Summary Despite the importance of Eucalyptus spp. in thepulp and paper industry, functional genomic approaches haveonly recently been applied to understand wood formation inthis genus. We attempted to establish a global view of gene ex-pression in the juvenile cambial region of Eucalyptus grandisHill ex Maiden. The expression profile was obtained from se-rial analysis of gene expression (SAGE) library data producedfrom 3- and 6-year-old trees. Fourteen-base expressed se-quence tags (ESTs) were searched against public EucalyptusESTs and annotated with GenBank. Altogether 43,304 tagswere generated producing 3066 unigenes with three or morecopies each, 445 with a putative identity, 215 with unknownfunction and 2406 without an EST match. The expression pro-file of the juvenile cambial region revealed the presence ofhighly frequent transcripts related to general metabolism andenergy metabolism, cellular processes, transport, structuralcomponents and information pathways. We made a quantita-tive analysis of a large number of genes involved in thebiosynthesis of cellulose, pectin, hemicellulose and lignin. Ourfindings provide insight into the expression of functionally re-lated genes involved in juvenile wood formation in youngfast-growing E. grandis trees.

Keywords: cell wall, cellulose, gene expression, lignin, nucle-otide-sugars interconvertions, transcriptome, wood forma-tion.

Introduction

Among plantation tree species, Eucalyptus spp. have the high-est growth rates. In Brazil, Eucalyptus wood is widely used asraw material for the pulp and paper industry. Despite the highproductivity (45–60 m3 ha–1 year–1) of Eucalyptus planta-

tions, increasing demand for cellulose has resulted in woodshortages in recent years. Hence, many efforts are being madeto improve forest productivity.

Wood is formed by the differentiation of cells produced bythe vascular cambium. During differentiation, the xylemmother cells undergo an ordered series of developmental stepsthat include cell division, cell expansion, deposition of the sec-ondary cell wall, lignification and programmed cell death(Larson 1994). The genetic factors controlling wood forma-tion in Eucalyptus are not fully understood, although manygenes involved in wood formation have been identified bylarge-scale genomic approaches in Populus, Pinus and Euca-lyptus (Hertzberg et al. 2001, Lorenz and Dean 2002, Paux etal. 2004). Hertzberg et al. (2001) established a hierarchicalpattern of gene expression through different zones of develop-ing xylem in Populus by isolating cells at different stages ofxylogenesis. Based on microarray analysis, these authorsshowed that genes encoding enzymes involved in celluloseand lignin biosynthesis, as well as a large number of transcrip-tion factors and potential xylogenesis regulators, are understrict control at each xylem differentiation stage. Paux et al.(2004) developed a targeted approach to functional genomicsby constructing a xylem versus leaves subtractive library toidentify genes involved in the control of Eucalyptus wood for-mation. The two main classes of expressed sequence tags(ESTs) preferentially expressed in xylem were related to auxinsignaling through ubiquitin proteolysis and cell wall biosyn-thesis and remodeling. More recently, the induction of tensionwood has been used as a model of wood formation because ofthe high cellulose content and limited lignification of tensionwood (Paux et al. 2005, Andersson-Gunneras et al. 2006).

To investigate gene expression during juvenile wood forma-tion, when tree growth is maximal, we produced two SAGE li-

Tree Physiology 28, 905–919© 2008 Heron Publishing—Victoria, Canada

SAGE transcript profiling of the juvenile cambial region of Eucalyptusgrandis

MAYRA COSTA DA CRUZ GALLO DE CARVALHO,1,2 DANIELLE GREGORIO GOMESCALDAS,1,2 RAPHAEL TOZELLI CARNEIRO,1,2 DAVID HENRY MOON,1,2 GUILLERMORAFAEL SALVATIERRA,1 LÍVIA MARIA FRANCESCHINI,1 ALEXANDER DE ANDRADE,1

PAOLA ALEJANDRA FIORANI CELEDON,1 SHINITIRO ODA3 and CARLOS ALBERTOLABATE1,4

1 Laboratório Max Feffer de Genética de Plantas, Departamento de Genética, Escola Superior de Agricultura “Luiz de Queiroz”, Universidade deSão Paulo, Piracicaba-SP, Brazil

2 These authors contributed equally to this work as first authors3 Suzano Papel e Celulose, Av. Brigadeiro Faria Lima No. 1355, 8° andar, CEP 01452-919, São Paulo-SP, Brazil4 Corresponding author (calabate@esalq.usp.br)

Received August 20, 2007; accepted November 28, 2007; published online April 1, 2008

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

braries (Velculescu et al. 1995) from the juvenile cambial re-gions of 3- and 6-year-old trees of the highly productive Euca-lyptus grandis Hill ex Maiden. We identified 445 genes relatedto cellulose biosynthesis, nucleotide sugar metabolism andlignin biosynthesis, as well as other physiological processesinvolving general metabolism and cellular regulation.

Materials and methods

Plant material

Tissue samples were collected from a half-sibling populationof E. grandis derived from a single mother tree, second gener-ation from a clonal seed orchard, introduced from Coff’s Har-bour, Australia, and kindly provided by Suzano Papel eCelulose. Forty 3-year-old and forty 6-year-old trees weresampled from stands located in Itapetininga, State of SãoPaulo, Brazil (23°35′20″ S, 48°03′11″ W) at an altitude of656 m. The 3- and 6-year-old trees were spaced at 3 × 1.5 mand had a mean height of 18 and 25 m, and a diameter at breastheight (DBH) of 10 and 15 cm, respectively. On the samemorning in the summer of 2003, the cambial region from eachtree was collected by opening a window (20 × 15 cm) in thebark at breast height, scraping the exposed stem tissue and im-mediately freezing the sample in liquid nitrogen (Figures 1aand 1b). The stem tissue was scraped until the fibrous materialbelow the differentiating cells was reached. We also scrapedthe inner side of the bark to ensure that all the meristematicmaterial would be represented in the SAGE libraries. This pro-cedure was first used by Foucart et al. (2006) who showed thatcambial cells adhere to the bark during removal. In the twotransverse sections of Eucalyptus wood (xylem, cambial re-gion and phloem) shown in Figures 1c and 1d, it can be seenthat the meristematic cells tend to stay with the phloem whenthe bark is removed. Two bulked samples, one representing the3-year-old trees and the other the 6-year-old trees, were madeby grinding and mixing all the sampled material.

Young fully expanded leaves from 3-year-old E. grandistrees were collected and immediately frozen in liquid nitrogenand stored at –80 °C until processed for RNA extraction.E. grandis seeds were surface sterilized with hypochlorite,

germinated on agar medium (Murashige and Skoog 1962,0.6% agar) and the hypocotyls harvested after 30 days, frozenand stored at –80 °C. Transverse sections of the hypocotylshowed that the vascular bundles had not fused to form a con-tinuous cambium (Figure 1e).

Extraction of RNA

Total RNA was extracted from 2 g of each bulked sample bythe phenol-based protocol described by Salzman et al. (1999)and quantified spectrophotometrically at 260 nm. Because thesamples oxidized rapidly and contained polyphenol com-pounds, we doubled the extraction buffer volume and in-creased the PVP concentration to 2% (w/v). Before startingthe construction of each serial analysis of gene expression(SAGE) library, the RNA quality was checked spectrophoto-metrically and by RT-PCR analysis using specific primers forthe Eucalyptus gene encoding isocitrate dehydrogenase. Thesame protocol was used to extract total RNA from the leavesand hypocotyls.

SAGE library construction and sequencing

Total RNA (75 µg) was used to construct each library using theI-SAGE Kit (Invitrogen). NlaIII was used as the anchoring en-zyme and BsmFI as the tagging enzyme (Invitrogen T5000-01)to produce 10- to 14-base SAGE tags. The SAGE technique in-volved: (1) ligation of the polyadenylated mRNA to oligo dTmagnetic beads, (2) cDNA synthesis, (3) digestion with NlaIIIwhich cuts at the CATG recognition site, (4) ligation of adapt-ers containing the recognition site for BsmFI and annealingsites for specific primers, (5) digestion with BsmFI cleaving 10bases downstream of the recognition site, (6) ligation of di-gested fragments leaving adapters at the extremities, (7) am-plification and digestion of the products with NlaIII releasingthe ditags, (8) concatamerization of the ditags and purificationof the concatamers (400–800 bp), (9) cloning into pZerO andtransformation of Escherichia coli by electroporation (MicroPulserTM da Bio-Rad). Plasmid DNA extraction from theSAGE clones was carried out with the PureLink Plasmid Puri-fication System (Invitrogen) and inserts were sequenced withthe BigDye Terminator v.3.1 system and the ABI PRISM 3100Genetic Analyzer (Applied Biosystems).

906 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

Figure 1. Sampling of the Eucalyptus grandis stem. (a) Removal of the bark. (b) Harvesting the cambial region by scraping the tissue. (c)Transverse section of E. grandis wood before removal of the bark. (d) Transverse section of E. grandis wood after removal of the bark.(e) Transverse section of the hypocotyl showing the four vascular bundles (arrow). Bars = 100 µm. Abbreviations: X = xylem; and C = cambialregion.

