis.
If SCAR and WASp activated simultaneously Arp2/3 complexes at the pIIa-pIIb
interfaces, it could question how a competition between the two NPFs in binding Arp2/3
complexes leads to two cellular processes robustly reproducible throughout SOPs. The
simplest solution would consist in an excess of Arp2/3 molecules compared to the NPFs.
Chapter 6. Discussion
186
Thereby, activated SCAR or WASp would never saturate the total pool of available Arp2/3.
Alternatively, a balance between NPF concentration and affinity for Arp2/3 (for example, low
concentration is compensated by higher affinity) would fine-tune the differential mode of
Arp2/3 function.
On the other hand, SCAR- and WASp-dependent activations might occur sequentially
at cytokinesis. First, Arp2/3 complexes would be saturated by Rac-activated WRC complexes
and only employed to expand the newly-forming contact. Once this contact is stabilized by
adhesive molecules, such as E-Cad, Rac activity would be inhibited and WRC complexes
inactivated. Free Arp2/3 complexes would then be available to be bound by WASp molecules
and initiate Delta endocytosis.
Testing these different hypotheses would require developing an imaging setup with
high temporal and spatial resolutions to resolve NPF distributions along the pIIa-pIIb
interface at cytokinesis as well as to probe their activities using bio-sensors.
6.2.3. Is lineage progression hiding a “competence window”?
Analysis of Notch functional requirement after SOP division clearly showed that Notch
receptors need to be activated at cytokinesis to ensure pIIa fate acquisition prior to the next
division round (Remaud et al., 2008). The most parsimonious hypothesis would assume that
this requirement underlies the time required for the expression of all Notch target genes
specifying the pIIa fate.
During my thesis, I found that the Arp2/3 complex couples Notch activation with
cytokinesis to ensure both Notch activity onset and high activity levels following telophase
completion in pIIa (Chapter 5). Nonetheless, presuming that this mechanism is conserved at
each step of the SO lineage, the constraint of the lineage division rate stops being relevant for
the terminal divisions of pIIa and pIIIb. Indeed, arp3 lineages were reported to produce only
neurons, implying that pIIa-to-pIIb and sheath-to-neuron fate transformations occurred (Rajan
et al., 2009). Similar requirements were found with WASp (Ben-Yaacov et al., 2001).
Therefore, WASp-dependent Arp2/3 activity is also required for fate specification after pIIIb
division, even though the daughter cells will stay interphasic throughout animal life. In
addition, even though Notch is weakly activated in pIIa after division, integration over longer
time periods of this weak signaling activity is not sufficient to specify the sheath fate. This
suggests that additional regulatory mechanisms are in place in pIIIb daughter cells to lock the
6.2. Interplay between cytokinesis and Notch signaling
187
neuronal fate in absence of strong Notch activity and thereby restrict temporally the response
to Notch signaling.
In light of this interpretation, one might consider that the pIIa-to-pIIb fate
transformation observed in arp3 and WASp SO lineages would also be caused by the
expression of genes that determine the pIIb fate and prevent the expression of pIIa-specific
genes. Thereby, the switch mediated by Notch signaling between these alternative fates would
be restricted in time by a so-called “competence window”. This potential restriction would
reinforce the necessity for Notch receptors to be activated at cytokinesis to ensure Notch
target expression in pIIa prior to the expression by default of “pIIb” genes.
Temporal profiling of gene expression in pIIa and pIIb cells would uncover whether
such transcriptional regulatory mechanisms exist and how they are organized to direct fate
acquisitions and to antagonize the opposite fate.
188
Chapter 7
Perspectives
7.1. A widely-applicable technique to identify Notch activation
site in vivo
Combination of photobleaching and photoconversion of fluorophore-tagged Notch receptors
provides a powerful technique to map Notch activation at the subcellular scale (Chapter 4).
As genome editing strategies have improved in efficiency over the past years following the
fast development of the CRISPR technology, tagging Notch genes at the endogenous locus
with the fluorescent protein of interest became more accessible and allows to monitor
signaling activities at endogenous levels. Advances in imaging systems also helps in precisely
quantifying Notch levels at the cell surface and in the nucleus under its cleaved form, a
prerequisite to apply the phototracking technique.
This section will briefly present applications of this technique to biological problems
related to Notch signaling.
7.1.1. Testing the contact area/Notch activity correlation
In vitro demonstration of the correlation between the contact area and Notch activity levels in
pairs of signal-sending and signal-receiving cells begs the question of its significance in vivo
(Shaya et al., 2017). In their experimental approach, Shaya et al. proceeded by reducing the
contacting interface to a single straight line and observed that Notch activity levels scaled
with the length of the line. Methodically, reducing the dimensionality of the interface (i.e.
from a surface to a line) was key to test such fundamental hypothesis. In vivo, as interfaces in
most biological systems can hardly be considered as mere lines, the distance seems quite
broad to extrapolate these findings. First and foremost, testing this correlation requires
knowing the location of Notch activation site.
To overcome this limitation, the phototracking technique offers a powerful
experimental strategy. Not only it identifies where Notch receptors are activated, but also
7.1. A widely-applicable technique to identify Notch activation site in vivo
189
provides Notch signaling dynamics. Combination with the geometric properties of interfaces
would reveal whether the correlation is valid or not in hypothetically any system allowing
decent live-imaging conditions.
7.1.2. Notch signaling site and regulatory mechanisms
The SO lineage provides a clear example of how untested assumptions, including Notch
apical activation and Delta recycling, have presumably misled the interpretations on the
cellular functions related to Notch signaling of multiple regulators. During my thesis,
identifying Notch activation site at the lateral side of the pIIa-pIIb interface further orientated
my work when reinvestigating Arp3 function during SOP ACD. More generally, all Notch
regulators identified in this experimental model and linked with one of the two
aforementioned assumptions (Benhra et al., 2010, 2011; Jafar-Nejad et al., 2005; Rajan et al.,
2009) should be, in principle, reexamined in light of lateral Notch activation at cytokinesis.
From a wider perspective, determining receptor activation site could be the starting
point in understanding the context-specific regulatory mechanisms governing and organizing
Notch signaling at the protein level. Upstream of the signaling site, trafficking pathways
dictate where receptors, ligands and other essential regulators are targeted. How these
pathways are regulated, for example by receptor or ligand post-translational modifications,
remains largely unknown. At the level of the signaling site, our understanding on how the
membrane microenvironment, including the lipid composition of the membrane bilayer, the
cortical cytoskeleton or neighboring transmembrane or membrane-associated proteins, affects
in vivo Notch activation is scarce.
Thereby, once Notch activation site is established, analysis of regulatory mechanisms
might spread out from and around this subcellular site. Lastly, such knowledge would be
particularly valuable in pathological contexts where common cellular mechanisms become
dysregulated and lead to aberrant Notch activity levels (Siebel and Lendahl, 2017).
Chapter 7. Perspectives.
190
7.2. Arp2/3-mediated Delta endocytosis: a molecular basis for the
mechanotransduction model
The mechanotransduction model for Notch activation necessitates a molecular mechanism
transmitting a pulling force to the receptor-ligand complex. Over the past years, ligand
endocytosis became the prevalent source of such forces (Lovendahl et al., 2018). Nonetheless,
the molecular machinery generating the forces during ligand endocytosis is not determined.
The endocytic adaptor Epsin seems to be required in many different systems (Langridge and
Struhl, 2017; Meloty-Kapella et al., 2012), albeit its molecular activity does not trigger
membrane bending. Actin also appears required (Meloty-Kapella et al., 2012), although actin
nucleators were not characterized.
Work from Chapter 5 provides evidence that WASp-dependent Arp2/3 activity
regulates a subset of Dl endocytic events at the pIIa-pIIb interface. Given that WASp-Arp2/3-
mediated actin polymerization at endocytic sites was recently demonstrated to efficently
induce membrane bending and endosome tubulation (Mund et al., 2018; Picco et al., 2018), it
becomes plausible that Arp2/3 is one of the actin nucleators generating the pulling force.
Implications of this hypothesis are discussed in the following subsections.
7.2.1. Towards an array of Delta endocytosis mechanisms
The fact that WASp and Arp2/3 appear to be required for Notch signaling only in lineages
implies that they are not essential components of Notch activation mechanism. Molecularly,
this implication means that neither Neur-mediated nor Mib1-mediated Delta endocytoses are
in general dependent on the WASp-Arp2/3 pathway. Consistently, in arp3 or WASp pIIb cells,
Delta was still endocytosed, albeit in lower amounts (Chapter 5). Conversely, Epsin is not
required in SO lineages to mediate Notch signaling (Wang and Struhl, 2004).
Collectively, these context-specific requirements of endocytosis regulators indicate
that Delta can enter different endocytic pathways to activate Notch receptors depending on
the cellular environment. Mechanistically, it asks whether all these endocytic pathways
activate Notch receptors with the same efficiencies. In arp3 and WASp pIIb cells, Delta was
still endocytosed while Notch activity was weak, but not abolished, in their siblings (Chapter
5). One interpretation might be that the remaining mechanism driving Delta endocytosis only
7.2. Arp2/3-mediated Delta endocytosis: a molecular basis for the mechanotransduction model
191
weakly activate Notch receptors. In the light of Notch activation, this WASp-Arp2/3-
independent Delta endocytosis would rather be inefficient in reproducibly generating pulling
forces within the 2-10 pN range.
Further investigations are needed to uncover context-specific molecular requirements
for Delta endocytosis in vivo. These findings could then be correlated with the studied
biological context to generate a comprehensive map linking Delta endocytosis pathways with
the features of the Notch-dependent process (inductive signaling, fate specification, time
constraints, location of the signaling site).
7.2.2. Probing the forces generated by WASp-Arp2/3-dependent Delta
endocytosis
SOPs are presumably to best model to probe the range of pulling forces generated by WASp-
Arp2/3-dependent Delta endocytosis. In vitro, one would need to find cell lines where most, if
not all, Delta endocytoses are dependent on WASp-dependent Arp2/3 activity. Such research
might reveal to be highly time consuming. In SOPs, on the other hand, this requirement is
already fulfilled.
Experimentally, forces could be estimated using the strategy based on the
mechanosensitive vWF A2 domain and developed by Langridge and Struhl (Langridge and
Struhl, 2017). Concretely, synthetic pairs of receptor-ligand could be specifically expressed in
SOPs using the neurPGal4 SOP driver where: (1) Notch ECD would be replaced by a vWF
A2 domain fused to a motif recognizing the ligand synthetic ECD (for instance GFP/nano-
GFP, FSH/FSHR) and (2) Notch ICD would be tagged with a fluorescent protein to follow the
activity of the synthetic pair in pIIa. As several A2 domain variants exist with different force
requirements for activation, forces generated by WASp-Arp2/3-dependent (control
background) or independent (arp3 or WASp background) Delta endocytosis at cytokinesis
could be estimated, as well as their efficiency in triggering activation of the chimeric Notch
receptor. Results obtained in SOPs could finally be compared with values found during Epsin-
dependent Delta endocytosis in the wing disc.
Finally, this method could be applied in many different Notch-dependent processes
where signal-sending and signal-receiving cells are clearly identified. By doing so, one could
build a comprehensive map with context-specific force requirements and test in a wide range
of in vivo contexts the mechanotransduction model.
193
References
Abella, J.V.G., Galloni, C., Pernier, J., Barry, D.J., Kjær, S., Carlier, M.-F., and Way, M. (2016). Isoform diversity in the Arp2/3 complex determines actin filament dynamics. Nat. Cell Biol. 18, 76–86.
Acar, M., Jafar-Nejad, H., Takeuchi, H., Rajan, A., Ibrani, D., Rana, N.A., Pan, H., Haltiwanger, R.S., and Bellen, H.J. (2008). Rumi Is a CAP10 Domain Glycosyltransferase that Modifies Notch and Is Required for Notch Signaling. Cell 132, 247–258.
Adam, J., Myat, A., Le Roux, I., Eddison, M., Henrique, D., Ish-Horowicz, D., and Lewis, J. (1998). Cell fate choices and the expression of Notch, Delta and Serrate homologues in the chick inner ear: parallels with Drosophila sense-organ development. Dev. Camb. Engl. 125, 4645–4654.
del Álamo, D., Rouault, H., and Schweisguth, F. (2011). Mechanism and Significance of cis-Inhibition in Notch Signalling. Curr. Biol. 21, R40–R47.
Alekhina, O., Burstein, E., and Billadeau, D.D. (2017). Cellular functions of WASP family proteins at a glance. J. Cell Sci. 130, 2235–2241.
Almeida, M.S., and Bray, S.J. (2005). Regulation of post-embryonic neuroblasts by Drosophila Grainyhead. Mech. Dev. 122, 1282–1293.
Andersen, P., Uosaki, H., Shenje, L.T., and Kwon, C. (2012). Non-canonical Notch signaling: emerging role and mechanism. Trends Cell Biol. 22, 257–265.
Aulehla, A., Wiegraebe, W., Baubet, V., Wahl, M.B., Deng, C., Taketo, M., Lewandoski, M., and Pourquié, O. (2008). A β-catenin gradient links the clock and wavefront systems in mouse embryo segmentation. Nat. Cell Biol. 10, 186–193.
Bailey, A.M., and Posakony, J.W. (1995). Suppressor of hairless directly activates transcription of enhancer of split complex genes in response to Notch receptor activity. Genes Dev. 9, 2609–2622.
Baker, N.E., and Yu, S.-Y. (1997). Proneural function of neurogenic genes in the developing Drosophila eye. Curr. Biol. 7, 122–132.
Baker, N., Mlodzik, M., and Rubin, G. (1990). Spacing differentiation in the developing Drosophila eye: a fibrinogen-related lateral inhibitor encoded by scabrous. Science 250, 1370–1377.
Baker, N.E., Yu, S., and Han, D. (1996). Evolution of proneural atonal expression during distinct regulatory phases in the developing Drosophila eye. Curr. Biol. 6, 1290–1302.
Banda, E., McKinsey, A., Germain, N., Carter, J., Anderson, N.C., and Grabel, L. (2015). Cell Polarity and Neurogenesis in Embryonic Stem Cell-Derived Neural Rosettes. Stem Cells Dev. 24, 1022–1033.
References
194
Banerjee, J.J., Aerne, B.L., Holder, M.V., Hauri, S., Gstaiger, M., and Tapon, N. (2017). Meru couples planar cell polarity with apical-basal polarity during asymmetric cell division. ELife 6.
Barad, O., Rosin, D., Hornstein, E., and Barkai, N. (2010). Error Minimization in Lateral Inhibition Circuits. Sci. Signal. 3, ra51–ra51.
Basant, A., and Glotzer, M. (2018). Spatiotemporal Regulation of RhoA during Cytokinesis. Curr. Biol. 28, R570–R580.
Bellaïche, Y., Gho, M., Kaltschmidt, J.A., Brand, A.H., and Schweisguth, F. (2001). Frizzled regulates localization of cell-fate determinants and mitotic spindle rotation during asymmetric cell division. Nat. Cell Biol. 3, 50–57.
Bellaïche, Y., Beaudoin-Massiani, O., Stuttem, I., and Schweisguth, F. (2004). The planar cell polarity protein Strabismus promotes Pins anterior localization during asymmetric division of sensory organ precursor cells in Drosophila. Dev. Camb. Engl. 131, 469–478.
Bellaıche, Y., Radovic, A., Woods, D.F., Hough, C.D., Parmentier, M.-L., O’Kane, C.J., Bryant, P.J., and Schweisguth, F. (2001). The Partner of Inscuteable/Discs-Large Complex Is Required to Establish Planar Polarity during Asymmetric Cell Division in Drosophila. Cell 106, 355–366.
