Epigenetics Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520.

transcript

Epigenetics

Xiaole Shirley Liu

STAT115, STAT215, BIO298, BIST520

Epigenetics• Heritable changes in gene function that occur

without a change in the DNA sequence – How come not all the motif sites are bound by the

factor?

– How come TF binding only regulate some of the nearby genes?

Epigenetics

• The study of heritable (transgenerational) changes in gene activity that are not caused by changes in the DNA sequence

• The study of stable, long-term alterations in the transcriptional potential of a cell that are not necessarily heritable

• Functionally relevant changes to the genome that do not involve a change in the nucleotide sequence

In Human

• Nature vs nurture• Zygotic twins: same DNA different epigenome• North American Ice Storm of 1998

Agouti Mice and DNA Methylation

The Making of a Queen

Larvae

Queen WorkerFrom Ting Wang, Wash U

Conrad Hal Waddington(1905–1975)Developmental biologistPaleontologistGeneticistEmbryologistPhilosopherFounder for systems biology

Epigenetic Landscape

Components

• DNA-methylation• Nucleosome

position and histone modifications

• Chromatin accessibility

• Higher order chromatin interactions

• Analogy

DNA Methylation Distribution in Mammalian Genomes

• In human somatic cells, 60%-80% of all CpGs (~1% of total DNA bases) are methylated – Most methylation is found in “repetitive”

elements• “CpG islands”, GC-rich regions that possess a high

density of CpGs, remain methylation-free– The promoter regions of ~70% of genes have

CpG islands

From Ting Wang, Wash U

Two classes of DNA methyltransferases (DNMTs)

Jones and Liang, 2009 Nature Review Genetics

Inheritance of DNA Methylation

DNA Methylation Detection

• Bisulfite sequencing– Unmethyl C T

– High resolution, quantitative, but expensive!

From Wei Li, Baylor

BS-seq Methylation Call

• Most regions are either mostly methylated or mostly unmethylated (dichotomy)

• Methylation level within a short distance is consistent

ACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCCGGGTTTATTTGCTTTTTTATGGGCTGGGTTTATTTGCTTTTTTATGGGCTGGGTTTATTTGCTTTCCTATGGGCCGGGCTTATTTGCTTTCCTATGGGCCGGGCTTATTTGCTTTCCTATGGGC

3/5 0/5

60% methylated 0% methylated

DNA Methylation Controls Gene Expression

• Methylation at CpG islands often repress nearby gene expression

• Many highly expressed genes have CpG methylation on their exonsSome genes could be imprinted, so maternal and paternal copies have different DNA methylation

DNA Methylation in Cancer

• Prevalent misregulation of DNA methylation in cancer: global hypomethylation and CpG island hypermethylation

• Methylation variable regions in cancer

DNA Demethylation

• Recently, another type of DNA methylation called hydroxyl methylation (hmC) is found

• hmC is an intermediate step between mC and C.• TET family of proteins are important for DNA

demethylation• Mutation in TET is linked to many cancers

Components

• Analogy

Nucleosome Occupancy & Histone Modification Influence Factor Binding

Histone Modifications

• Different modifications at different locations by different enzymes

Histone Modifications in Relation to Gene Transcription

Histone Modifications

• Gene body mark: H3K36me3, H3K79me3• Active promoter (TSS) mark: H3K4me3• Active enhancer (TF binding) mark: H3K4me1,

H3K27ac• Both enhancers and promoters: H3K4me2,

H3/H4ac, H2AZ• Repressive promoter mark: H3K27me3• Repressive mark for DNA methylation:

H3K9me3

lncRNA Identification• H3K4me3 active promoters• H3K36me3 transcription elongation

Guttman et al, Nat 200923

Nucleosome Occupancy & Histone Modification Influence Factor Binding

Antibody for

MNase digest

Combine Tags From All ChIP-Seq

Extend Tags 3’ to 146 nt Check Tag Count Across Genome

Take the middle 73 nt

Nucleosome Stabilization-Destabilization (NSD) Score

Condition 1

Condition 2

Use H3K4me2 / H3K27ac Nucleosome Dynamics to Infer TF Binding Events

/ac /ac /ac

/ac /ac

He et al, Nat Genet, 2010; Meyer et al, Bioinfo 2011

Condition-Specific Binding, Epigenetics and Gene Expression

31Genes TF1 TF2 TF3 Epigenetics

• Condition-specific TF bindings are associated with epigenetic signatures

• Can we use the epigenetic profile and TF motif analysis to simultaneous guess the binding of many TFs together?

Predict Driving TFs and Bindings for Gut Differentiation

Identify Major TF Modules Regulating Gut Differentiation and Function

• Nucleosome dynamics now applied to hematopoiesis and cancer cell reprogramming

Verzi et al, Dev Cell, 2010

GATA6 Cdx2

Embryonic and organ development genes

Metabolic and digestive genes

Components

• Analogy

DNase Hypersensitive (HS) Mapping

• DNase randomly cuts genome (more often in open chromatin region)

• Select short fragments (two nearby cuts) to sequence

• Map to

active

promoters

enhancers

Ling et al, MCB 2010

DHS Peaks Capture Most TF

Binding Sites

• Motif occurrence in the DHS peaks suggest TF binding

• Quantitative signal strength also suggest binding stability

Thurman et al, Nat 2012

TF Network from DNase Footprint

DnaseI Cleavage vs Footprint

• Footprint occupancy score: FOS = (C + 1)/L + (C + 1)/R

• Smaller FOS value better footprint, for

predicting base resolution TF binding

GAT ACA CTA TGT

DnaseI Cleavage vs Footprint

• Footprint occupancy score: FOS = (C + 1)/L + (C + 1)/R

• Smaller FOS value better footprint, for

predicting base resolution TF binding

• Intrinsic DNase cutting bias could

have 300-fold difference, creating fake footprints

GAT ACA CTA TGT

CAGATA 0.004CAGATC 0.004…ACTTAC 1.225ACTTGT 1.273

Using DNaseI “Footprint” to Predict TF Binding

• Using base-pair resolution cleavage pattern (“footprint”) hurts TF binding prediction when it is similar to intrinsic DNaseI cutting bias

Using DNaseI “Footprint” to Predict Novel TF Motifs

He et al, Nat Meth 2013

Components

• Analogy

HiC• In situ HiC has excellent resolution

• Domains conserved between cells and even species

HiC• Loops are

condition-specific– Assign binding

to genes

• Convergent CTCF at domain anchors– CTCF as

insulators

Epigenetics and Chromatin

Transcription and Epigenetic Regulation

• Stem cell differentiation• Aging brain• Cancer

Epigenetics Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520.

Documents