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

Bioinformatics

Because interpretation of the SAGE data is primarily de-pendent on the correct tag-gene association, we adopted fivecriteria for data analysis: (1) all reads from the sequencingwere analyzed with phred (www.phrap.org) and only thosewith q = 20 were selected for tag extraction using SAGE 2000v4.5 (Invitrogen) software; (2) tags with three or more copieswere selected for identification; (3) the CATG site and the tagsequence were used to search a locally constructed databasecontaining publicly available Eucalyptus ESTs and completecDNAs using BLASTn (www.ncbi.nlm.nih.gov); (4) only se-quences where the 10-base tag was immediately after the lastNlaIII recognition site (CATG) before the poly-A tail wereused for annotation; (5) the ESTs representing the tags wereused in BLASTx to find the most similar protein in theGenbank database (E value = e-05). BLASTn was carried outlocally using a database constructed specifically for SAGE tagannotation containing 15,351 sequences. This local databasecontained complete cDNA sequences from some importantgenes and ESTs from four libraries: cDNA library of differen-tiating xylem from Eucalyptus gunnii Hook. (gi 10348194–103473644 and 51555734–515555511); gravity versus mi-crogravity subtracted library from E. globulus Labill.(gi 103484112–103482902 and 103473643–103472139);E. globulus ESTs from juvenile versus mature wood andmature wood versus juvenile wood subtractive libraries(gi 103482899–103481625); and E. gunnii xylem versusphloem subtractive library (gi 84490924–84490662) (seeSupplementary Tables S1 and S2). An explanation of how thetags could be associated with eucalypt sequences using the re-mote BLASTn service at NCBI and the NCBI gi numbers ofthe Eucalyptus sequences used to construct the local databasecan be obtained from the corresponding author.

Because some important enzymes had no associated tagwith three or more copies, we carried out a reverse search us-ing a public protein sequence and tBLASTn to identify an ESTin our local database, extract the tag and confirm its presencein the SAGE database. When a cell-wall-related gene (Fig-ures 2a and 2b) was represented by more than one tag, the re-spective ESTs were aligned using bl2seq (www.ncbi.nlm.nih.gov) to look for potential alternative transcripts.

Functional analysis of the annotated genes expressed in thecambial region was carried out based on the categories de-scribed by Rison et al. (2000) with a few modifications. Thesubcategories vesicle transport and transport factors were in-cluded in the transport category, and the subcategory cy-toskeleton was included in the category structure and organi-zation of cellular structure. Genes associated with the bio-synthesis of cell wall components were also grouped into spe-cific metabolic pathways.

Validation by qRT-PCR

To validate the correlation between tag number and gene ex-pression, mRNA was purified from an aliquot (20 µg) of thesame total RNA used to construct the 3-year-old SAGE library(Dynabeads mRNA purification kit, Dynal Biotech). First

strand cDNA synthesis was carried out with gene-specificprimers and reverse transcriptase (Superscript RT-PCRInvitrogen 10928-034) (Table 1). The real-time reverse-tran-scriptase polymerase chain reaction (qRT-PCR) mix con-tained 400 nM primer, the cDNA equivalent to 240, 24 or2.4 ng total RNA and SYBR green (SYBR Green real-timeRT-PCR SuperMix-UDG 11733-038) in a reaction volume of25 µl. Three replications of each dilution for each gene werecarried out in an iQ5 instrument (BioRad) to determine thethreshold cycle (CT) values and to construct a standard curve tocalculate the amplification efficiencies (E). Melting curves foreach amplified gene were determined between 55 and 95 °C.An arbitrary expression value (V ) was calculated for eachgene based on E exponential to the inverse power of CT (Calsaand Figueira 2007). Estimated V was standardized to the refer-ence gene UDP-glucose pyrophosphorylase (UGPase) and theabsolute and standardized V were correlated (Pearson’s corre-lation) to the relative tag frequencies (TPT) from the SAGE3-year-old cambial region library (Calsa and Figueira 2007).To confirm the preferential expression of some of the genesidentified by SAGE, 10 genes were selected for qRT-PCRanalysis (see Table 2) using NADP isocitrate dehydrogenase(IDH) as the reference gene. The expression levels of mRNAfrom three tissues (cambial region of 3-year-old E. grandistrees, leaves and hypocotyls) were calculated as describedabove and compared.

Results and discussion

SAGE libraries and Eucalyptus juvenile cambial regionexpression profile

The 3- and 6-year-old SAGE libraries were produced by se-quencing 737 and 703 clones and generating 22,660 and22,024 tags, respectively. Based on physico-chemical analysescarried out on seven Eucalyptus species, Oliveira et al. (2005)demonstrated that E. grandis trees with a diameter at breastheight (DBH) of 30 cm still had juvenile wood characteristics.Because our SAGE libraries were produced from trees at thesame developmental stage (DBH less than 30 cm) and thenumber of tags produced by the two libraries was similar, wecombined the sequences from each library and analyzed thedata as a single library.

The SAGE 2000 software extracted 43,304 tags from the se-quencing data and produced 26,958 tags with three or morecopies representing 3066 unique tags or genes. Of these, weassigned ESTs to 659 unique tags. The remaining 2406 tagscould not be associated with any sequence because of the smallnumber of publicly available ESTs and complete cDNAs (Ta-ble 3). However, because the majority of the available ESTswere sequenced from differentiating xylem, we were able toidentify the probable function of 445 genes and produce a tran-scriptional profile for the cambial region of E. grandis that in-cluded the majority of the genes considered to be importantduring growth and wood formation in Eucalyptus species.

Table 4 shows the 50 most highly expressed genes in theE. grandis juvenile cambial region library to which a putative

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 907

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

908 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 909

identity could be attributed. The most highly expressed genewas an isoflavone reductase belonging to the phenylcoumaranbenzylic ether group of reductases that are involved in thebiosynthesis of isoflavonoids and lignans (Shoji et al. 2002)and are positively correlated to increased secondary growth intransgenic poplar trees (Israelsson et al. 2003). An ADP-ribosylation factor, involved in vesicle transport and an al-pha-tubulin were the second and third most highly expressedgenes indicating the importance of cytoskeleton organizationand vesicular transport in the cambium. Also included amongthe 50 most highly expressed genes were cdc2 protein kinaseand CHK1 checkpoint protein, both involved in cell division,indicating that our samples contained meristematic cambialcells at the beginning of the differentiation process. Fourteengenes associated with cell wall biosynthesis were among the50 most expressed genes, two caffeoyl-CoA O-methyl-transfersases (CCoAOMT ) , E. grandis cellulose synthase 1gene (EgCesA1), sucrose synthase, coumarate 3-hydroxylase(C3H) , endo-1,4-β-glucanase (KOR), caffeic acid 3-O-methyltransferase (COMT ) , dirigent-like protein (pDIR10),cinnamyl alcohol dehydrogenase (CAD), chitinase-like pro-tein, cinnamate 4-hydroxylase (C4H), pectinesterase and twoarabinogalactan proteins (Table 4).

Among the most highly expressed genes was an adenosinekinase whose importance in wood formation has recently beenhighlighted. Pereira et al. (2006) demonstrated that Arabi-dopsis mutants with a deficiency in this enzyme producedleaves and hypocotyls with abnormal morphology, probablybecause of the large quantity of low methyl-esterified pectinsin the primary cell wall. These results indicate that adenosinekinases function in the recycling of S-adenosyl-L-methionine-dependent methyltransferases during the process of pectinmethyl-esterification and in the determination of cell adhesionproperties.

The 445 identified genes were assigned to functional cate-gories as proposed by Rison et al. (2000) (see SupplementaryTables S1 and S2). Because the principal advantage of SAGEis the quantification of the expression level of a large numberof genes simultaneously, it was possible to compare expres-sion of groups of functionally related genes by analyzing thenumber of transcripts per gene in each category or subcategory(Table 5). Based on the transcripts per gene ratio, the most ex-pressed categories were Metabolism and energy and Structureand organization, followed by Transport, information path-ways and Cellular processes (Table 5). The analysis alsoshowed that the differences in expression levels within a cate-

gory were higher than the differences between categories.Most of the transcripts in Metabolism and energy were re-

lated to the subcategories Secondary metabolism, Nitrogenmetabolism and Small molecule metabolism (Table 5). Fourgenes included in the Secondary metabolism subcategory rep-resented 86.8% of all transcripts and showed high similarity toisoflavone reductases. In the subcategory Nitrogen metabo-lism, two glutamine synthetase (GS1) genes accounted for93.75% of the transcripts. Similarly, about 81% of the tran-scripts in the subcategory Small molecule metabolism wererepresented by a single adenosine kinase gene. Although thesegenes were included in Metabolism and energy, they also haveimportant roles in the production of precursors required in theprocess of wood formation.

Cells of the cambial region require energy for maintenanceand development; accordingly, among the genes in the subcat-egory Autotrophic and energy (ATP) metabolism we foundgenes associated with glycolysis, TCA cycle, alcoholic fer-mentation and ATP synthesis. In non-photosynthetic organs,carbohydrates are consumed through respiration to produceenergy and carbon skeletons for cellular metabolism and bio-synthesis of structural molecules, including cell wall poly-mers. It is possible that the quantity of free O2 in the cambialregion is limited by the physical barrier imposed by the barkand by respiratory O2 consumption. If so, a proportion of theenergy necessary for secondary growth could be provided byalcoholic fermentation (Kimmerer and Stringer 1988). Thepossible role of alcoholic fermentation as an alternative orprincipal supplier of energy in juvenile E. grandis trees is indi-cated by the presence of alcohol dehydrogenase and pyruvatedecarboxylase transcripts. Other recent studies have reportedthe presence of transcripts or proteins associated with anaero-bic respiration, particularly alcohol dehydrogenase and py-ruvate decarboxylase, during xylem formation and secondarygrowth (Gion et al. 2005, Juan et al. 2006, Ranik et al. 2006,Celedon et al. 2007).