Benedito, R., Roca, C., Sörensen, I., Adams, S., Gossler, A., Fruttiger, M., and Adams, R.H. (2009). The Notch Ligands Dll4 and Jagged1 Have Opposing Effects on Angiogenesis. Cell 137, 1124–1135.
Benhra, N., Vignaux, F., Dussert, A., Schweisguth, F., and Le Borgne, R. (2010). Neuralized Promotes Basal to Apical Transcytosis of Delta in Epithelial Cells. Mol. Biol. Cell 21, 2078–2086.
Benhra, N., Lallet, S., Cotton, M., Le Bras, S., Dussert, A., and Le Borgne, R. (2011). AP-1 Controls the Trafficking of Notch and Sanpodo toward E-Cadherin Junctions in Sensory Organ Precursors. Curr. Biol. 21, 87–95.
Benjamin, J.M., Kwiatkowski, A.V., Yang, C., Korobova, F., Pokutta, S., Svitkina, T., Weis, W.I., and Nelson, W.J. (2010). αE-catenin regulates actin dynamics independently of cadherin-mediated cell–cell adhesion. J. Cell Biol. 189, 339–352.
Ben-Yaacov, S., Le Borgne, R., Abramson, I., Schweisguth, F., and Schejter, E.D. (2001). Wasp, the Drosophila Wiskott-Aldrich Syndrome Gene Homologue, Is Required for Cell Fate Decisions Mediated by Notch Signaling. J. Cell Biol. 152, 1–14.
Berndt, N., Seib, E., Kim, S., Troost, T., Lyga, M., Langenbach, J., Haensch, S., Kalodimou, K., Delidakis, C., and Klein, T. (2017). Ubiquitylation-independent activation of Notch signalling by Delta. ELife 6.
Berry, L.W., Westlund, B., and Schedl, T. (1997). Germ-line tumor formation caused by activation of glp-1, a Caenorhabditis elegans member of the Notch family of receptors. Dev. Camb. Engl. 124, 925–936.
References
195
Besson, C., Bernard, F., Corson, F., Rouault, H., Reynaud, E., Keder, A., Mazouni, K., and Schweisguth, F. (2015). Planar Cell Polarity Breaks the Symmetry of PAR Protein Distribution prior to Mitosis in Drosophila Sensory Organ Precursor Cells. Curr. Biol. CB 25, 1104–1110.
Binshtok, U., and Sprinzak, D. (2018). Modeling the Notch Response. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 79–98.
Blanchoin, L., Pollard, T.D., and Mullins, R.D. (2000). Interactions of ADF/cofilin, Arp2/3 complex, capping protein and profilin in remodeling of branched actin filament networks. Curr. Biol. CB 10, 1273–1282.
Bowman, S.K., Neumüller, R.A., Novatchkova, M., Du, Q., and Knoblich, J.A. (2006). The Drosophila NuMA Homolog Mud regulates spindle orientation in asymmetric cell division. Dev. Cell 10, 731–742.
Bowman, S.K., Rolland, V., Betschinger, J., Kinsey, K.A., Emery, G., and Knoblich, J.A. (2008). The Tumor Suppressors Brat and Numb Regulate Transit-Amplifying Neuroblast Lineages in Drosophila. Dev. Cell 14, 535–546.
Bozkulak, E.C., and Weinmaster, G. (2009). Selective Use of ADAM10 and ADAM17 in Activation of Notch1 Signaling. Mol. Cell. Biol. 29, 5679–5695.
Brand, M., Jarman, A.P., Jan, L.Y., and Jan, Y.N. (1993). asense is a Drosophila neural precursor gene and is capable of initiating sense organ formation. Dev. Camb. Engl. 119, 1–17.
Bray, S.J. (2016). Notch signalling in context. Nat. Rev. Mol. Cell Biol. 17, 722–735.
Bray, S., and Furriols, M. (2001). Notch pathway: Making sense of Suppressor of Hairless. Curr. Biol. 11, R217–R221.
Bray, S.J., and Gomez-Lamarca, M. (2018). Notch after cleavage. Curr. Opin. Cell Biol. 51, 103–109.
Brou, C., Logeat, F., Gupta, N., Bessia, C., LeBail, O., Doedens, J.R., Cumano, A., Roux, P., Black, R.A., and Israël, A. (2000). A Novel Proteolytic Cleavage Involved in Notch Signaling. Mol. Cell 5, 207–216.
Brückner, K., Perez, L., Clausen, H., and Cohen, S. (2000). Glycosyltransferase activity of Fringe modulates Notch–Delta interactions. Nature 406, 411–415.
Cabrera, C.V. (1990). Lateral inhibition and cell fate during neurogenesis in Drosophila: the interactions between scute, Notch and Delta. Dev. Camb. Engl. 110, 733–742.
Cagan, R.L., and Ready, D.F. (1989). Notch is required for successive cell decisions in the developing Drosophila retina. Genes Dev. 3, 1099–1112.
Cai, L., Holoweckyj, N., Schaller, M.D., and Bear, J.E. (2005). Phosphorylation of coronin 1B by protein kinase C regulates interaction with Arp2/3 and cell motility. J. Biol. Chem. 280, 31913–31923.
References
196
Cai, L., Makhov, A.M., Schafer, D.A., and Bear, J.E. (2008). Coronin 1B Antagonizes Cortactin and Remodels Arp2/3-Containing Actin Branches in Lamellipodia. Cell 134, 828–842.
Campellone, K.G., and Welch, M.D. (2010). A nucleator arms race: cellular control of actin assembly. Nat. Rev. Mol. Cell Biol. 11, 237–251.
Campellone, K.G., Webb, N.J., Znameroski, E.A., and Welch, M.D. (2008). WHAMM Is an Arp2/3 Complex Activator That Binds Microtubules and Functions in ER to Golgi Transport. Cell 134, 148–161.
Campos-Ortega, J.A. (1994). Cellular interactions in the developing nervous system of Drosophila. Cell 77, 969–975.
Caridi, C.P., D’Agostino, C., Ryu, T., Zapotoczny, G., Delabaere, L., Li, X., Khodaverdian, V.Y., Amaral, N., Lin, E., Rau, A.R., et al. (2018). Nuclear F-actin and myosins drive relocalization of heterochromatic breaks. Nature 559, 54–60.
Carrieri, F.A., and Dale, J.K. (2017). Turn It Down a Notch. Front. Cell Dev. Biol. 4.
Castro, B., Barolo, S., Bailey, A.M., and Posakony, J.W. (2005). Lateral inhibition in proneural clusters: cis-regulatory logic and default repression by Suppressor of Hairless. Dev. Camb. Engl. 132, 3333–3344.
Cave, J.W., Loh, F., Surpris, J.W., Xia, L., and Caudy, M.A. (2005). A DNA transcription code for cell-specific gene activation by notch signaling. Curr. Biol. CB 15, 94–104.
Cave, J.W., Xia, L., and Caudy, M. (2011). Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters. Mol. Cell. Biol. 31, 22–29.
Cavey, M., and Lecuit, T. (2009). Molecular Bases of Cell-Cell Junctions Stability and Dynamics. Cold Spring Harb. Perspect. Biol. 1, a002998–a002998.
de Celis, J.F., and Bray, S. (1997). Feed-back mechanisms affecting Notch activation at the dorsoventral boundary in the Drosophila wing. Dev. Camb. Engl. 124, 3241–3251.
Chastagner, P., Rubinstein, E., and Brou, C. (2017). Ligand-activated Notch undergoes DTX4-mediated ubiquitylation and bilateral endocytosis before ADAM10 processing. Sci. Signal. 10.
Chen, N., and Greenwald, I. (2004). The lateral signal for LIN-12/Notch in C. elegans vulval development comprises redundant secreted and transmembrane DSL proteins. Dev. Cell 6, 183–192.
Chen, B., Chou, H.-T., Brautigam, C.A., Xing, W., Yang, S., Henry, L., Doolittle, L.K., Walz, T., and Rosen, M.K. (2017). Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites. ELife 6.
Chen, H., Ko, G., Zatti, A., Di Giacomo, G., Liu, L., Raiteri, E., Perucco, E., Collesi, C., Min, W., Zeiss, C., et al. (2009). Embryonic arrest at midgestation and disruption of Notch
References
197
signaling produced by the absence of both epsin 1 and epsin 2 in mice. Proc. Natl. Acad. Sci. 106, 13838–13843.
Chen, J., Xu, N., Wang, C., Huang, P., Huang, H., Jin, Z., Yu, Z., Cai, T., Jiao, R., and Xi, R. (2018). Transient Scute activation via a self-stimulatory loop directs enteroendocrine cell pair specification from self-renewing intestinal stem cells. Nat. Cell Biol. 20, 152–161.
Chen, Z., Borek, D., Padrick, S.B., Gomez, T.S., Metlagel, Z., Ismail, A.M., Umetani, J., Billadeau, D.D., Otwinowski, Z., and Rosen, M.K. (2010). Structure and control of the actin regulatory WAVE complex. Nature 468, 533–538.
Chillakuri, C.R., Sheppard, D., Ilagan, M.X.G., Holt, L.R., Abbott, F., Liang, S., Kopan, R., Handford, P.A., and Lea, S.M. (2013). Structural Analysis Uncovers Lipid-Binding Properties of Notch Ligands. Cell Rep. 5, 861–867.
Chorev, D.S., Moscovitz, O., Geiger, B., and Sharon, M. (2014). Regulation of focal adhesion formation by a vinculin-Arp2/3 hybrid complex. Nat. Commun. 5.
Chou, F.-S., and Wang, P.-S. (2016). The Arp2/3 complex is essential at multiple stages of neural development. Neurogenesis 3, e1261653.
Chowdhury, F., Li, I.T.S., Ngo, T.T.M., Leslie, B.J., Kim, B.C., Sokoloski, J.E., Weiland, E., Wang, X., Chemla, Y.R., Lohman, T.M., et al. (2016). Defining Single Molecular Forces Required for Notch Activation Using Nano Yoyo. Nano Lett. 16, 3892–3897.
Cohen, M., Georgiou, M., Stevenson, N.L., Miodownik, M., and Baum, B. (2010). Dynamic Filopodia Transmit Intermittent Delta-Notch Signaling to Drive Pattern Refinement during Lateral Inhibition. Dev. Cell 19, 78–89.
Cordle, J., Johnson, S., Zi Yan Tay, J., Roversi, P., Wilkin, M.B., de Madrid, B.H., Shimizu, H., Jensen, S., Whiteman, P., Jin, B., et al. (2008). A conserved face of the Jagged/Serrate DSL domain is involved in Notch trans-activation and cis-inhibition. Nat. Struct. Mol. Biol. 15, 849–857.
Corson, F., Couturier, L., Rouault, H., Mazouni, K., and Schweisguth, F. (2017). Self-organized Notch dynamics generate stereotyped sensory organ patterns in Drosophila. Science 356.
Cotton, M., Benhra, N., and Le Borgne, R. (2013). Numb Inhibits the Recycling of Sanpodo in Drosophila Sensory Organ Precursor. Curr. Biol. 23, 581–587.
Coumailleau, F., Fürthauer, M., Knoblich, J.A., and González-Gaitán, M. (2009). Directional Delta and Notch trafficking in Sara endosomes during asymmetric cell division. Nature 458, 1051–1055.
Coutts, A.S., and La Thangue, N.B. (2015). Actin nucleation by WH2 domains at the autophagosome. Nat. Commun. 6.
Coutts, A.S., Weston, L., and La Thangue, N.B. (2009). A transcription co-factor integrates cell adhesion and motility with the p53 response. Proc. Natl. Acad. Sci. 106, 19872–19877.
References
198
Couturier, L., Vodovar, N., and Schweisguth, F. (2012). Endocytosis by Numb breaks Notch symmetry at cytokinesis. Nat. Cell Biol. 14, 131–139.
Couturier, L., Mazouni, K., and Schweisguth, F. (2013). Numb Localizes at Endosomes and Controls the Endosomal Sorting of Notch after Asymmetric Division in Drosophila. Curr. Biol. 23, 588–593.
Couturier, L., Trylinski, M., Mazouni, K., Darnet, L., and Schweisguth, F. (2014). A fluorescent tagging approach in Drosophila reveals late endosomal trafficking of Notch and Sanpodo. J. Cell Biol. 207, 351–363.
Cowan, C.R., and Hyman, A.A. (2004). Asymmetric cell division in C. elegans: cortical polarity and spindle positioning. Annu. Rev. Cell Dev. Biol. 20, 427–453.
Daeden, A., and Gonzalez-Gaitan, M. (2018). Endosomal Trafficking During Mitosis and Notch-Dependent Asymmetric Division. In Endocytosis and Signaling, C. Lamaze, and I. Prior, eds. (Cham: Springer International Publishing), pp. 301–329.
D’Amato, G., Luxán, G., and de la Pompa, J.L. (2016). Notch signalling in ventricular chamber development and cardiomyopathy. FEBS J. 283, 4223–4237.
Dang, I., Gorelik, R., Sousa-Blin, C., Derivery, E., Guérin, C., Linkner, J., Nemethova, M., Dumortier, J.G., Giger, F.A., Chipysheva, T.A., et al. (2013). Inhibitory signalling to the Arp2/3 complex steers cell migration. Nature 503, 281–284.
Daniel, E., Daudé, M., Kolotuev, I., Charish, K., Auld, V., and Le Borgne, R. (2018). Coordination of Septate Junctions Assembly and Completion of Cytokinesis in Proliferative Epithelial Tissues. Curr. Biol. 28, 1380-1391.e4.
Daskalaki, A., Shalaby, N.A., Kux, K., Tsoumpekos, G., Tsibidis, G.D., Muskavitch, M.A.T., and Delidakis, C. (2011). Distinct intracellular motifs of Delta mediate its ubiquitylation and activation by Mindbomb1 and Neuralized. J. Cell Biol. 195, 1017–1031.
De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J.S., Schroeter, E.H., Schrijvers, V., Wolfe, M.S., Ray, W.J., et al. (1999). A presenilin-1-dependent γ-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518–522.
Deblandre, G.A., Lai, E.C., and Kintner, C. (2001). Xenopus Neuralized Is a Ubiquitin Ligase that Interacts with XDelta1 and Regulates Notch Signaling. Dev. Cell 1, 795–806.
Del Signore, S.J., Cilla, R., and Hatini, V. (2018). The WAVE Regulatory Complex and Branched F-Actin Counterbalance Contractile Force to Control Cell Shape and Packing in the Drosophila Eye. Dev. Cell 44, 471-483.e4.
Derivery, E., Sousa, C., Gautier, J.J., Lombard, B., Loew, D., and Gautreau, A. (2009). The Arp2/3 Activator WASH Controls the Fission of Endosomes through a Large Multiprotein Complex. Dev. Cell 17, 712–723.
Derivery, E., Seum, C., Daeden, A., Loubéry, S., Holtzer, L., Jülicher, F., and Gonzalez-Gaitan, M. (2015). Polarized endosome dynamics by spindle asymmetry during asymmetric cell division. Nature 528, 280–285.
References
199
Dix, C.L., Matthews, H.K., Uroz, M., McLaren, S., Wolf, L., Heatley, N., Win, Z., Almada, P., Henriques, R., Boutros, M., et al. (2018). The Role of Mitotic Cell-Substrate Adhesion Re-modeling in Animal Cell Division. Dev. Cell 45, 132-145.e3.
