Post on 27-May-2020
transcript
Chapter 4Results
49
Occurrence of watermelon bud necrosis virus
Surveys were conducted during the February-May, 2008 to observe the natural
occurrence of viral diseases on watermelon (Citrullus lantalus) cultivated in Northern
areas such as New Delhi (IARI Experimental field, nearby area of Yamuna bank,
Majnutila, and ISBT), Haryana (Balabhgarh, Gurgaon) and Uttar Pradesh (Kanpur,
Lucknow). Watermelon plants growing near bank of Yamuna River and other cultivated
areas were showing severe of necrotic bud, mottling, yellowing, and stunting symptoms
(Fig. 4.I.1A) which resulted died the infected crop. The disease incidence was about 20-
60% in Uttar Pradesh and Haryana and 50-70% in on the bank of Yamuna River in New
Delhi. While in experimental field of Indian Agricultural Research Institute (IARI), New
Delhi, the disease incidence was about 90-100% which resulted died the plants within a
week.
Mechanical transmission WBNV
To maintain the virus for further studies, infected watermelon samples were sap
inoculated on host plants like Nicotiana benthamiana and Vigna unguiculata cv. Pusa
Komal which were developed chlorotic and wilting symptoms on Nicotiana benthamiana
while only chlorotic symptoms on Vigna unguiculata (Fig. 4.I.1B and Fig. 4.I.2B) after
6-8 days of post inoculation at 28˚C and 56% humidity conditions in Phytotron facility.
Electron microscopic studies
Electron microscopy with leaf dip preparations (crude sap of experimentally
inoculated N. benthamiana leaf tissue) showed spherical particles of 100-110 nm (in
diameter). The presence of spherical virus particles with a central core, a
characteristic feature of WBNV, indicated the virus to be WBNV (Fig. 4.I.5).
Physical Properties
WBNV was efficiently transmitted (100%) by sap inoculation to Nicotiana
benthamiana and cowpea (cvs Pusa Komal and C-152). WBNV was sap transmissible
from infected N. benthamiana leaves stored at 4°C and -80°C upto 25 days (Fig. 4.I.11C)
Results
50
and 4 months, respectively. The thermal inactivation point of the virus was 40°C
(Fig.4.I.11B).The dilution end point was 1:100, however maximum number of local
lesions per leaf was obtained at 1:1 dilution (Fig. 4.I.11A). Regular sap inoculation
changed virus properties.
Host Range
The sap inoculations resulted in chlorotic local lesion on Nicotiana benthamiana
(Fig. 4.I.2A), V. unguiculata cv Pusa Komal (Fig. 4.I.2B) or necrotic lesion on C.
amaranticolor (Fig. 4.I.2F), N. glutinosa (Fig. 4.I.2E) and N. tabacum (Fig. 4.I.2D),
chlorotic ring on V. unguiculata cv. C-152. The local lesions on every test/host species
were developed within 4 to 7 dpi. The watermelon virus isolate also induced systemic
symptom on leaf in N. glutinosa (necrotic spot), N. tabacum (veinal necrosis) (Fig.
4.I.2D) and N. benthamiana (chlorosis, mottling and wilting (Fig 4.I.2A) within 6 to 10
dpi. Inoculated watermelon plant produced bud necrosis symptoms (Fig.4.I.3) similar to
as those observed in the naturally infected field plants. The isolate was designated as
WBNV-wDel. Other inoculated plants Cucumis sativus, Cucurbit moschata, Lagenaria
siceraria, Arachis hypogaea, Lycopersicum esculatum cv. Pusa Ruby did not give any
symptom after three replication (Table.4.I.1).
Comparison of symptoms of WBNV and GBNV
Both the viruses were sap-transmitted to the members of Fabaceae and
Solanaceae where localized infection in both the inoculated plants showed differentiating
symptoms (Table 4.I.1). On N. benthamiana, WBNV produced chlorotic lesion local and
systemic mottling and wilting but GBNV inoculated produced chlorotic rings local and
systemic necrosis and wilting. On cowpea cv Pusa komal and C-152, GBNV produced
chlorotic lesion followed by necrotic lesion, vein necrosis, leaf distortion, bud necrosis,
stunting, stem necrosis and wilting but WBNV produced cholorotic lesion on Pusa
Komal and chlorotic ring followed by spread the ring on C-152 and there was no
systemic symptoms. GBNV did not show any symptoms on cucurbitaceous plants and
WBNV did not produce any symptoms on groundnut.
Results
51
Table 4.I.1: Comparative host range and symptomology study of the bud necrosisviruses.
NLL necrotic local lesions; Mo Mottle; NR necrotic rings; CLL chlorotic local lesions;CR crinkling; NS necrotic spots; CS chlorotic spots; DW dwarfing; Y yellowing; Vnveinal necrosi; Sn stem necrosis; Tn tip necrosis; LD leaf died , NS; No symptoms, -- not,1&2; Singh et al., 1998.
symptomsFamily Test Plants WBNV-wDel WBNV1 GBNV2
Chenopodiaceae
Chenopodiumamaranticolor
NLL NLL --
Citrullus lantalus CLL, Y, Mo,NS, Tn, DW
CLL, Mo,CR, NS, Tn
--
Cucumis sativus NS CLL --
Cucurbitaceae
Cucurbitmoschata
NS -- --
Lagenariasiceraria
NS -- --
Fabaceae Arachis hypogaea NS NS CLL, Tn,NLL, Y,DW
Vignaunguiculata cv.C-152
CLR CLL --
Vignaunguiculata cv.Pusa Komal
CLL -- CLL, Y,Tn, NLL,DW, W, Sn,Vn,
Nicotianabenthamiana
CLL, Mo,CS, DW, Vn, W, LD
-- CLL, NLL,Y, Vn, Tn,W, LD
Nicotianatabaccum L.
NLL, VN,DW,
NR --
Nicotianaglutinosa
NLL, NL NLL, Sn --
Solanaceae
Lycopersicumesculatum cv.Pusa Ruby
NS -- --
Results
52
Specific detection of GBNV and WBNV
WBNV and GBNV can be differentiated by host reaction as well as RT- PCR
using specific primers. For the specific detection, two set of primers were designed and
used for amplification of WBNV and GBNV. Based on the M RNA sequence
comparison, specific primers were designed for differential detection of WBNV and
GBNV by PCR and duplex PCR.
The primer BM 67wf and BM 68R originated from Gn/Gc ORF could be
successfully used to amplify 618 bp fragment only from WBNV (Fig. 4.4). Primer pairs
BM 67 wf and BM 182 R, BM 67F and BM 181R used for duplex PCR which resulted in
specific amplification of WBNV (490bp) and GBNV (850 bp) from mixture of GBNV
and WBNV samples (Fig. 4.I.13).
Molecular cloning of entire genome of WBNV-wDel
Total RNA isolated from the infected tissue of N. benthamiana plant was
quantified by spectrophotometer (Nano Drop) and the concentration of RNA was found
about 250 ng/μl. This RNA preparation was used as template for the first strand
complementary DNA (cDNA) synthesis. Whole genome was amplified from 5' end to 3'
end by RT-PCR using designed primers for M RNA segment. The cDNA prepared from
RNA of symptomatic as well as non-symptomatic tissues was used as a template for
PCR. Agarose gel electrophoresis revealed expected size of amplified fragment from
infected sample (Fig. 4.I.6); no such amplifications were obtained from the healthy
sample. The primers were successfully used to amplify the M RNA fragment-1, 2, 3, 4, 5
and 7 sequentially from the 5′ end by RT-PCR. The primers BM67F and BM68R,
however, failed to produce the expected fragment-6. The sequence obtained from
fragment-5 revealed difference in the primer BM67F. A new primer BM67wF
(caaagttaattttctccactcaac) was developed based on the specific sequence and the gap of
618 nt was filled-up by sequencing the clone generated using primer pair BM67WF &
BM68R. RT-PCR amplified amplicons of all fragments were purified through agarose gel
purification kit and cloned in pGEM-T easy vector. Competent E. coli cells (strain DH
5) were transformed. About 15-25 transformed white colonies of E. coli were obtained
for each of the cloned fragments. Of these, 10 white colonies representing fragments of
Results
53
each of the seven sets of primers were randomly selected and analyzed to identify the
positive clones based on electrophoretic mobility of recombinant plasmid DNA,
restriction digestion and colony PCR. Two clones were identified for each of the seven
sets of primers (Table 4.I.2). The nucleotide sequences of the seven clones showed that
the size of inserts in different clones varied from 662 to 1080 nt.
Table 4.I.2: Clones of genome segments of watermelon bud necrosis virus.
F: Forward primer, R: Reverse primer,
Table 4.I.3: Open reading frames (ORFs) and putative proteins coded by thegenome of Watermelon bud necrosis virus.
NT= Nucleotides; AA= Amino acids
Sl. No. Name of primers Genome segmentnumber from 5’end
Size of the clonedfragment (Numberof nucleotides)
1. BM55F+BM56R 1 8402. BM 59F+ BM 60R 2 8563. BM 61F+ BM 62R 3 7814. BM 63F+ BM 64R 4 9995. BM 65F+ BM 66R 5 7526. BM 67FW+ BM 68R 6 6237. BM 57F+ BM 58R 7 801
Area NT position from5’ end
NT AA Protein kDa
5’UTR 1-55 56ORF1 56-979 924 307 Movement 34.22IR 980 -1381 402ORF2 1382-4747 3366 1121 Glycoprotein 127.153’UTR 4748-4794 47
Results
54
Sequence submission in GenBank
The nucleotide sequences of all the seven clones were joined to construct full-
length M RNA genome of WBNV wDel and analysed to resolved any ambiguity using
BLAST tool to obtain consensus sequence. Consensus sequences of the virus under study
were determined and
submitted in GenBank under accession number GU474545 (Fig. 4.I.12). Analysis of the
sequences in BLAST search programme with the available sequences in GenBank,
revealed a close identity of the sequences of the present isolate with other WSMoV sero
group sequenced by earlier workers.