We found genes representing light-induced proteins andcomponents of photosystems I and II in our library. The pres-ence of functional chloroplasts with active photosystems in theouter peridermal layers (chlorenchyma) and in deeper stemtissues such as ray cells and pith, has been reported in manywoody species (Pfanz et al. 2002), which could explain thepresence of transcripts related to photosynthesis in our mate-rial. Supporting this finding, Celedon et al. (2007) identifiedRubisco proteins by LC-MS/MS in the same biological sam-ples used in our study. The outer bark of the stems has a rather

Figure 2. Transcript profiling of genes related to the main biosynthetic routes for cell wall components. For each enzyme, the corresponding tag(s)and its expression level are presented. Tags preceeded by an asterisk (*) have been identified as potential alternative transcripts. (a) Pathways re-lated to sugar-nucleotide interconversions, pectin, hemicellulose and cellulose biosynthesis. (b) Pathways related to lignin biosynthesis. Abbrevia-tions: GT8D, glycosyl transferase family 8D; UXS, UDP-xylose synthase; UGDH, UDP-glucose dehydrogenase; PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate: coenzmye A ligase; CCR, cinnamoyl-coenzyme A reductase; CAD, cinnamoyl alcoholdehydrogenase; C3H, coumarate 3-hydroxylase; HCT, hydroxycinnamoyltransferase; COMT, caffeate/5-hydroxyconiferaldehyde O-methyl-transferase; CCoAOMT, caffeoyl-coenzyme A O-methyltransferase; F5H, ferulic acid/coniferaldehyde 5-hydroxylase; SAMS, S-adenosyl-methionine-synthetase and GS1, cytosolic glutamine synthetase.

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

910 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

Table 1. Gene-specific primers used in qRT-PCR validation and their respective amplification efficiencies (E). For each gene, the representativetag, the copy number observed in the 3-year-old library and the gi of the template sequence are indicated.

Gene Tag (copy no.) gi(NCBI) Primer pairs E

NADP-Isocitrate dehydrogenase (IDH) TACTCAGATG (20) 1750379 Left: CTGTTGAGTCTGGCAAGATGAC 1.98Right: CATTTAATTCCTCCCCAACAAA

S-Adenosylmethionine synthetase (SAMS) GTTCGCCGCT (34) 103482634 Left: TGTCCGTCTTCGTTGATTCTTA 1.93Right: GGCTAACCAATTACCCAATGAG

Cinnamyl alcohol dehydrogenase (CAD) CCCTCTGTTG (24) 2984652 Left: GTTTGTGGTGAAAATCCCAGAT 1.91Right: ATTGACTTCCTCCCAAGCATAA

UDP-Glucose pyrophosphorylase (UGPase) TCGGTCTTAT (15) 103475065 Left: TTCCAGTGAAAGCAACTTCAGA 1.95Right: AAGATGCTTCAAACGGAATTGT

Pectinesterase GGAAAGGCAG (9) 103474979 Left: AGCTTCGCTTCACGAATTTATC 1.94Right: ATCCGTCAAATTCATTCCATTC

4-Coumarate: coenzyme A ligase (4CL) CTATTGTAAT (8) 73665528 Left: ACCGCGAATACCATAGACAAAG 1.88Right: ATTGCTTGATTTCGTCCTCAGT

Caffeoyl-CoA O-methyltransferase AACCTAGAAA (48) 3319277 Left: TCTTCCTGATGACGGAAAGATT 1.97(CCoAOMT) Right: ATAGGGTGTTGTCGTAGCCAATXylan 1,4-beta-xylosidase TAGCCAAACT (2) 103474759 Left: AGAAGGTGTTCTTGGCCTCA 1.92

Right: AGAGGGAGTTCTTGCGAACAUDP-Xylose synthase 4 (UXS4) TCATTATCAA (5) 103473775 Left: GAGGAAGCCCGATATCACAA 1.63

Right: TGTGCCGGTACTGAAGATTGSucrose synthase (SuSy) TGACTAACCT (29) 80973755 Left: GAAATCCTTCCACCCTGAGAT 2.36

Right: TTCATCTCAGACTGCTCTTCCAUDP-Arabinose 4-epimerase TATTGTAAAC (5) 103480449 Left: CACACCGGATGGTACTTGTG 1.82

Right: GTGTATTTCGCCGTCCAGTTAlcohol dehydrogenase (ADH) TATTTCCTGG (3) 103474114 Left: GTGCCCCATAAAGATGCTGT 1.87

Right: TCCGCTTCTTTACTCCTCCAPyruvate kinase (PK) TCCTTTTGAT (12) 103478670 Left: GTCAGTGGTGGTCCCTGTTT 2

Right: CCTTCACTTCACGATGCAGAGlutamine synthetase (GS1) TATATCGTCG (66) 103473664 Left: CGTCAATTAGGGTTGGGAGA 1.81

Right: ATTCCCCACAAGGACAACAA

Table 2. Gene-specific primers used in qRT-PCR validation in different tissues. For each gene, the expressed sequence tag (EST) gi of the templatesequence and the amplification efficiencies (E) in each tissue are indicated.

Gene EST gi Primer pairs E

Cambial Leaves Hypocotyl

NADP-Isocitrate dehydrogenase (IDH) 1750379 Left: CTGTTGAGTCTGGCAAGATGAC 1.75 1.78 1.80Right: CATTTAATTCCTCCCCAACAAA

Caffeoyl-CoA O-methyltransferase 3319277 Left: TCTTCCTGATGACGGAAAGATT 1.86 1.91 1.87(CCoAOMT) Right: ATAGGGTGTTGTCGTAGCCAATCaffeic acid/5-hydroxyferulic acid 3/5-O- 437776 Left: AAATCCTCATGGAAAGCTGGTA 1.69 1.70 1.79methyltransferase (COMT) Right: GTCGAAGTTGATCCCTTTCATCS-Adenosylmethionine synthetase (SAMS) 103482634 Left: TGTCCGTCTTCGTTGATTCTTA 1.78 1.81 1.84

Right: GGCTAACCAATTACCCAATGAGCellulose synthase 1 67003906 Left: CGATCGCAGTGATCGATATG 1.71 1.77 1.80

Right: TCCAAGGTTGAAGATGGCGGCATTCellulose synthase 4 67003912 Left: AGCCAAAGCAGAGAAAGTCA 1.67 1.75 1.78

Right: ATAAGCGTAGAGGCCACAAACellulose synthase 5 67003914 Left: GGGAAGGGTGGCAATAAGAA 1.75 1.76 1.77

Right: AACAGGAGACTGACCGAATCEndo 1,4-β-glucanase (KOR) 70779690 Left: CATTTCACAATCAGACCAGCAT 1.69 1.66 1.74

Right: TGTAGCTCATTTTCCGAGGATTSucrose synthase (SuSy) 80973755 Left: GAAATCCTTCCACCCTGAGAT 1.70 1.97 1.95

Right: TTCATCTCAGACTGCTCTTCCAAlcohol dehydrogenase (ADH) 103474114 Left: GTGCCCCATAAAGATGCTGT 1.64 1.75 1.71

Right: TCCGCTTCTTTACTCCTCCALIM 62087116 Left: GAATCATAAAACGCTTTGATCT 1.698 1.736 1.747

Right: ACAAGACTGAAAAGAAAGCAAG

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 911

low permeability to gaseous diffusion, leading to accumula-tion of CO2 in the intercellular air spaces, which may reachconcentrations 500–800 times those of ambient air (Pfanz etal. 2002). Thus, stem photosynthesis may reduce tissueanaerobiosis thereby promoting dark respiration and ATP pro-duction (Pfanz et al. 2002).

The Cellular processes category was mainly represented bythe subcategory Cell division which showed the highest ratioof transcripts per gene (Table 5). Among the genes in thisclass, were some with similarity to the CDC2 protein kinasegenes, CHK1 checkpoint homolog and translationally con-trolled tumor proteins (TCTP), indicating that our study sam-ple contained the zone of cell division. Although TCTP is be-lieved to be important in cell growth and division in mamma-lian systems (Bommer and Thiele 2004), its exact role in theplant system remains unknown. In pea, TCTP expression is lo-calized in dividing cells within the root cap, suggesting thatthese genes, like their mammalian counterparts, are involvedin cell proliferation (Woo and Hawes 1997). An elevated num-ber of genes involved in the cell cycle were also found in divid-ing cambial cells in Populus (Hertzberg et al. 2001).

Other genes classified in the Cellular processes category, in-cluded those coding for 14-3-3-like proteins and a germin-likeprotein (GLP). The 14-3-3 proteins are multigenic familiespresent in most organisms and involved in the regulation ofmultiplex signal transduction events during the activation of awide variety of target proteins (Ferl 2004). Four genes, with atotal of 46 transcripts, were similar to those of 14-3-3-like pro-teins suggesting a possible role for these proteins in the regula-tion of Eucalyptus juvenile xylem differentiation. The 14-3-3-like proteins were also found in a proteomic study on thesame material indicating a direct link between transcript leveland protein expression (Celedon et al. 2007). Germins andGLPs are part of the cupin super family that is characterized bytwo enzymatic functions, oxalate oxidase and superoxidedismutase. Both enzymes catalyze the production of H2O2

which could be diverted to the oxidative polymerization ofmonolignols during lignification (Mathieu et al. 2006). Thus,there may be a link between the expression of GLP in the

E. grandis cambial region and a role in lignification.Some genes that are important during PCD and autolysis of

vessel elements, such as apoptosis regulator Bcl-2 binding fac-tor (Chintharlapalli et al. 2005), Radical-Induced Cell Death 1protein (RCD1) (Ahlfors et al. 2004), cysteine proteases andsubtilisin serine protease (Moreau et al. 2005), were repre-sented by a large number of transcripts in our library. Thisfinding indicates that all developmental phases of xylogenesiswere included in the material we sampled from the cambialregion.

The high transcripts to gene ratios observed in the subcate-gories Vesicular Transport and Cytoskeleton (Table 5) wereexpected because cell-wall polysaccharides synthesized in theGolgi complex are exported to the cell matrix in Golgi-derivedvesicles through the cytoskeletal network. As well, membraneprotein complexes involved in cellulose synthesis are incorpo-rated into Golgi vesicles, transported through the cytoskeletonnetwork and incorporated into the cell membrane by vesiclefusion (Oda et al. 2005). Hertzberg et al. (2001) observed highexpression of tubulins in poplar cambial regions C and D,where secondary wall synthesis occurs. Among the genes as-sociated with intracellular vesicle transport, we found mem-bers of the small GTPase families, like Ras, Rab and Arf(ADP-rybosylation factors), and annexins (Carrol et al. 1998).We also observed a large number of transcripts for alpha-tubulins, actins, actin depolymerizing factors and profilins.