Doe, C.Q., and Spana, E.P. (1995). A collection of cortical crescents: asymmetric protein localization in CNS precursor cells. Neuron 15, 991–995.
Dong, Z., Yang, N., Yeo, S.-Y., Chitnis, A., and Guo, S. (2012). Intralineage Directional Notch Signaling Regulates Self-Renewal and Differentiation of Asymmetrically Dividing Radial Glia. Neuron 74, 65–78.
Donnelly, S.K., Weisswange, I., Zettl, M., and Way, M. (2013). WIP Provides an Essential Link between Nck and N-WASP during Arp2/3-Dependent Actin Polymerization. Curr. Biol. 23, 999–1006.
Dornier, E., Coumailleau, F., Ottavi, J.-F., Moretti, J., Boucheix, C., Mauduit, P., Schweisguth, F., and Rubinstein, E. (2012). TspanC8 tetraspanins regulate ADAM10/Kuzbanian trafficking and promote Notch activation in flies and mammals. J. Cell Biol. 199, 481–496.
Dye, C.A., Lee, J.K., Atkinson, R.C., Brewster, R., Han, P.L., and Bellen, H.J. (1998). The Drosophila sanpodo gene controls sibling cell fate and encodes a tropomodulin homolog, an actin/tropomyosin-associated protein. Dev. Camb. Engl. 125, 1845–1856.
Eden, S., Rohatgi, R., Podtelejnikov, A.V., Mann, M., and Kirschner, M.W. (2002). Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature 418, 790–793.
Ehrlich, J.S., Hansen, M.D.H., and Nelson, W.J. (2002). Spatio-temporal regulation of Rac1 localization and lamellipodia dynamics during epithelial cell-cell adhesion. Dev. Cell 3, 259–270.
Elowitz, M.B., Santat, L.A., and Nandagopal, N. (2018). -activation in the Notch signaling pathway.
Emery, G., Hutterer, A., Berdnik, D., Mayer, B., Wirtz-Peitz, F., Gaitan, M.G., and Knoblich, J.A. (2005). Asymmetric Rab11 Endosomes Regulate Delta Recycling and Specify Cell Fate in the Drosophila Nervous System. Cell 122, 763–773.
Engl, W., Arasi, B., Yap, L.L., Thiery, J.P., and Viasnoff, V. (2014). Actin dynamics modulate mechanosensitive immobilization of E-cadherin at adherens junctions. Nat. Cell Biol. 16, 584–591.
Espinoza-Sanchez, S., Metskas, L.A., Chou, S.Z., Rhoades, E., and Pollard, T.D. (2018). Conformational changes in Arp2/3 complex induced by ATP, WASp-VCA, and actin filaments. Proc. Natl. Acad. Sci. 115, E8642–E8651.
Evans, I.R., Ghai, P.A., Urbančič, V., Tan, K.-L., and Wood, W. (2013). SCAR/WAVE-mediated processing of engulfed apoptotic corpses is essential for effective macrophage migration in Drosophila. Cell Death Differ. 20, 709–720.
References
200
Fang, J.S., Coon, B.G., Gillis, N., Chen, Z., Qiu, J., Chittenden, T.W., Burt, J.M., Schwartz, M.A., and Hirschi, K.K. (2017). Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification. Nat. Commun. 8.
Fehon, R.G., Kooh, P.J., Rebay, I., Regan, C.L., Xu, T., Muskavitch, M.A.T., and Artavanis-Tsakonas, S. (1990). Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell 61, 523–534.
Fichelson, P., and Gho, M. (2003). The glial cell undergoes apoptosis in the microchaete lineage of Drosophila. Dev. Camb. Engl. 130, 123–133.
Fischer, A., and Gessler, M. (2007). Delta Notch and then? Protein interactions and proposed modes of repression by Hes and Hey bHLH factors. Nucleic Acids Res. 35, 4583–4596.
Fleming, R.J., Gu, Y., and Hukriede, N.A. (1997). Serrate-mediated activation of Notch is specifically blocked by the product of the gene fringe in the dorsal compartment of the Drosophila wing imaginal disc. Dev. Camb. Engl. 124, 2973–2981.
Fostier, M., Evans, D.A., Artavanis-Tsakonas, S., and Baron, M. (1998). Genetic characterization of the Drosophila melanogaster Suppressor of deltex gene: A regulator of notch signaling. Genetics 150, 1477–1485.
Founounou, N., Loyer, N., and Le Borgne, R. (2013). Septins Regulate the Contractility of the Actomyosin Ring to Enable Adherens Junction Remodeling during Cytokinesis of Epithelial Cells. Dev. Cell 24, 242–255.
Frankfort, B.J., and Mardon, G. (2002). R8 development in the Drosophila eye: a paradigm for neural selection and differentiation. Dev. Camb. Engl. 129, 1295–1306.
Frémont, S., and Echard, A. (2018). Membrane Traffic in the Late Steps of Cytokinesis. Curr. Biol. 28, R458–R470.
Fricke, R., Gohl, C., Dharmalingam, E., Grevelhörster, A., Zahedi, B., Harden, N., Kessels, M., Qualmann, B., and Bogdan, S. (2009). Drosophila Cip4/Toca-1 Integrates Membrane Trafficking and Actin Dynamics through WASP and SCAR/WAVE. Curr. Biol. 19, 1429–1437.
Furriols, M., and Bray, S. (2001). A model Notch response element detects Suppressor of Hairless-dependent molecular switch. Curr. Biol. CB 11, 60–64.
Gandhi, M., Smith, B.A., Bovellan, M., Paavilainen, V., Daugherty-Clarke, K., Gelles, J., Lappalainen, P., and Goode, B.L. (2010). GMF Is a Cofilin Homolog that Binds Arp2/3 Complex to Stimulate Filament Debranching and Inhibit Actin Nucleation. Curr. Biol. 20, 861–867.
Gautier, J.J., Lomakina, M.E., Bouslama-Oueghlani, L., Derivery, E., Beilinson, H., Faigle, W., Loew, D., Louvard, D., Echard, A., Alexandrova, A.Y., et al. (2011). Clathrin is required for Scar/Wave-mediated lamellipodium formation. J. Cell Sci. 124, 3414–3427.
Gazave, E., Lapébie, P., Richards, G.S., Brunet, F., Ereskovsky, A.V., Degnan, B.M., Borchiellini, C., Vervoort, M., and Renard, E. (2009). Origin and evolution of the Notch signalling pathway: an overview from eukaryotic genomes. BMC Evol. Biol. 9, 249.
References
201
Gazave, E., Lemaître, Q.I.B., and Balavoine, G. (2017). The Notch pathway in the annelid Platynereis : insights into chaetogenesis and neurogenesis processes. Open Biol. 7, 160242.
Georgiou, M., and Baum, B. (2010). Polarity proteins and Rho GTPases cooperate to spatially organise epithelial actin-based protrusions. J. Cell Sci. 123, 1089–1098.
Georgiou, M., Marinari, E., Burden, J., and Baum, B. (2008). Cdc42, Par6, and aPKC Regulate Arp2/3-Mediated Endocytosis to Control Local Adherens Junction Stability. Curr. Biol. 18, 1631–1638.
Gho, M., Bellaïche, Y., and Schweisguth, F. (1999). Revisiting the Drosophila microchaete lineage: a novel intrinsically asymmetric cell division generates a glial cell. Dev. Camb. Engl. 126, 3573–3584.
Giagtzoglou, N., Li, T., Yamamoto, S., and Bellen, H.J. (2013). Drosophila EHBP1 regulates Scabrous secretion during Notch-mediated lateral inhibition. J. Cell Sci. 126, 3686–3696.
Glittenberg, M., Pitsouli, C., Garvey, C., Delidakis, C., and Bray, S. (2006). Role of conserved intracellular motifs in Serrate signalling, cis-inhibition and endocytosis. EMBO J. 25, 4697–4706.
Glotzer, M. (2017). Cytokinesis in Metazoa and Fungi. Cold Spring Harb. Perspect. Biol. 9, a022343.
Go, M.J., and Artavanis-Tsakonas, S. (1998). A genetic screen for novel components of the notch signaling pathway during Drosophila bristle development. Genetics 150, 211–220.
Gohl, C., Banovic, D., Grevelhörster, A., and Bogdan, S. (2010). WAVE Forms Hetero- and Homo-oligomeric Complexes at Integrin Junctions in Drosophila Visualized by Bimolecular Fluorescence Complementation. J. Biol. Chem. 285, 40171–40179.
Goley, E.D., and Welch, M.D. (2006). The ARP2/3 complex: an actin nucleator comes of age. Nat. Rev. Mol. Cell Biol. 7, 713–726.
Gomez, T.S., and Billadeau, D.D. (2009). A FAM21-Containing WASH Complex Regulates Retromer-Dependent Sorting. Dev. Cell 17, 699–711.
Gomez-Lamarca, M.J., Snowdon, L.A., Seib, E., Klein, T., and Bray, S.J. (2015). Rme-8 depletion perturbs Notch recycling and predisposes to pathogenic signaling. J. Cell Biol. 210, 303–318.
Gomez-Lamarca, M.J., Falo-Sanjuan, J., Stojnic, R., Abdul Rehman, S., Muresan, L., Jones, M.L., Pillidge, Z., Cerda-Moya, G., Yuan, Z., Baloul, S., et al. (2018). Activation of the Notch Signaling Pathway In Vivo Elicits Changes in CSL Nuclear Dynamics. Dev. Cell.
Gómez-Skarmeta, J.L., Campuzano, S., and Modolell, J. (2003). Half a century of neural prepatterning: the story of a few bristles and many genes. Nat. Rev. Neurosci. 4, 587–598.
Gordon, W.R., Vardar-Ulu, D., Histen, G., Sanchez-Irizarry, C., Aster, J.C., and Blacklow, S.C. (2007). Structural basis for autoinhibition of Notch. Nat. Struct. Mol. Biol. 14, 295–300.
References
202
Gordon, W.R., Arnett, K.L., and Blacklow, S.C. (2008). The molecular logic of Notch signaling - a structural and biochemical perspective. J. Cell Sci. 121, 3109–3119.
Gordon, W.R., Vardar-Ulu, D., L’Heureux, S., Ashworth, T., Malecki, M.J., Sanchez-Irizarry, C., McArthur, D.G., Histen, G., Mitchell, J.L., Aster, J.C., et al. (2009a). Effects of S1 Cleavage on the Structure, Surface Export, and Signaling Activity of Human Notch1 and Notch2. PLoS ONE 4, e6613.
Gordon, W.R., Roy, M., Vardar-Ulu, D., Garfinkel, M., Mansour, M.R., Aster, J.C., and Blacklow, S.C. (2009b). Structure of the Notch1-negative regulatory region: implications for normal activation and pathogenic signaling in T-ALL. Blood 113, 4381–4390.
Gordon, W.R., Zimmerman, B., He, L., Miles, L.J., Huang, J., Tiyanont, K., McArthur, D.G., Aster, J.C., Perrimon, N., Loparo, J.J., et al. (2015). Mechanical Allostery: Evidence for a Force Requirement in the Proteolytic Activation of Notch. Dev. Cell 33, 729–736.
Gournier, H., Goley, E.D., Niederstrasser, H., Trinh, T., and Welch, M.D. (2001). Reconstitution of human Arp2/3 complex reveals critical roles of individual subunits in complex structure and activity. Mol. Cell 8, 1041–1052.
Groot, A.J., and Vooijs, M.A. (2012). The Role of Adams in Notch Signaling. In Notch Signaling in Embryology and Cancer, J. Reichrath, and S. Reichrath, eds. (New York, NY: Springer US), pp. 15–36.
Gu, Y., Hukriede, N.A., and Fleming, R.J. (1995). Serrate expression can functionally replace Delta activity during neuroblast segregation in the Drosophila embryo. Dev. Camb. Engl. 121, 855–865.
Gulino, A., Di Marcotullio, L., and Screpanti, I. (2010). The multiple functions of Numb. Exp. Cell Res. 316, 900–906.
Guo, B., McMillan, B.J., and Blacklow, S.C. (2016). Structure and function of the Mind bomb E3 ligase in the context of Notch signal transduction. Curr. Opin. Struct. Biol. 41, 38–45.
Guo, M., Jan, L.Y., and Jan, Y.N. (1996). Control of Daughter Cell Fates during Asymmetric Division: Interaction of Numb and Notch. Neuron 17, 27–41.
Haining, E.J., Yang, J., Bailey, R.L., Khan, K., Collier, R., Tsai, S., Watson, S.P., Frampton, J., Garcia, P., and Tomlinson, M.G. (2012). The TspanC8 subgroup of tetraspanins interacts with A disintegrin and metalloprotease 10 (ADAM10) and regulates its maturation and cell surface expression. J. Biol. Chem. 287, 39753–39765.
Hambleton, S., Valeyev, N.V., Muranyi, A., Knott, V., Werner, J.M., McMichael, A.J., Handford, P.A., and Downing, A.K. (2004). Structural and Functional Properties of the Human Notch-1 Ligand Binding Region. Structure 12, 2173–2183.
Hamel, S., Fantini, J., and Schweisguth, F. (2010). Notch ligand activity is modulated by glycosphingolipid membrane composition in Drosophila melanogaster. J. Cell Biol. 188, 581–594.
References
203
Han, Z., and Bodmer, R. (2003). Myogenic cells fates are antagonized by Notch only in asymmetric lineages of the Drosophila heart, with or without cell division. Dev. Camb. Engl. 130, 3039–3051.
Hansen, S.D., Kwiatkowski, A.V., Ouyang, C.-Y., Liu, H., Pokutta, S., Watkins, S.C., Volkmann, N., Hanein, D., Weis, W.I., Mullins, R.D., et al. (2013). αE-catenin actin-binding domain alters actin filament conformation and regulates binding of nucleation and disassembly factors. Mol. Biol. Cell 24, 3710–3720.
Hansson, E.M., Lanner, F., Das, D., Mutvei, A., Marklund, U., Ericson, J., Farnebo, F., Stumm, G., Stenmark, H., Andersson, E.R., et al. (2010). Control of Notch-ligand endocytosis by ligand-receptor interaction. J. Cell Sci. 123, 2931–2942.
Hao, Y.-H., Doyle, J.M., Ramanathan, S., Gomez, T.S., Jia, D., Xu, M., Chen, Z.J., Billadeau, D.D., Rosen, M.K., and Potts, P.R. (2013). Regulation of WASH-Dependent Actin Polymerization and Protein Trafficking by Ubiquitination. Cell 152, 1051–1064.
Harmansa, S., Alborelli, I., Bieli, D., Caussinus, E., and Affolter, M. (2017). A nanobody-based toolset to investigate the role of protein localization and dispersal in Drosophila. ELife 6.
Hartenstein, V., and Posakony, J.W. (1989). Development of adult sensilla on the wing and notum of Drosophila melanogaster. Dev. Camb. Engl. 107, 389–405.
Hartenstein, V., and Posakony, J.W. (1990). A dual function of the Notch gene in Drosophila sensillum development. Dev. Biol. 142, 13–30.
Hartenstein, V., and Wodarz, A. (2013). Initial neurogenesis in Drosophila: Neurogenesis in Drosophila. Wiley Interdiscip. Rev. Dev. Biol. 2, 701–721.
Harvey, B.M., and Haltiwanger, R.S. (2018). Regulation of Notch Function by O-Glycosylation. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 59–78.
Harvey, B.M., Rana, N.A., Moss, H., Leonardi, J., Jafar-Nejad, H., and Haltiwanger, R.S. (2016). Mapping Sites of O -Glycosylation and Fringe Elongation on Drosophila Notch. J. Biol. Chem. 291, 16348–16360.