Genome organization
The nucleotide sequences of M RNA genome of WBNV wDel consisted of 4794
nt, composed of 31.6% A, 33.2% U, 17.8% C and 17.3% G. The RNA genome
organisation was similar to the other tospoviruses (Fig. 4.I.9). The genome contained two
non-overlapping open reading frames (ORFs) in ambisense orientation separated by 402
nt A-U-rich intergenic region (IGR) (Fig. 4.I.7; Table 4.I.3). The 5′ and 3′ untranslated
regions (UTR) of the M RNA were 55 and 47 nt long, respectively forming a panhandle
consisting of 22 nt having 19 complementary pairs and three mismatches at the terminal
ends. The first ORF towards 5´ end was 924 nt long in the viral (v) strand that started
with an ATG codon at 56 nt and ended at 979 nt with a UAA codon. The ORF encoded a
protein of 307 amino acids with a predicted molecular mass of 34.22 kDa and was similar
to NSm gene of the other tospoviruses. The second was ORF was larger and located
towards 3´ end containing 3366 nt in viral complementary strand of the genome that
started with ATG at 4747 nt and ending with a stop codon, UAA at 1382 nt (numbered
from 5´ end of the vRNA). Based on similarities with the other tospoviruses, the larger
ORF encoded the precursor of the glycoproteins, Gn/Gc containing 1121 amino acids
with a predicted molecular mass of 127.15 kDa.
Genome sequence comparison of WBNV-wDel
The M RNA genome sequence of WBNV-wDel was compared with that of
WBNV-Wm-Som isolates and nine different tospoviruses (Table 4.I.4). Wm-Som isolate
was one nt longer than wDel isolate sharing 91.6% sequence identity. The 5′ UTR and
Results
55
NSm of Wm-Som isolate were near identical to wDel isolates; interestingly, Gn/Gc and
3′ UTR were significantly different sharing only 74.6% and 80.8% identity, respectively.
Comparison of terminal sequence revealed that the eight nucleotides in both the termini
of M RNA of WBNV were identical to all the tospoviruses compared. Wide variations in
the UTRs of other tospoviruses were observed that ranged from 20.1 to 98.1%. A
contrasting difference was observed with Gloxinia tospovirus-HT1 (GTV-HT1), which
was highly different (37.5% identity) at 5′ UTR, whereas quite similar Table: 4.I.4.
Comparisons of M -RNA genome of Watermelon bud necrosis virus (Under study)
with that of the other Tospovirus.
% Sequence Identity
NSm Gn/Gc
Virus Accessionnumber
Gen
ome
Size
nt
5UTR
IR 3 U
TR
Size aa Size aaCaCV DQ256125 4823 74.8 87.5 48.9 85.1 927 81.8 3366 82.9GBNV NC-003620 4815 78.6 94.6 52.4 80.8 924 84.6 3366 85.8HT-1 AF023172 4780 74.1 37.5 35.0 85.1 927 80.1 3369 82.1INSV NC_003616 4950 45.9 41.1 35.7 20.1 912 35.8 3333 31.9IYSV AF214014 4838 62.1 55.5 36.0 56.0 936 65.4 3411 60.7MYSV NC_008307 4815 63.2 59.3 31.6 68.7 927 61.7 3384 63.2TSWV NC_002050 4821 44.9 31.0 27.9 36.9 909 34.5 3407 31.9TZSV EF552434 4945 64.8 67.8 25.3 67.3 930 69.5 3369 71.2WBNV- FJ694963 4795 91.6 100 93.2 80.8 921 97.3 3363 73.3
Results
56
Acronyms used in this table: CaCV: Capsicum chlorosis virus, GBNV: Groundnut budnecrosis virus, HT-1:Gloxinia tospovirus, INSV: Impatiens necrotic spot virus, IYSV:Iris yellow spot virus, MYSV: Melon yellow spot virus, TSWV: Tomato spotted wiltvirus, TZSV: Tomato zonate spot virus, WBNV-som: watermelon bud necrosis virus,WSMoV: Watermelon silver mottle virus.
(85.1% identity) at 3′ UTR. The IGR of WBNV is located within 980-1381 nt, which
showed a least similarities (29.3-52.7%) compared to the other coding and non-coding
regions in the M RNA of all the other tospoviruses. RNA secondary structure prediction
analysis of IGR of M RNA revealed that WBNV formed a secondary structure containing
bifurcated interior- and hairpin-loops with free energy of -30.8 kcal/mol. The form of
secondary structure of GBNV IGR was similar to WBNV with free energy -45.8
kcal/mol; whereas, the Wm-Som isolate was different from the wDel isolate in IGR
showed a trifurcated loop structure with free energy -38.3 kcal/mol.
Phylogenetic relationships:
Phylogenetic analysis (Fig. 4.II.1) based on complete M RNA sequence revealed
three distinct groups of relatives of WBNV: (i) the close relatives, CaCV, GBNV, GTV-
HT1 and WSMoV sharing 73.9-79.1% sequence identity; (ii) the intermediate relatives,
IYSV, Melon yellow spot virus (MYSV) and Tomato zonate spot virus (TZSV) sharing
62.0-65.3% sequence identity and (iii) the distant relatives, Impatiens necrotic virus
SomWSMoV DQ157768 4877 75.1 98.1 54.7 72.3 939 78.2 3366 83.2
Results
57
(INSV) and TSWV sharing only 46.3% and 44.7% sequence identity, respectively.
Among these tospoviruses, GBNV was closest to WBNV sharing 79.1% sequence
identity. The melon infecting tospoviruses, MYSV and WSMoV known to occur in Japan
and Taiwan (Fang et al., 2001; Kato et al., 200; Yeh et al., 1992) shared only 63.3% and
75.2% identity, respectively with WBNV.
The WBNV isolates, wDel and Wm-Som, were closely clustering together based
on complete nucleotide sequence of M RNA and amino acid sequence of NSm protein
(Fig. 4.II.1a,c). Interestingly, Wm-Som showed greater divergence from wDel in the
Gn/Gc protein (Fig. 4.II.1b), suggesting intraspecies incongruence between the two
isolates of WBNV within a genome segment. Intraspecies incongruence in phylogenetic
trees has been observed in Cucumber mosaic virus (Roossinck, 2002; White et al, 1995)
and has been attributed to recombination, an indication of modular evolution a virus
(Roossinck, 2005). Recombination analysis of M RNA of the tospoviruses known to
occur in India revealed potential recombination in the Gn/Gc. Interestingly, WBNV-Wm-
Som isolate showed greater number of recombination events throughout the genome with
the Indian tospoviruses and possessed a recombination hot spot in Gn/Gc ORF
(breakpoints in the genome, 3839-4027 nt) as indicated by all the six recombination
analysis methods (Fig.4.I.14). Co-infection of viruses/isolates in an ecological niche
provides opportunities for recombination and evolution. Since, all the Indian tospoviruses
were originally reported from central and southern part of India [Reddy et al., 1996; Jain
et al., 1998; Satayanarayana et al., 1998; Ravi et al., 2006; Reddy et al., 2008) and
WBNV-Wm-Som isolate was also reported from central India, it might have
differentially evolved due to recombination with the available relatives as compared to
WBNV-wDel isolate originating from northern India.
Results
58
Transgene Constructs
Developments of WBNV NP full gene construct: A pair of primers are designed
based on the terminal sequences of WBNV NP gene. The restriction sites, BamHI and
SacI were added in the forward and reverse primers, respectively. The GUS gene was
released from pBI121 vector by BamHI and SacI digestions (Fig. 4.III.1). The NP gene
was amplified with the primers BM 01F and BM 02R (Table 4.III.1), digested with
BamHI and SacI and ligated in pBI121 in place of GUS (Fig.4.III.1). The E. coli strain
was transformed with the ligated product and the clones were analysed by rapid
disruption of bacterial cell (Fig. 4.III.2A) and PCR amplification (Fig.4.III.2B). The
clone number 18 was identified as positive clone and confirmed by sequencing (Fig.
4.III.3).
WBNV-NPP partial Gene construct: RT-PCR of partial NP gene of WBNV-
wDel using primers BM49Fa and BMRb (Table 4.III.1), was amplified the fragment of
about 356 bp (Fig. 4.III.4A) and cloned in T&A vector (Fig. 4.III.4B). The cloned partial
NP gene and binary vector pBIN AR were restricted with restriction enzymes BamH1
and XbaI (Fig 4.III.5) and ligated with T4 ligase enzyme then transformed into E. coli.
Molecular cloning of the putative partial NP gene fragments in pBIN AR vector resulted
in a large number of apparently transformed colonies of E. coli. Seven apparently
transformed colonies were selected at random to confirm transformation by colony PCR.
Of these, seven colonies showed amplification of partial NP gene by PCR indicating
positive transformation ((Fig. 4.III.6).). Sequencing of one of these clones (clone number
6) (Fig. 4.III.7) and finally confirmed the presence of partial NP gene (356 nt) of WBNV-
wDel in Antisense orientation in pBIN AR. Overview of partial NP gene of WBNV
shown in Fig. 4.III.8.