Two remorins genes were expressed in the cambial materialindicating the probable importance of these genes in vasculardevelopment. Bariola et al. (2004) used monospecific antibod-ies to study tissue localization of remorins and observed thatthe tomato remorin 1 protein is enriched in vascular, meri-stematic and embryonic-type cells. These authors suggestedthat remorins are associated with the cytoskeleton or mem-brane skeleton and help to determine cell integrity or act asscaffolds for signaling in defense or development.

No large differences in transcripts per gene ratios were ob-served among the subcategories within the Information path-ways. However, in the Eucalyptus cambial region we ob-served: class III HD-Zip members similar to the poplarPtaHB1, which is developmentally and seasonally regulated,and closely associated with wood formation in Populus (Ko etal. 2006); a bHLH transcription factor of Arabidopsis; twoethylene transcriptional factors containing the AP2 domain,important in the transition from primary to secondary growthin phloem cells (van Raemdonck et al. 2005); two LIM pro-teins analogous to the E. globulus Lim1; and one E. grandisEgMYB1 linked to lignin biosynthesis regulation (Paux et al.2005). The Eucalyptus ESTs corresponding to the LIM se-quences are similar to the Ntlim1 of Nicotiana tabacum L.which is positively associated with lignin concentration(Kawaoka and Ebinuma 2001).

The Information pathways category included many genesinvolved in the proteasome-ubiquitin pathway, the main pro-teolytic system in plants that is directly or indirectly associatedwith plant hormones (Hellmann and Estelle 2002). TheUb/26S proteasome system has been identified as playing animportant role in the pathways that respond to auxins (Smalle

Table 3. Summary of the SAGE data. *The total tag number of the ju-venile cambial region library is lower than the sum of tags producedby the 3- and 6-year-old libraries because the SAGE software ex-cluded tags originated from duplicate dimers, which are more abun-dant when the libraries are analyzed as one.

Cambial region library

Number of sequenced clones 1440Total number of tags 43,304*Number of singletons (single copy tags) 11,504Number of tags = 3 copies 26,958Number of genes = 3 copies 3066Number of identified genes 445 (14.5%)Number of genes with unknown function 215 (7%)(expressed sequence)Number of tags without EST matches 2406 (78.5%)

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

912 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

and Vierstra 2004), including those involved in cellular differ-entiation in the xylem (Berleth and Sachs 2001, Paux et al.2004).

The Cell wall subcategory had the second highest tran-

scripts per gene ratio of the Structure and organization cate-gory. We identified genes similar to those encodingarabinogalactan proteins, like the poplar FLA13 gene, prefer-entially expressed in differentiating xylem tissue undergoing

Table 4. The 50 most abundant expressed sequence tags (ESTs) for which a putative identity was assigned. Tag sequences are followed by copynumber, putative identity, gi of the most similar protein and E value (score values considered = e-05).

EST sequence Copies EST gi Putative identity gi (NCBI) E value

AATTTCCCAG 472 103473726 Allergenic isoflavone reductase 10764491 2e-87GGATTGCATA 195 103473647 ADP-Ribosylation factor 39653273 2e-42AATTGCTATC 122 103473962 Tubulin alpha-2/alpha-4 chain 110742192 2e-98AGGTTTCTTG 104 103474682 Putative membrane protein (Cytochrome b-561) 50920439 1e-50TATATCGTCG 101 103473664 Cytosolic glutamine synthetase GS1 13924490 5e-18ATTTGCTGTT 97 103474853 Blue copper protein 21553614 8e-35AGACGGAATA 96 103478621 Adenosine kinase 92880884 2e-113GGAACCTCCG 92 103478817 Profilin 85701214 2e-65ATAAGAGTTT 92 103476949 Translation initiation factor 15236989 3e-54GCCGTTCTTA 91 103475739 rRNA Intron-encoded endonuclease 13171103 1e-25TGTGCTGTAG 88 103475094 Cdc2 Protein kinases 3482933 5e-06ATAACTTGAC 75 103479690 CHK1 Checkpoint homolog 89271365 8e-08GAACGCTATC 73 32164273 Cysteine protease 94420703 4e-08AACCTAGAAA 70 1934858 Caffeoyl-CoA O-methyltransferase 3023419 5e-140GAATCAAAAT 63 103478738 Cellulose synthase 1 EgCesA1 67003907 2e-46GTGTCGGGTT 52 103479646 Eukaryotic translation initiation factor 124226 2e-71TGAATCAATA 50 103475306 Putative mitochondrial ATP synthase 48209968 3e-57GTTCGCCGCT 48 103482634 S-Adenosyl methionine synthase-like 78191442 6e-84TGACTAACCT 45 80973755 Sucrose synthase 80973756 0.0AATGAATTGT 45 103474990 Ribosomal protein small subunit 28 21902507 1e-19AACCTGAAAG 44 103479763 Coumarate 3-hydroxylase (CYP98A3) 30688445 1e-30ATCTCTATTG 44 103475041 Alpha tubulin 1 56481443 4e-81GTCATCTCAT 42 103475199 Blue copper protein 562779 1e-39TTGTATGGTT 42 103475156 Thioredoxin peroxidase CATP 40287562 9e-34TATTTGTATT 42 103474845 Caffeoyl-CoA O-methyltransferase 5739373 6e-35GATGGCACTT 42 103477045 Copper chaperone 47176684 5e-30TATTCTTTGA 41 70779690 Endo-1,4-β-glucanase (KOR)/EG2 70779691 7e-15ACCAGGGCCG 41 103474233 Fasciclin-like AGP 13 47717929 4e-26TGGTTCGTTT 40 103474658 Putative beta-subunit of K+ channels 1 3402279 4e-37TGTCCCGGCA 39 103474096 Acyl-CoA-binding protein 19352190 2e-33GTTCTTGGAT 39 103474325 Caffeic acid 3-O-methyltransferase 1169009 0.0TTTTTGGTAC 39 103480433 Protein binding/ubiquitin-protein 15236782 1e-16ATTGTGTCTG 39 103475609 Putative nitrilase-associated protein 21592628 3e-10GATCTCCGAT 38 103478396 Dirigent-like protein pDIR10 88771143 3e-24TAAGTGGCTT 37 103475032 NADH-Plastoquinone oxidoreductase 116617152 5e-70TTGCTTGAGG 37 103476507, Putative multiple stress-responsive 119367488 4e-24

30230103CCCTCTGTTG 37 2984652 Cinnamyl alcohol dehydrogenase 4336893 5e-57CCCTATGGAT 36 103476202 Golgi-associated membrane trafficking 4335768 1e-47GTCTCCCACT 36 103474928 Chitinase-like protein 34016875 4e-51AGAACTTATG 36 103481731 Trans-cinnamate 4-hydroxylase PtreC4H2 67983271 3e-38GTGTGCAAAG 35 88659657 Endo-1,4-β-xylanase 88659658 0.0GGGAATCCGA 35 103476439 Phospholipase C1 6969575 3e-20TAAGTATCGG 35 103475896 Pectinesterase 15234547 6e-20TTGAGGTTTT 35 103476562 Ribosomal protein S30 92872082 7e-09TACTCAGATG 35 1750379 NADP-Isocitrate dehydrogenase (EgICDH) 1750380 0.0CGGGCCGATC 34 84490752 Cytochrome P450 like_TBP 49532956 1e-30CTTTGAAAAA 34 103474983 Arabinogalactan protein-like 21553523 3e-28GAATAAAGAA 34 51555713 Laccase 3805956 2e-08GTGTTTTAGG 34 32163702 Peptidylprolyl isomerase 21886603 7e-44TTGTAGCTCT 33 103479799 PPi-PFK 2499489 2e-82

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

secondary wall thickening (Lafarguette et al. 2004). Althoughplants contain no endogenous chitin, a gene encoding achitinase-like protein was expressed with high frequency inour library. Zhang et al. (2004) characterized a group of chitin-like proteins (CLP) in cotton and showed that they are prefer-entially expressed during secondary cell wall deposition. Sim-ilarly, Aspeborg et al. (2005) observed the expression of aGH19 chitinase-like protein during poplar secondary wall syn-thesis and suggested its importance in secondary cell wall for-mation. Thus, the high expression of a chitinase-like protein in

E. grandis wood-forming tissue could be explained by a possi-ble role in secondary cell wall synthesis.

Validation of the SAGE data

The SAGE results were validated by qRT-PCR with specificprimers for transcripts representing selected tags (Table 1).We used UDP-glucose pyrophosphorylase (UGPase) as thereference gene for standardization of the data because therewas no quantitative difference in its expression between thecambial region and leaf SAGE libraries from E. grandis (datanot shown). The absolute and standardized expression valuesV were positively and significantly (P < 0.01) correlated to theSAGE tag frequencies (Table 6), thus validating the results ob-tained with SAGE. A proteomics study on the same biologicalmaterial showing that some of the most abundant transcripts inthe SAGE library were also the most abundant proteins en-countered in 2-D gels, for example, SAMS, COMT,CCoAOMT, isoflavone reductase, GS1 and adenosine kinase(ADK), support the validity of our SAGE data (Celedon et al.2007).

Six of the ten selected genes (Table 2) were preferentiallyexpressed in the cambial region when compared with their ex-pression profiles in leaves and hypocotyls (Figure 3). Fourgenes coding for proteins involved in lignin biosynthesis(CCoAOMT, COMT, SAMS and LIM) were preferentially ex-pressed in the cambial region. This result was also reflected ingenes coding for enzymes known to be involved in cell wallsynthesis (SuSy) and specifically with one of the cellulosesynthases associated with secondary wall synthesis, CesA1(Ranik and Myburg 2006). Two other cellulose synthases as-sociated with primary cell wall synthesis were also analyzed;CesA4, which showed no difference between leaf andhypocotyl samples; and CesA5, which showed higher expres-sion in leaf and hypocotyl samples. These results corroboratethose of Ranik and Myburg (2006). Expression of KOR wassimilar in all samples independent of growth activity. Theother gene encoded ADH, which showed higher expression inhypocotyls, perhaps because seeds were germinated in agar,which has been shown to induce ADH expression throughanoxic or hypoxic stress (Chung and Ferl 1999). However, nodifference in expression of this gene was observed between the3-year-old-tree cambial material and leaves.