Hass, M.R., Liow, H., Chen, X., Sharma, A., Inoue, Y.U., Inoue, T., Reeb, A., Martens, A., Fulbright, M., Raju, S., et al. (2015). SpDamID: Marking DNA Bound by Protein Complexes Identifies Notch-Dimer Responsive Enhancers. Mol. Cell 59, 685–697.
Heitzler, P., and Simpson, P. (1991). The choice of cell fate in the epidermis of Drosophila. Cell 64, 1083–1092.
Helgeson, L.A., and Nolen, B.J. (2013). Mechanism of synergistic activation of Arp2/3 complex by cortactin and N-WASP. ELife 2.
Helwani, F.M., Kovacs, E.M., Paterson, A.D., Verma, S., Ali, R.G., Fanning, A.S., Weed, S.A., and Yap, A.S. (2004). Cortactin is necessary for E-cadherin-mediated contact formation and actin reorganization. J. Cell Biol. 164, 899–910.
References
204
Herszterg, S., Leibfried, A., Bosveld, F., Martin, C., and Bellaiche, Y. (2013). Interplay between the Dividing Cell and Its Neighbors Regulates Adherens Junction Formation during Cytokinesis in Epithelial Tissue. Dev. Cell 24, 256–270.
Herszterg, S., Pinheiro, D., and Bellaïche, Y. (2014). A multicellular view of cytokinesis in epithelial tissue. Trends Cell Biol. 24, 285–293.
Ho, D.M., Guruharsha, K.G., and Artavanis-Tsakonas, S. (2018). The Notch Interactome: Complexity in Signaling Circuitry. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 125–140.
Ho, H.-Y.H., Rohatgi, R., Lebensohn, A.M., Le Ma, null, Li, J., Gygi, S.P., and Kirschner, M.W. (2004). Toca-1 mediates Cdc42-dependent actin nucleation by activating the N-WASP-WIP complex. Cell 118, 203–216.
Homem, C.C.F., Repic, M., and Knoblich, J.A. (2015). Proliferation control in neural stem and progenitor cells. Nat. Rev. Neurosci. 16, 647–659.
Hori, K., Fostier, M., Ito, M., Fuwa, T.J., Go, M.J., Okano, H., Baron, M., and Matsuno, K. (2004). Drosophila deltex mediates suppressor of Hairless-independent and late-endosomal activation of Notch signaling. Dev. Camb. Engl. 131, 5527–5537.
Hori, K., Sen, A., Kirchhausen, T., and Artavanis-Tsakonas, S. (2011). Synergy between the ESCRT-III complex and Deltex defines a ligand-independent Notch signal. J. Cell Biol. 195, 1005–1015.
Housden, B.E., and Perrimon, N. (2014). Spatial and temporal organization of signaling pathways. Trends Biochem. Sci. 39, 457–464.
Housden, B.E., Fu, A.Q., Krejci, A., Bernard, F., Fischer, B., Tavaré, S., Russell, S., and Bray, S.J. (2013). Transcriptional Dynamics Elicited by a Short Pulse of Notch Activation Involves Feed-Forward Regulation by E(spl)/Hes Genes. PLoS Genet. 9, e1003162.
Huang, H., and Kornberg, T.B. (2015). Myoblast cytonemes mediate Wg signaling from the wing imaginal disc and Delta-Notch signaling to the air sac primordium. ELife 4.
Huenniger, K., Krämer, A., Soom, M., Chang, I., Köhler, M., Depping, R., Kehlenbach, R.H., and Kaether, C. (2010). Notch1 signaling is mediated by importins alpha 3, 4, and 7. Cell. Mol. Life Sci. 67, 3187–3196.
Hunter, G.L., Hadjivasiliou, Z., Bonin, H., He, L., Perrimon, N., Charras, G., and Baum, B. (2016). Coordinated control of Notch/Delta signalling and cell cycle progression drives lateral inhibition-mediated tissue patterning. Development 143, 2305–2310.
Hutterer, A., and Knoblich, J.A. (2005). Numb and α-Adaptin regulate Sanpodo endocytosis to specify cell fate in Drosophila external sensory organs. EMBO Rep. 6, 836–842.
Imayoshi, I., Shimojo, H., Sakamoto, M., Ohtsuka, T., and Kageyama, R. (2013). Genetic visualization of notch signaling in mammalian neurogenesis. Cell. Mol. Life Sci. 70, 2045–2057.
References
205
Innocenti, M., Gerboth, S., Rottner, K., Lai, F.P.L., Hertzog, M., Stradal, T.E.B., Frittoli, E., Didry, D., Polo, S., Disanza, A., et al. (2005). Abi1 regulates the activity of N-WASP and WAVE in distinct actin-based processes. Nat. Cell Biol. 7, 969–976.
Ismail, A.M., Padrick, S.B., Chen, B., Umetani, J., and Rosen, M.K. (2009). The WAVE regulatory complex is inhibited. Nat. Struct. Mol. Biol. 16, 561–563.
Itoh, M., Kim, C.-H., Palardy, G., Oda, T., Jiang, Y.-J., Maust, D., Yeo, S.-Y., Lorick, K., Wright, G.J., Ariza-McNaughton, L., et al. (2003). Mind Bomb Is a Ubiquitin Ligase that Is Essential for Efficient Activation of Notch Signaling by Delta. Dev. Cell 4, 67–82.
Jafar-Nejad, H., Andrews, H.K., Acar, M., Bayat, V., Wirtz-Peitz, F., Mehta, S.Q., Knoblich, J.A., and Bellen, H.J. (2005). Sec15, a component of the exocyst, promotes notch signaling during the asymmetric division of Drosophila sensory organ precursors. Dev. Cell 9, 351–363.
Jain, N., Lim, L.W., Tan, W.T., George, B., Makeyev, E., and Thanabalu, T. (2014). Conditional N-WASP knockout in mouse brain implicates actin cytoskeleton regulation in hydrocephalus pathology. Exp. Neurol. 254, 29–40.
Jarman, A.P., Brand, M., Jan, L.Y., and Jan, Y.N. (1993). The regulation and function of the helix-loop-helix gene, asense, in Drosophila neural precursors. Dev. Camb. Engl. 119, 19–29.
Jarman, A.P., Grell, E.H., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1994). atonal is the proneural gene for Drosophila photoreceptors. Nature 369, 398–400.
Jarman, A.P., Sun, Y., Jan, L.Y., and Jan, Y.N. (1995). Role of the proneural gene, atonal, in formation of Drosophila chordotonal organs and photoreceptors. Dev. Camb. Engl. 121, 2019–2030.
Jia, D., Gomez, T.S., Metlagel, Z., Umetani, J., Otwinowski, Z., Rosen, M.K., and Billadeau, D.D. (2010). WASH and WAVE actin regulators of the Wiskott-Aldrich syndrome protein (WASP) family are controlled by analogous structurally related complexes. Proc. Natl. Acad. Sci. 107, 10442–10447.
Johnston, C.A., Manning, L., Lu, M.S., Golub, O., Doe, C.Q., and Prehoda, K.E. (2013). Formin-mediated actin polymerization cooperates with Mushroom body defect (Mud)-Dynein during Frizzled-Dishevelled spindle orientation. J. Cell Sci. 126, 4436–4444.
de Joussineau, C., Soulé, J., Martin, M., Anguille, C., Montcourrier, P., and Alexandre, D. (2003). Delta-promoted filopodia mediate long-range lateral inhibition in Drosophila. Nature 426, 555–559.
Kaksonen, M., and Roux, A. (2018). Mechanisms of clathrin-mediated endocytosis. Nat. Rev. Mol. Cell Biol. 19, 313–326.
Kakuda, S., and Haltiwanger, R.S. (2017). Deciphering the Fringe-Mediated Notch Code: Identification of Activating and Inhibiting Sites Allowing Discrimination between Ligands. Dev. Cell 40, 193–201.
References
206
Kapus, A., and Janmey, P. (2013). Plasma Membrane-Cortical Cytoskeleton Interactions: A Cell Biology Approach with Biophysical Considerations. In Comprehensive Physiology, R. Terjung, ed. (Hoboken, NJ, USA: John Wiley & Sons, Inc.), p.
Kast, D.J., Zajac, A.L., Holzbaur, E.L.F., Ostap, E.M., and Dominguez, R. (2015). WHAMM Directs the Arp2/3 Complex to the ER for Autophagosome Biogenesis through an Actin Comet Tail Mechanism. Curr. Biol. 25, 1791–1797.
Kershaw, N.J., Church, N.L., Griffin, M.D.W., Luo, C.S., Adams, T.E., and Burgess, A.W. (2015). Notch ligand delta-like1: X-ray crystal structure and binding affinity. Biochem. J. 468, 159–166.
Khait, I., Orsher, Y., Golan, O., Binshtok, U., Gordon-Bar, N., Amir-Zilberstein, L., and Sprinzak, D. (2016). Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Rep. 14, 225–233.
Khmelinskii, A., Keller, P.J., Bartosik, A., Meurer, M., Barry, J.D., Mardin, B.R., Kaufmann, A., Trautmann, S., Wachsmuth, M., Pereira, G., et al. (2012). Tandem fluorescent protein timers for in vivo analysis of protein dynamics. Nat. Biotechnol. 30, 708–714.
Kidd, S., and Lieber, T. (2002). Furin cleavage is not a requirement for Drosophila Notch function. Mech. Dev. 115, 41–51.
Kim, A.S., Kakalis, L.T., Abdul-Manan, N., Liu, G.A., and Rosen, M.K. (2000). Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature 404, 151–158.
King, J.S., Veltman, D.M., Georgiou, M., Baum, B., and Insall, R.H. (2010). SCAR/WAVE is activated at mitosis and drives myosin-independent cytokinesis. J. Cell Sci. 123, 2246–2255.
Kitt, K.N., and Nelson, W.J. (2011). Rapid Suppression of Activated Rac1 by Cadherins and Nectins during De Novo Cell-Cell Adhesion. PLoS ONE 6, e17841.
Kiyota, T., Jono, H., Kuriyama, S., Hasegawa, K., Miyatani, S., and Kinoshita, T. (2001). X-Serrate-1 is involved in primary neurogenesis in Xenopus laevis in a complementary manner with X-Delta-1. Dev. Genes Evol. 211, 367–376.
Klueg, K.M., and Muskavitch, M.A. (1999). Ligand-receptor interactions and trans-endocytosis of Delta, Serrate and Notch: members of the Notch signalling pathway in Drosophila. J. Cell Sci. 112 ( Pt 19), 3289–3297.
Knoblich, J.A. (2008). Mechanisms of Asymmetric Stem Cell Division. Cell 132, 583–597.
Knoblich, J.A., Jan, L.Y., and Jan, Y.N. (1997). The N terminus of the Drosophila Numb protein directs membrane association and actin-dependent asymmetric localization. Proc. Natl. Acad. Sci. U. S. A. 94, 13005–13010.
Kolodziejczyk, A.A., Kim, J.K., Svensson, V., Marioni, J.C., and Teichmann, S.A. (2015). The Technology and Biology of Single-Cell RNA Sequencing. Mol. Cell 58, 610–620.
References
207
Koo, B.-K., Lim, H.-S., Song, R., Yoon, M.-J., Yoon, K.-J., Moon, J.-S., Kim, Y.-W., Kwon, M.-C., Yoo, K.-W., Kong, M.-P., et al. (2005a). Mind bomb 1 is essential for generating functional Notch ligands to activate Notch. Dev. Camb. Engl. 132, 3459–3470.
Koo, B.-K., Yoon, K.-J., Yoo, K.-W., Lim, H.-S., Song, R., So, J.-H., Kim, C.-H., and Kong, Y.-Y. (2005b). Mind bomb-2 is an E3 ligase for Notch ligand. J. Biol. Chem. 280, 22335–22342.
Koo, B.-K., Yoon, M.-J., Yoon, K.-J., Im, S.-K., Kim, Y.-Y., Kim, C.-H., Suh, P.-G., Jan, Y.N., and Kong, Y.-Y. (2007). An Obligatory Role of Mind Bomb-1 in Notch Signaling of Mammalian Development. PLoS ONE 2, e1221.
Kopan, R., and Ilagan, M.X.G. (2009). The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell 137, 216–233.
Kopan, R., Schroeter, E.H., Weintraub, H., and Nye, J.S. (1996). Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc. Natl. Acad. Sci. 93, 1683–1688.
Kovacs, E.M., Goodwin, M., Ali, R.G., Paterson, A.D., and Yap, A.S. (2002). Cadherin-directed actin assembly: E-cadherin physically associates with the Arp2/3 complex to direct actin assembly in nascent adhesive contacts. Curr. Biol. CB 12, 379–382.
Kovall, R.A., Gebelein, B., Sprinzak, D., and Kopan, R. (2017). The Canonical Notch Signaling Pathway: Structural and Biochemical Insights into Shape, Sugar, and Force. Dev. Cell 41, 228–241.
Krejci, A., Bernard, F., Housden, B.E., Collins, S., and Bray, S.J. (2009). Direct Response to Notch Activation: Signaling Crosstalk and Incoherent Logic. Sci. Signal. 2, ra1–ra1.
Kressmann, S., Campos, C., Castanon, I., Fürthauer, M., and González-Gaitán, M. (2015). Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. Nat. Cell Biol. 17, 333–339.
Kühbacher, A., Emmenlauer, M., Rämo, P., Kafai, N., Dehio, C., Cossart, P., and Pizarro-Cerdá, J. (2015). Genome-Wide siRNA Screen Identifies Complementary Signaling Pathways Involved in Listeria Infection and Reveals Different Actin Nucleation Mechanisms during Listeria Cell Invasion and Actin Comet Tail Formation. MBio 6.
Kumar, J.P. (2012). Building an ommatidium one cell at a time: Ommatidial Assembly in Drosophila. Dev. Dyn. 241, 136–149.
Lai, E.C., and Orgogozo, V. (2004). A hidden program in Drosophila peripheral neurogenesis revealed: fundamental principles underlying sensory organ diversity. Dev. Biol. 269, 1–17.
Lai, E.C., Deblandre, G.A., Kintner, C., and Rubin, G.M. (2001). Drosophila Neuralized Is a Ubiquitin Ligase that Promotes the Internalization and Degradation of Delta. Dev. Cell 1, 783–794.
Lai, E.C., Roegiers, F., Qin, X., Jan, Y.N., and Rubin, G.M. (2005a). The ubiquitin ligase Drosophila Mind bomb promotes Notch signaling by regulating the localization and activity of Serrate and Delta. Dev. Camb. Engl. 132, 2319–2332.
References
208
Lai, E.C., Roegiers, F., Qin, X., Jan, Y.N., and Rubin, G.M. (2005b). The ubiquitin ligase Drosophila Mind bomb promotes Notch signaling by regulating the localization and activity of Serrate and Delta. Dev. Camb. Engl. 132, 2319–2332.
Lake, R.J., Grimm, L.M., Veraksa, A., Banos, A., and Artavanis-Tsakonas, S. (2009). In Vivo Analysis of the Notch Receptor S1 Cleavage. PLoS ONE 4, e6728.
Lammich, S., Kojro, E., Postina, R., Gilbert, S., Pfeiffer, R., Jasionowski, M., Haass, C., and Fahrenholz, F. (1999). Constitutive and regulated alpha-secretase cleavage of Alzheimer’s amyloid precursor protein by a disintegrin metalloprotease. Proc. Natl. Acad. Sci. U. S. A. 96, 3922–3927.
