Post on 25-Dec-2015
transcript
Cells
Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, …
Human genome is around 3 billions base pair long
Almost every cell in human body contains same set of genes
But not all genes are used or expressed by those cells
Terminology Genome is an organism’s complete set
of DNA. a bacteria contains ~ 600,000 DNA base pairs human and mouse genomes have some 3 billion.
Chromosomes Human genome has 23 distinct pairs of chromosomes
(22 pairs of autosomes and one pair of sex chromosomes).
Each chromosome contains many genes.
Gene basic physical and functional units of heredity. specific sequences of DNA bases that encode
instructions on how to make proteins. Genotype: Genetic makeup of an organism Phenotype: Physical expressed traits of an
organism
Elements of Molecular Biology
All Life depends on 3 critical molecules DNA
Hold information on how cell works
RNA Act to transfer short pieces of information to
different parts of cell Provide templates to synthesize into protein
Proteins Form enzymes that send signals to other cells and
regulate gene activity Form body’s major components (e.g. hair, skin, etc.)
Central dogma
the national health museum
OC
DNADNA
DNA is composed of four nucleotides or "bases": A,T,C,G
3rd C
5th C
Proteins are composed of amino acids
Basic Amino AcidStructure: The side chain, R,
varies for each ofthe 20 amino acids
C
R
C
H
NO
OHH
H
Aminogroup
Carboxylgroup
Side chain
Central Dogma of Molecular BiologyCentral Dogma of Molecular Biology
DNA RNA protein
Sequence structure function
Central Dogma
DNA RNA protein
transcription translation
A string of the alphabet {A,C,G,T} Ex. CCTAAGA
A string of the alphabet{A,C,G,U} Ex. CCUAAGA
A string of the alphabet {20 amino acids} Ex. TGFIKYL
Gene expression
DNA to RNA to Protein
A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis
Translation (animation)
TranslationTranslation
conversion from RNA to protein is by codon: 3 bases = 1 amino acid
translation done by ribosome and tRNA
translation efficiency controlled by mRNA copy number (turnover) and ribosome binding efficiency
translation affected by mRNA tertiary structure
Biology, 7/c, Peter H. Raven
Gene expression
http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#
Exercise Translate the following DNA to a
protein:…ctatgcccaagctgaaaaatgagcgtaatgaggtcatcat… -3’
…gatacgggttcgactttttactcgcattactccagtagta… -5’
template
The Human Genome Project
The human genome sequence is complete - - approximately 3 billion base pairs.
How does the human genome stack up?
OrganismGenome Size (Bases)
Estimated Genes
Human (Homo sapiens) 3.2 billion 25,000
Laboratory mouse (M. musculus) 2.6 billion 25,000
Mustard weed (A. thaliana) 100 million 27,000
Rice (Oryza sativa) 430 million 50,000
Roundworm (C. elegans) 97 million 19,000
Fruit fly (D. melanogaster) 137 million 13,000
Yeast (S. cerevisiae) 12.1 million 6,000
Bacterium (E. coli) 4.6 million 3,200
Human immunodeficiency virus (HIV) 9700 9
H1N1 13500 8
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
The Path Forward How does DNA impact health?
Identify and understand the difference in DNA sequence among human populations
What do all the genes do? Discover the functions of human genes by
experimentation and by finding genes with similar funcs in the model organisms
What are the functions of nongene areas? Identify important elements in the nongene
regions of DNA How does info in the genome enable life?
Explore life at the ultimate level of the whole organism instead of single genes/proteins.
U.S. Department of Energy, 2005
Diverse applications Medicine – customized treatments, … Microbes for energy and the
environment – generate clean energy source, clean up toxic wastes,…
Bioanthropology – human lineage Agriculture, livestock breeding,
Bioprocessing – crops&animals more resistant to diseases, efficient industrial processes,…
DNA identification – implicate people accused of crimes, identify contaminants in air, water, …
U.S. Department of Energy, 2005
Homework - Quiz on Wednesday
Terminology: genome, genes, proteins, Nucleic acid, amino acids, DNA, RNA, mRNA, tRNA, rRNA, mutation, chromosomes, genotype, phenotype, codon, …
DNA structures, RNA structures, direction of DNA sequence, DNA replication
Central dogma of molecular biology, transcription, translation
…