Sugar-nucleotide metabolism related to cell wallbiosynthesis

Sugar-nucleotide metabolism provides the precursors for thebiosynthesis of hemicelluloses and pectins during wood for-mation. These polysaccharides represent 65 and 26–36% ofthe primary and secondary cell walls, respectively (Mell-erowicz et al. 2001). The cross-linked glycans and pectic poly-mers are synthesized from UDP-glucuronate, which can beproduced from UDP-glucose through UDP-glucose dehydro-genase, or from myo-inositol by myo-inositol oxygenase(MIOX). However, no tags representing the key enzymes ofthe myo-inositol pathway were found. To confirm the absenceof MIOX, the protein sequences coded by the four ArabidopsisAtMIOX genes (1, 2, 4 and 5) were used to BLAST (tBLASTn)

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 913

Table 5. Transcription profile of the identified genes based on func-tional categories and subcategories.

Functional categories Genes Transcript Transcriptsno. per gene

Metabolism and energyAutotrophic and energy 61 849 13.91(ATP) metabolismCarbon metabolism 1 3 3Carbohydrate metabolism 23 248 10.78Nitrogen metabolism 3 112 37.33Amino acid metabolism 18 226 12.55Lipid metabolism 4 63 15.75Small molecules metabolism 6 118 19.66Secondary metabolism 8 560 70Total 124 2179 17.57

Cellular processesCell division 9 258 28.6Signal transduction 26 266 10.23Cell regulation 26 235 9.04Protection responses/ 22 272 12.36detoxificationResponses to stimuli 3 23 7.66Total 86 1054 12.25

TransportLarge molecules 5 25 5Small molecules 8 86 10.75Vesicular 20 439 21.95Kinesins/transport factors 3 20 6.66Total 36 570 15.83

Structure and organizationCell envelope/membrane 7 67 9.57Cell wall 41 901 21.97Cytoskeleton 15 385 25.66Ribosomal RNAs/proteins 41 416 10.14Chromosome related 3 12 4Total 107 1781 16.64

Information pathwaysDNA synthesis/degradation/ 3 32 10.66modificationRNA synthesis/degradation/ 19 230 12.10modificationProtein synthesis/degradation/ 70 931 13.3modificationTotal 92 1193 12.96

Total identified 445 6777 –

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

the local Eucalyptus EST database and no significant similar-ity was found. If MIOX were a key enzyme in the productionof UDP-glucuronate in Eucalyptus cambium, it would be rep-resented in the xylem-specific EST libraries and, as such, berepresented in our SAGE library. Seitz et al. (2000) demon-

strated a predominance of UDP-glucose dehydrogenase inArabidopsis meristems, growing roots and vascular tissues,whereas the inositol oxidation pathway was predominant inyoung hypocotyls and cotyledons.

UDP-Glucose dehydrogenase (UGDH) and UDP-glucur-

914 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

Table 6. Correlation analysis between SAGE tags frequencies (tags per thousand, TPT) and the expression values obtained from qRT-PCR (ampli-fication efficiency exponential to the inverse power of CT, V ) . Correlation coefficients (r) were estimated based on absolute TPT and V values andon the normalized TPT and V values (adopted reference gene was UGPase).

Gene CT ± SD Absolute Normalized

TPT V (10–5) TPT V (10–5)

UDP-Glucose pyrophosphorylase (UGPase) 13.65 ± 0.09 0.6619 10.9908 1 1Pectinesterase 15.52 ± 0.04 0.3972 3.4076 0.6000 0.3100Caffeoyl-CoA O-methyltransferase (CCoAOMT) 12.87 ± 0.18 2.1183 16.2593 3.2000 1.4793S-Adenosylmethionine synthetase (SAMS) 12.51 ± 0.25 1.5004 26.8247 2.2667 2.4406Cinnamyl alcohol dehydrogenase (CAD) 14.03 ± 0.12 1.0591 11.3831 1.6000 1.03574-Coumarate: coenzyme A ligase (4CL) 13.61± 0.02 0.3530 18.5306 0.5333 1.6860NADP-Isocitrate dehydrogenase (IDH) 13.58 ± 0.34 0.8826 9.3411 1.3333 0.8499β-Xylosidase 20.87 ± 0.63 0.0883 0.1226 0.1333 0.0111UDP-Xylose synthase 4 (UXS4) 25.89 ± 0.34 0.2206 0.3205 0.3333 0.0292Sucrose synthetase (SuSy) 9.77 ± 0.01 1.2798 22.6352 1.9333 2.0595UDP-Arabinose 4 epimerase 16.06 ± 0.05 0.2206 6.6686 0.3333 0.6067Alcohol dehydrogenase (ADH) 14.39 ± 0.15 0.1324 12.2748 0.2000 1.1168Pyruvate kinase (PK) 14.26 ± 0.07 0.5296 5.0864 0.8000 0.4628Glutamine synthetase (GS) 12.81 ± 0.10 2.9126 50.0193 4.4000 4.5510

r (12) = 0.85, P < 0.01 r (12) = 0.85, P < 0.01

Figure 3. Comparison of the ex-pression levels of 10 genes inthree tissues by qRT-PCR. The yaxes represent the expression val-ues (V) (E–CT) and the x axes rep-resent tissues, where C = cambialregion, L = leaves and H = hypo-cotyls. Abbreviations:CCoAOMT, caffeoyl-CoAO-methyltransfersase; COMT,caffeic acid/5-hydroxyferulic acid3/5-O-methyltransferase; SAMS,S-adenosylmethionine synthase ;CesA1, cellulose synthase 1;CesA4, cellulose synthase 4;CesA5, cellulose synthase 5;KOR, endo-1,4-β-glucanase;SuSy, sucrose synthase; ADH, al-cohol dehydrogenase; and LIM,Lim gene.

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 915

onate decarboxylase (UXS), responsible for UDP-glucuronateand UDP-xylose production, respectively, were representedby highly frequent tags (Figure 2a). However, we observedonly one UGDH tag with 22 copies, and the total expression ofthe three UXS tags totaled 47 copies. This expression patternis consistent with previous findings of low UGDH activitycompared with the activities of other enzymes in subsequentreaction steps in the same pathway, suggesting its rate-limitingfunction in the synthesis of matrix polysaccharides(Dalessandro and Northcote 1977). Among the three UGDHisoforms present in poplar, only one is up-regulated duringsecondary cell wall formation (Hertzberg et al. 2001,Johansson et al. 2002) and our tag is similar to the poplarisoform (gi 61645910).

Among the UXS tags (Figure 2a), one (TACTCGGTTG)with 27 copies is associated with the Arabidopsis AtUXS3 sol-uble form. The other two, occurred at a frequency of 20 copiesand are associated with the Arabidopsis AtUX4 Golgi mem-brane form (Harper and Bar-Peled 2002). A more detailedanalysis of the ESTs associated with the AtUXS4 tags revealedthat the TCATTATCAA tag was present in both ESTs se-quences, 27 and 146 bp from the poly-A, suggesting that twoalternative transcripts of AtUXS4-like gene are expressed inE. grandis wood-forming tissues althought further results areneeded to confirm this.

Besides UDP-xylose production, another important UDP-glucuronate-derived branch leads to pectin metabolism. Pecticpolymers are important in primary cell walls where they com-prise about 47% of the polysaccharides. Despite the impor-tance of pectin in cell wall structure, only a few genes respon-sible for pectin biosynthesis have been identified. We foundonly one tag with low expression associated with the poplarPttGTD8 gene (Figure 2a), a glycosyl transferase belonging tothe same subgroup as Arabidopsis QUASIMODO 1 (QUA1).QUA1 may be involved in pectin biosynthesis because thehomogalacturonan-deficient phenotype is shown by QUA1mutants (Bouton et al. 2002). Another indication that theGT8D gene is involved in pectin synthesis was demonstratedby the positive correlation in the reduction in PttGT8D expres-sion and reduced hemicellulose concentration in poplar ten-sion wood (Andersson-Gunneras et al. 2006). In addition,Aspeborg et al. (2005) showed co-expression of GT8D withthe secondary-cell-wall-related CesA genes suggesting a po-tential role in cell wall synthesis.

In dicotyledonous plants, the primary cell wall consists ba-sically of a cellulose microfibril framework embedded in apolysaccharide matrix of pectin and cross-linked glycans(Carpita and Gibeaut 1993). During cell extension, modifica-tions in the structure and composition of the cross-linked pec-tin xyloglucans occur (Bourquin et al. 2002). For example,xyloglucan endotransglycosylases (XETs) are responsible forcell wall remodeling during primary cell wall biosynthesis bycutting and rejoining the xyloglucan chains. During secondarycell wall deposition, XETs create and reinforce the connec-tions between primary and secondary wall layers (Bourquin etal. 2002). Despite the importance of XETs in cell wall remod-eling, we found only one XET tag with 19 copies. An in-

creased number of transcripts for pectinesterases and pectatelyases were observed during increased secondary growth inpoplar tension wood (Andersson-Gunneras et al. 2006). Underthe normal growth conditions, we observed two pectin-esterases tags at a frequency of 35 and 11 copies and onepectate lyase tag with four copies in the cambial region library.In contrast to the 11 highly expressed genes identified in activepoplar cambium by Geisler-Lee et al. (2006), we found onlyone tag representing polygalacturonase with low expression inour library (Figure 2a).