Langridge, P.D., and Struhl, G. (2017). Epsin-Dependent Ligand Endocytosis Activates Notch by Force. Cell 171, 1383-1396.e12.
Le Borgne, R., and Schweisguth, F. (2003). Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev. Cell 5, 139–148.
Le Borgne, R., Remaud, S., Hamel, S., and Schweisguth, F. (2005). Two Distinct E3 Ubiquitin Ligases Have Complementary Functions in the Regulation of Delta and Serrate Signaling in Drosophila. PLoS Biol. 3, e96.
Le Bras, S., Loyer, N., and Le Borgne, R. (2011). The Multiple Facets of Ubiquitination in the Regulation of Notch Signaling Pathway. Traffic 12, 149–161.
Le Bras, S., Rondanino, C., Kriegel-Taki, G., Dussert, A., and Le Borgne, R. (2012). Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division. J. Cell Sci. 125, 4886–4901.
Lebensohn, A.M., and Kirschner, M.W. (2009). Activation of the WAVE complex by coincident signals controls actin assembly. Mol. Cell 36, 512–524.
LeBon, L., Lee, T.V., Sprinzak, D., Jafar-Nejad, H., and Elowitz, M.B. (2014). Fringe proteins modulate Notch-ligand cis and trans interactions to specify signaling states. ELife 3.
Lecourtois, M., and Schweisguth, F. (1998). Indirect evidence for Delta-dependent intracellular processing of Notch in Drosophila embryos. Curr. Biol. 8, 771–775.
Lee, E.C., Yu, S.Y., and Baker, N.E. (2000). The scabrous protein can act as an extracellular antagonist of notch signaling in the Drosophila wing. Curr. Biol. CB 10, 931–934.
Lee, T.V., Sethi, M.K., Leonardi, J., Rana, N.A., Buettner, F.F.R., Haltiwanger, R.S., Bakker, H., and Jafar-Nejad, H. (2013). Negative Regulation of Notch Signaling by Xylose. PLoS Genet. 9, e1003547.
Legent, K., Steinhauer, J., Richard, M., and Treisman, J.E. (2012). A Screen for X-Linked Mutations Affecting Drosophila Photoreceptor Differentiation Identifies Casein Kinase 1α as an Essential Negative Regulator of Wingless Signaling. Genetics 190, 601–616.
Lehmann, R., Dietrich, U., Jim�nez, F., and Campos-Ortega, J.A. (1981). Mutations of early neurogenesis inDrosophila. Wilhelm Rouxs Arch. Dev. Biol. 190, 226–229.
References
209
Lehmann, R., Jim�nez, F., Dietrich, U., and Campos-Ortega, J.A. (1983). On the phenotype and development of mutants of early neurogenesis inDrosophila melanogaster. Wilhelm Rouxs Arch. Dev. Biol. 192, 62–74.
Leibfried, A., Fricke, R., Morgan, M.J., Bogdan, S., and Bellaiche, Y. (2008). Drosophila Cip4 and WASp Define a Branch of the Cdc42-Par6-aPKC Pathway Regulating E-Cadherin Endocytosis. Curr. Biol. 18, 1639–1648.
Leitch, C.C., Lodh, S., Prieto-Echague, V., Badano, J.L., and Zaghloul, N.A. (2014). Basal body proteins regulate Notch signaling through endosomal trafficking. J. Cell Sci. 127, 2407–2419.
Lekomtsev, S., Su, K.-C., Pye, V.E., Blight, K., Sundaramoorthy, S., Takaki, T., Collinson, L.M., Cherepanov, P., Divecha, N., and Petronczki, M. (2012). Centralspindlin links the mitotic spindle to the plasma membrane during cytokinesis. Nature 492, 276–279.
Leung, D.W., and Rosen, M.K. (2005). The nucleotide switch in Cdc42 modulates coupling between the GTPase-binding and allosteric equilibria of Wiskott-Aldrich syndrome protein. Proc. Natl. Acad. Sci. U. S. A. 102, 5685–5690.
Lewellyn, E.B., Pedersen, R.T.A., Hong, J., Lu, R., Morrison, H.M., and Drubin, D.G. (2015). An Engineered Minimal WASP-Myosin Fusion Protein Reveals Essential Functions for Endocytosis. Dev. Cell 35, 281–294.
Li, Y., and Baker, N.E. (2001). Proneural enhancement by Notch overcomes Suppressor-of-Hairless repressor function in the developing Drosophila eye. Curr. Biol. CB 11, 330–338.
Li, H., Koo, Y., Mao, X., Sifuentes-Dominguez, L., Morris, L.L., Jia, D., Miyata, N., Faulkner, R.A., van Deursen, J.M., Vooijs, M., et al. (2015). Endosomal sorting of Notch receptors through COMMD9-dependent pathways modulates Notch signaling. J. Cell Biol. 211, 605–617.
Li, X., Erclik, T., Bertet, C., Chen, Z., Voutev, R., Venkatesh, S., Morante, J., Celik, A., and Desplan, C. (2013). Temporal patterning of Drosophila medulla neuroblasts controls neural fates. Nature 498, 456–462.
Li, Y., Fetchko, M., Lai, Z.-C., and Baker, N.E. (2003). Scabrous and Gp150 are endosomal proteins that regulate Notch activity. Dev. Camb. Engl. 130, 2819–2827.
Liebau, S., Steinestel, J., Linta, L., Kleger, A., Storch, A., Schoen, M., Steinestel, K., Proepper, C., Bockmann, J., Schmeisser, M.J., et al. (2011). An SK3 Channel/nWASP/Abi-1 Complex Is Involved in Early Neurogenesis. PLoS ONE 6, e18148.
Lieber, T., Kidd, S., and Young, M.W. (2002). kuzbanian-mediated cleavage of Drosophila Notch. Genes Dev. 16, 209–221.
Ligoxygakis, P., Yu, S.Y., Delidakis, C., and Baker, N.E. (1998). A subset of notch functions during Drosophila eye development require Su(H) and the E(spl) gene complex. Dev. Camb. Engl. 125, 2893–2900.
Liu, S., and Boulianne, G.L. (2017). The NHR domains of Neuralized and related proteins: Beyond Notch signalling. Cell. Signal. 29, 62–68.
References
210
Liu, R., Abreu-Blanco, M.T., Barry, K.C., Linardopoulou, E.V., Osborn, G.E., and Parkhurst, S.M. (2009). Wash functions downstream of Rho and links linear and branched actin nucleation factors. Development 136, 2849–2860.
Liu, T., Dai, A., Cao, Y., Zhang, R., Dong, M.-Q., and Wang, H.-W. (2017). Structural Insights of WHAMM’s Interaction with Microtubules by Cryo-EM. J. Mol. Biol. 429, 1352–1363.
Logeat, F., Bessia, C., Brou, C., LeBail, O., Jarriault, S., Seidah, N.G., and Israel, A. (1998). The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proc. Natl. Acad. Sci. 95, 8108–8112.
Loria, A., Longhini, K.M., and Glotzer, M. (2012). The RhoGAP Domain of CYK-4 Has an Essential Role in RhoA Activation. Curr. Biol. 22, 213–219.
Loubéry, S., Daeden, A., Seum, C., Holtzer, L., Moraleda, A., Damond, N., Derivery, E., Schmidt, T., and Gonzalez-Gaitan, M. (2017). Sara phosphorylation state controls the dispatch of endosomes from the central spindle during asymmetric division. Nat. Commun. 8, 15285.
Lovendahl, K.N., Blacklow, S.C., and Gordon, W.R. (2018). The Molecular Mechanism of Notch Activation. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 47–58.
Lu, B., Rothenberg, M., Jan, L.Y., and Jan, Y.N. (1998). Partner of Numb Colocalizes with Numb during Mitosis and Directs Numb Asymmetric Localization in Drosophila Neural and Muscle Progenitors. Cell 95, 225–235.
Lu, B., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1999). Modes of protein movement that lead to the asymmetric localization of partner of Numb during Drosophila neuroblast division. Mol. Cell 4, 883–891.
Lubensky, D.K., Pennington, M.W., Shraiman, B.I., and Baker, N.E. (2011). A dynamical model of ommatidial crystal formation. Proc. Natl. Acad. Sci. 108, 11145–11150.
Luca, V.C., Jude, K.M., Pierce, N.W., Nachury, M.V., Fischer, S., and Garcia, K.C. (2015). Structural basis for Notch1 engagement of Delta-like 4. Science 347, 847–853.
Luca, V.C., Kim, B.C., Ge, C., Kakuda, S., Wu, D., Roein-Peikar, M., Haltiwanger, R.S., Zhu, C., Ha, T., and Garcia, K.C. (2017). Notch-Jagged complex structure implicates a catch bond in tuning ligand sensitivity. Science 355, 1320–1324.
Mack, J.J., Mosqueiro, T.S., Archer, B.J., Jones, W.M., Sunshine, H., Faas, G.C., Briot, A., Aragón, R.L., Su, T., Romay, M.C., et al. (2017). NOTCH1 is a mechanosensor in adult arteries. Nat. Commun. 8.
Maritzen, T., Zech, T., Schmidt, M.R., Krause, E., Machesky, L.M., and Haucke, V. (2012). Gadkin negatively regulates cell spreading and motility via sequestration of the actin-nucleating ARP2/3 complex. Proc. Natl. Acad. Sci. 109, 10382–10387.
References
211
Marshall, O.J., Southall, T.D., Cheetham, S.W., and Brand, A.H. (2016). Cell-type-specific profiling of protein–DNA interactions without cell isolation using targeted DamID with next-generation sequencing. Nat. Protoc. 11, 1586–1598.
Massarwa, R., Carmon, S., Shilo, B.-Z., and Schejter, E.D. (2007). WIP/WASp-based actin-polymerization machinery is essential for myoblast fusion in Drosophila. Dev. Cell 12, 557–569.
McGill, M.A., Dho, S.E., Weinmaster, G., and McGlade, C.J. (2009). Numb Regulates Post-endocytic Trafficking and Degradation of Notch1. J. Biol. Chem. 284, 26427–26438.
Meloty-Kapella, L., Shergill, B., Kuon, J., Botvinick, E., and Weinmaster, G. (2012). Notch Ligand Endocytosis Generates Mechanical Pulling Force Dependent on Dynamin, Epsins, and Actin. Dev. Cell 22, 1299–1312.
Micchelli, C.A., Rulifson, E.J., and Blair, S.S. (1997). The function and regulation of cut expression on the wing margin of Drosophila: Notch, Wingless and a dominant negative role for Delta and Serrate. Dev. Camb. Engl. 124, 1485–1495.
Michelot, A., Grassart, A., Okreglak, V., Costanzo, M., Boone, C., and Drubin, D.G. (2013). Actin Filament Elongation in Arp2/3-Derived Networks Is Controlled by Three Distinct Mechanisms. Dev. Cell 24, 182–195.
Mikami, S., Nakaura, M., Kawahara, A., Mizoguchi, T., and Itoh, M. (2015). Mindbomb 2 is dispensable for embryonic development and Notch signalling in zebrafish. Biol. Open 4, 1576–1582.
Miller, A.C., Lyons, E.L., and Herman, T.G. (2009). cis-Inhibition of Notch by Endogenous Delta Biases the Outcome of Lateral Inhibition. Curr. Biol. 19, 1378–1383.
Mizuhara, E., Nakatani, T., Minaki, Y., Sakamoto, Y., Ono, Y., and Takai, Y. (2005). MAGI1 Recruits Dll1 to Cadherin-based Adherens Junctions and Stabilizes It on the Cell Surface. J. Biol. Chem. 280, 26499–26507.
Moloney, D.J., Panin, V.M., Johnston, S.H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K.D., Haltiwanger, R.S., et al. (2000a). Fringe is a glycosyltransferase that modifies Notch. Nature 406, 369–375.
Moloney, D.J., Shair, L.H., Lu, F.M., Xia, J., Locke, R., Matta, K.L., and Haltiwanger, R.S. (2000b). Mammalian Notch1 is modified with two unusual forms of O-linked glycosylation found on epidermal growth factor-like modules. J. Biol. Chem. 275, 9604–9611.
Montagne, C., and Gonzalez-Gaitan, M. (2014). Sara endosomes and the asymmetric division of intestinal stem cells. Development 141, 2014–2023.
Morsut, L., Roybal, K.T., Xiong, X., Gordley, R.M., Coyle, S.M., Thomson, M., and Lim, W.A. (2016). Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors. Cell 164, 780–791.
Mukherjee, S., Tucker-Burden, C., Zhang, C., Moberg, K., Read, R., Hadjipanayis, C., and Brat, D.J. (2016). Drosophila Brat and Human Ortholog TRIM3 Maintain Stem Cell
References
212
Equilibrium and Suppress Brain Tumorigenesis by Attenuating Notch Nuclear Transport. Cancer Res. 76, 2443–2452.
Mumm, J.S., Schroeter, E.H., Saxena, M.T., Griesemer, A., Tian, X., Pan, D.., Ray, W.J., and Kopan, R. (2000). A Ligand-Induced Extracellular Cleavage Regulates γ-Secretase-like Proteolytic Activation of Notch1. Mol. Cell 5, 197–206.
Mummery-Widmer, J.L., Yamazaki, M., Stoeger, T., Novatchkova, M., Bhalerao, S., Chen, D., Dietzl, G., Dickson, B.J., and Knoblich, J.A. (2009). Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi. Nature 458, 987–992.
Mund, M., van der Beek, J.A., Deschamps, J., Dmitrieff, S., Hoess, P., Monster, J.L., Picco, A., Nédélec, F., Kaksonen, M., and Ries, J. (2018). Systematic Nanoscale Analysis of Endocytosis Links Efficient Vesicle Formation to Patterned Actin Nucleation. Cell 174, 884-896.e17.
Nagel, B.M., Bechtold, M., Rodriguez, L.G., and Bogdan, S. (2017). Drosophila WASH is required for integrin-mediated cell adhesion, cell motility and lysosomal neutralization. J. Cell Sci. 130, 344–359.
Nandagopal, N., Santat, L.A., LeBon, L., Sprinzak, D., Bronner, M.E., and Elowitz, M.B. (2018). Dynamic Ligand Discrimination in the Notch Signaling Pathway. Cell 172, 869-880.e19.
Narui, Y., and Salaita, K. (2013). Membrane Tethered Delta Activates Notch and Reveals a Role for Spatio-Mechanical Regulation of the Signaling Pathway. Biophys. J. 105, 2655–2665.
Nemetschke, L., and Knust, E. (2016). Drosophila Crumbs prevents ectopic Notch activation in developing wings by inhibiting ligand-independent endocytosis. Dev. Camb. Engl. 143, 4543–4553.
Neto, H., Collins, L.L., and Gould, G.W. (2011). Vesicle trafficking and membrane remodelling in cytokinesis. Biochem. J. 437, 13–24.
Neujahr, R., Heizer, C., and Gerisch, G. (1997). Myosin II-independent processes in mitotic cells of Dictyostelium discoideum: redistribution of the nuclei, re-arrangement of the actin system and formation of the cleavage furrow. J. Cell Sci. 110 ( Pt 2), 123–137.
Nguyen, H.T., Voza, F., Ezzeddine, N., and Frasch, M. (2007). Drosophila mind bomb2 is required for maintaining muscle integrity and survival. J. Cell Biol. 179, 219–227.
O’Connor-Giles, K.M., and Skeath, J.B. (2003). Numb inhibits membrane localization of Sanpodo, a four-pass transmembrane protein, to promote asymmetric divisions in Drosophila. Dev. Cell 5, 231–243.