Mobilization of transgene constructs in Agrobacterium tumefacience
Mobilization of binary vector pBI121 containing Gus gene into Agrobacterium
tumefaciens strain EHA 105: The binary vector pBI121 (Fig.4.III.9) containing β-
glucuronidase (GUS) reporter gene was mobilized into A. tumefaciens strain EHA 105
Results
59
by freeze thaw method. The Agrobacterium colonies containing the Gus gene were
confirmed by colony PCR using GUS gene specific primers (Fig. 4.III.10).
Mobilization of WBNV-NP gene constructs into Agrobacterium tumefaciens
strain LBA 4404: The binary vector pBI121 containing WBNV-NP gene (Fig. 4.III.1)
used to mobilize
Table 4.III.1: Primers used for amplification of nucleocapsid protein (NP) gene of
WBNV.
from E. coli to Agrobacterium tumefacience strain LBA 4404 by triparental
mating. The Agrobacterium colonies containing the WBNV-NP gene were confirmed by
colony PCR using WBNV-NP gene specific primers (Fig. 4.III.11).
Mobilization of partial NP gene constructs of WBNV into Agrobacterium
tumefaciens (LBA 4404): The binary vector pBIN AR containing WBNV-NP partial
gene (Fig.4.21) used to mobilize from E. coli to Agrobacterium tumefaciens strain LBA
4404 by triparental mating. The Agrobacterium colonies containing the WBNV-NP
partial gene were confirmed by colony PCR using WBNV-NP partial gene specific
primers (Fig.4.III.12).
Regeneration and transformation of watermelon
To obtain explants for co-cultivation, watermelon seedlings were raised from surface
sterilized seeds under aseptic conditions. Best germination (80%) was obtained from
ID Primer sequences specification Tm Ann.temp.
BM01 F 5' ttggatccatgtctaacgtaaagcagct 3'Forward primer specificto WBNV-NP region
56°C 50
BM02 R 5’ aagagctcttacacttccaaagaagtgc 3’Reverse primer specificto WBNV-CP region
56°C 50
BM49Fa 5 tt gatcc tct gtc cty ttg aak gtc ca3'
Forward primer specificto WBNV-NP partialregion (356 bp)
54°C 54
BM50Rb 5' tt ctaga aga gca atc gag gcg ct 3' Reverse primer specificto WBNV-NP partialregion (356 bp)
54°C 54
Results
60
seeds soaked with distilled water containing fungicide, followed by seeds sterilized with
0.1% mercuric chloride. The seeds soaked in water, however, were highly (70%)
contaminated with surface fungi. Seed treatment with 0.1% bavistin (fungicide) resulted
in 70-80% germination but only (10%) seeds showed fungal contamination in glass house
germinated seeds (in vivo).
Similarly watermelon seeds washed with sodium hypo chloride and 3 times distilled
water followed by treatment with 0.1% mercuric chloride was superior as it resulted in
good germination (80%) and no contamination. Therefore for obtaining explants, seeds
treated with 0.1% mercuric chloride were used for raising seedlings on half strength MS
soaked sterilized cotton in jam bottles, a small (about 1 cm diameter) hole was cut in the
center of the lids, which was plugged with sterilized cotton for aeration.
The explants excised from in vitro and in vivo raised seedlings were cultured on
different combinations of hormones for callus and shoot induction.
Effect of age of cotyledon explants: The effect of age of the explants on shoot
regeneration was determined. With increase in age of the cotyledon explants, the
frequency of regeneration and the number of shoots per explant less than from 4 day old
cotyledon halves. The highest frequency (76%) and the maximum number of shoots (7-9)
were observed from explants excised from 4-d-old seedling (Table 4.IV).
Table 4.IV: Effect of age of explants on regeneration of watermelon cv. Sugarbaby
*4 day old cotyledon raised in vivo
Age ofexplants
Explants Calli % Shoot %
4* Coty 76 86
6 Coty 10.4 0
7 CotyStemPetiole
31.481.915.7
01.915.7
9 CotyStemPetiole
20.826.334.2
018.428.5
Results
61
Plant growth hormones: Preliminary experiments were set up to standardize the
hormonal combinations for optimum callusing from epicotyls, hypocotyls and cotyledon
halves of watermelon cv. Sugar Baby. Plant growth medium employed in this study was
MS basal medium (Appendix). Different concentrations of BAP (0.5, 1.0, 2.0, 3.0, and
4.0 mg/l) for cotyledon halves, hypocotyl and epicotyl explants and IAA (0.1, 0.2, 0.3,
0.4 and 0.5 mg/l) in combination with 6-benzylaminopurine (BAP: 0.5, 1.0, 2.0, and 3.0
mg/l) for in vitro raised cotyledon were used (Table 4.IV.1 and Table 4.IV.2). Maximum
response of callus development was observed on MS basal medium supplemented with
BAP 3.0 mg/l from epicotyl (4.IV.3D) and hypocotyl explants (Fig.4.IV.2C) and 0.1
mg/l IAA in combination with 2.0 mg/l BAP from cotyledon (Fig. 4.IV.4D). The
maximum shoot regeneration response and the highest number of multiple shoots were
observed on MS medium supplemented with BAP 3.0 mg/l from epicotyl (Fig. 4.IV.3E)
and hypocotyl (Fig.4.IV.2C) explants and 0.1 mg/l IAA, 2.0 mg/l BAP from cotyledon
halves (Fig.4.IV.4E) with an average of 8 shoots per explants but the percent regeneration
of shoots from hypocotyl was less than epicotyl (Table 4.IV.1) explant but there is no
shoot regeneration from the calli developed from cotyledon halves on BAP and IAA
combination from old cotyledon ex-plants (more than 6 days) (Fig.4.IV). The data was
generated from 20 explants per treatment and experiment was repeated thrice. The results
obtained are summarized in Fig.4.IV.1. MS basal medium without hormones was suitable
for root induction on 2-3 cm long shoots.
Transplantation of rooted shoots: Rooted shoots (plantlets) were transferred to
1 X Hoagland’s solution or ½ MS for about 2 days, however, 1 X Hoagland’s solution
was comparatively better for their survival and growth (Fig. 4.IV.5A). These plantlets
grew in autoclaved sand for another 7-10 days under tissue culture room conditions for
hardening (Fig. 4.IV.5B). Well established plants were transferred to pots containing soil
under greenhouse conditions at 30˚C and 56% humidity. Summary of different
regeneration stages of cotyledon explants of watermelon cv. Sugar Baby at different
hormonal concentration shown in table 4.1.
Results
62
Table 4.IV.1: Effect of hormone concentrations on regeneration of watermelon cv.Sugar Baby explants.
7-9 days old explants were use and Culture medium: MS salts
Table 4.IV.2: Effect of hormone concentrations on in vitro germinated cotyledonexplants of watermelon cv. Sugar Baby.
BAConc.
Explants % explantforming calli
% explantformingShoot
4 Cotyledon 11.7 03 Cotyledon
HypocotylEpicotyl
12.89.528
06.324.0
2 CotyledonHypocotyl
513
06.5
1 CotycotyledonHypocotyl
313.6
00
0 CotyledonHypocotyl
00
00
Hormone concentration % of explantsforming calli
% of explantsforming shoot
BA IAA
Results
63
4 days old cotyledon explants were use and Culture medium: MS salts with different hormonal conc.
Green House establishment and pollination
The well-established plants in green house started flowering after 20-25 days of
establishment. They developed more male flowers first than female flowers. Early
morning was the best time for cross pollination inside the green house. Pollinated flowers
developed fruits after 20 days of pollination and subsequently ripped.
Optimization of kanamycin as selectable marker: The kanamycin at
concentrations 25, 50, 100, 125, 150 and 200 mg/l was used to screen the survival of
untransformed explants to ascertain the concentration of antibiotic for the selection of
transformed shoots. Kanamycin at 100 mg/l or higher concentrations inhibited the
regeneration of untransformed explants and therefore, kanamycin at 100 mg/l was used
for the selection of transformants (Fig.4.IV.6 & Fig.4.IV.7) and similarly seed
germination of different varieties of watermelon was also affected by kanamycin at a
concentration more the 100 mg/l (Table.4.IV.3, 4.IV.4, 4.IV.5).
Effect of antibiotic for Agrobacterium elimination: Survival of A. tumefaciens
strain LBA 4404 on different concentrations of cefotaxime antibiotic was checked by
plating the bacteria at 100, 250, 300, 500 and 750 mg/l cefotaxime. Results showed that
1 0.1 0 01 0.2 0 01 0.3 0 01 0.5 46 02 0.1 86 762 0.2 86 552 0.3 100 332 0.5 73 93 0.1 80 333 0.2 73 633 0.3 80 333 0.4 100 26
Results
64
cefotaxime at 500 mg/l or above concentrations inhibited the growth of Agrobacterium
and used in for further experimentation.
Effect of Agrobacterium concentrations on infection frequency: To determine
the effect of bacterial concentrations on watermelon transformation efficiency,
bacterial culture at different OD at 600nm: 0.25, 0.5, 0.6, 0.8 and 1.0 were used. Out of
various ODs, 0.6 showed t h e highest numbers of kanamycin resistant transformants.
However higher or lower OD than 0.6 at 600 nm was found to result in lower
transformation efficiency.
Effect of co-cultivation time and inoculation duration: To find out the effect of
inoculation duration cotyledon explants of watermelon were immersed in the
Agrobacterium suspension for 5, 10, 20, and 30 minutes. Results obtained revealed
that inoculation duration of 20 min was optimum, as a high number of shoots were
regenerated on the selection medium. The inoculation duration of 20 min and co-
cultivation for 48 hours were found to be the optimum for better transformation
efficiency. The rate of explants survival and number of transformants were higher
under these conditions.