Cellulose biosynthesis

Current models of cellulose biosynthesis involve both CesAproteins and membrane-associated proteins like KORRIGAN(endo-1,4-β-glucanase) and SuSy (sucrose synthase) (Joshi etal. 2004). Five tags corresponding to E. grandis EgCesA geneswere identified, one showing high similarity to the primary-cell-wall-related cellulose synthase gene EgCesA4, and fourshowing high similarity to the secondary-cell-wall-relatedgenes EgCesA1, EgCesA2 and EgCesA3 (Figure 2a). Two tags(AATTGATATG and GAATCAAAAT) represented theEgCesA1 gene, the first tag occurred in both EST sequences ata distance of 151 and 30 bp from the poly-A tail, indicatingpossible alternative transcripts.

According to Ranik and Myburg (2006), genes implicatedin Eucalyptus secondary wall formation (EgCesA1, EgCesA2and EgCesA3) have higher expressions than genes involved inprimary cell wall formation (EgCesA4, EgCesA5 andEgCesA6) in xylem. We observed similar transcriptional pro-files for primary cell wall EgCesA genes. The EgCesA4 geneshowed low expression (Figure 2a), and the EgCesA5 andEgCesA6 genes were represented as single-copy transcripts(data not shown). The higher expression of the secondary-cell-wall-associated CesA genes was expected because oursample contained more cells from the xylem-side of thecambial region. Ranik and Myburg (2006) reported thatEgCesA3 gene was the most abundantly expressed CesA genein secondary xylem. In contrast, our results indicated thatEgCesA1 was the most abundantly expressed (a total of 71copies) cellulose synthase gene in the E. grandis juvenile-wood-forming tissue (Figure 2a). This discrepancy is of inter-est because Ranik et al. (2006), using cDNA-AFLPs identifiedseveral transcript-derived fragments from immature and ma-ture xylem of a highly productive E. grandis × E. nitens hybridtree, reported that a secondary-cell-wall cellulose synthasegene, similar to Arabidopsis AtCesA8, Populus PtrCesA1 andEucalyptus EgCesA1 (Ranik and Myburg 2006), was stronglyup-regulated in xylem tissues.

The pool of UDP-glucose destined for cellulose synthesiscan be produced either by UDP-glucose pyrophosphorylase orby sucrose synthase. In our study, the higher frequency ofSuSy transcripts compared with UDP-glucose pyrophospho-rylase transcripts indicates that SuSy activity is probably themain source of UDP-glucose for cellulose synthesis in differ-entiating xylem of E. grandis (Figure 2a). SuSy transcriptswere the most abundant CAZyme transcripts in poplar andhave been shown to be highly expressed during secondary cell

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

916 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

wall biosynthesis in tension wood formation (Andersson-Gunneras et al. 2006). The membrane-associated SuSy wasdetected in developing cotton fibers giving rise to a functionalmodel for cellulose biosynthesis where this enzyme directlychannels UDP-glucose to the membrane-bound cellulose syn-thesis complex, thereby avoiding competition from the cellu-lar metabolic pool of UDP-glucose, and facilitating more effi-cient cellulose synthesis (Amor et al. 1995), which is impor-tant during active secondary growth.

The primer-mediated model for cellulose biosynthesis con-siders that an endo-1,4-β-glucanase (KORRIGAN) cleaves thegrowing β-1,4-glucan chain from the primer and transfers thechain to another CesA protein allowing further glucan chainelongation (Doblin et al. 2002). Supporting this idea, an endo-1,4-β-glucanase gene was shown to be preferentially ex-pressed in Eucalyptus secondary xylem (Paux et al. 2004).Our results indicate a role for endo-1,4-β-glucanase inE. grandis wood-forming tissue because of the large numberof transcripts observed (Figure 2a). The more frequentKORRIGAN tag (41 copies) is similar to the E. globulus endo-1,4-β-glucanase gene (EG2), whereas the other tag (three cop-ies) is similar to EG1. In general, the similar expression levelsof the genes encoding KORRIGAN, EgCesA1 and SuSy (Fig-ure 2a) fit the proposed model for cellulose biosynthesis (Joshiet al. 2004).

Lignin biosynthesis

The phenylpropanoid pathway starts with the deamination ofphenylalanine to cinnamic acid by phenylalanine ammonia-lyase (PAL). Cinnamic acid is then converted to coumaric acidby cinnamate 4-hydroxylase (C4H) and diverted tomonolignol synthesis (Figure 2b). Both PAL and C4H wererepresented by highly frequent tags (Figure 2b). Two PALgenes, one with 30 copies, showed high similarity to theArabidopsis AtPAL1 gene, and one with only three copies, wassimilar to both AtPAL1 and AtPAL2. The alignment of the twoESTs indicates that they represent different genes. AtPAL1 andAtPAL2 are believed to be the most important genes in ligninsynthesis during vascular lignification among the fourArabidopsis PAL genes (Raes et al. 2003). An EST represent-ing C4H (with 36 copies) was similar to the poplar PtreC4H2gene, which is more xylem specific than the PtreC4H1, andmore weakly expressed in phloem (Lu et al. 2006).

Only one tag representing the 4-coumarate:coenzyme Aligase (4CL) gene (Figure 2b) was identified with high simi-larity to the 4CL1 gene from E. camaldulensis Dehnh. The4CL enzyme produces CoA thioesters of the hydroxycinnamicacids p-coumaryl alcohol, coniferyl alcohol and sinapyl alco-hol which are precursors of p-hydroxyphenyl (H), guaiacyl(G) and syringyl (S) lignin subunit synthesis, respectively. Apoplar 4CL gene was reported to be up-regulated in the cam-bial zone undergoing lignification (Hertzberg et al. 2001) con-firming its role in the initial steps of lignin synthesis. Ligninpolymers in angiosperm wood are composed of large amountsof G and S units, whereas only small amounts of H units areadded. This is because H units are predominantly deposited in

the middle lamella and cell corners followed by G units, whichare mainly laid down in the secondary wall, and S units that aredeposited during the late stages of lignification (Lewis 1999).Thus, it is expected that the key enzymes in the biosynthesis ofthe monolignols G and S will show higher expression levelsduring secondary growth. Genes for caffeic acid/5- hydroxyfe-rulic acid 3/5-O methyltransferase (COMT), caffeoyl coen-zyme A O-methyltransferase (CCoAOMT) and S-adenosyl-methionine synthase (SAMS) showed higher expression levelsthan those for 4CL and cinnamoyl-CoA reductase (CCR)(Figure 2b). These results agree with Paux et al. (2005), whosuggested that the expression of 4CL, CCR and CAD is under acommon transcriptional control while COMT and CCoAOMTform another co-regulated transcriptional cluster. In support ofthis hypothesis, similar expression profiles for the COMT andCCoAOMT genes were also observed by Hertzberg et al.(2001).

The determining step for the diversion of p-coumaryl-CoAfor G and S monolignols synthesis is its conversion top-coumaroyl shikimic acid/quinic acid by hydroxycinnam-oyltransferase (HCT), because p-coumarate 3-hydroxylase(C3H) cannot use p-coumaryl-CoA as substrate (Schoch et al.2001). It has been shown that p-coumaroyl shikimate andp-coumaroyl quinate are important intermediates in thephenylpropanoid pathway with HCT acting both upstream anddownstream of C3H in the production of caffeoyl CoA(Hoffmann et al. 2004). The EST representing the C3H genewas similar to the Arabidopsis CYP98A3 gene whose expres-sion is more evident in lignifying vascular cells (Nair et al.2002), and its expression was almost four times greater thanthat of HCT (Figure 2b). Alternatively, C3H can act onp-coumaric acid precursors producing caffeic acid which inturn can be diverted to ferulate, by COMT, or to caffeoyl CoA,by 4CL (Figure 2b).

Although COMT was first believed to convert caffeic acidinto ferulate (Dixon 2001), it was subsequently shown thatCOMT preferentially catalyzes the conversion of 5-hydroxy-ferulate, 5-hydroxyconiferaldehyde and 5-hydroxyconiferylalcohol into sinapic acid, sinapaldehyde and sinapyl alcohol,respectively, and thus acts preferentially on ferulic acid andconiferaldehyde 5-hydroxylase (F5H) derived products(Parvathi et al. 2001). A differential regulation for F5H andCOMT genes is supported by recent findings obtained througha proteomics approach where F5H proteins were not foundamong the expressed proteins during poplar cambial regenera-tion, whereas COMT isoforms were detected at all stages(Juan et al. 2006). Consistent with this result, our data showedthat COMT transcript abundance was almost twice that of theF5H transcripts (Figure 2b).

Based on our results, CCoAOMT has the highest expressionlevel of all the genes involved in lignin biosynthesis inE. grandis wood-forming tissue (Figure 2b). This finding is inagreement with the results of Paux et al. (2004) who reported apreferential expression of CCoAOMT during Eucalyptuswood formation. CCoAOMT adds a methyl radical to caffeoylCoA, producing feruloyl CoA in an alternative route formonolignol production (Zhong et al. 1998). The importance of

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 917

this alternative route was demonstrated by the down regulationof CCoAOMT in transgenic tobacco and poplar plants leadingto an altered S/G ratio and significantly decreased lignin con-tent (Zhong et al. 1998, Zhong et al. 2000). Because the num-ber of CCoAoMT transcripts is higher than the number ofCOMT transcripts, the S and G units are probably synthesizedpreferentially from caffeoyl CoA in E. grandis.

Expression of both the CCoAOMT and SAMS genes washigh in our library (Figure 2b), although a common tran-scriptional regulatory system for these genes is unknown. Al-though SAMS is a housekeeping enzyme involved in me-thionine metabolism, its activity has been detected in xylemtissue undergoing secondary growth (Juan et al. 2006). Ac-cording to Cantón et al. (2005), SAMS may provide methylgroups consumed locally by CCoAOMT and COMT, thus en-suring high rates of lignification. Confirming the importanceof SAMS in xylem formation/lignification, three spots repre-senting this protein were identified in a proteomics study withthe same 3- and 6-year-old Eucalyptus juvenile cambial region(Celedon et al. 2007).