Oikawa, T., Yamaguchi, H., Itoh, T., Kato, M., Ijuin, T., Yamazaki, D., Suetsugu, S., and Takenawa, T. (2004). PtdIns(3,4,5)P3 binding is necessary for WAVE2-induced formation of lamellipodia. Nat. Cell Biol. 6, 420–426.
Okajima, T., and Irvine, K.D. (2002). Regulation of notch signaling by o-linked fucose. Cell 111, 893–904.
References
213
Okano, M., Matsuo, H., Nishimura, Y., Hozumi, K., Yoshioka, S., Tonoki, A., and Itoh, M. (2016). Mib1 modulates dynamin 2 recruitment via Snx18 to promote Dll1 endocytosis for efficient Notch signaling. Genes Cells 21, 425–441.
Oswald, F., Täuber, B., Dobner, T., Bourteele, S., Kostezka, U., Adler, G., Liptay, S., and Schmid, R.M. (2001). p300 acts as a transcriptional coactivator for mammalian Notch-1. Mol. Cell. Biol. 21, 7761–7774.
Overstreet, E., Chen, X., Wendland, B., and Fischer, J.A. (2003). Either part of a Drosophila epsin protein, divided after the ENTH domain, functions in endocytosis of delta in the developing eye. Curr. Biol. CB 13, 854–860.
Overstreet, E., Fitch, E., and Fischer, J.A. (2004). Fat facets and Liquid facets promote Delta endocytosis and Delta signaling in the signaling cells. Dev. Camb. Engl. 131, 5355–5366.
Palmer, W.H., and Deng, W.-M. (2015). Ligand-Independent Mechanisms of Notch Activity. Trends Cell Biol. 25, 697–707.
Palomero, T., Lim, W.K., Odom, D.T., Sulis, M.L., Real, P.J., Margolin, A., Barnes, K.C., O’Neil, J., Neuberg, D., Weng, A.P., et al. (2006). NOTCH1 directly regulates c-MYC and activates a feed-forward-loop transcriptional network promoting leukemic cell growth. Proc. Natl. Acad. Sci. 103, 18261–18266.
Panin, V.M., Papayannopoulos, V., Wilson, R., and Irvine, K.D. (1997). Fringe modulates Notch–ligand interactions. Nature 387, 908–912.
Park, M., Yaich, L.E., and Bodmer, R. (1998). Mesodermal cell fate decisions in Drosophila are under the control of the lineage genes numb, Notch, and sanpodo. Mech. Dev. 75, 117–126.
Parks, A.L., Klueg, K.M., Stout, J.R., and Muskavitch, M.A. (2000). Ligand endocytosis drives receptor dissociation and activation in the Notch pathway. Dev. Camb. Engl. 127, 1373–1385.
Pavlopoulos, E., Pitsouli, C., Klueg, K.M., Muskavitch, M.A.T., Moschonas, N.K., and Delidakis, C. (2001). neuralized Encodes a Peripheral Membrane Protein Involved in Delta Signaling and Endocytosis. Dev. Cell 1, 807–816.
Perez-Mockus, G., and Schweisguth, F. (2017). Cell Polarity and Notch Signaling: Linked by the E3 Ubiquitin Ligase Neuralized? BioEssays 39, 1700128.
Perez-Mockus, G., Mazouni, K., Roca, V., Corradi, G., Conte, V., and Schweisguth, F. (2017a). Spatial regulation of contractility by Neuralized and Bearded during furrow invagination in Drosophila. Nat. Commun. 8, 1594.
Perez-Mockus, G., Roca, V., Mazouni, K., and Schweisguth, F. (2017b). Neuralized regulates Crumbs endocytosis and epithelium morphogenesis via specific Stardust isoforms. J. Cell Biol. 216, 1405–1420.
Picco, A., Kukulski, W., Manenschijn, H.E., Specht, T., Briggs, J.A.G., and Kaksonen, M. (2018). The contributions of the actin machinery to endocytic membrane bending and vesicle formation. Mol. Biol. Cell 29, 1346–1358.
References
214
Piekny, A.J., and Maddox, A.S. (2010). The myriad roles of Anillin during cytokinesis. Semin. Cell Dev. Biol. 21, 881–891.
Pinheiro, D., Hannezo, E., Herszterg, S., Bosveld, F., Gaugue, I., Balakireva, M., Wang, Z., Cristo, I., Rigaud, S.U., Markova, O., et al. (2017). Transmission of cytokinesis forces via E-cadherin dilution and actomyosin flows. Nature 545, 103–107.
Pitsouli, C., and Delidakis, C. (2005). The interplay between DSL proteins and ubiquitin ligases in Notch signaling. Dev. Camb. Engl. 132, 4041–4050.
Pizarro-Cerdá, J., Chorev, D.S., Geiger, B., and Cossart, P. (2017). The Diverse Family of Arp2/3 Complexes. Trends Cell Biol. 27, 93–100.
Polacheck, W.J., Kutys, M.L., Yang, J., Eyckmans, J., Wu, Y., Vasavada, H., Hirschi, K.K., and Chen, C.S. (2017). A non-canonical Notch complex regulates adherens junctions and vascular barrier function. Nature.
Pollard, T.D. (2007). Regulation of Actin Filament Assembly by Arp2/3 Complex and Formins. Annu. Rev. Biophys. Biomol. Struct. 36, 451–477.
Poulson, D.F. (1937). Chromosomal Deficiencies and the Embryonic Development of Drosophila Melanogaster. Proc. Natl. Acad. Sci. U. S. A. 23, 133–137.
Powell, P.A., Wesley, C., Spencer, S., and Cagan, R.L. (2001). Scabrous complexes with Notch to mediate boundary formation. Nature 409, 626–630.
Preuße, K., Tveriakhina, L., Schuster-Gossler, K., Gaspar, C., Rosa, A.I., Henrique, D., Gossler, A., and Stauber, M. (2015). Context-Dependent Functional Divergence of the Notch Ligands DLL1 and DLL4 In Vivo. PLOS Genet. 11, e1005328.
Qiu, L., Joazeiro, C., Fang, N., Wang, H.-Y., Elly, C., Altman, Y., Fang, D., Hunter, T., and Liu, Y.-C. (2000). Recognition and Ubiquitination of Notch by Itch, a Hect-type E3 Ubiquitin Ligase. J. Biol. Chem. 275, 35734–35737.
Rajan, A., Tien, A.-C., Haueter, C.M., Schulze, K.L., and Bellen, H.J. (2009). The Arp2/3 complex and WASp are required for apical trafficking of Delta into microvilli during cell fate specification of sensory organ precursors. Nat. Cell Biol. 11, 815–824.
Ramkumar, N., and Baum, B. (2016). Coupling changes in cell shape to chromosome segregation. Nat. Rev. Mol. Cell Biol. 17, 511–521.
Rampal, R., Luther, K.B., and Haltiwanger, R.S. (2007). Notch signaling in normal and disease States: possible therapies related to glycosylation. Curr. Mol. Med. 7, 427–445.
Ready, D.F., Hanson, T.E., and Benzer, S. (1976). Development of the Drosophila retina, a neurocrystalline lattice. Dev. Biol. 53, 217–240.
Rebay, I., Fleming, R.J., Fehon, R.G., Cherbas, L., Cherbas, P., and Artavanis-Tsakonas, S. (1991). Specific EGF repeats of Notch mediate interactions with Delta and serrate: Implications for notch as a multifunctional receptor. Cell 67, 687–699.
References
215
Reiss, K., Maretzky, T., Ludwig, A., Tousseyn, T., de Strooper, B., Hartmann, D., and Saftig, P. (2005). ADAM10 cleavage of N-cadherin and regulation of cell-cell adhesion and beta-catenin nuclear signalling. EMBO J. 24, 742–752.
Remaud, S., Audibert, A., and Gho, M. (2008). S-Phase Favours Notch Cell Responsiveness in the Drosophila Bristle Lineage. PLoS ONE 3, e3646.
Ren, Q., Awasaki, T., Wang, Y.-C., Huang, Y.-F., and Lee, T. (2018). Lineage-guided Notch-dependent gliogenesis by Drosophila multi-potent progenitors. Dev. Camb. Engl. 145.
Renaud, O., and Simpson, P. (2001). scabrous Modifies Epithelial Cell Adhesion and Extends the Range of Lateral Signalling during Development of the Spaced Bristle Pattern in Drosophila. Dev. Biol. 240, 361–376.
Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76, 477–491.
Richardson, B.E., Beckett, K., Nowak, S.J., and Baylies, M.K. (2007). SCAR/WAVE and Arp2/3 are crucial for cytoskeletal remodeling at the site of myoblast fusion. Dev. Camb. Engl. 134, 4357–4367.
Robinson, R.C., Turbedsky, K., Kaiser, D.A., Marchand, J.B., Higgs, H.N., Choe, S., and Pollard, T.D. (2001). Crystal structure of Arp2/3 complex. Science 294, 1679–1684.
Rocca, D.L., Martin, S., Jenkins, E.L., and Hanley, J.G. (2008). Inhibition of Arp2/3-mediated actin polymerization by PICK1 regulates neuronal morphology and AMPA receptor endocytosis. Nat. Cell Biol. 10, 259–271.
Rodrigues, N.T.L., Lekomtsev, S., Jananji, S., Kriston-Vizi, J., Hickson, G.R.X., and Baum, B. (2015). Kinetochore-localized PP1–Sds22 couples chromosome segregation to polar relaxation. Nature 524, 489–492.
Roegiers, F., Younger-Shepherd, S., Jan, L.Y., and Jan, Y.N. (2001a). Two types of asymmetric divisions in the Drosophila sensory organ precursor cell lineage. Nat. Cell Biol. 3, 58–67.
Roegiers, F., Younger-Shepherd, S., Jan, L.Y., and Jan, Y.N. (2001b). Bazooka is required for localization of determinants and controlling proliferation in the sensory organ precursor cell lineage in Drosophila. Proc. Natl. Acad. Sci. 98, 14469–14474.
Rotty, J.D., Wu, C., and Bear, J.E. (2013). New insights into the regulation and cellular functions of the ARP2/3 complex. Nat. Rev. Mol. Cell Biol. 14, 7–12.
Rouiller, I., Xu, X.-P., Amann, K.J., Egile, C., Nickell, S., Nicastro, D., Li, R., Pollard, T.D., Volkmann, N., and Hanein, D. (2008). The structural basis of actin filament branching by the Arp2/3 complex. J. Cell Biol. 180, 887–895.
Roy, S., Hsiung, F., and Kornberg, T.B. (2011). Specificity of Drosophila Cytonemes for Distinct Signaling Pathways. Science 332, 354–358.
References
216
Roy, S., Huang, H., Liu, S., and Kornberg, T.B. (2014). Cytoneme-Mediated Contact-Dependent Transport of the Drosophila Decapentaplegic Signaling Protein. Science 343, 1244624–1244624.
Sachan, N., Mishra, A.K., Mutsuddi, M., and Mukherjee, A. (2013). The Drosophila Importin-α3 Is Required for Nuclear Import of Notch In Vivo and It Displays Synergistic Effects with Notch Receptor on Cell Proliferation. PLoS ONE 8, e68247.
Sakata, T., Sakaguchi, H., Tsuda, L., Higashitani, A., Aigaki, T., Matsuno, K., and Hayashi, S. (2004). Drosophila Nedd4 Regulates Endocytosis of Notch and Suppresses Its Ligand-Independent Activation. Curr. Biol. 14, 2228–2236.
San-Juán, B.P., and Baonza, A. (2011). The bHLH factor deadpan is a direct target of Notch signaling and regulates neuroblast self-renewal in Drosophila. Dev. Biol. 352, 70–82.
Santos, A.L., and Preta, G. (2018). Lipids in the cell: organisation regulates function. Cell. Mol. Life Sci. 75, 1909–1927.
Sasaki, N., Sasamura, T., Ishikawa, H.O., Kanai, M., Ueda, R., Saigo, K., and Matsuno, K. (2007). Polarized exocytosis and transcytosis of Notch during its apical localization in Drosophila epithelial cells. Genes Cells Devoted Mol. Cell. Mech. 12, 89–103.
Schaefer, M., Shevchenko, A., Shevchenko, A., and Knoblich, J.A. (2000). A protein complex containing Inscuteable and the Gα-binding protein Pins orients asymmetric cell divisions in Drosophila. Curr. Biol. 10, 353–362.
Schäfer, G., Weber, S., Holz, A., Bogdan, S., Schumacher, S., Müller, A., Renkawitz-Pohl, R., and Onel, S.-F. (2007). The Wiskott-Aldrich syndrome protein (WASP) is essential for myoblast fusion in Drosophila. Dev. Biol. 304, 664–674.
Schechtman, A.M. (1937). LOCALIZED CORTICAL GROWTH AS THE IMMEDIATE CAUSE OF CELL DIVISION. Science 85, 222–223.
Schier, A.F., Neuhauss, S.C., Harvey, M., Malicki, J., Solnica-Krezel, L., Stainier, D.Y., Zwartkruis, F., Abdelilah, S., Stemple, D.L., Rangini, Z., et al. (1996). Mutations affecting the development of the embryonic zebrafish brain. Dev. Camb. Engl. 123, 165–178.
Schnute, B., Troost, T., and Klein, T. (2018). Endocytic Trafficking of the Notch Receptor. In Molecular Mechanisms of Notch Signaling, T. Borggrefe, and B.D. Giaimo, eds. (Cham: Springer International Publishing), pp. 99–122.
Scholey, J., Civelekoglu-Scholey, G., and Brust-Mascher, I. (2016). Anaphase B. Biology 5, 51.
Schrank, B.R., Aparicio, T., Li, Y., Chang, W., Chait, B.T., Gundersen, G.G., Gottesman, M.E., and Gautier, J. (2018). Nuclear ARP2/3 drives DNA break clustering for homology-directed repair. Nature 559, 61–66.
Schroeter, E.H., Kisslinger, J.A., and Kopan, R. (1998). Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393, 382–386.
References
217
Schweisguth, F. (2015). Asymmetric cell division in the Drosophila bristle lineage: from the polarization of sensory organ precursor cells to Notch-mediated binary fate decision. Wiley Interdiscip. Rev. Dev. Biol. 4, 299–309.
Seegar, T.C.M., Killingsworth, L.B., Saha, N., Meyer, P.A., Patra, D., Zimmerman, B., Janes, P.W., Rubinstein, E., Nikolov, D.B., Skiniotis, G., et al. (2017). Structural Basis for Regulated Proteolysis by the α-Secretase ADAM10. Cell 171, 1638-1648.e7.
Ségalen, M., Johnston, C.A., Martin, C.A., Dumortier, J.G., Prehoda, K.E., David, N.B., Doe, C.Q., and Bellaïche, Y. (2010). The Fz-Dsh Planar Cell Polarity Pathway Induces Oriented Cell Division via Mud/NuMA in Drosophila and Zebrafish. Dev. Cell 19, 740–752.
Seo, D., Southard, K.M., Kim, J., Lee, H.J., Farlow, J., Lee, J., Litt, D.B., Haas, T., Alivisatos, A.P., Cheon, J., et al. (2016). A Mechanogenetic Toolkit for Interrogating Cell Signaling in Space and Time. Cell 165, 1507–1518.
Seugnet, L., Simpson, P., and Haenlin, M. (1997). Requirement for Dynamin during Notch Signaling inDrosophilaNeurogenesis. Dev. Biol. 192, 585–598.