Effect of acetosyringone: In order to optimize the concentration ofacetosyringone during transformation, the different concentrations of acetosyringone(0, 100, 150 and 200
Table 4.IV.3: Effect of different concentrations of kanamycin on seedsgermination of watermelon cv. Khusbu (hyb.)
Measurements of length (cm)
Kan
amyc
in(m
g/L)
Tota
l No.
of
seed
s/ger
mi
nate
d % o
fge
rmin
atio
n
Shoots Average Roots AverageObservation
0 12/9 75 8.9, 11.9, 4.7, 8.9, 10.7,10.9, 9.2, 4.7
8.74 4.9,3.1,3.5,2.41.5,2.9,2.1, 3.9
3.04 Normal
50 12/9 75 4.0, 2.8, 2.6, 4.1, 1.6,2.5, 2.3, 1.5
2.67 0.7, 0.7, 0.5, 0.7,0.6, 0.5, 0.6, 0.5
0.60 Affected
100 12/10 83 4.5, 4.0, 3.2, 3.5, 2.5,1.4, 2.3, 1.5
2.72 0.5, 0.6, 0.8, 0.6,0.6, 0.6, 0.6, 0.4
0.58 Affected
150 12/10 83 3.8, 2.8,2.8, 2.2, 1.5,2.1, 1.8, 0.6
2.32 0.5, 0.4, 0.5, 0.8,0.6, 0.8, 0.4, 0.5
0.56 Affected
Results
65
200 12/9 75 1.0, 0.8, 3.5, 2.0, 1.1,0.6, 0.4
1.34 0.4, 0.4, 0.5, 0.6,0.4, 0.4, 0.4
0.46 Affected
Table 4.IV.4: Effect of different concentrations of kanamycin on seeds germinationof watermelon cv. Sweet Baby
Measurements of length (cm)
Kan
amyc
in(m
g/L
)
Tot
al N
o. o
fse
eds/
germ
inat
ed%
of
germ
inat
ion
Shoots Aver. Roots Aver. Obs.
0 20/16 80 4.0, 3.9, 4.6,5.6, 6.5, 5.0,2.0, 4.5, 2.6,3.0
4.17 2.0, 3.0, 2.6,2.4, 3.0, 1.5,1.8, 1.4, 1.7,1.6
2.1 Normal
50 20/19 95 9.2, 6.0, 5.5,4.1, 3.0, 2.2,2.5, 2.5
4.37 0.7, 1.4, 0.5,0.5, 0.4, 0.5,0.5, 0.5
0.62 Affected
100 20/20 100 2.0, 2.1, 2.0,1.9, 2.0, 2.5,1.5, 0.5
2.4 0.5, 0.4, 0.4,0.3, 0.5, 0.2,0.3, 0.3
0.36 Affected
150 20/18 90 3.1, 2.5, 3.5,2.2, 2.3, 2.5,1.9, 1.7
2.5 0.6, 0.5, 0.2,0.3, 0.3, 0.6,0.4, 0.3
0.4 Affected
200 20/20 100 3.4, 2.8, 1.7,1.5, 0.8, 0.4,0.5, 0.3, 0.4,0.4
1.22 0.5, 0.5, 0.3,0.5, 0.3, 0.2,0.3,0.2, 0.1,0.2
0.3 Affected
Table 4.IV.5: Effect of different concentrations of kanamycin on seeds germinationof watermelon cv. Madhuri (hybrid)
Measurements of length (cm) Obs.
Kan
amyc
in (m
g/L
)T
otal
No.
ofse
eds/
ger
min
ated
% o
fge
rmin
ati
on Shoots Aver.
Roots Aver.
0 15/15 100 8.6, 12.2, 8.0,5.0, 9.1, 8.1, 7.5,7.5, 7.2
8.02 3.0, 3.2, 4.0, 1.5,2.0, 4.0, 3.8, 2.0,2.4
2.85 Normal
50 15/15 100 5.6, 4.7, 5.5, 5.0,2.6, 4.3, 3.5, 4.3,3.0
4.43 1.1, 0.8, 1.2, 1.2,0.5, 1.0, 1.0,0.7,0.8
0.92 Affected
Results
66
Table.4.IV.6: Effect of different concentrations of kanamycin on shoot regenerationfrom epicotyl explants of watermelon cv. Sugar Baby
No. of regeneratedshoots
Kan
amyc
in(m
g/L
)
Tot
al N
o.of
exp
lant
s
Green yellow
% s
urvi
val
of e
xpla
nts Response
14 13 1 92.86 Normal15 13 2 86.67 ,,
0 11 10 1 91.67 ,,14 12 2 85.71 ,,15 12 3 80.00 ,,
50 11 10 1 91.67 ,,14 8 6 57.14 Light green15 9 6 60.00 ,,
100 11 8 3 72.73 ,,14 4 10 28.57 Yellowish15 4 11 26.67 ,,
150 11 3 8 27.27 ,,14 0 14 00.00 Brownish15 2 13 13.33 ,,
200 11 0 11 00.00 ,,µM) were added to the bacterial inoculation medium as it is known t o
i n h a n c e transformation efficiency. Among various concentration of acetosyringone,
the optimum transformation efficiency was achieved with 200 µM acetosyringone in the
inoculation medium.
Genetic regeneration and transformation of watermelon cv. Sugar Baby plants
A. tumefaciens-mediated transformation of epicotyl and cotyledon explants of
watermelon cv. Sugar Baby was carried out following the standardized protocols
100 15/13 86.67 9.3, 6.4, 3.5, 3.3,7.2, 2.5, 1.4, 1.8
4.42 1.4, 1.2, 1.2, 0.5,0.3, 1.4, 0.1,0.1
0.77 Affected
150 15/13 86.67 3.6, 7.8, 5.0, 5.1,3.8, 6.0, 3.5, 2.8,2.4
4.40 1.5, 1.3, 0.7, 0.6,0.8, 1.5, 0.8, 0.4,0.4
0.89 Affected
200 15/13 86.67 2.2, 3.5, 4.7, 2.9,3.1 2.8, 3.4, 2.0
3.07 0.4, 0.8, 1.0, 0.5,0.5, 0.7, 0.7, 0.3
0.61 Affected
Results
67
reported by previous workers. Amongst various media used, MS medium supplemented
with 3mg/l BAP for epicotyls (Table4.IV.1) and 0.3 mg/l IAA in combination
2.0 mg/l BAP for cotyledon (4.IV.2) were the best for callus induction and 3mg/l BAP
for epicotyls (Table4.IV.1) and 0 .1 mg/l IAA in combination with 2.0 mg/l
BAP for cotyledon were optimal for shoot regeneration (4.IV.2). Cotyledon explants
cocultivated with A. tumefaciens showed regenerat ion of shoots on MS medium
supplemented with 0.1 mg/l IAA, 2.0 mg/l BAP, 500 mg/l cefotaxime and 100 mg/l
kanamycin. Explants wi th g re en shoo t b ud s were subcultured on the medium
containing the same levels of antibiotics for further shoots proliferation. After
two weeks of subculture on the callusing medium, explants were subsequently
transferred from Petri dishes to jars containing MS shoot regeneration medium for
shoot pro l i fera t ion and elongation (Fig 4.1V.3 & 4.IV.4). Those explants, which
did not show any sign of shoot or callus initiation even after 2-3 successive transfers
were discarded. Each shoot developed from a transformed explant was treated a s a
s in g l e transformation event. During subculture, some of the transformed explants
which initially showed shoot initiation but did not survive in subsequent transfers or
contaminated were discarded.
After 2-3 subcultures, putatively transformed shoots attained an average height
of 3-4 cm. Such shoots ( F i g .4 . IV . 4 F ) were excised from the base of callus and
transferred to rooting medium MS basal without growth hormone (Fig. 4.IV.3G and
4.IV.4F). Care was taken while transferring shoots to rooting medium that they do not
contain any callus to avoid re-
Table 4.1: Regeneration of watermelon cv. Sugar Baby cotyledon explants underdifferent hormones concentration.
Stages Conc. of hormones (mg/l)BA IAA
Days required formorphogenicresponse
Callus induction 2 0.3 08-10
Shoot initiation 2 0.1 18-25
Results
68
initiation of callus formation. Kanamycin and cefotaxime at 100 mg/l and 500 mg/l,
respectively were maintained throughout the regeneration process. It was observed that
some of the putative transformed shoots (8-10%) did not produce roots on medium
containing kanamycin although they survived for longer period.
Analysis of GUS gene Expression in watermelon transformants
A total of 51 cotyledon explants of watermelon cv. Sugar Baby was
co-cultivated for transformation in four independent experiments (Table 4.IV.7). Out of
51 explants employed, 28 shoots were successfully regenerated on selection medium.
GUS expression was monitored at different stages (callusing, shoot initiation and leaves).
Out of 28 shoots, 8 showed blue colour in their tissues indicating the expression of GUS
gene (Fig.4.IV.8). These 8 putative transformants were subjected to PCR to confirm
the presence of transgene (GUS). Total genomic DNA was isolated from all the 8
putative transgenic plants and was analysed by PCR using GUS gene specific primers
Four transformants showed the amplification of the fragment of the expected size ~1800
bp that corresponds to the size of the GUS gene (Fig.4.IV.9). The remaining
transformants showed no amplification similar to the negative control untransformed
watermelon plants. This may be due to the chimeric nature of the shoots.