During the first step in phenylpropanoid biosynthesis, cata-lyzed by PAL, extensive amounts of ammonium are liberatedby phenylalanine deamination, and an efficient system to recy-cle nitrogen is needed to prevent a severe N deficiency inplants during active lignification (Cantón et al. 2005). Cantónet al. (2005) proposed a mechanism in which the liberated ni-trogen is locally recycled and re-incorporated into glutamineby GS1 (glutamine synthetase). Our results indicate a role forthe GS1 gene during lignification because GS1 showed highexpression (101 copies), the fifth highest among the 50 mostexpressed genes in the E. grandis juvenile cambial region li-brary (Figure 2b), which is in agreement with the results ofCeledon et al. (2007) showing the presence of GS1 in the Eu-calyptus cambial region.

The final step in lignin biosynthesis is the polymerization ofmonolignols catalyzed by peroxidases and laccases (Baucheret al. 2003). No peroxidases were represented in our library,even though two E. globulus peroxidases (gi 88659655 and88659653) are present in the Eucalyptus EST database. Thisfinding suggests low expression of these isoforms or expres-sion of other peroxidase isoforms unrepresented in public da-tabases and does not rule out the participation of peroxidasesduring monolignol polymerization. Although the role oflaccases in lignin polymerization remains a matter of debate,their importance during wood formation has been reported(Paux et al. 2004), and our results corroborate the potentialrole of laccases in lignin polymerization during Eucalyptuswood formation (Figure 2b). Supporting this idea, no signifi-cant decrease in peroxidase expression was observed in poplartension wood (characterized by decreased lignin content),whereas the laccase gene lac3 was co-regulated with the ligninbiosynthesis genes (Andersson-Gunneras et al. 2006).

Hertzberg et al. (2001) demonstrated the induction of adirigent-like protein during lignification and secondary xylemcell wall formation. Dirigent proteins can bind to sites local-ized mainly in the S(1) sublayer and mediate monolignol cou-

pling during the assembly of the lignin biopolymer (Burlat etal. 2001). We observed two tags representing dirigent proteingenes from Picea glauca, pDIR18 with low expression andpDIR10 with higher expression (Figure 2b). Thus, in accor-dance with their probable functions and their expression levelsin our study, it seems likely that both laccases and dirigent pro-teins are involved in lignification in E. grandis juvenile wood-forming tissues.

In conclusion, we used SAGE to investigate the expressionof genes involved in wood formation in the cambial region ofjuvenile E. grandis trees. We identified 445 genes that repre-sented all functional categories necessary for the maintenanceof an actively growing tissue. Our data offer insight into theexpression of functionally related genes directly and indirectlyinvolved in cell wall biosynthesis during the first years of de-velopment of fast-growing Eucalyptus trees.

Acknowledgments

This work was supported by FAPESP Innovation Technology (proc.01/11080-8), CNPq and CAPES. We thank Suzano Papel e Celulosefor the biological material and financial support. We also thankJuliano Bragatto and Maria A.R. Chavez Bermudez for the anatomi-cal illustrations, and Dr. João Lúcio de Azevedo (Laboratório deGenética de Microrganismos-ESALQ/USP) for the use of the iQ5 in-strument (BioRad).

References

Ahlfors, R., S. Lang, K. Overmyer et al. 2004. Arabidopsis RADI-CAL-INDUCED CELL DEATH1 belongs to the WWE protein–protein interaction domain protein family and modulates abscisicacid, ethylene, and methyl jasmonate responses. Plant Cell 16:1925–37.

Amor, Y., C.H. Haigler, S. Johnson, M. Wainscott and D.P. Delmer.1995. A membrane-associated form of sucrose synthase and its po-tential role in synthesis of cellulose and callose in plants. Proc.Natl. Acad. Sci. USA 92:9353–9357.

Andersson-Gunnerås, S., E.J. Mellerowicz, J. Love et al. 2006. Bio-synthesis of cellulose-enriched tension wood in Populus: globalanalysis of transcripts and metabolites identifies biochemical anddevelopmental regulators in secondary wall biosynthesis. Plant J.45:144–165.

Aspeborg, H., J. Schrader, P.M. Coutinho et al. 2005. Carbohy-drate-active enzymes involved in the secondary cell wall bio-genesis in hybrid aspen. Plant Physiol. 137:983–997.

Bariola, P.A., D. Retelska, A. Stasiak, R.A. Kammerer, A. Fleming,M. Hijri, S. Frank and E.E. Farmer. 2004. Remorins form a novelfamily of coiled coil-forming oligomeric and filamentous proteinsassociated with apical, vascular and embryonic tissues in plants.Plant Mol. Biol. 55:579–594.

Baucher, M., C. Halpin, M. Petit-Conil and W. Boerjan. 2003. Lignin:genetic engineering and impact on pulping. Crit. Rev. Biochem.Mol. Biol. 38:305–350.

Berleth, T. and T. Sachs. 2001. Plant morphogenesis: long-distancecoordination and local patterning. Curr. Opin. Plant Biol. 4:57–62.

Bommer, U.A. and B.J. Thiele. 2004. The translationally controlledtumour protein (TCTP). Int. J. Biochem. Cell Biol. 36:379–85.

Bourquin, V., N. Nishikubo, H. Abe et al. 2002. Xyloglucan endo-transglycosylases have a function during the formation of second-ary cell walls of vascular tissues. Plant Cell 14:3073–3088.

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

Bouton, S., E. Leboeuf, G. Mouille, M. Leydecker, J. Talbotec,F. Granier, M. Lahaye, H. Höfte and H. Truong. 2002.QUASIMODO1 encodes a putative membrane-bound glycosyl-transferase required for normal pectin synthesis and cell adhesionin Arabidopsis. Plant Cell 14:2577–2590.

Burlat, V., M. Kwon, L.B. Davin and N.G. Lewis. 2001. Dirigent pro-teins and dirigent sites in lignifying tissues. Phytochemistry 57:883–897.

Calsa, Jr., T. and A. Figueira. 2007. Serial analysis of gene expressionin sugarcane (Saccharum spp.) leaves revealed alternative C4 me-tabolism and putative antisense transcripts. Plant Mol. Biol. 63:745–762.

Cantón, F.R., M.F. Suárez and F.M. Cánovas. 2005. Molecular as-pects of nitrogen mobilization and recycling in trees. Photosynth.Res. 83:265–278.

Carpita, N. and D.M. Gibeaut. 1993. Structural models of primary cellwalls in flowering plants: consistency of molecular structure withthe physical properties of the walls during growth. Plant J. 3:1–30.

Carroll, A.D., C. Moyen, P. van Kesteren, F. Tooke, N. Battey andC. Brownlee. 1998. Ca21, annexins, and GTP modulate exocytosisfrom maize root cap protoplasts. Plant Cell 10:1267–1276.

Celedon, P.A.F., A. Andrade, K.G.X. Meireles et al. 2007. Proteomicanalysis of the cambial region in juvenile Eucalyptus grandis atthree ages. Proteomics 7:2258–2274.

Chintharlapalli, S.R., M. Jasti, S. Malladi, K.V.L. Parsa, R.P. Ball-estero and M. Gonzalez-Garcia. 2005. BMRP is a Bcl-2 bindingprotein that induces apoptosis. J. Cell. Biochem. 94:611–626.

Chung, H.J. and R.J. Ferl. 1999. Arabidopsis alcohol dehydrogenaseexpression in both shoots and roots is conditioned by root growthenvironment. Plant Physiol. 121:429–436.

Dalessandro, G. and D.H. Northcote. 1977. Possible control sites ofpolysaccharide synthesis during cell growth and wall expansion ofpea seedlings (Pisum sativum L.). Planta 134:39–44.

Dixon, R.A. 2001. Natural products and plant disease resistance. Na-ture 411:843–847.

Doblin, M.S., I. Kurek, D. Jacob-Wilk and D.P. Delmer. 2002. Cellu-lose biosynthesis in plants: from genes to rosettes. Plant CellPhysiol. 43:1407–1420.

Ferl, R.J. 2004. 14-3-3 protein: regulation of signal-induced events.Physiol. Plant. 120:173–178.

Foucart, C., E. Paux, N. Ladouce, H. San-Clemente, J. Grima-Pettenati and P. Sivadon. 2006. Transcript profiling of a xylem vsphloem cDNA subtractive library identifies new genes expressedduring xylogenesis in Eucalyptus. New Phytol. 170:739–752.

Geisler-Lee, J., M. Geisler, P.M. Coutinho et al. 2006. Poplar carbo-hydrate-active enzymes. Gene identification and expression analy-sis. Plant Physiol. 140:946–962.

Gion, J., C. Lalanne, G. Le Provost et al. 2005. The proteome of mari-time pine wood forming tissue. Proteomics 5:3731–3751.

Harper, A.D. and M. Bar-Peled. 2002. Biosynthesis of UDP-Xylose.Cloning and characterization of a novel Arabidopsis gene family,UXS, encoding soluble and putative membrane-bound UDP-glucuronic acid decarboxylase isoforms. Plant Physiol. 130:2188–2198.

Hellmann, H. and M. Estelle. 2002. Plant development: regulation byprotein degradation. Science 297:793–97.

Hertzberg, M., H. Aspeborg, J. Schrader et al. 2001. A transcriptionalroadmap to wood formation. Proc. Nat. Acad. Sci. USA 98:14,732–14,737.

Hoffmann, L., S. Besseau, P. Geoffroy, C. Ritzenthaler, D. Meyer,C. Lapierre, B. Pollet and M. Legrand. 2004. Silencing of hydroxy-cinnamoyl-coenzyme A shikimate/quinate hydroxycinnamoyl-transferase affects phenylpropanoid biosynthesis. Plant Cell 16:1446–1465.