Severson, E., Arnett, K.L., Wang, H., Zang, C., Taing, L., Liu, H., Pear, W.S., Shirley Liu, X., Blacklow, S.C., and Aster, J.C. (2017). Genome-wide identification and characterization of Notch transcription complex–binding sequence-paired sites in leukemia cells. Sci. Signal. 10, eaag1598.
Shan, Z., Tu, Y., Yang, Y., Liu, Z., Zeng, M., Xu, H., Long, J., Zhang, M., Cai, Y., and Wen, W. (2018). Basal condensation of Numb and Pon complex via phase transition during Drosophila neuroblast asymmetric division. Nat. Commun. 9.
Shaya, O., Binshtok, U., Hersch, M., Rivkin, D., Weinreb, S., Amir-Zilberstein, L., Khamaisi, B., Oppenheim, O., Desai, R.A., Goodyear, R.J., et al. (2017). Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Dev. Cell 40, 505-511.e6.
Shen, Q.-T., Hsiue, P.P., Sindelar, C.V., Welch, M.D., Campellone, K.G., and Wang, H.-W. (2012). Structural insights into WHAMM-mediated cytoskeletal coordination during membrane remodeling. J. Cell Biol. 199, 111–124.
Shergill, B., Meloty-Kapella, L., Musse, A.A., Weinmaster, G., and Botvinick, E. (2012). Optical Tweezers Studies on Notch: Single-Molecule Interaction Strength Is Independent of Ligand Endocytosis. Dev. Cell 22, 1313–1320.
Shi, S., and Stanley, P. (2003). Protein O-fucosyltransferase 1 is an essential component of Notch signaling pathways. Proc. Natl. Acad. Sci. 100, 5234–5239.
Shimizu, H., Woodcock, S.A., Wilkin, M.B., Trubenová, B., Monk, N.A.M., and Baron, M. (2014). Compensatory Flux Changes within an Endocytic Trafficking Network Maintain Thermal Robustness of Notch Signaling. Cell 157, 1160–1174.
Shimizu, K., Chiba, S., Kumano, K., Hosoya, N., Takahashi, T., Kanda, Y., Hamada, Y., Yazaki, Y., and Hirai, H. (1999). Mouse Jagged1 Physically Interacts with Notch2 and Other Notch Receptors: ASSESSMENT BY QUANTITATIVE METHODS. J. Biol. Chem. 274, 32961–32969.
References
218
Siebel, C., and Lendahl, U. (2017). Notch Signaling in Development, Tissue Homeostasis, and Disease. Physiol. Rev. 97, 1235–1294.
Simonetti, B., and Cullen, P.J. (2019). Actin-dependent endosomal receptor recycling. Curr. Opin. Cell Biol. 56, 22–33.
Simpson, P. (1990). Lateral inhibition and the development of the sensory bristles of the adult peripheral nervous system of Drosophila. Dev. Camb. Engl. 109, 509–519.
Simpson, P. (2007). The stars and stripes of animal bodies: evolution of regulatory elements mediating pigment and bristle patterns in Drosophila. Trends Genet. 23, 350–358.
Skalska, L., Stojnic, R., Li, J., Fischer, B., Cerda-Moya, G., Sakai, H., Tajbakhsh, S., Russell, S., Adryan, B., and Bray, S.J. (2015). Chromatin signatures at Notch-regulated enhancers reveal large-scale changes in H3K56ac upon activation. EMBO J. 34, 1889–1904.
Skeath, J.B., and Carroll, S.B. (1992). Regulation of proneural gene expression and cell fate during neuroblast segregation in the Drosophila embryo. Dev. Camb. Engl. 114, 939–946.
Skeath, J.B., and Doe, C.Q. (1998). Sanpodo and Notch act in opposition to Numb to distinguish sibling neuron fates in the Drosophila CNS. Dev. Camb. Engl. 125, 1857–1865.
Skeath, J.B., Panganiban, G., Selegue, J., and Carroll, S.B. (1992). Gene regulation in two dimensions: the proneural achaete and scute genes are controlled by combinations of axis-patterning genes through a common intergenic control region. Genes Dev. 6, 2606–2619.
Smith, C.A., Lau, K.M., Rahmani, Z., Dho, S.E., Brothers, G., She, Y.M., Berry, D.M., Bonneil, E., Thibault, P., Schweisguth, F., et al. (2007). aPKC-mediated phosphorylation regulates asymmetric membrane localization of the cell fate determinant Numb. EMBO J. 26, 468–480.
Sokolova, O.S., Chemeris, A., Guo, S., Alioto, S.L., Gandhi, M., Padrick, S., Pechnikova, E., David, V., Gautreau, A., and Goode, B.L. (2017). Structural Basis of Arp2/3 Complex Inhibition by GMF, Coronin, and Arpin. J. Mol. Biol. 429, 237–248.
Song, Y., and Lu, B. (2011). Regulation of cell growth by Notch signaling and its differential requirement in normal vs. tumor-forming stem cells in Drosophila. Genes Dev. 25, 2644–2658.
Sorensen, E.B., and Conner, S.D. (2010). γ-Secretase-Dependent Cleavage Initiates Notch Signaling from the Plasma Membrane. Traffic 11, 1234–1245.
Sossey-Alaoui, K., Li, X., and Cowell, J.K. (2007). c-Abl-mediated phosphorylation of WAVE3 is required for lamellipodia formation and cell migration. J. Biol. Chem. 282, 26257–26265.
Southall, T.D., and Brand, A.H. (2009). Neural stem cell transcriptional networks highlight genes essential for nervous system development. EMBO J. 28, 3799–3807.
Southall, T.D., Gold, K.S., Egger, B., Davidson, C.M., Caygill, E.E., Marshall, O.J., and Brand, A.H. (2013). Cell-Type-Specific Profiling of Gene Expression and Chromatin Binding
References
219
without Cell Isolation: Assaying RNA Pol II Occupancy in Neural Stem Cells. Dev. Cell 26, 101–112.
Spana, E.P., and Doe, C.Q. (1996). Numb antagonizes Notch signaling to specify sibling neuron cell fates. Neuron 17, 21–26.
Spratford, C.M., and Kumar, J.P. (2014). Hedgehog and extramacrochaetae in the Drosophila eye: An irresistible force meets an immovable object. Fly (Austin) 8, 36–42.
Sprinzak, D., Lakhanpal, A., LeBon, L., Santat, L.A., Fontes, M.E., Anderson, G.A., Garcia-Ojalvo, J., and Elowitz, M.B. (2010). Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature 465, 86–90.
Stevenson, V., Hudson, A., Cooley, L., and Theurkauf, W.E. (2002). Arp2/3-Dependent Psuedocleavage Furrow Assembly in Syncytial Drosophila Embryos. Curr. Biol. 12, 705–711.
Struhl, G., and Adachi, A. (1998). Nuclear Access and Action of Notch In Vivo. Cell 93, 649–660.
Struhl, G., and Greenwald, I. (1999). Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398, 522–525.
Suckling, R.J., Korona, B., Whiteman, P., Chillakuri, C., Holt, L., Handford, P.A., and Lea, S.M. (2017). Structural and functional dissection of the interplay between lipid and Notch binding by human Notch ligands. EMBO J. e201796632.
Sun, Y., Jan, L.Y., and Jan, Y.N. (1998). Transcriptional regulation of atonal during development of the Drosophila peripheral nervous system. Dev. Camb. Engl. 125, 3731–3740.
Sun, Y., Leong, N.T., Jiang, T., Tangara, A., Darzacq, X., and Drubin, D.G. (2017). Switch-like Arp2/3 activation upon WASP and WIP recruitment to an apparent threshold level by multivalent linker proteins in vivo. ELife 6.
Sunshine, H., and Iruela-Arispe, M.L. (2017). Membrane lipids and cell signaling: Curr. Opin. Lipidol. 28, 408–413.
Swaney, K.F., and Li, R. (2016). Function and regulation of the Arp2/3 complex during cell migration in diverse environments. Curr. Opin. Cell Biol. 42, 63–72.
Swanson, C.I., Evans, N.C., and Barolo, S. (2010). Structural Rules and Complex Regulatory Circuitry Constrain Expression of a Notch- and EGFR-Regulated Eye Enhancer. Dev. Cell 18, 359–370.
Swanson, C.I., Schwimmer, D.B., and Barolo, S. (2011). Rapid Evolutionary Rewiring of a Structurally Constrained Eye Enhancer. Curr. Biol. 21, 1186–1196.
Tagami, S., Okochi, M., Yanagida, K., Ikuta, A., Fukumori, A., Matsumoto, N., Ishizuka-Katsura, Y., Nakayama, T., Itoh, N., Jiang, J., et al. (2008). Regulation of Notch Signaling by Dynamic Changes in the Precision of S3 Cleavage of Notch-1. Mol. Cell. Biol. 28, 165–176.
References
220
Takano, K., Takano, K., Toyooka, K., and Suetsugu, S. (2008). EFC/F-BAR proteins and the N-WASP-WIP complex induce membrane curvature-dependent actin polymerization. EMBO J. 27, 2817–2828.
Tal, T., Vaizel-Ohayon, D., and Schejter, E.D. (2002). Conserved Interactions with Cytoskeletal but Not Signaling Elements Are an Essential Aspect of Drosophila Wasp Function. Dev. Biol. 243, 260–271.
Terriente-Felix, A., Li, J., Collins, S., Mulligan, A., Reekie, I., Bernard, F., Krejci, A., and Bray, S. (2013). Notch cooperates with Lozenge/Runx to lock haemocytes into a differentiation programme. Dev. Camb. Engl. 140, 926–937.
van Tetering, G., van Diest, P., Verlaan, I., van der Wall, E., Kopan, R., and Vooijs, M. (2009). Metalloprotease ADAM10 is required for Notch1 site 2 cleavage. J. Biol. Chem. 284, 31018–31027.
Thieleke-Matos, C., Osório, D.S., Carvalho, A.X., and Morais-de-Sá, E. (2017). Emerging Mechanisms and Roles for Asymmetric Cytokinesis. In International Review of Cell and Molecular Biology, (Elsevier), pp. 297–345.
Tian, X., Hansen, D., Schedl, T., and Skeath, J.B. (2004). Epsin potentiates Notch pathway activity in Drosophila and C. elegans. Dev. Camb. Engl. 131, 5807–5815.
Tognon, E., Wollscheid, N., Cortese, K., Tacchetti, C., and Vaccari, T. (2014). ESCRT-0 Is Not Required for Ectopic Notch Activation and Tumor Suppression in Drosophila. PLoS ONE 9, e93987.
Tomasevic, N., Jia, Z., Russell, A., Fujii, T., Hartman, J.J., Clancy, S., Wang, M., Beraud, C., Wood, K.W., and Sakowicz, R. (2007). Differential regulation of WASP and N-WASP by Cdc42, Rac1, Nck, and PI(4,5)P2. Biochemistry 46, 3494–3502.
Torres, E., and Rosen, M.K. (2006). Protein-tyrosine kinase and GTPase signals cooperate to phosphorylate and activate Wiskott-Aldrich syndrome protein (WASP)/neuronal WASP. J. Biol. Chem. 281, 3513–3520.
Tran, D.T., Masedunskas, A., Weigert, R., and Ten Hagen, K.G. (2015). Arp2/3-mediated F-actin formation controls regulated exocytosis in vivo. Nat. Commun. 6.
Truman, J.W., Moats, W., Altman, J., Marin, E.C., and Williams, D.W. (2010). Role of Notch signaling in establishing the hemilineages of secondary neurons in Drosophila melanogaster. Development 137, 53–61.
Tyler, J.J., Allwood, E.G., and Ayscough, K.R. (2016). WASP family proteins, more than Arp2/3 activators. Biochem. Soc. Trans. 44, 1339–1345.
Uemura, T., Shepherd, S., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1989). numb, a gene required in determination of cell fate during sensory organ formation in Drosophila embryos. Cell 58, 349–360.
Upadhyay, A., Kandachar, V., Zitserman, D., Tong, X., and Roegiers, F. (2013). Sanpodo controls sensory organ precursor fate by directing Notch trafficking and binding γ-secretase. J. Cell Biol. 201, 439–448.
References
221
Vaccari, T., Rusten, T.E., Menut, L., Nezis, I.P., Brech, A., Stenmark, H., and Bilder, D. (2009). Comparative analysis of ESCRT-I, ESCRT-II and ESCRT-III function in Drosophila by efficient isolation of ESCRT mutants. J. Cell Sci. 122, 2413–2423.
Volkmann, N., Amann, K.J., Stoilova-McPhie, S., Egile, C., Winter, D.C., Hazelwood, L., Heuser, J.E., Li, R., Pollard, T.D., and Hanein, D. (2001). Structure of Arp2/3 complex in its activated state and in actin filament branch junctions. Science 293, 2456–2459.
Wang, W., and Struhl, G. (2004). Drosophila Epsin mediates a select endocytic pathway that DSL ligands must enter to activate Notch. Dev. Camb. Engl. 131, 5367–5380.
Wang, W., and Struhl, G. (2005). Distinct roles for Mind bomb, Neuralized and Epsin in mediating DSL endocytosis and signaling in Drosophila. Dev. Camb. Engl. 132, 2883–2894.
Wang, X., and Ha, T. (2013). Defining Single Molecular Forces Required to Activate Integrin and Notch Signaling. Science 340, 991–994.
Wang, H., Somers, G.W., Bashirullah, A., Heberlein, U., Yu, F., and Chia, W. (2006). Aurora-A acts as a tumor suppressor and regulates self-renewal of Drosophila neuroblasts. Genes Dev. 20, 3453–3463.
Wang, H., Ouyang, Y., Somers, W.G., Chia, W., and Lu, B. (2007). Polo inhibits progenitor self-renewal and regulates Numb asymmetry by phosphorylating Pon. Nature 449, 96–100.
Wang, H., Zang, C., Taing, L., Arnett, K.L., Wong, Y.J., Pear, W.S., Blacklow, S.C., Liu, X.S., and Aster, J.C. (2014). NOTCH1-RBPJ complexes drive target gene expression through dynamic interactions with superenhancers. Proc. Natl. Acad. Sci. 111, 705–710.
Wang, Z., Bosveld, F., and Bellaïche, Y. (2018). Tricellular junction proteins promote disentanglement of daughter and neighbour cells during epithelial cytokinesis. J. Cell Sci. 131, jcs215764.
Weinmaster, G., and Fischer, J.A. (2011). Notch Ligand Ubiquitylation: What Is It Good For? Dev. Cell 21, 134–144.
Weisshuhn, P.C., Sheppard, D., Taylor, P., Whiteman, P., Lea, S.M., Handford, P.A., and Redfield, C. (2016). Non-Linear and Flexible Regions of the Human Notch1 Extracellular Domain Revealed by High-Resolution Structural Studies. Structure 24, 555–566.
Welch, M.D., Rosenblatt, J., Skoble, J., Portnoy, D.A., and Mitchison, T.J. (1998). Interaction of human Arp2/3 complex and the Listeria monocytogenes ActA protein in actin filament nucleation. Science 281, 105–108.
Weng, A.P., Ferrando, A.A., Lee, W., Morris, J.P., Silverman, L.B., Sanchez-Irizarry, C., Blacklow, S.C., Look, A.T., and Aster, J.C. (2004). Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269–271.
Weng, A.P., Millholland, J.M., Yashiro-Ohtani, Y., Arcangeli, M.L., Lau, A., Wai, C., Del Bianco, C., Rodriguez, C.G., Sai, H., Tobias, J., et al. (2006). c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev. 20, 2096–2109.