Table: 4.2: Protocol for Agrobacterium mediated transformation of watermelon cv.Sugar Baby
Shoot elongation MS MS 28-40
Rooting MS MS 35-50
Results
69
.
Analysis of WBNV-NP gene in watermelon transformants
A total of 267 epicotyl explants of watermelon cv. Sugar baby were co-
cultivated for transformation in different experiments. Out of 267 explants employed,
101 shoots were successfully regenerated on selection medium. From these 101 shoots,
only 6 shoots were successfully rooted. These 6 putative transformants were subjected
Steps Discription Duration(days)Germination Raising seedlings (pre wash seeds with 2% sodium
hypochloride and surface sterilization with 0.1%mercuric chloride)
5-6
Explants immature cotyledon
Pre-culture Basal medium+ BA 3 mg/l, IAA 0.3mg/l 2Agrobacteriumstrain
LBA4404
Innoculation Basal medium + 200 micromole acetosyringone,OD600 : 0.6
20 min.
Co-cultivation Basal medium + BA 3 mg/l, IAA 0.3mg/l+200micromole acetocyringone
2days in dark
Selection andcallusing
Basal medium + BA (3 mg/l), IAA (0.3mg/l),Kanamycin 100 (mg/l), augmentin (250 mg/l)
8-10
Shooting Basal medium + BA 3 mg/l, IAA 0.1mg/l,Kanamicin 100 mg/l, augmentin 250 mg/l
10-15
ShootElongation
Basal medium, Kanamycin (100 mg/l), augmentin(250 mg/l)
10-15
Rooting Basal medium 7-10Hardening Rooted shoots in Hoagland solution for 2-3 days
and then transferred to pots containing autoclavedriver sand
10-13
Results
70
to PCR for the detection of transgene (WBNV-NP). Total genomic DNA was isolated
from all the 6 putative transgenic plants and PCR was carried out using WBNV-NP
specific primers. PCR was found to be positive in 1 transformants as it showed expected
size ~831 bp amplification (Fig.4.IV.10) and was found negative in rest of the putative
transgenic plants, similar as in negative control untransformed watermelon cv.
sugarbaby). The authenticity of PCR amplicons was further confirmed by Southern
blot analysis using WBNV-NP gene probe which gave positive signal of
hybridization in transformant.
Results
71
Table 4.IV.7: Summary of the transformation of cotyledon explants of watermeloncv. Sugar Baby transformed with A. tumefacience strain EHA105 harbouring abinary vector pBI121 containing GUS gene.
Explants Total number ofexplants co-cultivation
with Agrobacteriumharbouring a binary
vector, pBI121
Total no. of callideveloped from
cocultivatedexplants.
Total no. of shootsregenerated on
shoot regenerationmedium
Total no. ofPCR +veshoots forGUS gene
Cotyledon 51 28 8 4
Table 4.IV.8: Summary of the transformation of cotyledon explants of watermelon
cv. Sugar Baby transformed with A. tumefacience strain LBA4404 containing NP
gene of WBN.
Explants No. explants Gene No. callus No. shoot No. PCR +ve
Cotyledon 101 WBNV 67 20 1
Fig. 4.I.1: WBNV symptoms on watermelon: bud necrosis, yellowing, mottling collectedfrom different parts of India (A) Gurgaon (B) Kanpur (C) Lucknow (D) Delhi.
(A) (B)
(C) (D)
(A) (B) (C)
(D) (E) (F)
Fig. 4.I.2: Symptoms developed on various host plants following sap inoculation of WBNV,(a) Nicotiana benthamiana (b) V. unguiculata cv Pusa Komal, (c) V. unguiculata cv. C-152 (d)Nicotiana tabacum (e) Nicotiana glutinosa (e) Chenopodium amaranticolor
Fig.4.I.3: Symptoms developed on watermelon plants inoculated with WBNV under controledconditions
Healthy Innoculated
Specific primers to
WBNV GBNV
M H WB GB H WB GB
Fig.4.I.4: RT-PCR showing differentiation of Watermelon bud necrosis virus (WBNV)and Groundnut bud necrosis virus (GBNV) using specific primers (BM67f and BM68R).(A) Specific detection of WBNV and GBNV in Nicotiana benthamiana M:Marker, H :Healthy WB:WBNV infected sample , GB: GBNV infected sample (B) specific detectionof WBNV in Lane 1: N. benthamiana, Lane 2: N. tabacum, Lane 3: Chenopodiumamranticolor, Lane 4: GBNV +ve, Lane 5: Vigna unguiculata cv. Pusa Komal (C) specificdetection of GBNV in Lane 1: N. tabaccum, Lane 2: Chenopodium amranticolor , Lane 3:WBNV + ve, Lane 4: Vigna unguiculata cv. Pusa Komal
(B) (C)
WBNV specific primer
M H 1 2 3 4 5 M H 1 2 3 4 5
924 NSm 3360 Gn/Gc 402
IR
5'
56 979 1390 47491
3'
Fig.4.I.6: RT-PCR of M RNA genome showing amplification of seven fragments (F1 to F7)covering the entire M RNA genome from Nicotiana benthamiana showing characteristicsymptoms of WBNV.
M F1 F2 F3 F4 F5 F6 F7
1.5 kb
1.0 Kb
0.7 kb
0.5 kb
0.4 kb
0.2 kb
Fig. 4.I.7: Schematic representation of the genome organisation of WBNV-wDel isolate.Coloured boxes represent the two open reading frames (ORFs) encoding the putativemovement protein (ORF1) and Glycoprotein (ORF2), and the untranslated regions (UTR)are indicated as Lines. The numbers indicate the position of ORFs and UTRs.
1 agagcaatcggtgcgccaattactagataaatcatcaaataattaacaagaaataatgtctcgcttttct
71 aacgtgatagaatctttccgttcttcaaagaactcaaacaaagagttggtgcctgctgtaaaaacagaaa
141 acaataagaatattctagctagaaatgtttctcagaaggatattgatactgctataatgaacaaagttaa
211 gacacttaatggaaatcagtatatttcaggaggagattctagtgttttgggcacttattctggtgaatcg
281 gaaatagaagcatcttctgacgatattctatccaggctagttattgagcagagcgctcacttaagcaact
351 ggaaaaatgattcacttgttggaaatggaaatgatagggtgagtttcaccataaatgttatgccaacatg
421 gaacagtaagcgtaaattcatgcacatatcaagacttataatttgggttgtccctacaatccctgacact
491 aaaaacaatgttaaaattactttgattgacccaaacaaaatgaccaaagaagagaaaataatactaagca
561 gacaatgctcattaaaagatcctatgtgttttatcttccatcttaattggtcattcccaaaagaaagaaa
631 cactcccgggcagtgcatgaggcttaatctgactagtgatgagaagtatgcaaaaggagttagctttgcc
701 tctgtcatgtattcttgggtgaagaacttctgcgatactcctattgcatcaaaaaataacacttgtgatg
771 ttgtgcctatcaatagagctaaggtcattcaatctgctgcattaatcgaagcatgtaagttaatgatacc
841 tagaggaactagtgggaaagcaatagctaatcagattaagagtttgcagaaagctgcagaaaagctagct
911 ttagaatcagaacaagaagaaaaagatattgatgtcgatatagagatggatagccttcttgaaatttaag
981 attactgattttaagtctgaattatatctaccaaccaagctctaattacgtttgtttctaataatttaag
1051 tttagaagtttgtgttacttataagagtattttatgatctgctattcgaatgtttgtgtgtttgtgtatc
1121 tatgtattgtgttatattttatctttagaaataagataatcaaaaactaaacaaaaatgaaaataagtaa
1191 aaacaacaaaaaaagagaaaaacaaaacaaaaaacaaaaaaactatatatatataaataaacaaggccta
1261 ggccaactttggcttttcagccttttttggattttgttgctttatattgtttttgggttttttgtctgtt
1331 ttaaatatacatatatatatatatactttgcaaattaacttacattcagaattaaatatctaaagaaaaa
1401 tcataacctttaggaggggatttcctcttccttgcttgatctactcctgtgtaatttgtcaaaagaacac
1471 ttgattcaacagattctatagcatcttctaatttttgccttcttctatctgcataatatgtcttagataa
1541 tctgaaaatgctacttagaatgtacaatccgatacatgctgctgtaatgaccaagataatcctgactaga
1611 tcgaagaaagtgccgaagaaagaagctacccaattgaagggtgccttgatccagtcccacaaactggaaa
ORF-1
ORF 2
5’ORF-1
1681 tagatgtatcagaatgatgtatcttttcatcatgtgcacttttatcatcaaaatgtattattgtatcttg
1751 atcaacttcagtaaactcatccacctgaatgtccactgtcaattcttcttgatcctcagggattaacttc
1821 agagatttgtctgagatttcttcagagcaataaaccttgatagatttttcatttggacctagaaatgttc
1891 ccaattgatcagatttaaaagagcatgtatccatgactaatcttgatgagaatgtagtgtctgacgtgta
1961 agttatattgcaatcaattcctgcagcacattgagcacaacctgaacagatcattttaacttcagacagg
2031 acaggctttgttgggatctttttgaacatttctttaggcatatctatgaccactttcaatttacccacta
2101 aaaaatccttctccatgtacagtttgttactattctcatctaagtgagatacatctttggatggagataa
2171 gatatagatggcactgtatgtgtaaagcccacattgctttatattaactttcttatccccaacagcacta
2241 caactccaggtgaaatcattttgagacagagttgctgggactgatagtgggacaccatctattgtgatct
2311 gaggatgtccaaacgatgatcctgaaaaatcccccaagtcagctatgttgcccgtaagaattttctgctg
2381 tttagtcacggcaaatagtttatcagtgctcatataatcgttgtgaagatctatggacatgtcaagttga
2451 tagtaatctgtttggataggagatctgtctgagtgttttttgcatgtgtatctatctaaagattttatgc
2521 agatctcagcagtaacatgactctcaacgacctgatagatgttgaccaagcttgacaagtcataaatgtt