Israelsson, M., M.E. Eriksson, M. Hertzberg, H. Aspeborg, P. Nilssonand T. Moritz. 2003. Changes in gene expression in the wood-forming tissue of transgenic hybrid aspen with increased secondarygrowth. Plant Mol. Biol. 52:893–903.

Johansson, H., F. Sterky, B. Amini, J. Lundeberg and L.A. Klecz-kowski. 2002. Molecular cloning and characterization of a cDNAencoding poplar UDP-glucose dehydrogenase, a key gene of hemi-cellulose/pectin formation. Biochim. Biophys. Acta 1576: 53–58.

Joshi, C.P., S. Bhandari, P. Ranjan, U.C. Kalluri, X. Liang, T. Fujinoand A. Samuga. 2004. Genomics of cellulose biosynthesis in pop-lars. New Phytol. 164:53–61.

Juan, D., X. Hong-Li, Z. De-Qiang, W. Min-Jie, L. Ying-Zhang,C. Ke-Ming and L. Meng-Zhu. 2006. Regeneration of the second-ary vascular system in poplar as a novel system to investigate geneexpression by a proteomic approach. Proteomics 6:881–895.

Kawaoka, A. and H. Ebinuma. 2001. Transcriptional control of ligninbiosynthesis by tobacco LIM protein. Phytochemistry 57:1149–1157.

Kimmerer, T.W. and M.A. Stringer. 1988. Alcohol dehydrogenaseand ethanol in the stems of trees: evidence for anaerobic metabo-lism in the vascular cambium. Plant Physiol. 87:693–697.

Ko, J., C. Prassinos and K. Han. 2006. Developmental and seasonalexpression of PtaHB1, a Populus gene encoding a class III HD-Zipprotein, is closely associated with secondary growth and inverselycorrelated with the level of microRNA (miR166). New Phytol.169:469–478.

Lafarguette, F., J.C. Leple, A. Dejardin, F. Laurans, G. Costa,M.C. Lesage-Descauses and G. Pilate. 2004. Poplar genes encod-ing fasciclin-like arabinogalactan proteins are highly expressed intension wood. New Phytol. 164:107–121.

Larson, P.R. 1994. The vascular cambium: development and struc-ture. Springer-Verlag, Berlin, 725 p.

Lewis, N.G. 1999. A 20th century roller coaster ride: a short accountof lignification. Curr. Opin. Plant Biol. 2:153–162.

Lorenz, W.W. and J.F.D. Dean. 2002. SAGE profiling and demonstra-tion of differential gene expression along the axial developmentalgradient xylem in loblolly pine (Pinus taeda). Tree Physiol. 22:301–310.

Lu, S., Y. Zhou, L. Li and V.L. Chiang. 2006. Distinct roles ofcinnamate 4-hydroxylase genes in Populus. Plant Cell Physiol.47:905–914.

Mathieu, M., M.A. Lelu-Walter, A.S. Blervacq, H. David, S. Hawkinsand G. Neutelings. 2006. Germin-like genes are expressed duringsomatic embryogenesis and early development of conifers. PlantMol. Biol. 61:615–627.

Mellerowicz, E.J., M. Baucher, B. Sundberg and W. Boerjan. 2001.Unravelling cell wall formation in the woody dicot stem. PlantMol. Biol. 47:239–274.

Moreau, C., N. Aksenov, M.G. Lorenzo, B. Segerman, C. Funk,P. Nilsson, S. Jansson and H. Tuominen. 2005. A genomic ap-proach to investigate developmental cell death in woody tissues ofPopulus trees. Genome Biol. 6:1–14.

Murashige, T. and F. Skoog. 1962. A revised medium for rapid growthand bioassays with tobacco tissue culture. Physiol. Plant. 15:473–497.

Nair, R.B., Q. Xia, C.J. Kartha, E. Kurylo, R.N. Hirji, R. Datla andG. Selvaraj. 2002. Arabidopsis CYP98A3 mediating aromatic3-hydroxylation. Developmental regulation of the gene, and ex-pression in yeast. Plant Physiol. 130:210–220.

Oda, Y., T. Mimura and S. Hasezawa. 2005. Regulation of secondarycell wall development by cortical microtubules during tracheary el-ement differentiation in Arabidopsis cell suspensions. PlantPhysiol. 137:1027–1036.

918 GALLO DE CARVALHO ET AL.

TREE PHYSIOLOGY VOLUME 28, 2008

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from

Oliveira, J.T.S., J.C. Hellmeister and M. Tomazello Filho. 2005. Vari-ation of the moisture content and specific gravity in wood of seveneucalypt species. Rev. Arvore Viçosa-MG. 29:115–127.

Parvathi, K., F. Chen, D. Guo, J.W. Blount and R.A. Dixon. 2001.Substrate preferences of O-methyltransferases in alfalfa suggestnew pathways for 3-O-methylation of monolignols. Plant J. 25:193–202.

Paux, E., M. Tamasloukht, N. Ladouce, P. Sivadon and J. Grima-Pettenati. 2004. Identification of genes preferentially expressedduring wood formation in Eucalyptus. Plant Mol. Biol. 55:263–280.

Paux, E., V. Carocha, C. Marques, A.M. de Sousa, N. Borralho,P. Sivadon and J. Grima-Pettenati. 2005. Transcript profiling of Eu-calyptus xylem genes during tension wood formation. New Phytol.167:89–100.

Pereira, L.A.R., S. Schoor, F. Goubet, P. Dupree and B.A. Moffatt.2006. Deficiency of adenosine kinase activity affects the degree ofpectin methyl-esterification in cell walls of Arabidopsis thaliana.Planta 224:1401–1414.

Pfanz, H., G. Aschan, R. Langenfeld-Heyser, C. Wittmann andM. Loose. 2002. Ecology and ecophysiology of tree stems:corticular and wood photosynthesis. Naturwissenschaften 89:147–162.

Raes, J., A. Rohde, J.H. Christensen, Y. Van de Peer and W. Boerjan.2003. Genome-wide characterization of the lignification toolbox inArabidopsis. Plant Physiol. 133:1051–1071.

Ranik, M. and A.A. Myburg. 2006. Six new cellulose synthase genesfrom Eucalyptus are associated with primary and secondary cellwall biosynthesis. Tree Physiol. 26:545–556.

Ranik, M., N.M. Creux and A.A. Myburg. 2006. Within-tree tran-scriptome profiling in wood-forming tissues of a fast-growing Eu-calyptus tree. Tree Physiol. 26:265–375.

Rison, S.C., T.C. Hodgman and J.M. Thornton. 2000. Comparison offunctional annotation schemes for genomes. Funct. Integ.Genomics 1:56–69.

Salzman, R.A., T. Fujita, K. Zhu-Salzman, P.M. Hasegawa andR.A. Bressan. 1999. An improved RNA isolation method for planttissues containing high levels of phenolic compounds or carbohy-drates. Plant Mol. Biol. Rep. 17:11–17.

Schoch, G., S. Goepfert, M. Morant, A. Hehn, D. Meyer, P. Ullmannand D. Werck-Reichhart. 2001. CYP98A3 from Arabidopsisthaliana is a 3-hydroxylase of phenolic esters, a missing link in thephenylpropanoid pathway. J. Biol. Chem. 276:36,566–36,574.

Seitz, B., C. Klos, M. Wurm and R. Tenhaken. 2000. Matrixpolysaccharide precursors in Arabidopsis cell walls are synthe-sized by alternate pathways with organ-specific expression pat-terns. Plant J. 21:537–546.

Shoji, T., R. Winz, T. Iwase, K. Nakajima, Y. Yamada andT. Hashimoto. 2002. Expression patterns of two tobacco isoflavonereductase-like genes and their possible roles in secondary metabo-lism in tobacco. Plant Mol. Biol. 50:427–40.

Smalle, J. and R.D. Vierstra. 2004. The ubiquitin 26S proteasomeproteolytic pathway. Annu. Rev. Plant Biol. 55:555–590.

van Raemdonck, D., E. Pesquet, S. Cloquet, H. Beeckman, W. Bo-erjan, D. Goffner, M. El Jaziri and M. Baucher. 2005. Molecularchanges associated with the setting up of secondary growth in as-pen. J. Exp. Bot. 56:2211–2227.

Velculescu, V.E., L. Zhang, B. Vogelstein and K.W. Kinzler. 1995.Serial analysis of gene expression. Science 270:484–487.

Woo, H.H. and M.C. Hawes. 1997. Cloning of genes whose expres-sion is correlated with mitosis and localized in dividing cells in rootcaps of Pisum sativum L. Plant Mol. Biol. 35:1045–1051.

Zhang, D., M. Hrmova, C. Wan et al. 2004. Members of a new groupof chitinase-like genes are expressed preferentially in cotton cellswith secondary walls. Plant Mol. Biol. 54:353–372.

Zhong, R., W.H. Morrison, III, J. Negrel and Z. Ye. 1998. Dualmethylation pathways in lignin biosynthesis. Plant Cell 10:2033–2045.

Zhong, R., W.H. Morrison, III, D.S. Himmelsbach, F.L. Poole, II andZ. Ye. 2000. Essential role of caffeoyl coenzyme A O-methyl-transferase in lignin biosynthesis in woody poplar plants. PlantPhysiol. 124:563–577.

TREE PHYSIOLOGY ONLINE at http://heronpublishing.com

SAGE TRANSCRIPT PROFILING OF CAMBIAL REGION 919

Supplementary material

Table S1. List of the 445 annotated sequences divided into functional categories based on their putative assigned functions. The table shows theoriginal tag sequence, tag count and the BLASTx result. Available at:

http://www.heronpublishing.com/tree/supplementary/28-905/28-905.TableS1.pdf

Tables S2. The NCBI Accession numbers of all the publicly available Eucalyptus EST and cDNA sequences used to construct our local database.Available at:

http://www.heronpublishing.com/tree/supplementary/28-905/28-905.TableS2.pdf

by guest on February 25, 2013http://treephys.oxfordjournals.org/

Dow

nloaded from