References
222
Wilkin, M.B., Carbery, A.-M., Fostier, M., Aslam, H., Mazaleyrat, S.L., Higgs, J., Myat, A., Evans, D.A.P., Cornell, M., and Baron, M. (2004). Regulation of Notch Endosomal Sorting and Signaling by Drosophila Nedd4 Family Proteins. Curr. Biol. 14, 2237–2244.
Windler, S.L., and Bilder, D. (2010). Endocytic Internalization Routes Required for Delta/Notch Signaling. Curr. Biol. 20, 538–543.
Wirtz-Peitz, F., Nishimura, T., and Knoblich, J.A. (2008). Linking Cell Cycle to Asymmetric Division: Aurora-A Phosphorylates the Par Complex to Regulate Numb Localization. Cell 135, 161–173.
Wolff, T., and Ready, D.F. (1991). The beginning of pattern formation in the Drosophila compound eye: the morphogenetic furrow and the second mitotic wave. Dev. Camb. Engl. 113, 841–850.
Xu, X., Choi, S.H., Hu, T., Tiyanont, K., Habets, R., Groot, A.J., Vooijs, M., Aster, J.C., Chopra, R., Fryer, C., et al. (2015). Insights into Autoregulation of Notch3 from Structural and Functional Studies of Its Negative Regulatory Region. Struct. Lond. Engl. 1993 23, 1227–1235.
Yamada, S., and Nelson, W.J. (2007). Localized zones of Rho and Rac activities drive initiation and expansion of epithelial cell-cell adhesion. J. Cell Biol. 178, 517–527.
Yamada, K., Fuwa, T.J., Ayukawa, T., Tanaka, T., Nakamura, A., Wilkin, M.B., Baron, M., and Matsuno, K. (2011). Roles of Drosophila Deltex in Notch receptor endocytic trafficking and activation: Deltex functions in Notch endocytosis. Genes Cells 16, 261–272.
Yamamoto, S., Charng, W.-L., Rana, N.A., Kakuda, S., Jaiswal, M., Bayat, V., Xiong, B., Zhang, K., Sandoval, H., David, G., et al. (2012). A Mutation in EGF Repeat-8 of Notch Discriminates Between Serrate/Jagged and Delta Family Ligands. Science 338, 1229–1232.
Yatim, A., Benne, C., Sobhian, B., Laurent-Chabalier, S., Deas, O., Judde, J.-G., Lelievre, J.-D., Levy, Y., and Benkirane, M. (2012). NOTCH1 Nuclear Interactome Reveals Key Regulators of Its Transcriptional Activity and Oncogenic Function. Mol. Cell 48, 445–458.
Yeaman, C., Grindstaff, K.K., Wright, J.R., and Nelson, W.J. (2001). Sec6/8 complexes on trans-Golgi network and plasma membrane regulate late stages of exocytosis in mammalian cells. J. Cell Biol. 155, 593–604.
Yeh, E., Zhou, L., Rudzik, N., and Boulianne, G.L. (2000). Neuralized functions cell autonomously to regulate Drosophila sense organ development. EMBO J. 19, 4827–4837.
Yeh, E., Dermer, M., Commisso, C., Zhou, L., McGlade, C.J., and Boulianne, G.L. (2001). Neuralized functions as an E3 ubiquitin ligase during Drosophila development. Curr. Biol. 11, 1675–1679.
Yonemura, Y., Futai, E., Yagishita, S., Kaether, C., and Ishiura, S. (2016). Specific combinations of presenilins and Aph1s affect the substrate specificity and activity of γ-secretase. Biochem. Biophys. Res. Commun. 478, 1751–1757.
References
223
Yousefian, J., Troost, T., Grawe, F., Sasamura, T., Fortini, M., and Klein, T. (2013). Dmon1 controls recruitment of Rab7 to maturing endosomes in Drosophila. J. Cell Sci. 126, 1583–1594.
Zacharioudaki, E., and Bray, S.J. (2014). Tools and methods for studying Notch signaling in Drosophila melanogaster. Methods 68, 173–182.
Zacharioudaki, E., Magadi, S.S., and Delidakis, C. (2012). bHLH-O proteins are crucial for Drosophila neuroblast self-renewal and mediate Notch-induced overproliferation. Dev. Camb. Engl. 139, 1258–1269.
Zallen, J.A., Cohen, Y., Hudson, A.M., Cooley, L., Wieschaus, E., and Schejter, E.D. (2002). SCAR is a primary regulator of Arp2/3-dependent morphological events in Drosophila. J. Cell Biol. 156, 689–701.
Zeng, C., Younger-Shepherd, S., Jan, L.Y., and Jan, Y.N. (1998). Delta and Serrate are redundant Notch ligands required for asymmetric cell divisions within the Drosophila sensory organ lineage. Genes Dev. 12, 1086–1091.
Zhang, Y., Yu, J.C., Jiang, T., Fernandez-Gonzalez, R., and Harris, T.J.C. (2018). Collision of Expanding Actin Caps with Actomyosin Borders for Cortical Bending and Mitotic Rounding in a Syncytium. Dev. Cell 45, 551-564.e4.
Zhong, W., Feder, J.N., Jiang, M.M., Jan, L.Y., and Jan, Y.N. (1996). Asymmetric localization of a mammalian numb homolog during mouse cortical neurogenesis. Neuron 17, 43–53.
Zhong, W., Jiang, M.M., Schonemann, M.D., Meneses, J.J., Pedersen, R.A., Jan, L.Y., and Jan, Y.N. (2000). Mouse numb is an essential gene involved in cortical neurogenesis. Proc. Natl. Acad. Sci. U. S. A. 97, 6844–6849.
Zhu, K., Shan, Z., Zhang, L., and Wen, W. (2016). Phospho-Pon Binding-Mediated Fine-Tuning of Plk1 Activity. Structure 24, 1110–1119.
Zuchero, J.B., Coutts, A.S., Quinlan, M.E., Thangue, N.B.L., and Mullins, R.D. (2009). p53-cofactor JMY is a multifunctional actin nucleation factor. Nat. Cell Biol. 11, 451–459.
Zuchero, J.B., Belin, B., and Mullins, R.D. (2012). Actin binding to WH2 domains regulates nuclear import of the multifunctional actin regulator JMY. Mol. Biol. Cell 23, 853–863.
224
List of figures
Figure 1. Overview of the steps leading to Notch activation. .................................................. 6 Figure 2. Structure and organization of Notch receptors and DSL ligands. .............................. 7 Figure 3. Structure of the Notch1-Dll4 complex in trans and cis conformations ...................... 8 Figure 4. Types of glycan modifications found in Notch EGF repeats. .................................. 11 Figure 5. A comprehensive and functional map of glycan modifications on Notch EGF repeats. ................................................................................................................................. 13 Figure 6. Mechanisms of receptor-ligand cis-inhibition. ....................................................... 14 Figure 7. Structure and force-dependent unfolding of the NRR............................................. 16 Figure 8. Overview of experimental strategies probing the force range required for Notch activation ............................................................................................................................. 18 Figure 9. Overview of mechanisms regulating NICD transcriptional activity ........................ 23 Figure 10. Notch trafficking from the cell surface to the lysosomes ...................................... 27 Figure 11. Ligand endocytosis as a molecular mechanism generating pulling forces during receptor activation. ............................................................................................................... 33 Figure 12. Neur and Mib1 functional domains ...................................................................... 39 Figure 13. Delta recycling model .......................................................................................... 43 Figure 14. Temporal profiling of Notch target gene expression ............................................. 46 Figure 15. Principle and application of the TaDa technique .................................................. 47 Figure 16. Notch-Gal4 chimeric receptors as a tool to follow Notch signaling dynamics ...... 49 Figure 17. Expression patterns of NRE-GFP and Cut, a Notch target gene............................ 50 Figure 18. Dynamics of Notch signaling using a NiGFP transgene. ...................................... 52 Figure 19. Types of gene expression profiles in response to an NICD stimulus ..................... 53 Figure 20. Dynamic encoding of Notch activity elicits different biological outputs ............... 56 Figure 21. Selection of neural progenitors during embryogenesis: from prepatterning genes to neuroblast ............................................................................................................................. 59 Figure 22. Diversity of sensory organs and lineages in Drosophila. ...................................... 61 Figure 23. Neural precursor selection occurs through gradual refinement of the cluster ........ 62 Figure 24. Patterning of the bristle rows in the notum combines prepatterning and self-organization ......................................................................................................................... 63 Figure 25. Combination between short-range and long-range signaling is a potent mechanism explaining lateral inhibition in large proneural clusters ......................................................... 64 Figure 26. Morphogenetic furrow progression and formation of ommatidial rows in the eye disc ...................................................................................................................................... 66 Figure 27. R8 selection and patterning in the eye disc........................................................... 67 Figure 28. The thoracic microchaete lineage ......................................................................... 72 Figure 29. Unequal segregation of Numb during SOP ACD in pIIb ...................................... 73 Figure 30. Polarization of polarity proteins prior to SOP division ensures unequal segregation of Numb and Neur and orientation of the mitotic spindle ...................................................... 74 Figure 31. Phosphorylation-based exclusion of Numb from the posterior pole prior to SOP division ................................................................................................................................ 75 Figure 32. Time-lapse images illustrating the relocalization of Numb from the anterior crescent to subapical endosomes in pIIb. .............................................................................. 77 Figure 33. Current model for Numb function in pIIb ........................................................... 78 Figure 34. Unequal segregation of Neur in pIIb during SOP ACD ....................................... 78 Figure 35. Correlation between contact area and Notch signaling activity ............................ 80 Figure 36. Notch localizes at the AJ level at cytokinesis in fixed tissues and in vivo ............ 81
List of Figures
225
Figure 37. Evolution of the Delta recycling model in the SO lineage .................................... 83 Figure 38. An actin rich structure containing microvilli forms at the pIIa-pIIb interface. ...... 84 Figure 39. Notch is detected laterally in vivo in numb and spdo backgrounds ....................... 86 Figure 40. Directionally trafficking Sara endosomes carrying Notch and Delta molecules are inherited by pIIa ................................................................................................................... 87 Figure 41. Notch activation at cytokinesis is required to specify the pIIa fate ....................... 89 Figure 42. Notch is activated at cytokinesis .......................................................................... 89 Figure 43. Cytokinetic ring positioning at anaphase onset ..................................................... 92 Figure 44. Overview of the molecular mechanisms at stake during anaphase elongation ....... 93 Figure 45. Midbody formation and abscission ...................................................................... 94 Figure 46. MyoII (red) activity in neighbors helps in juxtaposing the dividing cell membranes during cytokinetic ring constriction ...................................................................................... 95 Figure 47. Cell-autonomous Rac-dependent Arp2/3 activity ensures neighbor membrane withdrawal and contact expansion ........................................................................................ 97 Figure 48. Asymmetric furrowing in the notum caused by asymmetric MyoII distribution. .. 97 Figure 49. Two physically separated contact surfaces above and below the midbody at cytokinesis ........................................................................................................................... 98 Figure 50. The pIIa-pIIb interface is polarized along the apical-basal axis ............................ 99 Figure 51. Structure of the Apr2/3 complex under its active or inactive form ...................... 100 Figure 52. Diversity of Arp2/3 complexes found in cells .................................................... 102 Figure 53. Overview of cellular processes regulated by the Arp2/3 complex....................... 102 Figure 54. Summary of Arp2/3 interactors .......................................................................... 103 Figure 55. Domain structure of NPFs ................................................................................. 104 Figure 56. Activation modes of type I NPFs ....................................................................... 105 Figure 57. Arp2/3-mediated contact expansion as a zipper-like mechanism ........................ 109 Figure 58. WASp is required for correct bristle development in multiple epidermises......... 111 Figure 59. Decreasing Hairless activity is sufficient to rescue the WASp phenotype ............ 112 Figure 60. The neuronal fate is favored in absence of WASp in the RP2 lineage................. 113 Figure 61. Impairing Arp2/3 function does not impair Notch signaling during vein morphogenesis or wing margin formation........................................................................... 114 Figure 62. Alternative functions for the Arp2/3 complex at cytokinesis .............................. 116
Abstract
226
Abstract and Résumé Abstract Interplay between Notch signaling and cytokinesis in the Drosophila sensory organ
lineage
Notch signaling regulates fate specification in lineages among Metazoans. Although its
functional requirement is established, it remains unclear how Notch activity is coordinated
with lineage progression to ensure fate specification between each division round. To address
this question, I used the division of the Drosophila sensory organ precursor cell (SOP) as an
experimental model. During fly development, SOPs divide asymmetrically and generate a
pIIa cell where Notch is activated and a pIIb cell where Notch is turned off. Notch signaling is
mediated in an intralineage manner where pIIb serves as a signal source for pIIa. Following
SOP division, pIIb divides within two hours, thereby constraining pIIa fate acquisition within
this time window. In addition, activation of Notch receptors at cytokinesis was shown to be
required to specify the pIIa fate prior pIIb division. However, the molecular basis for the
Notch-cytokinesis interplay was not determined.
During my thesis, I first developed a strategy based on photobleaching and
photoconversion of fluorophore-tagged Notch receptors to determine Notch activation site
along the pIIa-pIIb interface. By doing so, I demonstrated that, in contrast with former
models, Notch receptors were activated at the lateral side of the pIIa-pIIb interface at
cytokinesis. Using live-imaging, I then provided evidence that the actin regulator Arp2/3 was
recruited to the lateral pIIa-pIIb contact during SOP division to expand the contact area and to
activate Notch receptors via Delta endocytosis. Thereby, Arp2/3 couples cytokinesis to Notch
activation following SOP division.
Keywords: Notch, Arp2/3, cytokinesis, sensory organ precursor cell, Drosophila, live-
imaging,
Résumé
227
Résumé Interaction entre la voie de signalisation Notch et la cytocinèse dans le lignage des soies
sensorielles chez la Drosophile
La voie Notch régule la spécification de destins cellulaires dans les lignages parmi les
Métazoaires. Bien sa nécessité fonctionnelle ait été établie, il est encore mal compris
comment l’activité de la voie se coordonne avec la progression du lignage pour assurer
l’acquisition des destins entre chaque division. Au cours de ma thèse, j’ai utilisé la division de
la cellule précurseur des soies sensorielles (SOP) chez la Drosophile comme modèle pour
comprendre cette coordination. Les SOPs se divisent de manière asymétrique au cours du
développement de la Drosophile et produisent une cellule pIIa, où Notch est activé, et une
cellule pIIb, où Notch est inhibé. Dans ce contexte, la signalisation se fait entre les cellules-
filles. Après la division de la SOP, pIIb se divise à son tour dans les deux heures qui suivent,
ce qui contraint l’acquisition de l’identité pIIa à cette fenêtre temporelle. De plus, des travaux
récents ont montré que les récepteurs Notch doivent être activés à la cytocinèse pour
déterminer l’identité pIIa. Cependant, la nature de l’interaction Notch-cytocinèse n’était pas
déterminée.
Au cours de ma thèse, j’ai d’abord développé une technique de photo-pistage de
récepteurs Notch marqués par des protéines fluorescentes pour déterminer le site de
signalisation le long de l’interface pIIa-pIIb, un prérequis pour comprendre l’interaction
Notch-cytocinèse. Par la suite, j’ai montré que le régulateur d’actine Arp2/3 est recruté
pendant la division de la SOP à l’interface pIIa-pIIb pour étendre le contact et pour activer les
récepteurs via l’endocytose de Delta. Ce faisant, Arp2/3 couple la cytocinèse à l’activation de
la voie Notch pendant la division de la SOP.
Mots-clés : Notch, Arp2/3, cytocinèse, cellule précurseur des soies sensorielles, Drosophile,
imagerie in vivo.