2591 cgtacaatgtccacagatggatccttcgttaattgctagacaaccaagttcttcacagccccaccaagag
2661 gttggtgttacacagaagtctaaaactcccactttaggtttttgttttacacagtcagcacaactccccg
2731 tgcatgtcactaggtaatctgccactgttgtgtcaatctttgctgtggaatatttgtacctcacatcata
2801 ttcaacaccaacactttttacataaaccataaactccatgggagaatgtgctgcatcgtcactgagtaag
2871 taaactgatcccgtatttgcttttatgtccatttccaagagatatctatatttcccatcaacttcagttg
2941 agaacaccaaagattgtcttggcattaaattctcaggaggtacatcatcgacctttaagcttttataaaa
3011 tttatattctttgataggttcttcttccaggattttagattcaattgggctgtccatataaccatctctt
3081 aatctattagctatcttcagactagtaagattgcctttaaaagatttccctttgtagaatttattaaatt
3151 tggtgtttggtatattttttatggatgccaaagagttgcaaccatttctgcatgcaaacaaattttgagc
3221 ctggttgttgcttaccaaacacaattctgaacccaaaacacaatcgttcaatgctgttgctctagacatt
3291 ggcacaccagacctgtatactgtttcagagattacatttccaatagagcactcacatgtctcatatccat
3361 tatctgccatcccaaacttgtctgtagtcaaggagtctaaatttaagttataatagcatttttcaacacg
3431 caagttggattgtttaagtgcaatacttgatggtatataagatataagaatagatgccaagatcattttt
3501 gttataagaactaagaaattggtgcttaattttgtatttattatgaactgaaattgctgaatcaaagtta
3571 attttctccactcacctttacttctgttgaaaagatagcaatcatcggtgtgggtttttgatgctctctc
3641 ttgattgcaaacacatttttctgcgcaggaatgagtcaagaatgatacgcaaccgcaaactctacattta
3711 aatgggaaatatggccataaccagttgatggcccaaagaacgggatatgttaagatcccgattatgtcgt
3781 accatatgctcagagcatttttagttttccaaatgagccatgatatagggaaagctattgtcaaaaacac
3851 aaaaatccatttaaaataagaaaaatttgtgcagaagaaaatcttttttggctcctctgagtatttggca
3921 acacatttcctcattggtatatctactttggcaatcaagctagatttatcaccacaaaggagaaaatgat
3991 ttccatctagttcttctggtttgaaatttattgttgaatcacctgtgatggatttgatgctttcggattt
4061 aggattttttacattttttattaagactccaatgttctcttcagatctcagtttgatttgataaggagat
131 gacatcgacacttgatttattttgcaaccaccagacaaccttacagaaagccgtgccacagtaggggact
4201 ttaaatttactttaggatcaatgttgatagggttgtttgacttgtctacaaaaaagaactttgttccaat
4271 ctctaaaacttttttattctctaattttagcacgggaaccacaggaaagcttttgaattttgtcctttta
4341 aattctttttcatattggcaaatatcaaatatattggaagagctgcttatacatgaaacgatttttcctc
4411 cattgtcaatttggtaatgagcgttgaactcgctcacaccctttatcatgcaatgctttttctcaaaatt
4481 gtcacagttcaagctctgggtaggtggttgagtcgtggtttcaccatttcttaagatcctggacaatttc
4551 ttctgcctaggcttgattgtttcagctggaatgtgctcctctgtttcgataagatcttccggatcatcta
4621 ctttgtatctatcttgaatctttctcaactggtcaccattatctatctgattcaacaggtagacctcaga
4691 cgcgagaaagagcaaatatagacttagacagtagataggtagatagtatttcttcatctttatgaggtat
4761 ttctaaggtgatgaattgttgcactgattgctct
Fig. 4.I.8: Complete nucleotide sequence of the genome of watermelon bud necrosis viruswDel isolate. The starting codons of ORFs are underlined and marked with arrows and thestop codons of ORF are indicated by bold letters and reverse arrows. The untranslatedregions (UTR) at 5’ and 3’ ends are indicated with green letters and intergenic regionindicated with blue letters.
ORF-23’
Fig. 4.I.9: Comparison of genome organisation of medium RNA of Watermelon bud necrosisvirus (WBNV) isolates-wDel (this study), -Wm-Som (FJ694963) and Groundnut bud necrosisvirus (GBNV, NC_003620). Shade box represents NSm open reading frame (ORF) and open boxrepresents Gn/Gc ORF. IGR: Intergenic region. Vertical solid lines indicate N-glycosylation sitesand dotted vertical lines indicate O-glycosylation sites. Hatch vertical boxes indicate trans-membrane domains. Open triangle represents cleavage sites VYL-LN and solid trianglerepresents cleavage sites PSSIA-LK. Arrows indicate direction of ORF and size of proteins. Scale(1 to 4801) on the top indicates nucleotide positions.
Fig. 4.I.11: (A) Dilution ratio (B) Thermal inactivation point and (C) Preservation on 4˚C ofWBNV on Vigna unguiculata cv. Pusa Komal after 7 days post inoculation
(B)
(C)
(A)
(A) NSm (B) Gn/Gc (C) M RNA0.1
GTV-HT1CaCVGBNV
-wDel-Wm-Som
WSMoV
TZSV
IYSV
MYSV
INSV
TSWV
-wDel
-Wm-Som
GBNVWSMoV
GTV-HT1 CaCV
TZSV
MYSV
IYSV
INSVTSWV
0.1
MYSV
-wDel
-Wm-Som
GBNV
WSMoV
GTV-HT1CaCV
TZSV
IYSV
TSWV
INSV0.1
:Close relatives :Intermediate relatives :WBNV isolates grouping:Distant relatives
Fig. 4.II.1: Phylogenetic trees of tospoviruses based on amino acid of NSm protein (a),Gn/Gc protein (b) and nucleotides sequence of M RNA (c). The evolutionary history wasinferred using the Neighbor-Joining method. The tree is drawn to scale, with branchlengths in the same units as those of the evolutionary distances used to infer thephylogenetic tree. The evolutionary distances were computed using the Poisson correctionmethod and are in the units of the number of amino acid substitutions per site. All positionscontaining gaps and missing data were eliminated from the dataset Phylogenetic analyseswere conducted in MEGA4. Phylogenetic groups based on M RNA were indicated withcircles. CaCV: Capsicum chlorosis virus, GBNV: Groundnut bud necrosis virus, GTV-HT1:Gloxinia tospovirus-HT1, INSV: Impatiens necrotic spot virus, IYSV: Iris yellow spotvirus, MYSV: Melon yellow spot virus, TSWV: Tomato spotted wilt virus, TZSV: Tomatozonate spot virus, WSMoV: Watermelon silver mottle virus, WBNV: Watermelon budnecrosis virus.
NucleotideAlphabet of Life
Search:Nucleotide
SearchClear
Watermelon bud necrosis virus isolate wDel segment M, completesequenceGenBank: GU474545.1
FASTA Graphics
Go to:
LOCUS GU474545 4794 bp RNA linear VRL 10-AUG-2010DEFINITION Watermelon bud necrosis virus isolate wDel segment M, complete sequence.ACCESSION GU474545VERSION GU474545.1 GI:289656459KEYWORDS .SOURCE Watermelon bud necrosis virus ORGANISM Watermelon bud necrosis virus Viruses; ssRNA negative-strand viruses; Bunyaviridae; Tospovirus.REFERENCE 1 (bases 1 to 4794) AUTHORS Kumar,R., Mandal,B., Geetanjali,A.S., Jain,R.K. and Jaiwal,P.K. TITLE Genome organisation and sequence comparison suggest intraspecies incongruence in M RNA of Watermelon bud necrosis virus JOURNAL Arch. Virol. 155 (8), 1361-1365 (2010) PUBMED 20480193REFERENCE 2 (bases 1 to 4794) AUTHORS Mandal,B., Kumar,R. and Jain,R.K. TITLE Direct Submission JOURNAL Submitted (16-JAN-2010) Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, Delhi 110012, IndiaFEATURES Location/Qualifiers source 1..4794 /organism="Watermelon bud necrosis virus" /mol_type="genomic RNA" /serotype="WSMoV" /isolate="wDel" /isolation_source="experimental watermelon field" /host="watermelon" /db_xref="taxon:76052" /segment="M; medium" /country="India: New Delhi, IARI" /collection_date="May-2008" /note="serogroup: IV"
gene 56..979 /gene="NSm"
CDS 56..979 /gene="NSm" /note="non-structural protein; movement protein" /codon_start=1 /product="NSm" /protein_id="ADD14052.1" /db_xref="GI:289656460" /
gene complement(1382..4747) /gene="Gn/Gc"
CDS complement(1382..4747)
Fig. 4.I.12. WBNV-wDel sequence submitted in gene Bank with Accession No. GU474545
1000bp
750bp
500bp
250bp
M 1 2 3 4
Fig.4.I.13: Duplex PCR of GBNV and WBNV by using primers BM 180R, BM 67F andBM 181R, BM 67wF, Lane1: Healthy, Lane 2: amplification of GBNV, Lane3: WBNV,Lane 4: duplex amplification of GBNV and WBNV
(A)
Breakpoints Method Major parent Minor parent Event Average P- value
2856-2991 Maxchi GBNV IYSV 2 2.278x10-01
2992-3670 Geneconv IYSV WBNV-Wm-Som
1 2.915x10-06
2992-3670 BootScan IYSV IYSV 1 4.969x10-04
3254-3269 Geneconv CaCV IYSV 1 4.335x10-02
(B)
Fig.4.I.14. Recombination analysis of the medium RNA genome of tospoviruses known tooccur in India. Complete nucleotide sequence data of Watermelon bud necrosis virus(WBNV) isolate-wDel, -Wm-Som and Groundnut bud necrosis virus (GBNV), Capsicumchlorosis virus (CaCV), Irish yellow spot virus (IYSV) were analysed using RDP3programme. (A) Graphical view showing recombination events and (B) showingrecombination with WBNV-wDel .
WBNV-wDel
WBNV-Wm-SomIYSV
IYSVWBNV-Wm-Som
WBNV-wDel CaCV IYSV UnknownWBNV-wDel Unknown
WBNV-wDel UnknownGBNV
GBNV
WBNV-wDel IYSVUnknown CaCV
CaCV
IYSV UnknownUnknown
IYSV
Unknown
IYSV
1 1000 2000 3000 4000 4794-
Fig. 4.IV.4: In vitro regeneration of shoots from cotyledonary half explants of watermelon cv.Sugar Baby (A) Seeds germinated on half strength of MS medium (B) Cotyledonary halveson MS medium (C) Enlargement of explants (D) Callus formation on MS mediumsupplemented with BAP 2 mg/l combination with IAA 0.3 mg/l (D) Multiple shoots fromexplants on MS medium supplemented with 2 mg/l BAP in combination with 0.1mg/l IAA(E) Rooted plantlet
C
DE FF
BA B
Fig. 4.IV.5: Hardening of rooted plantlets of watermelon cv. Sugar Baby (A)Acclimatization of rooted plantlet in Hoagland solution (B) Hardening of rooted plantlets inautoclaved sand (C) Watermelon plants in a glass house (D) Flowering watermelon plant(E) Riped watermelon fruit with mature seeds
BA
D E
C
In Glass house
Fig. 4.IV.7: Effect of different concentrations of kanamycin on leaf tissue of watermeloncv. Sugar Baby after 4 days.
Fig.4.IV.6: Number of epicotyls explants survived on different concentrations ofkanamycin of watermelon cv. Sugar Baby
Fig.4.IV.8: Transformation of watermelon cv. Sugar Baby with A. tumefaciens strain EHA105 harboring a binary vector pBI121 that contained GUS gene.(A) Nontransformed(Control ) & transformed tissues showing GUS expression in (B) callus (C) shoot initiatedfrom explant and (D) Leaf
Fig. 4.IV.10: PCR and PCR-southern hybridization showing watermelontransformation with WBNV-NP gene (828 bp).
M 1 2 3 4 5 6 7 8 9 10 11
Fig. 4.IV.9: PCR showing the presence of transgene in transformed watermelonplants, Lane1: +ve control, lanes 2 to 9: Putative transformed plants with GUSgene, lanes 10 & 11:–ve
+ -M 1 2 3 4 5 6 7 8 M 1 2 3 4 5 6 7 8
Fig.4.III.1. Restriction digestion of pBI 121 (lanes 1-3) and pTZ (lanes 4-6) showinga fallout of GUS gene (1.8 Kb) and NP gene of WBNV (0.828 Kb), respectively.
Fig.4.III.2: Analysis of clones of NP gene of WBNV in pBI121. Clone No. 18 is a positive clone. (A)Analysis by rapid disruption of bacterial cell. (B) Analysis by PCR.
+ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 +
M + 1 2 3 16 17 18 18
(A)
(B)
Fig.4.III.3: Confirmation of NP gene of Watermelon bud necrosis virus clone by nucleotidesequencing.
10 20 30 40 50 60 70 80....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|ATGTCTAACGTAAAGCAGCTCACCGACAAGAAAATCAAAGACTTGTTGGCTGGTGGTGCCGCTGACATTGAAATTGAAAC
90 100 110 120 130 140 150 160....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|CGAAGATGCAACACCTGGGTTCAGTTTTAAATCTTTTTATGATAATAATAAGGATGTTGAAATCACTTTCACAACCTGTT
170 180 190 200 210 220 230 240....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|TAAACATCTTGAAGTGCAGAAAGCAGATCTTTACTGCCTGCAAGAATGGGAAATATAATTTCTGTGGGAAAAATATTGTT
250 260 270 280 290 300 310 320....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|GCAACAACTGCTCAAGTAGGCCCTGATGATTGGACTTTTAAAAGGACAGAAGCTTTTATCAGAACAAAAATGGTTAGTAT
330 340 350 360 370 380 390 400....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|GGTGGAGAAAAGTACTAATGAAAATGCCAAGCAAGAGATGTACACGAAAATAATGGAACTGCCATTGGTGGCAGCTTACG
410 420 430 440 450 460 470 480....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|GCTTGAATGTTCCAGCAGCTTATGATTCGTGTGCTTTAAGAATGATGTTGTGTATTGGAGGTCCTTTACCTCTCTTATCT
490 500 510 520 530 540 550 560....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|AGCGTGAAAGGGCTGGCGCCAGTTATATTCCCTTTAGCTTATTACCAAAATGTAAAGAAAGAGAAGTTAGGCATTAAAAA
570 580 590 600 610 620 630 640....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|CTTCTCTACTTATGAACAGGTGTGCAAAGTAGCTAAAGTTCTTTCTGCCTCACAAATAGAGTTTAAGGGCGAATTGGATA
650 660 670 680 690 700 710 720....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|ACATGTTCAAATCAGCTGTTGAGTTGCTCAGCAAGAGTAACCCAGGAACAGCCAGTTCAATCTCTCTGAAGAAATACGAT
730 740 750 760 770 780 790 800....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|GATCAAGTCAAATACATGGATAGAGTCTTCAATGCTAGTCTTTCTATGGATGACTACGGTGAGCACTCTAAAAAGAGCTC
810 820....|....|....|....|....|...AAAGGCCAGCACTTCTTTGGAAGTGTAA
Fig. 4.III.4: Cloning of NPP gene of WBNV-wDel (A) Amplification of NPP gene(lane 1) by RT-PCR with primers BM 49Fa and BM 50Rb (B) Colony PCR of ClonedNPP gene in T& A vector.
M 1 2 3 4 5 6 7 M 1 H
356 bp
(A) (B)
M 1 2 3 4 5 6
M 1 2 3 4 5 6 7 8
Fig. 4.III.5: Restiction digestion of WBNV-wDel NP partial gene from T&A vector (1-3) andpBIN AR (Lane 4-6) with xBaI and Bam HI.
Fig. 4.III.6: Colony PCR of constructed partial NP gene of WBNV-wDel in pBIN AR. Lane 1: +control, Lane 2-8: PCR amplification of clone 1-7
10 20 30 40 50 60 70 80....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|AGAGCAATCGAGGCGCTAATAAAATCCGTTTAAAGTCAATCAATTAGACGTTTCCAGAGTAAACACCATGTCTAACGTTA 90 100 110 120 130 140 150 160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|AGCAACTCACCGACAAGAAAATCAAAGACTTGTTGGCTGGTGGCGCTGCTGATATTGAAATTGAAACCGAAGATGCAACA
170 180 190 200 210 220 230 240....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|CCTGGGTTCAGTTTTAAATCTTTCTATGACAATAATAAGGATGTTGAAATAACTTTTACAACCTGCTTAAATATCTTAAA
250 260 270 280 290 300 310 320....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|GTGCAGAAAGCAGATCTTCACTGCTTGCAAGAATGGGAATACAATTTCTGCGGGAAAAATATTGTTCCAACAACTGCTCA 330 340 350....|....|....|....|....|....|....|.AGTAGGCCCCGATGATTGGACATTCAAAAGGACAGA
Fig.4.III.7. Confirmation of partial NP gene of Watermelon bud necrosis virus-wDelisolate clone by nucleotide sequencing.
Fig.4.III.8: Strategy for developing WBNV NP partial gene construct in pBIN AR
S RNA NSs NPIR
Fig. 4.III.9: T DNA of binary vector pBI121 containing selectable marker gene (NPTII)and β-glucuronidase (GUS) gene (red arrow boxes).
Fig. 4.III.10. Mobilisation of GUS gene in the Agrobacterium tumefaciens EHA 105Lanes 1-6 show amplification of different colonies the gene by PCR.
M 1 2 3 4 5 6
1.8Kbp
M 1 2 3 4 5
356 bp
Fig.4.III.12: Mobilisation of the pBIN AR NPP-WBNV construct in Agrobacterium EHA105.Lanes 1-5 show amplification of NP partial gene in different colonies of Agrobacterium bycolony PCR
831bp
M 1 2 3 4 5
Fig. 4.III.11. Mobilisation of WBNV-NP gene in the Agrobacterium LBA4404.Lanes 1: +ve control, Lane 2-5: clone 1-4, show amplification of different colonies of thegene by PCR.
13.3µM BA
3.0µMBA +3.0µM IAA60 days 40 days
A B C
D E
Fig. 4.IV.1: Development of calli in cotyledonary explants of watermelon cv. SugarBaby. The calli were maintained up to 60 days but shoots were not developed withdifferent concentrations of hormones.
D
EF
A
C
B
Fig.4.IV.2: Regeneration from the hypocotyl explants of watermelon cv. Sugar Baby (A)Explant excised from 8-d- old seeding (B) Upper segment of hypocotyls cultured on BAP 3mg/l. (C) Initiation of shoot from explant (D) development of multiple shoots from explant(E) Elongated shoots (F) Shoot rooted on MS basal
Fig. 4. IV. 3: Different stages of regeneration from epicotyl explants of watermelon cv.
Sugar Baby at 3 mg/l of BAP.
(D) E
A B C
GF
7-9 days old explants were use and Culture medium: MS salts
BAConc.
Explants % explantforming calli
% explantformingShoot
4 Coty 11.7 03 Coty
HypocotylEpicotyl
12.89.528
06.324.0
2 CotyHypocotyl
513
06.5
1 CotyHypocotyl
313.6
00
0 CotyHypocotyl
00
00
Table 4.IV.1: Effect of hormone concentrations on regeneration of watermelon cv. SugarBaby explants.
Table 4.IV.2: Effect of hormone concentrations on in-vitro germinated cotyledon explantsof watermelon cv. Sugar Baby.
4-6 days old
explants were use
and Culture
medium: MS
medium
Hormone concentration % of explantsforming calli
% of eaplantsforming shoot
BA IAA1 0.1 0 01 0.2 0 01 0.3 0 01 0.5 46 02 0.1 86 762 0.2 86 552 0.3 100 332 0.5 73 93 0.1 80 333 0.2 73 633 0.3 80 333 0.4 100 26
Table 4.IV.3: Effect of different concentrations of kanamycin on seeds germination of watermeloncv. Khusbu (hyb.)
Measurements of length (cm)
Kan
amyc
in(m
g/L)
Tota
l No.
of
seed
s/ger
mi
nate
d % o
fge
rmin
atio
n
Shoots Average Roots AverageObservation
0 12/9 75 8.9, 11.9, 4.7, 8.9, 10.7,10.9, 9.2, 4.7
8.74 4.9,3.1,3.5,2.41.5,2.9,2.1, 3.9
3.04 Normal
50 12/9 75 4.0, 2.8, 2.6, 4.1, 1.6,2.5, 2.3, 1.5
2.67 0.7, 0.7, 0.5, 0.7,0.6, 0.5, 0.6, 0.5
0.60 Affected
100 12/10 83 4.5, 4.0, 3.2, 3.5, 2.5,1.4, 2.3, 1.5
2.72 0.5, 0.6, 0.8, 0.6,0.6, 0.6, 0.6, 0.4
0.58 Affected
150 12/10 83 3.8, 2.8,2.8, 2.2, 1.5,2.1, 1.8, 0.6
2.32 0.5, 0.4, 0.5, 0.8,0.6, 0.8, 0.4, 0.5
0.56 Affected
200 12/9 75 1.0, 0.8, 3.5, 2.0, 1.1,0.6, 0.4
1.34 0.4, 0.4, 0.5, 0.6,0.4, 0.4, 0.4
0.46 Affected
Table 4.IV.4: Effect of different concentrations of kanamycin on seeds germination ofwatermelon cv. Sweet Baby
Measurements of length (cm)
Kan
amyc
in(m
g/L)
Tota
l No.
of
seed
s/ger
min
ated % o
fge
rmin
atio
n Shoots Aver. Roots Aver. Obs.
0 20/16 80 4.0, 3.9, 4.6,5.6, 6.5, 5.0,2.0, 4.5, 2.6,3.0
4.17 2.0, 3.0, 2.6,2.4, 3.0, 1.5,1.8, 1.4, 1.7,1.6
2.1 Normal
50 20/19 95 9.2, 6.0, 5.5,4.1, 3.0, 2.2,2.5, 2.5
4.37 0.7, 1.4, 0.5,0.5, 0.4, 0.5,0.5, 0.5
0.62 Affected
100 20/20 100 2.0, 2.1, 2.0,1.9, 2.0, 2.5,1.5, 0.5
2.4 0.5, 0.4, 0.4,0.3, 0.5, 0.2,0.3, 0.3
0.36 Affected
150 20/18 90 3.1, 2.5, 3.5,2.2, 2.3, 2.5,1.9, 1.7
2.5 0.6, 0.5, 0.2,0.3, 0.3, 0.6,0.4, 0.3
0.4 Affected
200 20/20 100 3.4, 2.8, 1.7,1.5, 0.8, 0.4,0.5, 0.3, 0.4,0.4
1.22 0.5, 0.5, 0.3,0.5, 0.3, 0.2,0.3,0.2, 0.1,0.2
0.3 Affected
Table 4.IV.5: Effect of different concentrations of kanamycin on seeds germination ofwatermelon cv. Madhuri (hybrid)
Measurements of length (cm) Obs.
Kan
amyc
in(m
g/L)
Tota
l No.
of
seed
s/ger
mi
nate
d
% o
fge
rmin
atio
n Shoots Aver. Roots Aver.
0 15/15 100 8.6, 12.2, 8.0,5.0, 9.1, 8.1, 7.5,7.5, 7.2
8.02 3.0, 3.2, 4.0,1.5, 2.0, 4.0,3.8, 2.0, 2.4
2.85 Normal
50 15/15 100 5.6, 4.7, 5.5, 5.0,2.6, 4.3, 3.5, 4.3,3.0
4.43 1.1, 0.8, 1.2,1.2, 0.5, 1.0,1.0,0.7, 0.8
0.92 Affected
100 15/13 86.67 9.3, 6.4, 3.5, 3.3,7.2, 2.5, 1.4, 1.8
4.42 1.4, 1.2, 1.2,0.5, 0.3, 1.4,0.1,0.1
0.77 Affected
150 15/13 86.67 3.6, 7.8, 5.0, 5.1,3.8, 6.0, 3.5, 2.8,2.4
4.40 1.5, 1.3, 0.7,0.6, 0.8, 1.5,0.8, 0.4, 0.4
0.89 Affected
200 15/13 86.67 2.2, 3.5, 4.7, 2.9,3.1 2.8, 3.4, 2.0
3.07 0.4, 0.8, 1.0,0.5, 0.5, 0.7,0.7, 0.3
0.61 Affected
Table.4.IV.6: Effect of different concentrations of kanamycin on shoot regeneration fromepicotyl explants of watermelon cv. Sugar Baby
No. of regeneratedshoots
Kan
amyc
in(m
g/L
)
Tot
al N
o.of
exp
lant
sGreen yellow
% su
rviv
alof
exp
lant
s Response
14 13 1 92.86 Normal15 13 2 86.67 ,,
0 11 10 1 91.67 ,,14 12 2 85.71 ,,15 12 3 80.00 ,,
50 11 10 1 91.67 ,,14 8 6 57.14 Light green15 9 6 60.00 ,,
100 11 8 3 72.73 ,,14 4 10 28.57 Yellowish15 4 11 26.67 ,,
150 11 3 8 27.27 ,,14 0 14 00.00 Brownish15 2 13 13.33 ,,
200 11 0 11 00.00 ,,
Table. 4.IV.7: Summary of the transformation of epicotyl explants of watermelon cv. Sugar
Baby transformed with A. tumefacience strain EHA105 harbouring a binary vector pBI121
containing GUS gene.
Explants Total number ofexplants co-
cultivation withAgrobacterium
harbouring a binaryvector, pBI121
Total no. of callideveloped from
cocultivatedexplants.
Total no. of shootsregenerated on
shoot regenerationmedium
Total no. ofPCR +ve shootsfor GUS gene
Cotyledon 51 28 8 4
Table. 4.IV.8: Percent transformation (0.9%) of watermelon cv. Sugarbaby with NP gene
Table 4.IV: Regeneration of watermelon cv. Sugarbaby cotyledon explants under differenthormones concentration.
.
Explants No. explants Gene No. callus No. shoot No. PCR +vecotyledon 101 WBNV 67 20 1
Stages Conc. of hormones (mg/l)BA IAA
Days required formorphogenicresponse
Callus induction 3 0.3 08-10Shoot initiation 3 0.1 18-25Shoot elongation MS MS 28-40Rooting MS MS 35-50
Steps Discription Duration(days)Germination Raising seedlings (pre wash seeds with 2% sodium 5-6
Table: 4.2: Protocol for Agrobacterium mediated transformation of watermelon cv. SugarBaby
Table 4.IV: Effect of age of explants on regeneration of watermelon cv. Sugarbaby
*4 day old cotyledon raised in vivo
hypochloride and surface sterilization with 0.1% mercuricchloride)
Explants immature cotyledon
Pre-culture Basal medium+ BA 3 mg/l, IAA 0.3mg/l 2Agrobacteriumstrain
LBA4404
Innoculation Basal medium + 200 micromole acetosyringone, OD600 :0.6
20 min.
Co-cultivation Basal medium + BA 3 mg/l, IAA 0.3mg/l+200 micromoleacetocyringone
2days in dark
Selection andcallusing
Basal medium + BA (3 mg/l), IAA (0.3mg/l), Kanamycin100 (mg/l), augmentin (250 mg/l)
8-10
Shooting Basal medium + BA 3 mg/l, IAA 0.1mg/l, Kanamicin 100mg/l, augmentin 250 mg/l
10-15
ShootElongation
Basal medium, Kanamycin (100 mg/l), augmentin (250mg/l)
10-15
Rooting Basal medium 7-10Hardening Rooted shoots in Hoagland solution for 2-3 days and then
transferred to pots containing autoclaved river sand 10-13
Age ofexplants
Explants Calli % Shoot %
4* Coty 76 86
6 Coty 10.4 0
7 CotyStemPetiole
31.481.915.7
01.915.7
9 CotyStemPetiole
20.826.334.2
018.428.5